207.fm

Transcription

1 Lab. Anim. Res. 2010: 26(2), Aspectual Comparison of the Skin Changes in Hairless Mice According to the Aging Type Kyoung-Hwa Choi, Young-Chul Kim* and Bae-Hwan Kim* Department of Public Health, Keimyung University, Daegu, Korea The purpose of this study was to compare the skin changes in female SKH-1 hairless mice between UVB irradiated photo-aged group and endogenous aged group. The UVB irradiation and endogenous aged groups showed poor skin conditions when compared with normal (N) group in terms of the skin erythema, water content and TEWL (transepidermal water loss). For the changes in gross observation and replica image analysis on wrinkle of the skin tissue, UVB irradiation group showed thicker, wider and deeper wrinkles than the changes seen in N group, whereas endogenous aged group showed thinner, narrower and shallower wrinkles than that of UVB irradiation group. In histopathological findings, UVB irradiation group and endogenous aged group showed thickened epidermis, increased dermal inflammatory cells, decreased collagen and elastic fiber content, increased number of degranulated dermal/subcutaneous mast cells, and lower expression quantity of TGF-β in dermal layer when compared with N group, but to a lesser extent in aged group than the changes in UVB irradiation group. UVB irradiation group and endogenous aged group showed significantly higher xanthine oxidase activity, lower superoxide dismutase and catalase activities, and higher expression of MMP-3 mrna in skin than N group. Therefore, aspectual comparison of the skin change in hairless mice between photo-aged and endogenous aged groups showed different each other, and these results will be useful for skin aging research. Key words: Hairless mice, skin aging, photo-aging, endogenous aging Received 25 March 2010; Revised version received 10 May 2010; Accepted 10 June 2010 ¼ ùš š, y w w ƒwš. y w x ƒ w y v ü, w y x w»». ù w v w, v ww» ú y Ÿ y w y hairless Ÿ y š (Kligman, 1996). *Corresponding authors: Young-Chul Kim, Department of Public Health, Keimyung University, 1000 shindang-dong, Dalseogu, Daegu , Korea Tel: Fax: yckim@kmu.ac.kr Bae-Hwan Kim, Department of Public Health, Keimyung University, 1000 shindang-dong, Dalseogu, Daegu , Korea Tel: Fax: kim9399@kmu.ac.kr v yƒ w» p yw ü y y. ü y ù ƒ ù y» y w v w, y UVB y w y w (El- Domyati et al., 2002). ü y w, v, k w (Seo et al., 2001), w tv v ƒ r sw ƒ ùš(waller and Maibach, 2006), s w s w v» w w (Sunderkötter et al., 1997). w Ÿ y ü y w š ¾ w, v ³ew e y ƒ k. v eš, w, k w w v w (Seo et al., 2001). w v w ƒw, k 173

2 174 Kyung-Hwa Choi et al.» v ü w š k ƒ š (Rittie and Fisher, 2002). v ƒ, y (reactive oxygen species, ROS) s (apoptosis) mw jš s DNA,, w (Matsumura and Ananthaswamy, 2004). y ww» wš, matrix metalloproteinase (MMP) y y j ù MMP w w w w. w j w MMP in vivo in vitro x UVA UVB w y, MMP-3 4x g, v l e, q p, w w (Inomata et al., 2003). Transforming growth factor-beta(tgf-β) s s,» w, x w w y me x q w s, s, sy s, s w ƒ j (Peltonen et al., 1990). s w w insulin-like growth factor (IGF), epidermal growth factor (EGF), interleukin-1 tumor necrotic factor (TNF)-α sww w w in vivo TGF-βƒ ƒ w w (Fitzpatrick and Rostan, 2003). TGF-β e v me (Martin et al., 1992), yv v w x (Schmid et al., 1993). Ÿ y ü y y w y, y(premature aging) y (accelerated aging) š» w (Yaar and Gilchrist, 1999).» v Ÿ y v ü y w ƒ š w ƒ ú Ÿ y ü y wš. l ü y Ÿ y v w y w ƒ š ù ü ƒ. hairless 6 UV w Ÿ y y w v y y v y sƒ x w š w d t wš w. lò x 9 (12 ) 41 (6 ) SKH-1 hairless mouse (Charles-River, Japan) 1 k z, 9 e (Normal, N) e Ÿ y (Experiment 1, E1) 6 w wš, y (Experimental 2, E2) 6 sww 3, 18 x w. x» œ w, 22±3 o C, 50±10%,» 12 w. x x z e wš y 3R d š w ww. j m e Ÿ 302 nm UVB w sunlamp (UVM-225D, Mineralight Lamp UVP, USA) w. UV-radiometer (HD 9021, Delta OHM, Italy) d w, cage ƒ z 1 3z, 6 [1 : 60 mj/cm 2 (1 MED), 2 : 2 MED, 3 : 3 MED, 4-6 : 4 MED] w. j m Ð j 5&8- y, w, v (transepidermal water loss, TEWL) CK electronic (Germany) Mexameter (MX18), Corneometer (CM825) Tewameter (TM300) w ƒƒ e x 6 1z d w. j l j 6 ú fk (100 mg/kg BW) ƒ wš l e w z replica Visioline (VL650, CK electronic GmbH, Germany) w (total winkle area), (no. of wrinkles), ¼ (total length), s³¼ (mean length), s³¾ (mean depth) t 5 w w. j j w v 10% s š w z m, k, n, en e paraffin s wš 4µm Ì r

3 . r hematoxylin and eosin (H&E) z v y w, Masson s trichrome z vd ü (collagen fiber) xk w. Verhoeff mw v vd ü k (elastic fiber) y, nw y wš, Toluidine blue z vd vwd ü mast cell s k w. w ü TGF-β x w» w yw w.»(ventana Medical Systems Inc., USA, NEXES IHC) w, 1 w TGF-β (Dako, Japan, dilution 1:100), 2 w iview DAB Detection kit (Ventana Medical Systems Inc., USA, ) w š, Hematoxylin II (Ventana Medical Systems Inc., USA, ) Bluing Reagent (Ventana Medical Systems Inc., USA, ) w x w. j k m³ v e w z M sucrose š glass teflon homogenizer w 20%(w/v) ³. ³ 600 g 10 w w w d 10,000 g 20 w z d z y d w. v w Lowry (1951) d w. v Xanthine oxidase (XO) y xanthine» w 30 C 20 g o 292 nm Ÿ d w Stripe Della (1969) w d w. y z w 1mg 1 w» xanthine l uric acid nmole t w. v Superoxide dismutase (SOD) y hematoxylin y w Martin (1987) 0.1 mm EDTAƒ w 50 mm (ph 7.5) 10 µm hematoxylin z ƒw 25 C g hematein o 560 nm Skin changes of hairless mice by the aging type 175 d w z y w. y z hematoxylin y 50% w 1unit 1mg 1 w unit t w. v Catalase (CAT) y hydrogen peroxide» w y q 240 nm Ÿ š Ÿ (E=0.04 mm 1 cm ) 1 w y w Aebi (1974) w. y v w 1mg 1 w hydrogen peroxide nmole t w j..1 l Deep freezer þ w v trizol (Invitrogen, USA) ƒw w z RNA w. BioNEER cyclescript RT PreMix kit w cdna w w z PCR (Accupower PCR PreMix kit, BioNEER)» ww. Template 2 µl, forward primer reverse primer (10 pmole/l, BioNEER, Korea) ƒƒ 1.4 µl, ³ 15.2 µl š PCR (Bio-RAD, Mycycler TM thermal cycler, USA) w. Primer GAPDH (57 o C, 35 cycle), x MMP-3 (60 o C, 35 cycle) w primer» Table 1. Tris-acetate ethylenediaminetetra acetic acid (TAE) buffer w 1.5% agarose gel» g ethidium bromide w z wš UV w DNA band y w š Gel Logic 100 Imaging System (Kodak, USA) w x eyw m w m SPSS 17.0 for windows (SPSS Inc., USA) w one-way ANOVA w š,, x (E1, E2) w» w Duncan s multiple range test w z w. m w α=0.05 w w. Table 1. Nucleotide sequence of the primers and expected size of PCR products Items Primers Expected size (bp) 3) Forward (5' 3') CCCACTAACATCAAATGGGG GAPDH 1) Reverse (5' 3') ACACATTGGGGGTAGGAACA Forward (5' 3') TAGCAGGTTATCCTAAAAGCA MMP-3 2) Reverse (5' 3') CCAGCTATTGCTCTTCAAT ) GAPDH: Glyceraldehyde-3-phosphate dehydrogenase 2) MMP-3: Matrix metalloproteinase-3 3) bp: basepair

4 176 Kyung-Hwa Choi et al. Table 2. Comparison of erythema index, water capacity, TEWL in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment Items Normal Experimental N E1 E2 Erythema index 1) 98.07± ±68.85*** ±31.01** Water capacity 1) 61.83± ±10.87* 49.42±6.19 TEWL 2) 6.67± ±20.95 *** 6.43±1.73 ### Values are mean±sd of 6 mice. 1) Unit: AU (Arbitrary Unit) 2) Unit: g//h TEWL: Transepidermal water loss, N: non-treatment group, E1: UVB irradiation group, E2: aged group *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ###P<0.001 compared to the E1 group by ANOVA and Duncan's multiple range test. j m Ð j 5&8- y w Ÿ y y w ƒ y Ÿ y w. w w Ÿ y w y e ƒ û ù w. y Ÿ y w. tv w Ÿ y w ƒ y w e. y w Ÿ y w ƒ (Table 2). j l j w Ÿ y ̃ š ¾ x, y Ÿ y w ̃ š x (Figure 1A). v Visioline w d w, (total winkle area), (No. of wrinkles), ¼ (total length), s³¼ (mean length), s³¾ (mean depth) 5 t w Ÿ y y w ƒw y w Ÿ y w ƒw (Table 3). j j H&E mw v xk s w, tv vd ³e s, Ÿ y tv vƒ É š vd ü v, y ƒ, tvd z v Table 3. Comparison of wrinkle parameters in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment Items Total wrinkle area (mm 2 ) No. of wrinkles Total length (mm) Mean length (mm) Mean depth (m) Normal Experimental N E1 E2 0.36± ±0.21*** 0.67±0.15** ### 18.80± ±4.42*** 30.80±7.43** ### 5.04± ±2.06*** 9.10±2.15** ### 0.27± ±0.03*** 0.30±0.02* ### 47.59± ±2.21*** 48.23±0.21* ## Values are mean±sd of 6 mice. N: non-treatment group, E1: UVB irradiation group, E2: aged group, *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ## P<0.01, ### P<0.001 compared to the E1 group by ANOVA and Duncan's multiple range test.. y tvd š tv (Figure 1B). Masson s trichrome mw vd ü xk w, ƒ wš ³e Ÿ y ƒ q ƒ wš ³e š. y Ÿ y w yƒ ùkû (Figure 1C). Verhoeff s mw v vd ü k y, xk w, k ƒ ³e, Ÿ y k ƒ. y Ÿ y w k k wš ñ ¼ ƒ (Figure 1D). Toluidine blue mw vd vwd ü sƒ s k w, sƒ š k, Ÿ y sƒ x š k ƒ w ùkû. y Ÿ y w s ƒ (Figure 1E). yw vd ü TGF-β x w, w Ÿ y y x y w Ÿ y (Figure 1F). k m³ w v w w z XO y d w, w Ÿ y y w, y w Ÿ y w. w w z SOD

5 Skin changes of hairless mice by the aging type 177 Figure 1. Comparison of replica images in SKH-1 hairless mice at 6 weeks after the beginning of experiment a: normal group, b: UVB irradiation group, c: aged group (A). Histological observation on SKH-1 hairless mouse skin at 6 weeks after the beginning of experiment. H&E stain, 100 & 400 (enlarged box) (B). Masson s trichrome stain, 200 (C). Verhoeff s stain, 200 & 400(enlarged box) (D). Toluidine blue stain, 200 (E). Immunohistochemical staining for TGF-β in SKH-1 hairless mouse skin at 6 weeks after the beginning of experiment, 200 (F). y w Ÿ y y w û y Ÿ y w. CAT y w Ÿ y y w û y Ÿ y w (Table 4). j..1 l v MMP-3 mrna x d w, w Ÿ y y w y w Ÿ y w (Figure 2). v y yx š w j, v ü, w y x w»»» (Seo et al., 2001). Hairless v UVB w tvƒ É š ƒ q w k (fibroelstosis) wš glycosaminoglycan (GAG)ƒ ƒw v w v y (Fisher et al., 2002).

6 178 Kyung-Hwa Choi et al. Table 4. Comparison of xanthine oxidase (XO), superoxide dismutase (SOD) and catalase activities (CAT) in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment ltems Normal Experimental N E1 E2 XO 1) 3.69± ±01.55*** 5.77±1.23* ## SOD 2) 20.49± ±0.98* 12.89±1.01** CAT 3) 8.10± ±1.47** 4.54±1.06** Values are mean±sd of 6 mice. 1) Unit: nmole uric acid formed/mg protein/min 2) Unit: U (50% inhibition of autoxidation of hematoxylin)/mg protein/min 3) Unit: nmole H 2 O 2 reduced/mg protein/min N: non-treatment group, E1: UVB irradiation group, E2: aged group *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ## P<0.01 compared to the E1 group by ANOVA and Duncan's multiple range test. hairless Ÿ y y w v y, w, w y v y sƒ x w d t wš w. y ƒ s v s w v x y j UV q, Ÿ, v, y, UVB v d¾ w w y ù y k (Trevithick et al., 1992). y d w w Ÿ y y w ƒ. ƒ d ƒ dü» n w w w w (Blanken et al., 1989), w v v t w ƒ d w v ù e v w w (Haratake et al., 1997; Jiang et al., 2007). v hyaluronic acid (HA) s», s, s y w (Kim et al., 2005), v y wì v k w w š (Ghersetich et al., 1994). w, tv d w mw v y w. w w Ÿ y w y eƒ û ù w. v w Ÿ y w ƒ y w e ùkü v ƒ w. v y ƒ ù Figure 2. Comparison of MMP-3 expression in hairless mice skin at 6 weeks after the beginning of experiment. Values are mean±sd of 6 mice. **P<0.01, ***P<0.001 compared to the N group by ANOVA and Duncan's multiple range test. ù ƒ y p y w w. w v MMP ƒ w w vü» j vd w v x ƒ y k (Wlaschek et al., 1995). Oba Edwards (2006) UVB w hairless» v ü w vü w 3 y x»w š šw. Ÿ y w ¾ ƒ ¾š x y Ÿ y w ¾ ƒ š x. w» w Visioline w 5 t(,, ¼, s³¼, s³¾ ) d w Ÿ y y w ùk ù v yƒ w y w. w y w Ÿ y 5 t w, Ÿ y y v y t z x w y w. v y, s (apoptosis) mw(matsumura and Ananthaswamy, 2004) v s e k (Cole et al., 2010). v w w Ÿ y y sƒ x ƒwš k w, s e w ùkû. y w Ÿ y ƒ w.

7 v v v k k ƒ wš (Lee et al., 1999), yƒ w tvƒ š» sd w v-tv ƒ rsw š s w s ƒ w. w v s, s» k (Makrantonaki and Zouboulis, 2007). Ÿ v tvd É v d s sƒ ƒwš w k w É (Seite et al., 2006). Ÿ y tv vƒ z š vü ƒ q, y tv v ̃ š ù Ÿ y w ƒ w. Chung (2001) Ÿ y v y v w w ƒw» w z MMP y ƒ wƒ ƒw» j w š w. x, v MMP-3 mrna x w Ÿ y y w, y w Ÿ y w e w š š q. v 90% w TGF-β w, activator-1 (AP-1) y y k MMP w wƒ (Massague, 1998). TGF-β ù AP-1 w MMP» w w (Fisher et al., 1996; Quan et al., 2002). vd ü TGF-β x w Ÿ y y x Ÿ y ƒ. s w y p ƒ ROS free radical w (Sander et el., 2002), w y z w (Rittie and Fisher, 2002). v y x z w y. XO y Ÿ y y w, Ÿ y ƒ w. SOD y w Ÿ y y w û y Ÿ y w ƒ. CAT y w Ÿ y y w û y Ÿ y w. Ÿ y y w v w y w q. x ww hairless Skin changes of hairless mice by the aging type 179 y x v y w, Ÿ y y w v y z w sƒw» w». q 2008 w ( )» w w. k Aebi, H. (1974) Catalase. In Methods of Enzymatic Analysis. pp , Academic Press, New York. Blanken, R., Vilsteren, M.J.T., Tupker, R.A. and Coenraads, P.J. (1989) Effect of mineral oil and linoleic-acid-containing emulsions on the skin vapour loss of sodium-lauryl-sulphateinduced irritant skin reactions. Contact Dermatitis 20(2), Chung, J.H., Seo, J.Y., Choi, H.R., Lee, M.K., Youn, C.S., Rhie, G., Cho, K.H., Kim, K.H., Park, K.C. and Eun, H.C. (2001) Modulation of skin collagen metabolism in aged and photoaged human skin in vivo. J. Invest. Dermatol. 117(5), Cole, N., Sou, P.W., Ngo, A., Tsang, K.H., Severino, J.A., Arun, S.J., Duke, C.C. and Reeve, V.E. (2010) Topical 'Sydney' Propolis Protects against UV-Radiation-Induced Inflammation, Lipid Peroxidation and Immune Suppression in Mouse Skin. Int. Arch. Allergy Immunol. 152(2), El-Domyati, M., Attia, S., Saleh, F., Brown, D., Birk, D.E., Gasparro, F., Ahmad, H. and Uitto. J. (2002) Intrinsic aging vs. photoaging: a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp. Dermatol. 11(5), Fisher, G.J., Datta, S.C., Talwar, H.S., Wang, Z.Q., Varani, J., Kang, S. and Voorhees, J.J. (1996) Molecular basis of suninduced premature skin ageing and retinoid. Nature 379, Fisher, G.J., Kang, S., Varani, J., Bata-Csorgo, Z., Wan, Y., Datta, S. and Voorhees, J.J. (2002) Mechanisms of photoaging and chronological skin aging. Arch. Dermatol. 138, Fitzpatrick, R.E., and Rostan, E.F. (2003) Reversal of photodamage with topical growth factors: a pilot study. J. Cosmet. Laser Ther. 5, Ghersetich, I., Lotti, T., Campanile, G., Grappone, C. and Dini, G. (1994) Hyaluronic acid in cutaneous intrinsic aging. Int. J. Dermatol. 33(2), Haratake, A., Uchida, Y., Schmuth, M., Tanno, O., Yasuda, R., Epstein, J.H., Elias, P.M. and Holleran, W. M. (1997) UVBinduced alterations in permeability barrier function: roles for epidermal hyperproliferation and thymocyte-mediated response. J. Invest. Dermatol. 108(5), Inomata. S., Matsunaga, Y., Amano, S., Takada, K., Kobayashi, K., Tsunenaga, M., Nishiyama, T., Kohno, Y. and Fukuda, M. (2003) Possible involvement of gelatinase in basement membrane damage and wrinkle formation in chronically. J. Invest. Dermatol. 120(1), Jiang, S.J., Chu, A.W., Lu, Z.F., Pan, M.H., Che, D.F. and Zhou, X.J. (2007) Ultraviolet B-induced alterations of the skinbarrier and epidermal calcium gradient. Exp. Dermatol. 16(12), Kim, S.H., Nam, G.W., Kang, B.Y., Lee, H.K., Moon, S.J. and Chang, I.S. (2005) The effect of kaempferol quercetin on

8 180 Kyung-Hwa Choi et al. hyaluronan-synthesis stimulation in human keratinocytes (HaCaT). Korean J. Food Sci. Nutr. 31, Kligman, L.H. (1996) The hairless mouse model for photoaging. Clin. Dermatol. 14, Lee, K.K., Kim, J.H., Cho, J.J. and Choi, J.D. (1999) Inhibitory effects of 150 plant extracts on elastase activity, and their anti-inflammatory effects. Int. J. Cosmet. Sci. 21(2), Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall. R.J. (1951) Protein measurement with the folin phenol reagent. J. Biol. Chem. 193(1), Makrantonaki, E. and Zouboulis, C. C. (2007) Characteristics and pathomechanisms of endogeniously aged skin. Dermatol. 214(4), Martin, J.P., Dailey, M. and Sugarman, E. (1987) Negative and positive assays of superoxide dismutase based on hematoxylin autooxidation. Arch. Biochem. Biophys. 225(2), Martin, P., Hopkinson-Woolley, J. and McCluskey, J. (1992) Growth factors and cutaneous wound repair. Prog. Growth Factor Res. 4(1), Massague, J. (1998) TGF-β signal transduction. Ann. Rev. Biochem. 67, Matsumura, Y. and Ananthaswamy, H.N. (2004) Toxic effects of ultraviolet radiation on the skin. Toxicol. Appl. Pharmacol. 195(3), Oba A. and Edwards, C. (2006) Relationships between changes in mechanical properties of the skin, wrinkling, and destruction of dermal collagen fiber bundles caused by photoaging. Skin Res. Technol. 12(4), Peltonen, J., Kahari, L., Jaakkola, S., Kahari, V.M., Varga, J., Uitto, J. and Jimenez, S. A. (1990) Evaluation of transforming growth factorβ and type procollagen gene expression in fibrotic skin diseases by in situ hybridization. J. Invest. Dermatol. 94(3), Quan, T., He, T., Kang, S., Voorhees, J.J. and Fisher, G.J. (2002) Ultraviolet irradiation alters transforming growth factor beta/ smad pathway in human skin in vivo. J. Invest. Dermatol. 119(2), Rittie, L., and Fisher, G.J. (2002) UV-light-induced signal cascades and skin aging. Ageing Res. Rev. 1(4), Sander, C.S., Chang, H., Salzmann, S., Muller, C.S. Ekanayake- Mudiyanselage, S., Elsner, P. and Thiele, J.J. (2002) Photoaging is associated with protein oxidation in human skin in vivo. J. Invest. Dermatol. 118, Schmid, P., Kunz, S., Cerletti, N., Mcmaster, G. and Cox, D. (1993) Injury induced expression of TGF-β1 mrna is enhanced by exogenously applied TGF-βs. Biochem. Biophys. Res. Comm. 194(1), Seite, S., Zucchi, H., Septier, D., Igondjo-Tchen, S., Senni, K. and Godeau, G. (2006) Elastin changes during chronological and photo-ageing: the important role of lysozyme. J. Eur. Acad. Dermatol. Venereol. 20(8), Seo, J.Y., Cho, K.H., Eun, H.C. and Chung J. H. (2001) Skin aging from phenotype to mechanism. Korean J. Invest. Dermatol. 8(4), Stripe, F. and Della, C.E. (1969) The regulation of rat liver xanthine oxidase. Conversion in vitro of the enzyme activity from dehydrogenase(type D) oxidase (type O). J. Biol. Chem. 244(14), Sunderkötter, C., Kalden, H. and Luger, T.A. (1997) Aging and the skin immune system. Arch. Dermatol. 133(10), Trevithick, J.R., Xiong, H., Lee, S., Shum, D.T., Sanford, S.E., Karlik, S.J., Norley, C. and Dilworth GR. (1992) Topical tocopherol acetate reduces post-uvb, sunburn-associated erythema, edema, and skin sensitivity in hairless mice. Arch. Biochem. Biophys. 296(2), Waller, J.M. and Maibach. H.I. (2006) Age and skin structure and function, a quantitativeapproach (II): protein, glycosaminoglycan, water, and lipidcontent and structure. Skin Res. Technol. 12(3), Wlaschek, M., Briviba, K., Stricklin, G.P., Sies, H. and Scharffetter-Kochanek, K. (1995) Singlet oxygen may mediate the ultraviolet A-induced synthesis of interstitial collagenase. J. Invest. Dermatol. 104(2), Yaar, M. and Gilchrist, B.A. (1999) Aging of skin. Dermatology in general medicine. pp , Mcgraw-Hill, New York.