untitled
|
|
- 지유 저
- 5 years ago
- Views:
Transcription
1 ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4): pissn eissn Korean J Clin Lab Sci. Vol. 49, No. 4, December Distribution of Antimicrobial Resistant Genes in Acinetobacter calcoaceticus-baumannii Complex Isolated from Clinical Specimens in Chungcheong, Korea Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Eumseong, Korea 충청지역의임상검체로부터분리된 Acinetobacter calcoaceticus-baumannii Complex 를대상으로항균제내성유전자비교분석 성지연 극동대학교임상병리학과 Species that belong to the Acinetobacter calcoaceticus-baumannii (Acb) complex are major causes of hospital-acquired infections. They are important opportunistic pathogens. These species are usually multidrug resistant (MDR), and the therapeutic options to treat the infections caused by these species are limited. In the present study, we investigated fluoroquinolone resistance mechanisms in 53 ciprofloxacin resistant Acinetobacter species isolates in Chungcheong, Korea. Antimicrobial susceptibilities were determined using the disk-diffusion method. Detections of genes and identification of mutations associated with fluoroquinolone resistance were carried out using PCR and DNA sequencing. In our study, 47 out of 53 ciprofloxacin resistant Acinetobacter isolates harbored sense mutations at the 83rd residue (serine to leucine) in the gyra gene as well as at the 80th residue (serine to leucine) in the parc gene. Among the 47 isolates harboring sense mutations in gyra and parc gene, 44 isolates were A. baumannii and 3 isolates were A. pittii. Plasmid-mediated quinolone resistance (PMQR) determinants were detected in isolates in our study. Among the 46 ciprofloxacin resistant A. baumannii isolates, 41 showed type A, B, or F banding patterns on their REP-PCR profiles. This result suggests that clonal relation and horizontal spreading of the bacterial isolates have been around hospitals in Chungcheong area. To prevent colonization and disseminations of fluoroquinolone resistance Acb complex isolates, continuous investigation and monitoring of antimicrobial resistant determinants of MDR isolates are needed. Key words: Acinetobacter calcoaceticus-baumannii complex, A. baumannii, Fluoroquinolone, Multidrug resistant Corresponding author: Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Daehak-gil, Gamgok-myeon, Eumseong 27601, Korea Tel: Fax: azaza72@naver.com This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright 2017 The Korean Society for Clinical Laboratory Science. All rights reserved. Received: September 6, 2017 Revised 1 st : September 29, 2017 Revised 2 nd : September 29, 2017 Revised 3 rd : October 11, 2017 Accepted: October 11, 2017
2 428 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex 서론 Acinetobacter 속에속한균종들은토양과담수등자연환경에널리서식하는그람음성막대균으로이속에속한일부종들은병원감염및기회감염의원인균으로작용한다. Acinetobacter calcoaceticus-baumannii (Acb) complex에속하는 A. baumannii, A. pittii, 그리고 A. nosocomialis는병원환경및입원환자에서가장빈번하게분리되고있는균종으로, 특히신생아실이나중환자실등에서유행하며폐렴, 요로감염, 균혈증및심내막염등다양한감염병을일으키고있다 [1-3]. 이세균들에의한감염병은유병율과치사율이높은것으로알려져있는데최근여러계열의항균제에내성을동시에나타내는다제내성 Acinetobacter 균주의출현이빈번해지고있어이세균들에의한감염병치료가더욱어려워지고있다 [1-3]. Fluoroquinolones 는일반적으로그람양성세균과그람음성세균에모두효과적인광범위항균제로 cephalosporins 및 aminoglycosides 계열항균제와비교해우수한항균력을가지고있어 Acinetobacter 종들에의한감염병치료를위해오래동안사용되어왔다. 그러나최근 fluoroquinolone 에내성을보이는 Acinetobacter 종들의출현및확산이세계여러나라에서보고되어문제가되고있다 [4]. Acinetobacter 속에속한종들은다양한기전으로 fluoroquinolones 에내성을나타내는데이러한내성은세균세포의염색체 DNA에돌연변이가생기거나 plasmid를통해운반되는내성유전자를획득함으로써나타난다. 세균세포의염색체 DNA에돌연변이가발생하는경우중대표적인것이항균제가작용하는효소를암호화하는유전자의돌연변이이다. 가장빈번하게돌연변이가발생하는유전자는 DNA gyrase 효소를암호화하는 gyra 및 gyrb 유전자와 topoisomerase IV 효소를암호화하는 parc 및 pare 유전자이다. 이유전자들은 quinolone resistance determining regions (QRDRs) 라고불리우는영역에위치하고있는데변이된유전자에의해생산된효소는 fluoroquinolones 과결합하지않으므로항균제에내성을나타내게된다. 특히 Acinetobacter 속에속한종들은 gyra와 / 또는 parc 유전자에돌연변이가있는경우대부분 fluoroquinolones 에고도내성을보이는것으로알려져있다 [4]. 한편세균은 plasmid를통해다양한항균제에내성을나타낼수있게하는유전자들을획득한다. Plasmid를통해운반되며 quinolone 에내성을나타내도록하는인자들을 plasmid-mediated quinolone resistance (PMQR) determinants라고하는데이에해당하는유전자에는 qnr, aac(6 )-1b-cr, qepa, oqxa 및 oqxb 등이있다. 이유전자들에의해생성된단백들은다양한방법으로 fluoroquinolone 항균제가세균세포에작용하지못하도록하여세균이 fluoroquinolone 항균제에내성을갖도록한다. Onr 단백은 DNA gyrase와 topoisomerase IV 효소에 fluoroquinolone 항균제가결합하는것을방해하여 fluoroquinolone 항균제의항균능력을저하시킨다 [5]. AAC(6 )-1b-cr 단백은 aminoglycoside acetyltransferase효소로 fluoroquinolone 항균제를변형시켜항균작용을못하도록한다. 또한 QepA와 OqxAB 단백은유출펌프를활성화시켜 fluoroquinolone 항균제를세균세포바깥으로유출시킴으로써 fluoroquinolone 항균제가작용할수없도록한다 [6]. PMQR에포함되는유전자들은 plasmid를통해다양한균종으로빠르게확산될수있어내성유전자의확산이라는면에서는큰문제이지만 Acinetobacter 속에속한종에서는드물게보고되고있다 [7,8]. 최근까지전세계적으로 Acinetobacter 속에속한종들을대상으로내성연구가많이진행되었고보고되고있으나주로 A. baumannii 균종에만국한되어있거나 carbapenem 내성기전에초점이맞춰져있는경우가대부분이었다 [3,4]. 국내에서도 Acinetobacter 속에속한종들을대상으로한연구는많으나 [1,9] fluoroquinolone 항균제에대한내성연구는드물다. 본연구에서는충청지역에서분리된 Acb complex에속하는균주를대상으로 fluoroquinolone 항균제에대한내성기전을조사하여종간의내성현황및내성기전을비교분석하였다. 또한 fluoroquinolone 항균제에내성을보이는균주를대상으로 repetitive extragenic palindromic sequence-based PCR (REP-PCR) 을시행하여내성균주간의클론성을비교및분석하였다. DNA fingerprinting 방법중하나인 REP-PCR 분석법은 A. baumannii에의한병원내감염의역학적특성을밝히는데유용하고신속한방법으로알려져있으며, 역학조사를위한참조방법인 pulsed-field gel electrophoresis (PFGE) 방법으로얻은결과와유사한결과를보인다고보고되고있다 [10]. 본연구결과는충청지역에서분리되는 Acinetobacter 속에속한균주들의내성양상을파악하는데도움이될것으로사료된다. 재료및방법 1. 균주의수집및균종동정본연구는수집기간인 2014년 8월부터 2016월 5월까지충청지역에위치한대학병원에의뢰된객담 (68), 소변 (18), 기관지세척액 (14) 및그외검체 (4) 로부터분리된 104균주의 Acb
3 Korean J Clin Lab Sci. Vol. 49, No. 4, December complex에속하는 Acinetobacter species를대상으로하였다. 동일환자에서반복분리된균주는수집대상에서제외하였다. 검체로부터분리배양된균주를대상으로 Vitek 2R automated instrument ID system (biomérieux, Marcy l'etoile, France) 을이용하여일차균종동정을하였다. Vitek 2R automated instrument ID system (biomérieux) 분석결과가 Acinetobacter 속에속한종인균주를대상으로최종균종동정을위해 Ac1055F (5 -GTGATAARATGGCBGGTCGT-3 ) 및 Ac1598R (5 -CGBGCRTGCATYTTGTCRT-3 ) 를시발체로 rpob 유전자를증폭시켜염기서열을분석하였다 [2]. 먼저대상균주를 brain heart infusion broth (Difco, Cockeysville, MD, USA) 에접종하여 37 C에서 24시간배양한후배양액으로부터 DNA purification kit (Bioneer, Daejeon, Korea) 을사용하여 DNA를추출하였다. AccuPower PCR PreMix (Bioneer) 에 DNA 추출액 (2.5 L), primer 각 10 pmol 및증류수를혼합하여총부피 25 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Corp. Ltd, China) 로 95 C 에서 5분간반응시킨후, 95 C에서 30초, 52 C에서 40초, 72 C에서 30초씩 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 각각의 PCR 반응산물을 ethidium bromide가포함된 1.5% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물을 PCR purification kit (Bioneer) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서 열을분석하였다. 2. 항균제감수성시험 Mueller-Hinton 한천배지 (Difco) 를사용하여 amikacin, gentamicin, aztreonam, cefepime, ceftazidime, ciprofloxacin, imipenem 및 meropenem (BBL, Cockeysville, MI, USA) 에대한감수성을 Clinical and Laboratory Standards Institute (CLSI) 지침에따라디스크확산법으로확인하였다 [11]. 정도관리를위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을동시에시험하여허용범위내에있는지확인하였다. 본연구에서는 Acinetobacter species가 aminoglycosides, carbapenems, 광범위 cephalosporins 및 quinolones 계열의항균제중 3계열이상의항균제에내성을나타낼경우다제내성 (multidrug-resistant, MDR) Acinetobacter species로정하였다 [3]. 3. Quinolone 내성인자검출 QRDR에위치한 gyra 및 parc 유전자의돌연변이와 PMQR determinants 를검출하기위해기존의시발체 (Table 1) 를사용하여중합효소연쇄반응을수행하였다 [12-15]. 균종동정을위해 rpob 유전자를증폭시킬때와동일한방법으로준비한 DNA 추출액 (2.5 L), primer 각 10 pmol, AccuPower PCR PreMix (Bioneer) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Table 1. Oligonucleotides used in this study for detection of quinolone resistance determinants Primer Sequence (5 3 ) Gene Reference QRDR mutation detection gyra-f AAATCTGCTCGTGTCGTTGG gyra [12] gyra-r GCCATACCTACAGCAATACC parc-f AAGCCCGTACAGCGCCGTATT parc [12] parc-r AAAGTTATCTTGCCATTCGCT PMQR gene detection QnrA-F AGAGGATTTCTCACGCCAGG qnra [13] QnrA-R TGCCAGGCACAGATCTTGAC QnrB-F GGMATHGAAATTCGCCACTG qnrb [13] QnrB-R TTTGCYGYYCGCCAGTCGAA QnrS-F GCAAGTTCATTGAACAGGGT qnrs [13] QnrS-R TCTAAACCGTCGAGTTCGGCG Aac(6)-Ib-F TTGCGATGCTCTATGAGTGGCTA aac(6)-ib-cr [14] Aac(6)-Ib-R CTCGAATGCCTGGCGTGTTT QepA-F CCAGCTCGGCAACTTGATAC qepa [15] QepA-R ATGCTCGCCTTCCAGAAAA OqxA-F CTCGGCGCGATGATGCT oqxa [15] OqxA-R CCACTCTTCACGGGAGACGA Abbreviations: F, sense primer; R, antisense primer; M, A/C; H, A/T/C; Y, C/T.
4 430 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex Corp.) 로 95 C에서 5분간반응시킨후, 94 C에서 30초, 56 C 에서 30초, 72 C에서 50초씩 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 중합효소연쇄반응에서생성된반응산물을 ethidium bromide가포함된 1.5% agarose gel에서 30분간전기영동하여 band를확인한후 rpob 유전자분석할때와동일한방법으로염기서열분석을시행하였다. 4. REP-PCR 을이용한 ciprofloxacin 내성 A. baumannii의역학적연관성조사시발체로는 REP1 (5 -IIIGCGCCGICATCAGGC-3 ) 과 REP2 (5 -ACGTCTTATCAGGCCTAC-3 ) 로명명된장내세균의반복서열을이용하였다 [10]. 증폭반응은 DNA 추출액 (5.0 L), primer 각 20 pmol, AccuPower PCR PreMix (Bioneer) 및증류수를혼합하여총부피 50 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Corp.) 로 95 C에서 5분간반응시킨후, 90 C에서 40초, 42 C에서 1 분, 68 C에서 7분씩 35회증폭반응시키고, 68 C에서 15분간연장반응시켰다. 증폭산물 (10 L) 을 ethidium bromide가포함된 2% agarose gels에전기영동한후 Slite 140 Image System (Novusci, Bedfordshire, UK) 을이용하여 band패턴을분석하였다. Band의강도와상관없이 band의개수및분자량으로각균주를비교하였으며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [10]. 결과 1. Ciprofloxacin 내성 Acinetobacter species 의분리수집기간동안총 104 균주의 Acb complex에속하는 Acinetobacter species가분리되었는데 A. baumannii가 56 균주로가장많았으며 A. pittii가 28균주로그다음으로많았고 A. nosocomialis는 20균주가분리되었다. 한편임상검체종류에따라균종의분리빈도가다르게나타났는데객담검체에서는 A. baumannii가 (46/68) 압도적으로많이분리되었으며그다음으로 A. pittii가 (16/68) 많이분리되었다. 반면소변검체에서는 A. pittii가 (8/18) 가장빈번하게분리되었으며그다음으로 A. nosocomialis가 (6/18) 많이분리되었다. 기관지세척액검체에서는 Acb complex 에속하는 Acinetobacter species 가모두유사한빈도로분리되었다. 이균주들을대상으로 ciprofloxacin 에대한항균제감수성시험을한결과총 53균주즉 46균주 (82.1%) 의 A. baumannii, 4균주 (14.3%) 의 A. pittii, 그리고 3균주 (15.0%) 의 A. nosocomialis가 ciprofloxacin 에내성을가지고있는것이확인되었다 (Table 2). 또한시험기간동안분리된총 53 균주의 ciprofloxacin 내성 Acinetobacter species 중 49균주가다제내성을보였다. 한편정도관리를위해 E. coli ATCC 25922와 P. aeruginosa ATCC 균주도 Acinetobacter species 와동일한방법으로 9종류의항균제에대해감수성검사를시행하였다. 그결과 E. coli ATCC 25922의항균제억제영역의직경 (mm) 은각각 amikacin (23), gentamicin (24), aztreonam (32), cefepime (35), ceftazidime (31), ciprofloxacin (36), imipenem (30) 및 meropenem (32) 인것으로나타나모두허용범위내에들었다. P. aeruginosa ATCC 또한각항균제에대해억제영역의직경 (mm) 이 amikacin (24), gentamicin (20), aztreonam (26), cefepime (28), ceftazidime (26), ciprofloxacin (30), imipenem (26) 및 meropenem (32) 로모두허용범위내에드는것으로나타났다. 2. Quinolone 내성인자검출및분석총 53균주의 ciprofloxacin 내성 Acinetobacter species를대상으로 gyra 및 parc 유전자에돌연변이가있는지를확인하기위해중합효소연쇄반응과염기서열분석을수행한결과 A. baumannii 44균주, A. pittii 3균주, 그리고 A. nosocomialis 한균주로구성된총 48균주가 gyra 와 / 또는 parc 유전자에돌연변이를가지고있었다 (Table 2). 돌연변이가확인된 48균주의 Acinetobacter species 중 A. nosocomialis 한균주를제외한나머지 47 균주는 gyra와 parc 유전자모두에돌연변이를가지고있었다. 본연구에서확인된 gyra 및 parc 유전자돌연변이는염기의치환에의해 serine 잔기가 leucine 잔기로치환되는 sense mutation으로 gyra 유전자의 83번째아미노산 (serine) 과 parc 유전자의 80번째아미노산 (serine) 이 leucine 으로치환된돌연변이였다. 한편본연구에서는 53균주의 ciprofloxacin 내성 Acinetobacter species를대상으로 PMQR 유전자인 qnr, aac(6 )-1b-cr, qepa 및 oqxa 유전자의빈도를조사하기위해중합효소연쇄반응을시행하였으나양성반응을보인균주는하나도없는것으로나타났다. 3. Ciprofloxacin 내성 A. baumannii의유전형분석시험기간중분리된 46균주의 ciprofloxacin 내성 A. baumannii가같은클론에서유래되었는지를확인하기위하여 REP-PCR 을수행한결과총 7개의 band 패턴 (A, B, C, D, E, F 및 G형 ) 이확인되었다 (Figure 1). 분석대상이되었던 46 균주
5 Korean J Clin Lab Sci. Vol. 49, No. 4, December Table 2. Antimicrobial susceptibility patterns and characteristics of 53 Acinetobacter spp. isolated from clinical specimens in Chungcheong, Korea Isolate Acinetobacter spp. Antimicrobial susceptibility QRDR* mutations in AMK GEN AZT FEP CAZ CIP IPM MEM gyra parc PMQR genes R401 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R402 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R403 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R404 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R405 A. baumannii R R R R R R R R R406 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R407 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R409 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R410 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R501 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R502 A. baumannii S I R R R R R R Ser83Leu Ser83Leu - R503 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R504 A. baumannii S R R R R R R R Ser83Leu Ser83Leu - R505 A. baumannii S S R R R R R R Ser83Leu Ser83Leu - R506 A. baumannii S I R R R R R R Ser83Leu Ser83Leu - R507 A. baumannii S S R R R R S S Ser83Leu Ser83Leu - R508 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R509 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R510 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R511 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R512 A. baumannii S S R R R R I I Ser83Leu Ser83Leu - R601 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R602 A. baumannii R R R R R R R R R603 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R604 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R605 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R606 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R607 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R608 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R609 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R610 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R611 A. baumannii S S R I R R S I Ser83Leu Ser83Leu - R612 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R613 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R614 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R615 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R616 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R617 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R618 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R619 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R620 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R621 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R622 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R623 A. baumannii S S R R R R S S Ser83Leu Ser83Leu - R624 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R625 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - RP401 A. pittii R R R R R R R R RP402 A. pittii R R R R R R R R Ser83Leu Ser83Leu - RP403 A. pittii R R R R R R R R Ser83Leu Ser83Leu - RP404 A. pittii R R R R R R R R Ser83Leu Ser83Leu - SN603 A nosocomialis S R R S S R S S RN401 A nosocomialis R R R R R R R R Ser83Leu - - RN402 A nosocomialis R R R R R 4 R R aac(6 )-1b-cr, qepa 및 oqxa. Abbreviations: AMK, amikacin; GEN, gentamicin; AZT, aztreonam; FEP, cefepime; CAZ, ceftazidime; CIP, ciprofloxacin; IPM, imipenem; MEM, meropenem; S, susceptible; I, intermediate resistant; R, resistant. *Point mutations in the quinolone resistance-determining regions (QRDRs). Plasmid-mediated quinolone resistance (PMQR) genes: qnr,
6 432 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex Figure 1. Repetitive element sequence-based (REP)-PCR patterns of genomic DNA from forty-six ciprofloxacin resistant Acinetobacter baumannii isolates. Land SM is 1 kb DNA size marker. 중 5균주를제외한 41균주가 A형 (16균주), B형 (18균주), 또는 F형 (7균주) 의 band 패턴을보였다. 고찰 Acinetobacter속에속한종들은병원감염및기회감염을일으키는주된원인균으로다양한항균제내성인자를가지고있어병원환경에서내성유전자의확산에중요한역할을한다 [2]. 따라서 Acinetobacter 속에속한종들을대상으로한항균제내성연구는병원감염관리를위해매우중요하다. 본연구에서는환자로부터분리된 Acb complex에속하는균주를대상으로항균제감수성양상과 fluoroquinolone 항균제에대한내성기전조사하였으며 Acinetobacter 종간의차이점을비교분석하였다. 연구기간동안총 53 균주의 ciprofloxacin 내성 Acinetobacter species가임상검체로부터분리되었는데그중 86.8% 에해당하는 46균주가 A. baumannii였다. A. baumannii 균주의 ciprofloxacin 에대한항균제내성율은 82.1% 로 A. pittii 균주 (14.3%) 나 A. nosocomialis 균주 (15.0%) 보다 5배이상높았는데이전에아프리카 (82.4%) 와국내 (79.5%) 에서보고된연구결과와유사한내성율을보이고있다 [16,17]. 본연구에서분리된 A. pittii 및 A. nosocomialis 균주들의 ciprofloxacin 에대한내성율은 15.0% 이하로 A. baumannii 균주보다매우낮았는데유사한결과 ( %) 가이전에국내에서보고된바있다 [17]. 이상의결과에서 Acb complex에속하는 Acinetobacter 종들중 A. baumannii의분리빈도와 ciprofloxacin 에대한내성율이 non-a. baumannii에비해월 등하게높은것으로나타났는데이는 Acinetobacter 종들중주된병원감염균으로작용하고임상적으로매우중요한종이 A. baumannii 임을의미한다. 이전의국내외의많은연구자들은역시 Acinetobacter 종들중 A. baumannii 균주가기회감염및병원감염을일으키는주된원인균으로대부분의 A. baumannii 균주가다제내성을나타낸다고보고하고있다 [17-19]. Acinetobacter species가 fluoroquinolone 에내성을나타내는가장중요한기전중하나가 DNA gyrase 와 DNA topoisomerase IV의돌연변이이다. 특이 gyra 와 parc 유전자에모두돌연변이가일어나아미노산이치환될경우 fluoroquinolone 에고도내성을나타낸다고알려져있다 [19]. 본연구에서도수집된 53 균주의 ciprofloxacin 내성 Acinetobacter species 중 44균주의 A. baumannii와 3균주의 A. pittii 가 gyra 와 parc 유전자모두에돌연변이를가지고있는것이확인되었다. 이들은종에상관없이모두 serine 잔기가 leucine 잔기로치환되는 sense mutation을 gyra 유전자와 parc 유전자에포함하고있었다. 본연구에서확인된 serine 잔기의 leucine 잔기로의치환은이미 A. baumannii 균주를대상으로많은연구에서보고된바있다 [20,21]. 그러나 A. pittii 또는 A. nosocomialis 균주를대상으로한연구에서 gyra와 / 또는 parc 유전자에 sense mutation이있음을보고한연구는그동안거의없었다. 그러나본연구에서는 A. pittii 균주역시 A. baumannii 균주와마찬가지로 gyra와 parc 유전자모두에 sense mutation을가질경우 fluoroquinolone 에고도내성을보일수있음을확인하여의미가있었다. 한편본연구에서수집된 53 균주의 ciprofloxacin 내성 Acinetobacter species는 PMQR 유전자를포함하고있지않았는데이결과는 Acine-
7 Korean J Clin Lab Sci. Vol. 49, No. 4, December tobacter species 의 fluoroquinolone 내성과 PMQR 유전자의획득은크게관련성이없음을뒷받침하는것으로이전의 Acinetobacter species를대상으로한연구에서도 PMQR 유전자의검출빈도가매우낮거나검출되지않았다고보고하고있다 [22-24]. 본연구에서는총 44균주의 ciprofloxacin 내성 A. baumannii가분리되었는데이들을대상으로서로같은 clone에서유래했는지여부를알아보기위해 REP-PCR 을수행한결과분석대상이되었던 46 균주중 5균주를제외한 41균주가 A형, B 형, 또는 F형 band 패턴을보였다. 이러한결과는 ciprofloxacin 내성 A. baumannii 균주들이병원내에서수평확산되었음을의미한다. Ciprofloxacin 내성 Acb complex에속한균주의분리빈도가지속적으로증가하고있음에도불구하고충청지역에서분리된 Acinetobacter 균주의항균제감수성양상및 fluoroquinolone 내성기전에대한연구는상대적으로많지않았다. 본연구에서는충청지역에서분리된 Acb complex에속한균주를대상으로항균제감수성양상과 fluoroquinolone 내성기전을분석하였는데 A. baumannii가다른 Acinetobacter 종들에비해항균제내성율이높고다제내성을나타낼가능성이많은것으로나타났다. 또 Acinetobacter species의 fluoroquinolone 에대한내성은 PMQR 유전자의획득보다는 gyra 및 parc 유전자의돌연변이획득이더크게관련성이있는것으로나타났다. 한편다제내성 A. baumannii 균주가병원환경에지속적으로확산되고있음이확인되었는데이를방지하게위해서는지속적으로항균제내성을유발하는인자를조사하고내성세균의변화및확산양상을감시해야할것으로사료된다요약 Acinetobacter calcoaceticus-baumannii (Acb) complex 에속한종들은빈번하게병원감염및기회감염을일으킨다. 또한다제내성인경우가많아이균들의감염증치료를위한항균제선택이매우제한적이다. 본연구에서는 ciprofloxacin 내성 Acinetobacter species 53균주를대상으로 fluoroquinolone 내성기전을조사했다. 항균제감수성양상을조사하기위해디스크확산법이시행되었다. Fluoroquinolone 내성과관련된유전자및돌연변이검출을위해 PCR과염기서열분석이이루어졌다. 본연구에서수집된 53균주의 ciprofloxacin 내성 Acinetobacter 중 47균주가 gyra 유전자의 83번째 serine 아미노산잔기와 parc 유전자의 80번째 serine 아미노산잔기가 leucine 잔기로치환된 sense mutations 가지고있는것으로나타났다. gyra와 parc 유전자에 sense mutations을가지고있는 47균주중 44균주가 A. baumannii 였고 3균주는 A. pittii 였다. 본연구에서조사대상이되었던 Acb complex 균주들중 plasmid-mediated quinolone resistance (PMQR) determinants를가지고있는균주는한나도없었다. 46 균주의 ciprofloxacin 내성 A. baumannii 는 A, B, 또는 F형의 banding pattern을보였는데이는충청지역에위치한일개의병원에 ciprofloxacin 내성 A. baumannii가수평확산되어있음을의미한다. Fluoroquinolone 내성 Acb complex 균주의집락화및확산을막기위해서다제내성균주들을대상으로항균제내성인자들을지속적으로조사하고모니터링할필요가있을것으로사료된다. Acknowledgements: This work was supported by the 2017 Far East University Research Grant (FEU2017R02). Funding: None Conflict of interest: None REFERENCES 1. Sung JY. Clonal dissemination of multidrug resistant Acinetobacter baumannii isolates harboring bla OXA-23 at One University Hospital in Daejeon, Korea. Korean J Clin Lab Sci. 2016;48(2): La Scola B, Gundi VA, Khamis A, Raoult D. Sequencing of the rpob gene and flanking spacers for molecular identification of Acinetobacter species. J Clin Microbiol. 2006;44(3): Srinivasan VB, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann Clin Microbiol Antimicrob. 2009;8: Vila J, Ruiz J, Goni P, Jimenez de Anta T. Quinolone-resistance mutations in the topoisomerase IV parc gene of Acinetobacter baumannii. J Antimicrob Chemother. 1997;39(6): Jacoby GA. Mechanisms of resistance to quinolones. Clin Infect Dis. 2005;41(Suppl 2): Nordmann P, Poirel L. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J Antimicrob Chemother. 2005;56(3): Jiang X, Yu T, Jiang X, Zhang W, Zhang L, Ma J. Emergence of plasmid-mediated quinolone resistance genes in clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa in Henan, China. Diagn Microbiol Infect Dis. 2014;79(3): Touati A, Brasme L, Benallaoua S, Gharout A, Madoux J, De Champs C. First report of qnrb-producing Enterobacter cloacae and qnra-producing Acinetobacter baumannii recovered
8 434 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex from Algerian hospitals. Diagn Microbiol Infect Dis. 2008; 60(3): Lim J, Lee G, Choi Y, Kim J. An analysis of the antibiotic resistance genes of multi-drug resistant (MDR) Acinetobacter baumannii. Korean J Clin Lab Sci. 2016;48(3): Bou G, Cerveró G, Domínguez MA, Quereda C, Martínez- Beltrán J. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin Microbiol Infect. 2000; 6(12): CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Sixteenth Informational Supplement. CLSI document M100-S20. Wayne, Pennsylvania: Clinical and Laboratory Standards Institute; 2010, p Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol. 2008;46(8): Cattoir V, Poirel L, Rdotimi V, Soussy CJ, Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother. 2007;60(2): Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6')-ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006;50(11): Li J, Wang T, Shao B, Shen J, Wang S, Wu Y. Plasmid-mediated quinolone resistance genes and antibiotic residues in wastewater and soil adjacent to swine feedlots: potential transfer to agricultural lands. Environ Health Perspect. 2012;120(8): Khorsi K, Messai Y, Hamidi M, Ammari H, Bakour R. High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes bla OXA-23-lik, bla OXA-24-like and bla NDM-1 in Algiers hospitals. Asian Pac J Trop Med. 2015;8(6): Park YK, Jung SI, Park KH, Kim DH, Choi JY, Kim SH, et al. Changes in antimicrobial susceptibility and major clones of Acinetobacter calcoaceticus-baumannii complex isolates from a single hospital in Korea over 7 years. J Med Microbiol. 2012;61(Pt 1): Koo SH, Kwon KC, Cho HH, Sung JY. Genetic basis of multidrug-resistant Acinetobacter baumannii clinical isolates from three university hospitals in Chungcheong province, Korea. Korean J Lab Med. 2010;30(5): Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol. 2008;46(8): Güler G, Eraç B. Investigation of fluoroquinolone resistance mechanisms in clinical Acinetobacter baumannii isolates. Mikrobiyol Bul. 2016;50(2): Lee JK, Lee YS, Park YK, Kim BS. Mutations in the gyra and parc genes in ciprofloxacin-resistant clinical isolates of Acinetobacter baumannii in Korea. Microbiol Immunol. 2005; 49(7): Yang H, Hu L, Liu Y, Ye Y, Li J. Detection of the plasmid-mediated quinolone resistance determinants in clinical isolates of Acinetobacter baumannii in China. J Chemother. 2016;28(5): Gu DX, Hu YJ, Zhou HW, Zhang R, Chen GX. Substitutions of Ser83Leu in GyrA and Ser80Leu in ParC Associated with Quinolone Resistance in Acinetobacter pittii. Microb Drug Resist. 2015;21(3): MJ Jiang, Sh P Zhao, J M Li, FS Zhang. Molecular epidemiological study and detection of multi-drug resistant Acinetobacter baumannii -related resistance genes. African J Mirobiol Reser. 2013;7(48):
untitled
210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More informationuntitled
Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho
More information< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
More informationuntitled
Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,
More informationuntitled
Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University
More informationMicrosoft Word - 15-홍승복.doc
J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative
More information296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,
Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More informationuntitled
Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location
More informationKJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디
KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director
More information<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화
More information03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis
More informationuntitled
Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi
More information12_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬
More information12(2) fm
Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative
More informationuntitled
병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationKJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)
KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection
More informationKang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino
DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant
More information<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>
대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing
More information(59-69)Kjcm13.hwp
Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>
대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases
More informationuntitled
Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information<303120C6AFC1FD20B9E8C7F6C1D62E687770>
대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo
More information84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains
계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information2101
대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum
More information400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다
대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationÇмúº¸°í5¿À´ÙÇö
병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance
More informationDrug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob
Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과
More information<303220C6AFC1FD303220B0ADC3B6C0CE2E687770>
대한내과학회지 : 제 88 권제 5 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.5.502 특집 (Special Review) - 다제내성균감염의위협 다제내성그람음성균감염의항생제치료 성균관대학교의과대학삼성서울병원감염내과 강철인 Antimicrobial Therapy for Infections Caused by Multidrug-Resistant
More informationA. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla
대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1
More information< BFF8C0FA2D B9E8C7F6C1D62E687770>
대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,
More information22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서
대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More informationFebruary 2007
Nov 2008 Vol. 16 No. 4 Ser. No. 63 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2008 at a KONSAR program participating hospital
More informationÇмúº¸°í6ÇÏÇý¹Î
병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부
More information주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s
연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information10 원저 hwp
대한내과학회지 : 제 94 권제 1 호 2019 https://doi.org/10.3904/kjm.2019.94.1.107 비병원장기요양기관에서입원하는노인의다제내성그람음성균보유 서울특별시서울의료원내과 김민성ㆍ신진호ㆍ정연상ㆍ조진경ㆍ최재필 Multidrug-Resistant, Gram-Negative Bacteria in Hospitalized Elderly Patients
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationuntitled
Korean J Clin Microbiol Vol. 5, No., March, http://dx.doi.org/.545/kjcm..5.. Carbapenem-Resistant Acinetobacter baumannii Il Kwon Bae, Seok Hoon Jeong, Kyungwon Lee Department of Laboratory Medicine and
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationuntitled
Ann Clin Microbiol Vol. 19, No. 2, June, 2016 http://dx.doi.org/10.5145/acm.2016.19.2.48 pissn 2288-0585 eissn 2288-6850 Distribution and Antimicrobial Resistance of Streptococcus pneumoniae at Four University
More information한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri
한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationTable 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi
May 2012 Vol. 20, No. 2 Ser. No. 77, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during January to March, 2012 Antimicrobial resistance rates determined
More informationuntitled
Ann Clin Microbiol Vol. 7, No., June, http://dx.doi.org/5/acm..7..5 pissn -55 eissn -65 Characterization of Salmonella spp. Clinical Isolates in Gyeongsangbuk-do Province, to 3 Oh-Geun Kweon, Jin Seok
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationMicrosoft Word - 3-김정민.doc
Journal of Bacteriology and Virology 2006. Vol. 36, No. 1 p.21 30 다약제내성 Acinetobacter 균의유전종결정및항균제내성의특성규명 경북대학교의과대학미생물학교실, 단국대학교의과대학미생물학교실 1 임유미 최태생 1 김정민 * Determination of Genomospecies and Characterization
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationuntitled
Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Detection of CTX-M-Type Extended-Spectrum β-lactamase in Clinical Isolates of Chromosomal AmpC β-lactamase-producing Enterobacteriaceae from Korea
More information674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017
한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More informationMicrosoft Word - 09-김영권.doc
J. Exp. Biomed. Sci. 2012, 18(2): 152~159 pissn : 1738-3226 Original Article Prevalence and Antimicrobial Susceptibility of Erythromycin-Resistant Campylobacter jejuni and Campylobacter coli Isolated from
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information44-6대지.07전종한-5
Place Memories of the Urban Backlane: In case of the Pimat-gol of Jongno, Seoul Jong-Han Jeon* 600 vs. vs. vs. Abstract Pimat-gil is a bystreet over 600-years old of Jong-no in Seoul that originated in
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationFebruary 2007
May 2008 Vol. 16 No. 2 Ser. No. 61 Quarterly ISSN 1226-1734 www.whonet.org Antimicrobial resistance of bacteria isolated during January to March in 2008 at a KONSAR program participating hospital Antimicrobial
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 017;9():13-19 https://doi.org/10.153/kjcls.017.9..13 pissn 173-35 eissn -6 Korean J Clin Lab Sci. Vol. 9, No., December 017 13 The Characteristics of Imipenem-Resistant
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationuntitled
Ann Clin Microbiol Vol. 19, No. 1, March, 216 http://dx.doi.org/1.5145/acm.216.19.1.13 pissn 2288-585 eissn 2288-685 Prevalence and Antimicrobial Susceptibility of Genital Mycoplasmataceae in Korean Women:
More informationºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
More informationMicrosoft PowerPoint - 4.조지현 [호환 모드]
감염관리를위한진단검사 다제내성균감시검사 (MULTIDRUG RESISTANT ORGANISMS) 조지현원광의대진단검사의학과 다제내성균감시검사 1. MDRO 정의 (multidrug resistant organisms) 2. MDRO 중요성과국내 MDRO 현황 3. MDRO 검사 (screen, confirm) 1) MRSA, VRSA/VISA, CNS 2)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More informationuntitled
Ann Clin Microbiol Vol. 16, No. 1, March, 1 http://dx.doi.org/1.5145/acm.1.16.1.45 ISSN 88-585 Trends in Isolation and Antimicrobial Susceptibility of Enteropathogenic Bacteria in 1-1 at a Korean Tertiary
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information