untitled

Size: px

Start display at page:

Download "untitled"

지유 저
5 years ago
Views:

1 ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4): pissn eissn Korean J Clin Lab Sci. Vol. 49, No. 4, December Distribution of Antimicrobial Resistant Genes in Acinetobacter calcoaceticus-baumannii Complex Isolated from Clinical Specimens in Chungcheong, Korea Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Eumseong, Korea 충청지역의임상검체로부터분리된 Acinetobacter calcoaceticus-baumannii Complex 를대상으로항균제내성유전자비교분석 성지연 극동대학교임상병리학과 Species that belong to the Acinetobacter calcoaceticus-baumannii (Acb) complex are major causes of hospital-acquired infections. They are important opportunistic pathogens. These species are usually multidrug resistant (MDR), and the therapeutic options to treat the infections caused by these species are limited. In the present study, we investigated fluoroquinolone resistance mechanisms in 53 ciprofloxacin resistant Acinetobacter species isolates in Chungcheong, Korea. Antimicrobial susceptibilities were determined using the disk-diffusion method. Detections of genes and identification of mutations associated with fluoroquinolone resistance were carried out using PCR and DNA sequencing. In our study, 47 out of 53 ciprofloxacin resistant Acinetobacter isolates harbored sense mutations at the 83rd residue (serine to leucine) in the gyra gene as well as at the 80th residue (serine to leucine) in the parc gene. Among the 47 isolates harboring sense mutations in gyra and parc gene, 44 isolates were A. baumannii and 3 isolates were A. pittii. Plasmid-mediated quinolone resistance (PMQR) determinants were detected in isolates in our study. Among the 46 ciprofloxacin resistant A. baumannii isolates, 41 showed type A, B, or F banding patterns on their REP-PCR profiles. This result suggests that clonal relation and horizontal spreading of the bacterial isolates have been around hospitals in Chungcheong area. To prevent colonization and disseminations of fluoroquinolone resistance Acb complex isolates, continuous investigation and monitoring of antimicrobial resistant determinants of MDR isolates are needed. Key words: Acinetobacter calcoaceticus-baumannii complex, A. baumannii, Fluoroquinolone, Multidrug resistant Corresponding author: Ji Youn Sung Department of Biomedical Laboratory Science, Far East University, Daehak-gil, Gamgok-myeon, Eumseong 27601, Korea Tel: Fax: azaza72@naver.com This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyright 2017 The Korean Society for Clinical Laboratory Science. All rights reserved. Received: September 6, 2017 Revised 1 st : September 29, 2017 Revised 2 nd : September 29, 2017 Revised 3 rd : October 11, 2017 Accepted: October 11, 2017

2 428 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex 서론 Acinetobacter 속에속한균종들은토양과담수등자연환경에널리서식하는그람음성막대균으로이속에속한일부종들은병원감염및기회감염의원인균으로작용한다. Acinetobacter calcoaceticus-baumannii (Acb) complex에속하는 A. baumannii, A. pittii, 그리고 A. nosocomialis는병원환경및입원환자에서가장빈번하게분리되고있는균종으로, 특히신생아실이나중환자실등에서유행하며폐렴, 요로감염, 균혈증및심내막염등다양한감염병을일으키고있다 [1-3]. 이세균들에의한감염병은유병율과치사율이높은것으로알려져있는데최근여러계열의항균제에내성을동시에나타내는다제내성 Acinetobacter 균주의출현이빈번해지고있어이세균들에의한감염병치료가더욱어려워지고있다 [1-3]. Fluoroquinolones 는일반적으로그람양성세균과그람음성세균에모두효과적인광범위항균제로 cephalosporins 및 aminoglycosides 계열항균제와비교해우수한항균력을가지고있어 Acinetobacter 종들에의한감염병치료를위해오래동안사용되어왔다. 그러나최근 fluoroquinolone 에내성을보이는 Acinetobacter 종들의출현및확산이세계여러나라에서보고되어문제가되고있다 [4]. Acinetobacter 속에속한종들은다양한기전으로 fluoroquinolones 에내성을나타내는데이러한내성은세균세포의염색체 DNA에돌연변이가생기거나 plasmid를통해운반되는내성유전자를획득함으로써나타난다. 세균세포의염색체 DNA에돌연변이가발생하는경우중대표적인것이항균제가작용하는효소를암호화하는유전자의돌연변이이다. 가장빈번하게돌연변이가발생하는유전자는 DNA gyrase 효소를암호화하는 gyra 및 gyrb 유전자와 topoisomerase IV 효소를암호화하는 parc 및 pare 유전자이다. 이유전자들은 quinolone resistance determining regions (QRDRs) 라고불리우는영역에위치하고있는데변이된유전자에의해생산된효소는 fluoroquinolones 과결합하지않으므로항균제에내성을나타내게된다. 특히 Acinetobacter 속에속한종들은 gyra와 / 또는 parc 유전자에돌연변이가있는경우대부분 fluoroquinolones 에고도내성을보이는것으로알려져있다 [4]. 한편세균은 plasmid를통해다양한항균제에내성을나타낼수있게하는유전자들을획득한다. Plasmid를통해운반되며 quinolone 에내성을나타내도록하는인자들을 plasmid-mediated quinolone resistance (PMQR) determinants라고하는데이에해당하는유전자에는 qnr, aac(6 )-1b-cr, qepa, oqxa 및 oqxb 등이있다. 이유전자들에의해생성된단백들은다양한방법으로 fluoroquinolone 항균제가세균세포에작용하지못하도록하여세균이 fluoroquinolone 항균제에내성을갖도록한다. Onr 단백은 DNA gyrase와 topoisomerase IV 효소에 fluoroquinolone 항균제가결합하는것을방해하여 fluoroquinolone 항균제의항균능력을저하시킨다 [5]. AAC(6 )-1b-cr 단백은 aminoglycoside acetyltransferase효소로 fluoroquinolone 항균제를변형시켜항균작용을못하도록한다. 또한 QepA와 OqxAB 단백은유출펌프를활성화시켜 fluoroquinolone 항균제를세균세포바깥으로유출시킴으로써 fluoroquinolone 항균제가작용할수없도록한다 [6]. PMQR에포함되는유전자들은 plasmid를통해다양한균종으로빠르게확산될수있어내성유전자의확산이라는면에서는큰문제이지만 Acinetobacter 속에속한종에서는드물게보고되고있다 [7,8]. 최근까지전세계적으로 Acinetobacter 속에속한종들을대상으로내성연구가많이진행되었고보고되고있으나주로 A. baumannii 균종에만국한되어있거나 carbapenem 내성기전에초점이맞춰져있는경우가대부분이었다 [3,4]. 국내에서도 Acinetobacter 속에속한종들을대상으로한연구는많으나 [1,9] fluoroquinolone 항균제에대한내성연구는드물다. 본연구에서는충청지역에서분리된 Acb complex에속하는균주를대상으로 fluoroquinolone 항균제에대한내성기전을조사하여종간의내성현황및내성기전을비교분석하였다. 또한 fluoroquinolone 항균제에내성을보이는균주를대상으로 repetitive extragenic palindromic sequence-based PCR (REP-PCR) 을시행하여내성균주간의클론성을비교및분석하였다. DNA fingerprinting 방법중하나인 REP-PCR 분석법은 A. baumannii에의한병원내감염의역학적특성을밝히는데유용하고신속한방법으로알려져있으며, 역학조사를위한참조방법인 pulsed-field gel electrophoresis (PFGE) 방법으로얻은결과와유사한결과를보인다고보고되고있다 [10]. 본연구결과는충청지역에서분리되는 Acinetobacter 속에속한균주들의내성양상을파악하는데도움이될것으로사료된다. 재료및방법 1. 균주의수집및균종동정본연구는수집기간인 2014년 8월부터 2016월 5월까지충청지역에위치한대학병원에의뢰된객담 (68), 소변 (18), 기관지세척액 (14) 및그외검체 (4) 로부터분리된 104균주의 Acb

3 Korean J Clin Lab Sci. Vol. 49, No. 4, December complex에속하는 Acinetobacter species를대상으로하였다. 동일환자에서반복분리된균주는수집대상에서제외하였다. 검체로부터분리배양된균주를대상으로 Vitek 2R automated instrument ID system (biomérieux, Marcy l'etoile, France) 을이용하여일차균종동정을하였다. Vitek 2R automated instrument ID system (biomérieux) 분석결과가 Acinetobacter 속에속한종인균주를대상으로최종균종동정을위해 Ac1055F (5 -GTGATAARATGGCBGGTCGT-3 ) 및 Ac1598R (5 -CGBGCRTGCATYTTGTCRT-3 ) 를시발체로 rpob 유전자를증폭시켜염기서열을분석하였다 [2]. 먼저대상균주를 brain heart infusion broth (Difco, Cockeysville, MD, USA) 에접종하여 37 C에서 24시간배양한후배양액으로부터 DNA purification kit (Bioneer, Daejeon, Korea) 을사용하여 DNA를추출하였다. AccuPower PCR PreMix (Bioneer) 에 DNA 추출액 (2.5 L), primer 각 10 pmol 및증류수를혼합하여총부피 25 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Corp. Ltd, China) 로 95 C 에서 5분간반응시킨후, 95 C에서 30초, 52 C에서 40초, 72 C에서 30초씩 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 각각의 PCR 반응산물을 ethidium bromide가포함된 1.5% agarose gel에서 30분간전기영동하여밴드를확인하였다. 증폭산물을 PCR purification kit (Bioneer) 로분리후, BigDye Terminator Cycle Sequencing Kit (PE Applied Biosystems, Foster City, CA, USA) 와 ABI PRISM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서 열을분석하였다. 2. 항균제감수성시험 Mueller-Hinton 한천배지 (Difco) 를사용하여 amikacin, gentamicin, aztreonam, cefepime, ceftazidime, ciprofloxacin, imipenem 및 meropenem (BBL, Cockeysville, MI, USA) 에대한감수성을 Clinical and Laboratory Standards Institute (CLSI) 지침에따라디스크확산법으로확인하였다 [11]. 정도관리를위해 Escherichia coli ATCC 25922와 Pseudomonas aeruginosa ATCC 27853을동시에시험하여허용범위내에있는지확인하였다. 본연구에서는 Acinetobacter species가 aminoglycosides, carbapenems, 광범위 cephalosporins 및 quinolones 계열의항균제중 3계열이상의항균제에내성을나타낼경우다제내성 (multidrug-resistant, MDR) Acinetobacter species로정하였다 [3]. 3. Quinolone 내성인자검출 QRDR에위치한 gyra 및 parc 유전자의돌연변이와 PMQR determinants 를검출하기위해기존의시발체 (Table 1) 를사용하여중합효소연쇄반응을수행하였다 [12-15]. 균종동정을위해 rpob 유전자를증폭시킬때와동일한방법으로준비한 DNA 추출액 (2.5 L), primer 각 10 pmol, AccuPower PCR PreMix (Bioneer) 및증류수를혼합하여총부피 25 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Table 1. Oligonucleotides used in this study for detection of quinolone resistance determinants Primer Sequence (5 3 ) Gene Reference QRDR mutation detection gyra-f AAATCTGCTCGTGTCGTTGG gyra [12] gyra-r GCCATACCTACAGCAATACC parc-f AAGCCCGTACAGCGCCGTATT parc [12] parc-r AAAGTTATCTTGCCATTCGCT PMQR gene detection QnrA-F AGAGGATTTCTCACGCCAGG qnra [13] QnrA-R TGCCAGGCACAGATCTTGAC QnrB-F GGMATHGAAATTCGCCACTG qnrb [13] QnrB-R TTTGCYGYYCGCCAGTCGAA QnrS-F GCAAGTTCATTGAACAGGGT qnrs [13] QnrS-R TCTAAACCGTCGAGTTCGGCG Aac(6)-Ib-F TTGCGATGCTCTATGAGTGGCTA aac(6)-ib-cr [14] Aac(6)-Ib-R CTCGAATGCCTGGCGTGTTT QepA-F CCAGCTCGGCAACTTGATAC qepa [15] QepA-R ATGCTCGCCTTCCAGAAAA OqxA-F CTCGGCGCGATGATGCT oqxa [15] OqxA-R CCACTCTTCACGGGAGACGA Abbreviations: F, sense primer; R, antisense primer; M, A/C; H, A/T/C; Y, C/T.

4 430 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex Corp.) 로 95 C에서 5분간반응시킨후, 94 C에서 30초, 56 C 에서 30초, 72 C에서 50초씩 30회증폭반응시키고, 72 C에서 5분간연장반응시켰다. 중합효소연쇄반응에서생성된반응산물을 ethidium bromide가포함된 1.5% agarose gel에서 30분간전기영동하여 band를확인한후 rpob 유전자분석할때와동일한방법으로염기서열분석을시행하였다. 4. REP-PCR 을이용한 ciprofloxacin 내성 A. baumannii의역학적연관성조사시발체로는 REP1 (5 -IIIGCGCCGICATCAGGC-3 ) 과 REP2 (5 -ACGTCTTATCAGGCCTAC-3 ) 로명명된장내세균의반복서열을이용하였다 [10]. 증폭반응은 DNA 추출액 (5.0 L), primer 각 20 pmol, AccuPower PCR PreMix (Bioneer) 및증류수를혼합하여총부피 50 L의반응용액을만들었다. GenePro Thermal Cycler B48D (Bioer Technology Corp.) 로 95 C에서 5분간반응시킨후, 90 C에서 40초, 42 C에서 1 분, 68 C에서 7분씩 35회증폭반응시키고, 68 C에서 15분간연장반응시켰다. 증폭산물 (10 L) 을 ethidium bromide가포함된 2% agarose gels에전기영동한후 Slite 140 Image System (Novusci, Bedfordshire, UK) 을이용하여 band패턴을분석하였다. Band의강도와상관없이 band의개수및분자량으로각균주를비교하였으며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [10]. 결과 1. Ciprofloxacin 내성 Acinetobacter species 의분리수집기간동안총 104 균주의 Acb complex에속하는 Acinetobacter species가분리되었는데 A. baumannii가 56 균주로가장많았으며 A. pittii가 28균주로그다음으로많았고 A. nosocomialis는 20균주가분리되었다. 한편임상검체종류에따라균종의분리빈도가다르게나타났는데객담검체에서는 A. baumannii가 (46/68) 압도적으로많이분리되었으며그다음으로 A. pittii가 (16/68) 많이분리되었다. 반면소변검체에서는 A. pittii가 (8/18) 가장빈번하게분리되었으며그다음으로 A. nosocomialis가 (6/18) 많이분리되었다. 기관지세척액검체에서는 Acb complex 에속하는 Acinetobacter species 가모두유사한빈도로분리되었다. 이균주들을대상으로 ciprofloxacin 에대한항균제감수성시험을한결과총 53균주즉 46균주 (82.1%) 의 A. baumannii, 4균주 (14.3%) 의 A. pittii, 그리고 3균주 (15.0%) 의 A. nosocomialis가 ciprofloxacin 에내성을가지고있는것이확인되었다 (Table 2). 또한시험기간동안분리된총 53 균주의 ciprofloxacin 내성 Acinetobacter species 중 49균주가다제내성을보였다. 한편정도관리를위해 E. coli ATCC 25922와 P. aeruginosa ATCC 균주도 Acinetobacter species 와동일한방법으로 9종류의항균제에대해감수성검사를시행하였다. 그결과 E. coli ATCC 25922의항균제억제영역의직경 (mm) 은각각 amikacin (23), gentamicin (24), aztreonam (32), cefepime (35), ceftazidime (31), ciprofloxacin (36), imipenem (30) 및 meropenem (32) 인것으로나타나모두허용범위내에들었다. P. aeruginosa ATCC 또한각항균제에대해억제영역의직경 (mm) 이 amikacin (24), gentamicin (20), aztreonam (26), cefepime (28), ceftazidime (26), ciprofloxacin (30), imipenem (26) 및 meropenem (32) 로모두허용범위내에드는것으로나타났다. 2. Quinolone 내성인자검출및분석총 53균주의 ciprofloxacin 내성 Acinetobacter species를대상으로 gyra 및 parc 유전자에돌연변이가있는지를확인하기위해중합효소연쇄반응과염기서열분석을수행한결과 A. baumannii 44균주, A. pittii 3균주, 그리고 A. nosocomialis 한균주로구성된총 48균주가 gyra 와 / 또는 parc 유전자에돌연변이를가지고있었다 (Table 2). 돌연변이가확인된 48균주의 Acinetobacter species 중 A. nosocomialis 한균주를제외한나머지 47 균주는 gyra와 parc 유전자모두에돌연변이를가지고있었다. 본연구에서확인된 gyra 및 parc 유전자돌연변이는염기의치환에의해 serine 잔기가 leucine 잔기로치환되는 sense mutation으로 gyra 유전자의 83번째아미노산 (serine) 과 parc 유전자의 80번째아미노산 (serine) 이 leucine 으로치환된돌연변이였다. 한편본연구에서는 53균주의 ciprofloxacin 내성 Acinetobacter species를대상으로 PMQR 유전자인 qnr, aac(6 )-1b-cr, qepa 및 oqxa 유전자의빈도를조사하기위해중합효소연쇄반응을시행하였으나양성반응을보인균주는하나도없는것으로나타났다. 3. Ciprofloxacin 내성 A. baumannii의유전형분석시험기간중분리된 46균주의 ciprofloxacin 내성 A. baumannii가같은클론에서유래되었는지를확인하기위하여 REP-PCR 을수행한결과총 7개의 band 패턴 (A, B, C, D, E, F 및 G형 ) 이확인되었다 (Figure 1). 분석대상이되었던 46 균주

5 Korean J Clin Lab Sci. Vol. 49, No. 4, December Table 2. Antimicrobial susceptibility patterns and characteristics of 53 Acinetobacter spp. isolated from clinical specimens in Chungcheong, Korea Isolate Acinetobacter spp. Antimicrobial susceptibility QRDR* mutations in AMK GEN AZT FEP CAZ CIP IPM MEM gyra parc PMQR genes R401 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R402 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R403 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R404 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R405 A. baumannii R R R R R R R R R406 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R407 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R409 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R410 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R501 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R502 A. baumannii S I R R R R R R Ser83Leu Ser83Leu - R503 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R504 A. baumannii S R R R R R R R Ser83Leu Ser83Leu - R505 A. baumannii S S R R R R R R Ser83Leu Ser83Leu - R506 A. baumannii S I R R R R R R Ser83Leu Ser83Leu - R507 A. baumannii S S R R R R S S Ser83Leu Ser83Leu - R508 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R509 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R510 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R511 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R512 A. baumannii S S R R R R I I Ser83Leu Ser83Leu - R601 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R602 A. baumannii R R R R R R R R R603 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R604 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R605 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R606 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R607 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R608 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R609 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R610 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R611 A. baumannii S S R I R R S I Ser83Leu Ser83Leu - R612 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R613 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R614 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R615 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R616 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R617 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R618 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R619 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R620 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R621 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R622 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R623 A. baumannii S S R R R R S S Ser83Leu Ser83Leu - R624 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - R625 A. baumannii R R R R R R R R Ser83Leu Ser83Leu - RP401 A. pittii R R R R R R R R RP402 A. pittii R R R R R R R R Ser83Leu Ser83Leu - RP403 A. pittii R R R R R R R R Ser83Leu Ser83Leu - RP404 A. pittii R R R R R R R R Ser83Leu Ser83Leu - SN603 A nosocomialis S R R S S R S S RN401 A nosocomialis R R R R R R R R Ser83Leu - - RN402 A nosocomialis R R R R R 4 R R aac(6 )-1b-cr, qepa 및 oqxa. Abbreviations: AMK, amikacin; GEN, gentamicin; AZT, aztreonam; FEP, cefepime; CAZ, ceftazidime; CIP, ciprofloxacin; IPM, imipenem; MEM, meropenem; S, susceptible; I, intermediate resistant; R, resistant. *Point mutations in the quinolone resistance-determining regions (QRDRs). Plasmid-mediated quinolone resistance (PMQR) genes: qnr,

6 432 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex Figure 1. Repetitive element sequence-based (REP)-PCR patterns of genomic DNA from forty-six ciprofloxacin resistant Acinetobacter baumannii isolates. Land SM is 1 kb DNA size marker. 중 5균주를제외한 41균주가 A형 (16균주), B형 (18균주), 또는 F형 (7균주) 의 band 패턴을보였다. 고찰 Acinetobacter속에속한종들은병원감염및기회감염을일으키는주된원인균으로다양한항균제내성인자를가지고있어병원환경에서내성유전자의확산에중요한역할을한다 [2]. 따라서 Acinetobacter 속에속한종들을대상으로한항균제내성연구는병원감염관리를위해매우중요하다. 본연구에서는환자로부터분리된 Acb complex에속하는균주를대상으로항균제감수성양상과 fluoroquinolone 항균제에대한내성기전조사하였으며 Acinetobacter 종간의차이점을비교분석하였다. 연구기간동안총 53 균주의 ciprofloxacin 내성 Acinetobacter species가임상검체로부터분리되었는데그중 86.8% 에해당하는 46균주가 A. baumannii였다. A. baumannii 균주의 ciprofloxacin 에대한항균제내성율은 82.1% 로 A. pittii 균주 (14.3%) 나 A. nosocomialis 균주 (15.0%) 보다 5배이상높았는데이전에아프리카 (82.4%) 와국내 (79.5%) 에서보고된연구결과와유사한내성율을보이고있다 [16,17]. 본연구에서분리된 A. pittii 및 A. nosocomialis 균주들의 ciprofloxacin 에대한내성율은 15.0% 이하로 A. baumannii 균주보다매우낮았는데유사한결과 ( %) 가이전에국내에서보고된바있다 [17]. 이상의결과에서 Acb complex에속하는 Acinetobacter 종들중 A. baumannii의분리빈도와 ciprofloxacin 에대한내성율이 non-a. baumannii에비해월 등하게높은것으로나타났는데이는 Acinetobacter 종들중주된병원감염균으로작용하고임상적으로매우중요한종이 A. baumannii 임을의미한다. 이전의국내외의많은연구자들은역시 Acinetobacter 종들중 A. baumannii 균주가기회감염및병원감염을일으키는주된원인균으로대부분의 A. baumannii 균주가다제내성을나타낸다고보고하고있다 [17-19]. Acinetobacter species가 fluoroquinolone 에내성을나타내는가장중요한기전중하나가 DNA gyrase 와 DNA topoisomerase IV의돌연변이이다. 특이 gyra 와 parc 유전자에모두돌연변이가일어나아미노산이치환될경우 fluoroquinolone 에고도내성을나타낸다고알려져있다 [19]. 본연구에서도수집된 53 균주의 ciprofloxacin 내성 Acinetobacter species 중 44균주의 A. baumannii와 3균주의 A. pittii 가 gyra 와 parc 유전자모두에돌연변이를가지고있는것이확인되었다. 이들은종에상관없이모두 serine 잔기가 leucine 잔기로치환되는 sense mutation을 gyra 유전자와 parc 유전자에포함하고있었다. 본연구에서확인된 serine 잔기의 leucine 잔기로의치환은이미 A. baumannii 균주를대상으로많은연구에서보고된바있다 [20,21]. 그러나 A. pittii 또는 A. nosocomialis 균주를대상으로한연구에서 gyra와 / 또는 parc 유전자에 sense mutation이있음을보고한연구는그동안거의없었다. 그러나본연구에서는 A. pittii 균주역시 A. baumannii 균주와마찬가지로 gyra와 parc 유전자모두에 sense mutation을가질경우 fluoroquinolone 에고도내성을보일수있음을확인하여의미가있었다. 한편본연구에서수집된 53 균주의 ciprofloxacin 내성 Acinetobacter species는 PMQR 유전자를포함하고있지않았는데이결과는 Acine-

7 Korean J Clin Lab Sci. Vol. 49, No. 4, December tobacter species 의 fluoroquinolone 내성과 PMQR 유전자의획득은크게관련성이없음을뒷받침하는것으로이전의 Acinetobacter species를대상으로한연구에서도 PMQR 유전자의검출빈도가매우낮거나검출되지않았다고보고하고있다 [22-24]. 본연구에서는총 44균주의 ciprofloxacin 내성 A. baumannii가분리되었는데이들을대상으로서로같은 clone에서유래했는지여부를알아보기위해 REP-PCR 을수행한결과분석대상이되었던 46 균주중 5균주를제외한 41균주가 A형, B 형, 또는 F형 band 패턴을보였다. 이러한결과는 ciprofloxacin 내성 A. baumannii 균주들이병원내에서수평확산되었음을의미한다. Ciprofloxacin 내성 Acb complex에속한균주의분리빈도가지속적으로증가하고있음에도불구하고충청지역에서분리된 Acinetobacter 균주의항균제감수성양상및 fluoroquinolone 내성기전에대한연구는상대적으로많지않았다. 본연구에서는충청지역에서분리된 Acb complex에속한균주를대상으로항균제감수성양상과 fluoroquinolone 내성기전을분석하였는데 A. baumannii가다른 Acinetobacter 종들에비해항균제내성율이높고다제내성을나타낼가능성이많은것으로나타났다. 또 Acinetobacter species의 fluoroquinolone 에대한내성은 PMQR 유전자의획득보다는 gyra 및 parc 유전자의돌연변이획득이더크게관련성이있는것으로나타났다. 한편다제내성 A. baumannii 균주가병원환경에지속적으로확산되고있음이확인되었는데이를방지하게위해서는지속적으로항균제내성을유발하는인자를조사하고내성세균의변화및확산양상을감시해야할것으로사료된다요약 Acinetobacter calcoaceticus-baumannii (Acb) complex 에속한종들은빈번하게병원감염및기회감염을일으킨다. 또한다제내성인경우가많아이균들의감염증치료를위한항균제선택이매우제한적이다. 본연구에서는 ciprofloxacin 내성 Acinetobacter species 53균주를대상으로 fluoroquinolone 내성기전을조사했다. 항균제감수성양상을조사하기위해디스크확산법이시행되었다. Fluoroquinolone 내성과관련된유전자및돌연변이검출을위해 PCR과염기서열분석이이루어졌다. 본연구에서수집된 53균주의 ciprofloxacin 내성 Acinetobacter 중 47균주가 gyra 유전자의 83번째 serine 아미노산잔기와 parc 유전자의 80번째 serine 아미노산잔기가 leucine 잔기로치환된 sense mutations 가지고있는것으로나타났다. gyra와 parc 유전자에 sense mutations을가지고있는 47균주중 44균주가 A. baumannii 였고 3균주는 A. pittii 였다. 본연구에서조사대상이되었던 Acb complex 균주들중 plasmid-mediated quinolone resistance (PMQR) determinants를가지고있는균주는한나도없었다. 46 균주의 ciprofloxacin 내성 A. baumannii 는 A, B, 또는 F형의 banding pattern을보였는데이는충청지역에위치한일개의병원에 ciprofloxacin 내성 A. baumannii가수평확산되어있음을의미한다. Fluoroquinolone 내성 Acb complex 균주의집락화및확산을막기위해서다제내성균주들을대상으로항균제내성인자들을지속적으로조사하고모니터링할필요가있을것으로사료된다. Acknowledgements: This work was supported by the 2017 Far East University Research Grant (FEU2017R02). Funding: None Conflict of interest: None REFERENCES 1. Sung JY. Clonal dissemination of multidrug resistant Acinetobacter baumannii isolates harboring bla OXA-23 at One University Hospital in Daejeon, Korea. Korean J Clin Lab Sci. 2016;48(2): La Scola B, Gundi VA, Khamis A, Raoult D. Sequencing of the rpob gene and flanking spacers for molecular identification of Acinetobacter species. J Clin Microbiol. 2006;44(3): Srinivasan VB, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann Clin Microbiol Antimicrob. 2009;8: Vila J, Ruiz J, Goni P, Jimenez de Anta T. Quinolone-resistance mutations in the topoisomerase IV parc gene of Acinetobacter baumannii. J Antimicrob Chemother. 1997;39(6): Jacoby GA. Mechanisms of resistance to quinolones. Clin Infect Dis. 2005;41(Suppl 2): Nordmann P, Poirel L. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J Antimicrob Chemother. 2005;56(3): Jiang X, Yu T, Jiang X, Zhang W, Zhang L, Ma J. Emergence of plasmid-mediated quinolone resistance genes in clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa in Henan, China. Diagn Microbiol Infect Dis. 2014;79(3): Touati A, Brasme L, Benallaoua S, Gharout A, Madoux J, De Champs C. First report of qnrb-producing Enterobacter cloacae and qnra-producing Acinetobacter baumannii recovered

8 434 Ji Youn Sung. Fluoroquinolone Resistance of Acb Complex from Algerian hospitals. Diagn Microbiol Infect Dis. 2008; 60(3): Lim J, Lee G, Choi Y, Kim J. An analysis of the antibiotic resistance genes of multi-drug resistant (MDR) Acinetobacter baumannii. Korean J Clin Lab Sci. 2016;48(3): Bou G, Cerveró G, Domínguez MA, Quereda C, Martínez- Beltrán J. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and meropenem-resistant Acinetobacter baumannii. Clin Microbiol Infect. 2000; 6(12): CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Sixteenth Informational Supplement. CLSI document M100-S20. Wayne, Pennsylvania: Clinical and Laboratory Standards Institute; 2010, p Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol. 2008;46(8): Cattoir V, Poirel L, Rdotimi V, Soussy CJ, Nordmann P. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother. 2007;60(2): Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6')-ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006;50(11): Li J, Wang T, Shao B, Shen J, Wang S, Wu Y. Plasmid-mediated quinolone resistance genes and antibiotic residues in wastewater and soil adjacent to swine feedlots: potential transfer to agricultural lands. Environ Health Perspect. 2012;120(8): Khorsi K, Messai Y, Hamidi M, Ammari H, Bakour R. High prevalence of multidrug-resistance in Acinetobacter baumannii and dissemination of carbapenemase-encoding genes bla OXA-23-lik, bla OXA-24-like and bla NDM-1 in Algiers hospitals. Asian Pac J Trop Med. 2015;8(6): Park YK, Jung SI, Park KH, Kim DH, Choi JY, Kim SH, et al. Changes in antimicrobial susceptibility and major clones of Acinetobacter calcoaceticus-baumannii complex isolates from a single hospital in Korea over 7 years. J Med Microbiol. 2012;61(Pt 1): Koo SH, Kwon KC, Cho HH, Sung JY. Genetic basis of multidrug-resistant Acinetobacter baumannii clinical isolates from three university hospitals in Chungcheong province, Korea. Korean J Lab Med. 2010;30(5): Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH. Phenotypic and molecular characterization of Acinetobacter baumannii clinical isolates from nosocomial outbreaks in Los Angeles County, California. J Clin Microbiol. 2008;46(8): Güler G, Eraç B. Investigation of fluoroquinolone resistance mechanisms in clinical Acinetobacter baumannii isolates. Mikrobiyol Bul. 2016;50(2): Lee JK, Lee YS, Park YK, Kim BS. Mutations in the gyra and parc genes in ciprofloxacin-resistant clinical isolates of Acinetobacter baumannii in Korea. Microbiol Immunol. 2005; 49(7): Yang H, Hu L, Liu Y, Ye Y, Li J. Detection of the plasmid-mediated quinolone resistance determinants in clinical isolates of Acinetobacter baumannii in China. J Chemother. 2016;28(5): Gu DX, Hu YJ, Zhou HW, Zhang R, Chen GX. Substitutions of Ser83Leu in GyrA and Ser80Leu in ParC Associated with Quinolone Resistance in Acinetobacter pittii. Microb Drug Resist. 2015;21(3): MJ Jiang, Sh P Zhao, J M Li, FS Zhang. Molecular epidemiological study and detection of multi-drug resistant Acinetobacter baumannii -related resistance genes. African J Mirobiol Reser. 2013;7(48):

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662