저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

Save this PDF as:

Size: px
Start display at page:

Download "저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할"


1 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우, 이저작물에적용된이용허락조건을명확하게나타내어야합니다. 저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다. 이것은이용허락규약 (Legal Code) 을이해하기쉽게요약한것입니다. Disclaimer

2 의학박사학위논문 최대무독성용량보다저용량의 bisphenol A 가생쥐의간과당대사에 미치는영향 2016 년 2 월 서울대학교대학원 의학과분자유전체의학전공 정인경

3 최대무독성용량보다저용량의 bisphenol A 가생쥐의간과당대사에 미치는영향 지도교수박경수 이논문을의학박사학위논문으로제출함 2015 년 10 월 서울대학교대학원 의학과분자유전체의학전공 정인경 정인경의의학박사학위논문을인준함 2015년 11월 위원장 ( 인 ) 부위원장 ( 인 ) 위 원 ( 인 ) 위 원 ( 인 ) 위 원 ( 인 )

4 국문초록 Bisphenol A(BPA) 는가장많이사용되는화학물질중하나로인간이노출되는정도는미량이지만평생동안지속적으로노출되고체내에누적되면문제가나타날수있다. 최근 BPA가생식기계부작용외에도다른장기에독성효과및여러대사장애를유발할수있다는연구결과들이보고되고있다. 오래되고민감하지못한방법으로시행된동물실험결과를바탕으로결정된 BPA의최대무독성용량은 5 mg/kg/day이며예측된하루허용용량은 50 μg/kg/day으로되어있다. 그러나이용량들에서부작용이생기지않고정말로안전한지에대해의문이제기되고있다. 우리몸의대사와해독작용에가장중요한역할을하는간에서, 최대무독성용량보다적은양의 BPA가간손상을유발하는지확인하고자 50 μg/kg/day과 1.2 mg/kg/day의 BPA를복강내로 5일간주사후관찰하였다. 간무게나간효소수치는두군당차이가없었으나미토콘드리아의산소소모율과호흡사슬복합체 III와 V의발현감소가 1.2 mg/kg/day에서관찰되었고두용량모두에서간세포내미토콘드리아의구조가손상되었다. 산화스트레스의지표인 malondialdehyde는 1.2 mg/kg/day에서유의한증가를보였고, 전염증성사이토카인인 interleukin 6와 tumor necrosis factor-α는혈중및간내발현이증가함을확인하였다. 또한항산화효소인 glutathione peroxidase 3의간조직내발현은두용량모두에서감소되었다. HepG2 세포에서도 10 nm 또는 100 nm의 BPA를처리시미토콘드리아의산소소모율, APT합성, 미토콘드리아막전압이감소함을확인하였다. 요약하면 BPA는최대무독성용량보다적은 i

5 양에서도간내미토콘드리아의기능장애를유발하며이는산화스트레스나전염증성사이토카인의증가와연관되어있음을확인하였다. 미토콘드리아기능저하와산화스트레스, 염증인자상승등은인슐린저항성과매우밀접한연관이있다. 하루허용용량인 50 μg/kg/day의 BPA를 12주동안경구투여하였을때당대사에어떤영향을미치는지, 고지방식이가 BPA의작용에어떤영향을미치는지알아보고자하였다. 동물은정상식이군, 정상식이와 BPA군, 고지방식이군, 고지방식이와 BPA군의 4 그룹으로나누어실험을진행하였다. 정상식이군에서는 BPA 투여여부에따라혈당에큰차이가없었으나고지방식이군에서는 BPA 투여시당불내인성이악화되는소견을보였다. 복강내당부하검사를시행하였을때, 곡선아래면적 (area under the curve, AUC) 이고지방식이와 BPA를투여한군이 mm/min로고지방식이만투여한군의 mm/min에비해유의하게증가된것을관찰하였으나 (P=0.027). 몸무게, 전신지방량, 백색지방조직의비율은큰차이가없었다. BPA를투여한고지방식이군의경우골격근에서 Thr308 위치에서 Akt 인산화와 Ser9 위치에서 glycogen synthase kinase 3 beta(gsk-3β) 의인산화가감소되어있는것을확인하였다. 반면췌장도세포면적이나췌장내인슐린함량은큰차이가없었다. 요약하면하루허용용량의 BPA를출생후시기의생쥐에 12주간경구투여하였을때고지방식이군에서당불내인성이더악화되었고이는골격근의 Akt 인산화및 GSK-3β 인산화감소로인슐린신호전달체계가교란되어생기는인슐린저항성증가가한 ii

6 기전으로작용하였을것으로생각된다. 결론적으로, BPA는최대무독성용량보다적은양에서도간내미토콘드리아의기능장애를유발하고산화스트레스를증가시키며 안전하다 고되어있는하루허용용량에서도고지방식이와동반될경우당불내인성을악화시키고인슐린저항성을유발하였다. 이에 BPA의최대무독성용량및하루허용용량에대한합리적인조정이필요할것으로생각된다. 주요어 : Bisphenol A, 최대무독성용량, 미토콘드리아기능이상, 산화 스트레스, 하루허용용량, 당불내인성, 인슐린저항성 학번 : iii

7 List of Tables Table 1.1. Estimates of daily bisphenol A intake from food List of Figures Figure 1.1 Measurement of oxygen consumption rate in isolated mitochondria Figure 1.2 Mitochondrial structure and function in the mouse liver treated with bisphenol A (1.2 mg/kg/day) for 5 days Figure 1.3 Serum AST and ALT levels after a single injection of 1.2 mg/kg/day of bisphenol A Figure 1.4 Changes in the levels of oxidative stress and inflammatory cytokines at 1, 6 and 24 hr after a single injection of bisphenol A (1.2 mg/kg/day) Figure 1.5 Changes of the level of MDA and antioxidant enzymes in the mouse liver treated with bisphenol A (1.2 mg/kg/day) for 5 days Figure 1.6 Mitochondrial structure and function in the mouse liver treated with bisphenol A (50 μg/kg/day) for 5 days iv

8 Figure 1.7 Changes of ATP production and reactive oxygen species (ROS) in HepG2 cells according to dose and duration of bisphenol A treatment Figure 1.8 Mitochondrial structure and function in HepG2 cells treated with bisphenol A Figure 2.1 Long-term exposure to bisphenol A had no effect on body weight or fat mass Figure 2.2 Long-term exposure to bisphenol A aggravated glucose intolerance in mice that received a high-fat diet Figure 2.3 Long-term exposure to bisphenol A impaired insulin signaling in skeletal muscle Figure 2.4 Long-term exposure of bisphenol A did not change the hepatic expression of phosphoenolpyruvate carboxykinase and glucose-6 phosphatase nor the expression of phosphofructokinase and glycogen synthase in skeletal muscle Figure 2.5 Bisphenol A does not increase serum interleukin 6 and tumor necrosis factor α levels nor decrease serum adiponectin levels 56 Figure 2.6 Deoxyglucose uptake and Akt phosphorylation in L6 cell were not affected by bisphenol A treatment Figure 2.7 Long-term exposure to bisphenol A did not induce any detrimental v

9 changes in the islet cell area or morphology or the insulin content of pancreas Figure 2.8 Effect of bisphenol A on glucose stimulated insulin secretion and ROS production over time in INS-1 cells treated with 50 nm bisphenol A vi

10 List of abbreviations and symbols ALT AST BPA CD COX2 DHE DXA EPA FCCP FDA GMN GMD GMcD GMcDS Alanine transaminase Aspartate transaminase Bisphenol A Chow diet Cytochrome c oxidase subunit II Dihydroethidium Dual-energy X-ray absorptiometry Environmental Protection Agency Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone Food and Drug Administration Glutamate + Malate Glutamate + Malate + ADP Glutamate + Malate + ADP + Cytochrome C Glutamate + Malate + ADP + Cytochrome C + Succinate GPX3 Glutathione peroxidase 3 G6Pase GS GSIS GSK-3β GTT HFD Glucose 6-phosphatase Glycogen synthase Glucose stimulated insulin secretion Glycogen synthase kinase 3 beta Glucose tolerance test High fat diet IL-6 Interleukin 6 IKK-β IPGTT IkappaB kinase beta Intraperitoneal glucose tolerance test IRS-1 Insulin receptor substrate 1 vii

11 JNK LOAEL MDA MMP c-jun NH2-terminal kinase Lowest observed adverse effect level Malondialdehyde Mitochondrial membrane potential NDUFS4 NADH dehydrogenase ubiquinone Fe-S protein 4 NF- κb NOAEL PBS PEPCK PFK PKC PVDF RIA ROS Rot SDHB SDS TBS TDI TNF- α TBARS Nuclear factor kappa-light-chain-enhancer of activated B cells No observed adverse effect level Phosphate buffered saline Phosphoenolpyruvate carboxykinase Phosphofructokinase Protein kinase C polyvinylidene difluoride Radioimmunoassay Reative oxygen species Rotenone Succinate dehydrogenase [ubiquinone] iron-sulfur subunit Sodium dodecyl sulfate Tris-buffered saline Tolerable daily intake Tumor necrosis factor α Thiobarbituric acid reactive substance UQCRC2 Ubiquinol-cytochrome c reductase core protein 2 WAT WHHL White adipose tissue Watanable heritable hyperlipidemic viii

12 목차 국문초록 i 표목록과그림목록 iv 약어목록 vii 목차 ix 제 1 장. 최대무독성용량보다저용량의 bisphenol A 투여가생쥐의간에미치는영향서론 연구재료및방법 연구결과 고찰 제 2 장. 하루허용용량의 bisphenol A 12주경구투여가생쥐의당대사에미치는영향서론 연구재료및방법 연구결과 고찰 참고문헌 영문초록 감사의글 ix

13 제 1 장. 최대무독성용량보다저용량의 bisphenol A 투여가생쥐의간에미치는영향 1

14 서론 환경성내분비계교란물질 (environmental endocrine disruptor) 이란환경중으로배출된화학물질이체내에유입되어마치호르몬처럼작용을나타낸다고하여환경호르몬이라고불리기도하는데, 내분비계의정상적인기능을방해하는화학물질로정의될수있다 (WHO, 2002). 환경성내분비계교란물질은대부분생물에의해잘분해되지않기때문에환경속에장기간잔류하여생물체내에축적되고생태계의상위포식자일수록체내에누적되어더욱큰문제를야기할수있다. 실제로환경성내분비계교란물질은생태계및인간의호르몬계에영향을미쳐생식기능저하, 기형과같은생식계이상, 뇌와행동장애, 각종암, 면역기능장애와성장장애등을유발하여 (Harrison 등, 1995) 전세계적으로생물종에위협이될수있다는경각심으로오존층파괴, 지구온난화문제와함께세계 3대환경문제로등장하였다. 우리주변은수많은종류의환경성내분비계교란물질로오염되어있어미국, 일본등선진국은지난 1995년부터이에대해본격적인대응을시작하였다. 과거일본환경청은 67종을, 미국 Environmental Protection Agency(EPA) 는 69종을우려물질로지정하였으나시간이지날수록그숫자는점점늘어날것으로생각된다. 환경성내분비계교란물질중특히우리생활에매우밀접한것으로서, 식당이나가정에서사용하는플라스틱식기및젖병, 캔음료에서나오는 bisphenol A(BPA) 를들수있다. BPA는아세톤과페놀의농축으로만들어지며플라스틱의일종인 polycarbonate, epoxy resin의원료가된다. Polycarbonate는열에강하고파손되지않는 2

15 " 유리 " 로서물병, 생수통, 아기젖병, 식기, 컵, CD, 스포츠용보호장비, 치과치료의재료및렌즈등에사용되며환상의신소재로각광받고있다. Epoxy resin도기계적, 화학적물성이아주뛰어나토목, 건축, 전기, 도료, 보호도장등많은분야에쓰이고있으며특히식품이나음료캔내부의코팅제로많이사용되고있다. 2009년보고에따르면전세계적인 BPA의생산은 2.2백만톤으로가장많이사용되는화학물질중하나이며연간수요증가율이 6~10% 에이른다고한다 (Burridge, 2003). BPA는음식과함께경구로흡수되는것이가장흔하지만공기흡입이나피부접촉을통해서도흡수될수있다 (Burridge, 2003). 도처에산재하는 BPA에인간이얼마나노출되어있는지살펴보았을때 1988~1994년에채취한미국성인 95% 의소변에서, 2003~2004년에아동과성인대상으로검사했을때 93% 의소변에서 BPA가발견되었고 (vom Saal 등, 2005; Calafat 등, 2008; Lang 등, 2008) 사람혈청내 BPA는약 0.2~1.6 ng/ml으로존재한다고보고된바있다 (Sajiki 등, 1999). 하루에인간이섭취하는 BPA의양이대략어느정도인지살펴보면표1과같다 (Willhite 등, 2008). BPA는쥐에서경구섭취시반수치사량 (Lethal dose 50) 이 3250 mg/kg/day로높아급성독성의위험은적지만, 내분비계교란물질의하나이기에저용량이라도만성적으로노출되면체내에악영향을미칠것으로생각되고있다. 미국 EPA는, 1980년대에고용량의 BPA를이용하여덜민감한방법으로시행된연구들에근거하여 LOAEL(lowest observed adverse effect level) 을 50 mg/kg/day로정하고이를기준으로 3개의불확실성인자 ( 예민한인간에서역치의 3

16 Table 1.1 Estimates of Daily Bisphenol A Intake from Food Human age Application Daily ingestion (mg/d) Infants (1-2 mo) Feeding bottles Infants (4-6 mo) Feeding bottles 0.05 Young children ( yr) Tableware 0.01 Infants (6-12 mo) Epoxy resin food contact 0.04 Young children Epoxy resin food contact 0.2 Adults Epoxy resin food contact 0.1 Adults Wine stored in epoxy lined vats 0.5 Source: Willhite et al. (2008) 4

17 불확실성, 동물실험결과를인간에적용하면서생기는동물종간차이에의한불확실성, 노출기간의불확실성 ) 마다 10을부여해, 이들의곱인 1000으로 LOAEL을나누어 50 µg/kg/day를하루허용용량 (tolerable daily intake, TDI) 으로예측하여제시하면서 BPA를 해롭지않은물질 로정하고있다 (EPA, 1998). 그러나 1997년저용량 BPA의부작용이동물실험에서규명되면서 (vom Saal 등, 2005; Welshons 등, 2006; Wetherill 등, 2006; Dairkee 등, 2008) 수많은연구가시행되었고, Alonso-Magalena 등 (2006) 은 LOAEL의 5000분의 1의용량을생쥐에주었을때포도당대사장애를유발함을보여 TDI보다낮은용량의 BPA 노출에서도부작용이생길수있음을확인하였다. 그러나미국 FDA는, 최근에시행된이런연구결과들을배제하고오래된, 특히화학산업단체의기금으로실험된논문에근거하여 NOAEL을 5 mg/kg/day로정하고 BPA가해롭지않다는결론을내렸다하여많은비판을받고있다. BPA는처음발견된내분비계교란물질인 diethylstilbestrol과비슷한구조를가지며결합력은 1:1000 정도로낮으나대개의경우 estrogen receptor α, β에결합하여작용을나타낸다. 따라서 BPA의부작용은여성호르몬효과와크게연관되어있으며 (Hiroi 등, 1999; Kurosawa 등, 2002) 주로생식기계장애를유발하는것으로알려져있었다 (Takeuchi 등, 2004). 그러나최근 BPA가전염증성사이토카인 (Wetherill 등, 2007; Ben-Jonathan 등, 2009) 이나산화스트레스 (Nakagawa 등, 2000; Bindhumol 등, 2003; Asahi 등, 2010; Hassan 등, 2012) 를증가시킬수있다는연구결과들이보고되면서, BPA의여성호르몬효과와는다른기전으로써새로운독성과 5

18 대사장애를유발할수있다는가능성이제시되었다. 세포는 DNA, 지질, 단백질등과활성산소종 (reactive oxygen species, ROS) 사이의상호작용으로발생하는손상을항산화효소를통해최소화하는시스템을가지고있다. 그러나항산화효소의이상이나항산화시스템을초과하는과도한 ROS의생성으로인한불균형은결국대사장애를포함하는여러가지질병을유발하기도한다 (Benhar 등, 2002; Golden 등, 2002; Agarwal 등, 2003; Rego and Oliveira, 2003). 세포내에서미토콘드리아는산화적인산화에의해체내에필요한 ATP를생산함으로써세포내에너지대사에핵심적인역할을수행하지만 ROS를생성하여세포사멸을유도하기도한다. 이런미토콘드리아에이상이생기면 ROS가과도하게만들어질수있고반대로 ROS가산화적독성을일으켜미토콘드리아의기능장애를유발하기도한다. 따라서산화스트레스를증가시키는 BPA 또한에너지대사의근간이되는미토콘드리아의기능장애를유발하여체내에영향을미칠가능성이높으나이에대한연구결과가많지않다. 간은우리몸의각종대사와 BPA를포함한각종생체이합물질들의해독작용을담당하는주요장기이다. 따라서다른장기에비해간은 BPA에더많이노출되고더쉽게손상을입을수있다. 실제로인간에서소변 BPA 농도와간기능이상이연관되어있다는연구결과 (Lang 등, 2008) 와, 쥐실험에서고용량의 BPA가간무게를감소시키고 (Tyl 등, 2008) 간효소의상승으로독성효과를보이며 (Hassan 등, 2012), 쥐의간세포를 BPA에노출시키면노출농도와시간에비례하여생존력이 6

19 줄어든다 (Nakagawa 등, 2000) 는연구결과들이이를뒷받침하고있다. 그러나미국 FDA에서제시하는 NOAEL인 5mg/kg/day 이하의용량에서도간에부작용이생기는지그리고산화스트레스나미토콘드리아의기능에어떤영향을미치는지에대해서는잘알지못한다. 현재까지 BPA에대한연구는여성호르몬과비슷한작용으로, 임신중이거나수유중인모체에노출시자손에게생기는성호르몬이나생식기계부작용에집중되어있었다. 그러나최근발표되는연구들에서 BPA가생식기이외의장기에도독성효과가있으며간기능장애, 비만, 당뇨병, 인슐린저항성과같은만성질환과연관성이있다는결과가보고되었고그기전에대해서는여성호르몬작용외에다른효과가있을것으로추정되고있다. 따라서본연구에서는태중이나수유기가아닌출생후시기의쥐에서 NOAEL보다낮은용량의 BPA에노출될경우간에어떤영향을미치는지산화스트레스와미토콘드리아를중심으로살펴보고자하였다. 7

20 연구재료및방법 1. 연구재료 1) 사용약제 Bisphenol A는 Sigma(St. Louis, Mo, USA) 에서구입하여사용하였고그순도는 99% 이상이었으며 30% 에탄올소량에녹인후물에희석하여실험에적합한농도로만들어사용하였다. 2) 실험동물가. BPA를 24시간간격으로 5일간복강내주사 NOAEL보다낮은 BPA에단기간노출후나타나는급성기변화를관찰하기위해실험을진행하였다. 3주령의수컷 C57BL/6 쥐를한국오리엔트사에서구입하여실험에사용하였다. 모든쥐는실험전최소 1주간실험환경에적응과정을거친후 3개의그룹으로나뉘어졌다. 첫번째군은대조군으로서생리식염수를, 두번째군은 NOAEL보다는낮지만 TDI보다는높은 1.2 mg/kg/day의 BPA를, 마지막한군은 TDI용량인 50 µg/kg/day의 BPA를사용하여 24시간간격으로 5일간복강내주사하였다. 우리당 5마리씩의쥐를사용하였고실험은 2009년부터 2010년까지최소 3번반복하였다. 모든쥐는적정온도 (23 ± 2 ), 적정습도 (60 ± 10%) 및정기적인공기순환시스템이갖춰진동물실험실에서 12시간밤낮의주기로사육하였다. 식이는정상식이로 3.6 Kcal/g, 대략단백질 21%, 지방 8

21 12.5% 와탄수화물 66.5% 로구성되었고관찰기간동안사료와물은제한없이공급하였다. 실험종료전 8시간동안금식하였고마취후희생시켜실험하였다. 나. BPA 1.2 mg/kg를 1회주사하고 1, 6, 24시간째관찰위의실험과별개로 BPA 투여직후 24시간동안시간경과에따라체내에미치는영향을관찰하기위해 1.2 mg/kg/day의 BPA를복강내주사후 1, 6, 24시간에희생시켜실험을진행하였다. 쥐는각군당 5마리씩사용하였고실험은 2회반복하였다. 모든동물실험은실험동물의관리와사용에관한표준지침을 따랐으며분당서울대학교병원동물실험윤리위원회의승인을받아 진행하였다 ( 승인번호 BA /021-01). 3) 세포주 HepG2 세포는 37, 95% 공기와 5% CO 2 상태에서숯처리된 10% 우태아혈청, 10 mm HEPES (ph 7.4), 10.2 mm L-glutamine, 50 mm sodium pyruvate, 2.5 mm β-mercaptoethanol, streptomycin(0.1 mg/ml) 과 penicillin(100 U/ml) 를포함하는페놀레드가들어있지않은 Roswell Park Memorial Institute (RPMI)-1640 배지 (Invitrogen, Carlsbad, CA, USA) 에서전배양하였다. 2. 연구방법 1) 혈중생화학검사및사이토카인측정 9

22 혈중 aspartate transaminase(ast) 와 alanine transaminase(alt) 는 Beckman Coulter AU480 automatic biochemistry analysis system(brea, CA, USA) 을이용하여측정하였다. Interleukin 6(IL-6) 와 tumor necrosis factor α(tnf-α) 는 radioimmunoassay kit(linco, St. Charles, MO, USA) 를 이용하여제조사의프로토콜에따라측정하였다. 2) 전자현미경관찰간실질과미토콘드리아와같은미세구조물의구조적변화를전자현미경을통해관찰하였다. 간실질은적출즉시 1x1 mm의크기로최소한의압력으로신속히절단하여산소와의접촉을최소화하면서 0.1 M 인산염완충액 (ph 7.2) 에녹인 2.5% 글루타르알데히드에담궈 4 에두었다. 이후샘플은다시상온에서 0.1 M 인산염혹은카코딜산염완충액 (ph 7.2) 에녹인 1% 사산화오스미움에서 1.5시간의후-고정과정을거쳤다. 검체는물로세척후 50, 60, 70, 80, 90과 100% 에탄올로탈수과정을거치고 propylene oxide(acros Organics, Morris Plains, NJ, USA) 와 EPON epoxy resin(electron Microscopy Polysciences, Hatfield, PA, USA) 에침윤시켰다. Epoxy resin에묻어고정시킨검체는캡슐에넣어 38 에서 12시간, 60 에서 48시간동안중합과정을거친후초미세절단기 (RMC MT- XL, RMC products, Tucson, AZ, USA) 로약 50 nm 두께로절단하여구리그리드에수집하여 4% 우라닐아세테이트와 4% 초산납으로염색하여전자현미경 (JEM-1400; Japan) 으로 x15000와 x50000 배율에서각각관찰하였다. 10

23 3) 미토콘드리아기능평가가. 미토콘드리아의산소소모율측정간조직과 HepG2 세포에서전자전달계를통한산소소모율을 Oxygraph-2k(Oroboros, Innsbruk, Austria) 를이용하여측정하였다. 간조직이나 HepG2 세포에서 Oroboros사에서제시하는 protocol을이용하여미토콘드리아를분리하고 MiRO5 용액 (0.5 mm EGTA, 3 mm MgCl2 6H2O, 60 mm K-lactobionate, 20 mm taurine, 10 mm KH2PO4, 20 mm HEPES, 110 mm sucrose, 1 g/l BSA essentially fatty acid free, ph 7.1) 에부유시켜 1시간정도안정화시켰다. 이후미토콘드리아 200 µg을 2 ml의 MiRO5 용액으로채워진 chamber에넣고신호가안정화될때까지기다린후 Hamilton 주사기를이용하여기질과억제제를넣어주면서실험을진행시켰다. 신호가안정화된상태에서미토콘드리아복합체 (complex) I의기질인 2 M glutamate 10 µl( 최종농도 10 mm) 와 0.8 M malate 5 µl( 최종농도 2 mm) 를넣어주어 oxygen flux를측정하고, 항정상태에도달하면 0.5 M ADP 4-20 µl( 최종농도 1-5 mm) 를넣어주고 oxygen flux를측정하였다. 이후미토콘드리아외막의손상여부를보기위해 4 mm cytochrome c 5 µl( 최종농도 10 µm) 를넣어준후 oxygen flux에변화가있는지관찰하였다 (cytochrome c test: 외막이파괴된경우복합체 III에붙어있던 cytochrome c가떨어져나가산화적인산화과정에제한이생기게되는데이때 cytochrome c를넣어주면산화적인산화과정이회복되어산소소모율이상승하게된다. 그러나미토콘드리아의외막의파괴가없는경우 oxygen flux는변화가없다 ). 이후복합체 II의기질인 1 M succinate 10 µl( 최종농도 10 mm) 를넣어주고 oxygen 11

24 flux를측정하고 1 mm의 carbonylcyanide p-triflouromethoxyphenylhydrazone(fccp) 을 1 µl( 최종농도 µm) 씩 oxygen flux가더이상증가하지않을때까지적정하면서넣어준후 oxygen flux를측정하였다. FCCP는 uncoupler로서외막에있는 porin을통해막사이공간에있는양전자를외막밖으로방출시키는작용을한다. 산화적인산화과정은막사이공간과기질사이에발생되는양전자의농도차와전압차를이용하는 ATP합성효소에의해제한을받게되는데 FCCP를이용하여막사이공간의양전자를고갈시키면미토콘드리아복합체들은이런제한에서벗어나최대역량을발휘하게된다. 이후복합체 I의억제제인 1 mm rotenone 1 µl( 최종농도 0.5 µm) 를 chamber에넣고신호가안정화될때까지기다려복합체 II에의한 oxygen flux를측정하였다. 그리고복합체 III 나 IV 억제제인안티마이신 A나올리고마이신을넣어주어기저상태에서의비사립체호흡 (non-mitochondrial respiration) 을측정하였다. 각과정에의해측정된 oxygen flux의변화는그림 1.1과같이관찰할수있다. Oxygen flux는 picomoles of oxygen consumed/(s*ml of mitochondrial suspension) 으로나타내었다. 나. ATP 및미토콘드리아막전압 (mitochondrial membrane potential, MMP) 측정 1 ATP 농도측정 ATP는세포생존능의표지자이며세포가세포사멸이나괴사로죽게되면농도가급격히떨어진다. 세포내 ATP 생산은 luminescence ATP detection assay kit(perkinelmer, Waltham, MA, USA) 를사용하였다. 이는세포내 ATP 가첨가된 luciferase 와 D-luciferin 에반응하여 12

25 발광하는원리로 ATP 농도를측정하는것이다. 96 well 평판을사용하며 1x10 4 개의세포를 200 µl well 에넣어주고밤새배양시킨후배지를흡인해내고 PBS 로 2 회세척해주었다. 이후각 well 에 100 µl 의 PBS 를넣어주고 50 µl 의세포용해용액을넣어오비탈쉐이커를이용하여 700 rpm 에서 5 분, 50 µl 의기질용액을추가하고다시 700 rpm 에서 5 분간흔들어주었다. 10 분간암실에적응시킨후마이크로플레이트판독기 (Wallac Victor3V 1420 Multilabel Counter; PerkinElmer) 에넣어주고발광을 counts per second(cps) 의단위로측정하였다. BPA 를처리한군의 CPS 를대조군의 CPS 값으로나누어 relative ATP level 을계산하였다. 2 미토콘드리아막전압측정미토콘드리아막전압은 JC-1(5,5,6,6 -tetrachloro 1,1,3,3 -tetraethylbenzimidazolylcarbocyanine Iodide)(Invitrogen) 의적색형광을측정하여구한다. JC-1은 cationic carbocyanine dye로전위에의존적으로미토콘드리아안에축적된다. 저농도에서 J monomer 상태로녹색형광을내고고농도에서는 J aggregates를형성해서적색형광을나타낸다. 적색과녹색의형광발색비율이미토콘드리아막전압을나타내는척도가되며형질막전위에대비해미토콘드리아막전압을특이하게나타낸다. 96-well 평판에 1x10 4 개의세포를 200 μl well에넣어주고밤새반응시킨후배지를흡인하고 2 μm JC-1이들어있는배지 200 μl를넣어주었다. 37 에서 2 시간동안둔후배지를흡인하고 PBS로 4-5회세척해주었다. 이후적색의형광 (excitation/emission 535/590 nm) 과녹색의형광 (excitation/emission 485/535 nm) 을마이크로플레이트판독기 (Wallac Victor3V

26 Figure 1.1 Measurement of oxygen consumption rate in isolated mitochondria Oxygen concentration ([µm], blue line) and oxygen flux per unit volume of mitochondrial suspension ([pmol s -1 ml-1 ], red lines) are displayed. Respiratory state: GMN, glutamate+malate without ADP; GMD, glutamate+malate with ADP; GMcD, GMD with cytochrome c; GMcDS, glutamate+malate+succinate with ADP; FCCP, uncoupled respiratory state by FCCP; Rot, inhibited complex I with rotenone; RotAma, non-mitochondrial basal respiration by inhibition with rotenone & antimycin A. G, glutamate; M, malate; D, ADP; c, cytochrome c; S, succinate; F, FCCP; Rot, rotenone; Ama, antimycin A. 14

27 Multilabel Counter; PerkinElmer) 에넣어주고측정하였다. 미토콘드리아 막전압은녹색형광에대한적색형광의비 (J aggregates : J monomers) 로표시하였다. 4) 단백질정량간조직은용해완충액 (Cell Signaling Tech., Davers, MA, USA) 을이용하여균질화시킨후단백질측정키트 (Pierce Biotechnology, Rockford, IL, USA) 를이용하여측정하였다. 각검체에서동량 (12 µg) 의단백질을 62.5 mm Tris-Cl (ph 6.8), 2% sodium dodecyl sulfate (SDS), 5% 2-mercaptoethanol, 13% glycerol과 0.013% bromophenol blue를함유한겔부하완충액에섞은후 25 mm Tris, 250 mm glycine, 0.1% SDS를함유한전기영동완충액에담긴 9% SDSpolyacrylamide 겔에부하하여전기영동을시행하였다. 전기영동이끝난겔의단백질은 25 mm Tris, 192 mm glycine, 20% methanol (ph 8.3) 완충액에서 polyvinylidene difluoride (PVDF) 막에 1 시간동안전사시키고 TBS 완충액으로헹구어주었다. 일차항체를 5% skim milk를함유한 TBS로희석한다음, 전사된막과 4 에서밤새반응시킨후 TBS로충분히세척하였다. 일차항체로는 complex I (NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, NDUFS4, 20 kda, MitoSciences company, Eugene, OR, USA), complex II (succinate dehydrogenase [ubiquinone] iron-sulfur subunit, SDHB, 30 kda), complex III (ubiquinol-cytochrome c reductase core protein 2, UQCRC2, 45 kda), complex IV (cytochrome c oxidase subunit II, COX2, 25 kda), complex V (ATP synthase subunit alpha, 55 kda), IL-6 (24 kda, AbCam, Cambridge, MA, USA), TNF- α (17 kda, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), 15

28 catalase (55 kda, Santa Cruz), glutathione peroxidase 3 (GPX3) (92 kda, Santa Cruz), actin(42 kda, Sigma) 을사용하였다. TBS로충분히세척하고막을상온에서 2차항체와 1 시간동안반응시킨후관찰하였다. Anti-rabbit, anti-goat, anti-mouse antibody를 2차항체로사용하였다. 5) 산화스트레스평가가. Malondialdehyde (MDA) 측정지질과산화는세포를손상시키는하나의기전으로잘알려져있으며세포나조직의산화스트레스지표로서사용되고있다. MDA는지질과산화에의해자연적으로발생하는산물이며 thiobarbituric acid reactive substance (TBARS) assay kit를이용한 MDA 측정은널리사용되고있는산화스트레스평가법이다. 간조직과 HepG2 세포는 RIPA buffer (50 mm Tris-HCl, ph 8.0, 150 mm sodium chloride, 1.0% Igepal CA-640 [NP-40], 0.5% sodium deoxycholate, 0.1% SDS) 250 l를첨가하여얼음위에서균질화시키고 4, 1600 g에서 10분간 원심분리를시행한후상층액을취하여측정시까지 -80 에보관하였다. 1 MDA 표준액 500 μm MDA 250 μl를물 750 μl와섞어 125 μm의 MDA 원액을만든후 MDA 0, 5, 10, 20, 40, 80, 200, 400 μl을물 1000, 995, 990, 980, 960, 920, 800, 600 μl 와섞어 0, 0.625, 1.25, 2.5, 5, 10, 25, 50 μm의 MDA 표준액을만들었다. 2 MDA 측정준비해둔조직균질물이나세포용해물은이중으로만들어 TBARS 16

29 assay kit(cayman Chemical, Ann Arbor, MI, USA) 를이용하여 MDA를측정하였다. 샘플은 SDS용액과발색시료를섞은후끊는물에 1시간동안둔후즉시 ice에꽂아 10분간두었다. 이후 4, 1600 g에서 10분간원심분리한후 MDA 표준액과함께 96-well 평판에이중으로담고 nm에서흡광도를측정하였다. 표준곡선을이용하여 MDA의농도를구하였다. 나. HepG2 세포에서 ROS 평가형광프로브인 H2DCFDA(2'7'-dichlorofluorescin diacetate) 는세포내로스며드는 ROS에대한지시약으로에스테르분해효소에의해아세테이트군이제거된후형광을띄게된다. 평판에서배지를흡인후 10 μm CM-H2DCFDA를페놀레드가포함안된배지 20 μl 에녹여 well에첨가해주고 37 에 1 시간동안반응시켰다. Well을 50 μl의 PBS로 3번세척후마이크로플레이트판독기 (Wallac Victor3V 1420 Multilabel Counter; PerkinElmer) 에넣어주고 excitation / emission 파장인 485 nm / 590 nm에서형광도를측정하였다. 6) 통계분석대조군과실험군간의비교는비모수검정법인 Mann-Whitney and Kruskal-Wallis test를이용하였고 P 값이 0.05 미만인경우를통계적유의성이있는것으로간주하였다. 17

30 연구결과 1. NOAEL 보다저용량 (1.2mg/kg/day) BPA 투여가간에 미치는급성기효과 BPA 가체내에미치는급성기효과를관찰하기위해 1.2 mg/kg/day 의 BPA 를 5 일간복강내주사후변화를관찰하였다. 1) BPA 투여후간기능의변화몸무게, 지방량과간무게는 BPA 투여후유의한변화가없었다. 간독성여부를보기위해간효소를측정하였을때 ALT는대조군이 60 ± 14 IU/L, BPA 투여군이 57 ± 10 IU/L로양군에서큰차이가없었다. AST는 BPA 투여군에서 46 ± 20 IU/L로대조군의 30 ± 4 IU/L에비해증가하는경향은보였으나, 통계적유의성은없었다. 2) BPA 투여후미토콘드리아구조와기능의변화 H&E 염색상간조직소견에는큰차이없었으나전자현미경으로관찰시 BPA 투여군에서간세포내미토콘드리아가심하게부어있는소견을관찰할수있었다 ( 그림 1.2A). 미토콘드리아산소소모율 (glutamate + malate + ADP [GMD], GMcD + succinate [GMcDS], carbonylcyanide p-triflouromethoxyphenylhydrazone [FCCP]) 을측정시 BPA 투여군에서 GMD가유의하게저하되었고 (P=0.03)( 그림 1.2B) 미토콘드리아호흡사슬복합체 Ⅲ와 Ⅴ의발현율도감소됨을 확인하였다 ( 그림 1.2C). 18

31 Figure 1.2 Mitochondrial structure and function in the mice livers treated with BPA (1.2 mg/kg/day) for 5 days. (A) Morphology of mitochondria in the hepatocyte by transmission electron microscopy (15000 x magnification). Control mice (A1) and BPA treated mice (A2). Normal mitochondria (arrows) and swollen mitochondria (arrowheads). (B) Oxygen consumption rate of liver tissue treated with BPA (1.2 mg/kg/day) for 5 days. GMD, glutamate + malate + ADP; GMcD, GMD + cytochrome c; GMcDS, GMcD + succinate; FCCP, uncoupler. P = 0.03 compared to control. (C) Western blot of mitochondrial complexs proteins. Complex I, NDUFS4; Complex II, SDHB; Complex III, UQCRC2; Complex IV, COX2; Complex V, ATP synthase subunit alpha. 19

32 2. NOAEL 보다저용량 BPA 의시간경과에따른효과 이상에서 NOAEL보다저용량 BPA에의해서도간세포내미토콘드리아구조와기능에장애가생김을확인하였고그기전에대해알아보고자실험을진행하였다. 산화스트레스와전염증성사이토카인이미토콘드리아기능장애를유발할수있어 (Ott 등, 2007) 1.2 mg/kg/day의 BPA를 1회복강내주사하고 1, 6, 24 시간후에산화스트레스의지표인 MDA와사이토카인 IL-6와 TNF- α의간내발현을살펴보았다. 1) BPA 투여후간기능의변화 BPA의시간경과에따른간독성여부를관찰하기위해간효소를측정시 BPA 투여후시간이경과하면서 AST와 ALT가대조군에비해점점높아져 24 시간째는통계적으로유의하게높아 BPA의간독성효과를확인하였다 ( 그림 1.3). 2) BPA 투여후간내산화스트레스와전염증성사이토카인의변화지질과산화의생산물인 MDA를산화스트레스의지표로서측정하였다. 간내 MDA 농도는 1.2 mg/kg/day의 BPA를 1회주사후시간에걸쳐점차적으로증가하였고 6, 24 시간째는대조군에비해유의한증가를보였다 ( 그림 1.4A). 중요한항산화효소인 GPX3의간내발현은주사후 1, 6 시간까지점차적으로감소하다가 24 시간째약간회복되는소견을보였으나 catalase의발현은큰변화가없었다 ( 그림 1.4B). 전염증성사이토카인이산화스트레스를유발할수있어 IL-6와 TNF-α의간내발현을살펴보았다. BPA를투여하고 20

33 Figure 1.3 Serum AST and ALT levels after a single injection of 1.2 mg/kg/day of BPA. P = compared to control; # P = compared to 6hr; P = compared to control; P = compared to 1hr 21

34 1, 6 시간째 IL-6의발현은증가되었으나 TNF α는변화가없었다 ( 그림1.4C). 반면혈중 IL-6와 TNF α를검사하였을때 IL-6는 1 시간과 6 시간째, TNF α는 6 시간째대조군에비해통계적으로유의하게상승되었으나 24 시간째는회복되는소견을관찰하였다 ( 그림1.4D). 이는미토콘드리아의기능변화를관찰하기위해시행한산소소모율검사에서 6 시간째소모율이감소하고 24 시간째회복되는것과상응되는소견이었다 ( 그림 1.4E). 위의실험결과에서전염증성사이토카인과산화스트레스의시간에따른변화가간내미토콘드리아의기능장애와연관성을보여 BPA가전염증성사이토카인의발현을유발하여간내산화스트레스를증가시켰을것으로생각해볼수있겠다. BPA에노출되면간내항산화효소의발현이떨어지고증가된산화스트레스로부터간세포가보호받지못해결국미토콘드리아의기능장애로이어질수있다. 이가설을증명하기위해 1.2 mg/kg/day 용량의 BPA를 5일간복강내주사한쥐에서간내지질과산화의지표인 MDA농도와항산화효소인 GPX3와카탈라제의발현을조사하였다. MDA는 BPA 처리시대조군에비해유의하게높은값을보였고 ( 그림 1.5A) 항산화효소중 GPX3의발현이유의하게감소함을확인하였다 ( 그림 1.5B). 3. TDI 용량 BPA 투여가간미토콘드리아기능과 산화스트레스에미치는영향 22

35 Figure 1.4 Changes in the levels of oxidative stress and inflammatory cytokines at 1, 6 and 24 hr after a single injection of BPA (1.2 mg/kg/day). (A) MDA concentrations in the liver. P = compared to control; # P = compared to control (B) Western blot of catalase and GPX3 in the liver. (C) IL- 6 and TNF-α levels in the liver. (D) Serum IL-6 and TNF-α levels. P < 0.01 compared to control; # P = 0.02 compared to control (E) Oxygen consumption rate of liver tissue treated with BPA (1.2 mg/kg/day) over time. GMD, glutamate + malate + ADP; GMcD, GMD + cytochrome c; GMcDS, GMcD + succinate. P =0.03 compared to control. 23

36 Figure 1.5 Changes of the level of MDA and antioxidant enzymes in the mice livers treated with BPA (1.2 mg/kg/day) for 5 days (A) MDA concentrations. P < 0.05 compared to control. (B) Western blot of Catalase and GPX3 24

37 앞에서 NOAEL보다저용량인 1.2 mg/kg/day의 BPA 투여후미토콘드리아의기능장애와산화스트레스가증가함을관찰하였다. 그러면이보다더낮은 TDI 용량인 50 μg/kg/day에서는어떤변화를일으키는지관찰하기위해 5일간복강내주사후실험을진행하였다. 전자현미경으로미토콘드리아의구조를관찰하였을때 1.2 mg/kg/day의용량과마찬가지로대조군에비해미토콘드리아가크게부어있는경우가많았으나일부생쥐는정상적인모양의미토콘드리아를보여일관되지않고차이가있었다. 이는 TDI 정도로낮은용량의 BPA에는개체간감수성이서로다를수있다는가능성을시사하였다 ( 그림 1.6A). 미토콘드리아의산소소모율을측정하였을때대조군과유의한차이는없었다 ( 그림 1.6B). 산화스트레스의표지자인 MDA 측정시 BPA 처리군에서통계적으로유의한변화는없었으나 GPX3의발현은감소되어있었다 ( 그림 1.6C와 1.6D). 이상에서 해롭지않다 는하루허용용량의 BPA에서도항산화효소의발현감소와개체간의차이는있지만미토콘드리아구조에문제가생길수있음을확인하였다. 4. HepG2 세포주에서 BPA 농도별, 시간별처리에 따른산화스트레스와미토콘드리아기능의변화 동물실험에서관찰한 BPA 의간미토콘드리아의기능과산화 스트레스에미치는영향이 BPA 에의한직접적인효과인지 확인하기위해, HepG2 세포주를이용하여 BPA 처리농도와처리 25

38 Figure 1.6 Mitochondrial structure and function in the mice livers treated with BPA (50 μg/kg/day) for 5 days. (A) Morphology of mitochondria in the hepatocyte by transmission electron microscopy (50,000 x magnification). Control (A1) and BPA-treated mice (A2, A3). Normal mitochondria (arrows) and swollen and cristae-disrupted mitochondria (arrowhead). (B) Oxygen consumption rate of liver tissue treated with BPA (50 μg/kg/day) for 5 days. GMD, glutamate + malate + ADP; GMcD, GMD + cytochrome c; GMcDS, GMcD + succinate; FCCP, uncoupler. (C) MDA concentration in the liver. (D) Western blot of catalase and GPX3 in the liver 26

39 시간을달리하여실험을진행하였다. BPA를 1~2000 nm로 2 시간, 6 시간처리한후 ATP 생산을측정시 10 nm에서는큰변화없으나 100 nm부터는점차감소하는것을관찰할수있었고 6시간째는회복되는소견을보였으나농도가높아질수록회복되는정도가둔화되는소견을관찰할수있었다 (Figure 1.7A). 위의결과를바탕으로 50 nm의 BPA를처리하고시간별로 ATP 생성과 ROS정도를측정하였다. ATP는 1~2시간에최고로감소하였다가시간이지나면서점차회복되는양상을, ROS는이와반대로점차증가하여 1~2시간에최고점에이르렀다가다시감소하는소견을보여주었다. 이로써 HepG2 세포주실험에서도동물실험결과와마찬가지로 ROS 생성이미토콘드리아기능장애와연관되었음을확인할수있었다 (Figure 1.7B). 한편 BPA처리 2시간째전자현미경을통해미토콘드리아의구조를살펴보았을때 10 nm로처리한 HepG2 세포에서미토콘드리아의부종소견을보였고이는 100 nm에서더욱두드러지는것을관찰할수있었다 ( 그림 1.8A). 구조적이상뿐아니라미토콘드리아의산소소모율도대조군에비해 BPA 처리군에서낮은경향을관찰하였고이는 100nM에서더심화되는것을관찰할수있었으나통계적으로유의하지는않았다 ( 그림 1.8B). 미토콘드리아기능의다른지표인 ATP 생산과 MMP를측정하였을때 100 nm의 BPA 처리시 ATP 생산이낮아지는경향을보였으나통계적유의성은없었다. 하지만 MMP는 BPA 처리시유의하게감소된소견을보여미토콘드리아의기능장애를확인할수있었다 ( 그림 1.8C와 1.8D). 27

40 Figure 1.7 Changes of ATP production and ROS in HepG2 cells according to dose and duration of BPA treatment. (A) Change of ATP production after the treatment with 10 to 2000 nm BPA for 2 or 6hr. (B) Change of ATP production and ROS over time after the treatment with 50nM BPA. 28

41 Figure 1.8 Mitochondrial structure and function in HepG2 cells treated with bisphenol A. (A) Morphology of mitochondria in HepG2 cells treated with BPA (10 nm and 100nM) for 2hrs by transmission electron microscopy (30,000 x magnification). Control HepG2 cells (A1), 10 nm BPA-treated HepG2 cells (A2), and 100 nm BPA-treated HepG2 cells (A3). Normal mitochondria (arrows) and swollen and cristae-disrupted mitochondria (arrow heads). (B) Oxygen consumption rate of HepG2 cells treated with BPA (10 nm and 100nM) for 2hrs. GMD, glutamate + malate + ADP; GMcD, GMD + cytochrome c; GMcDS, GMcD + succinate; FCCP, uncoupler. (C) ATP production of HepG 2 cells treated with100 nm BPA. (D) MMP of HepG2 cells treated with 10 and 100 nm BPA. P = compared to control; P = compared to control; # P=0.008 compared to control; ## P=0.003 compared to control 29

42 고찰 본연구에서는출생후시기의생쥐에 NOAEL보다저용량인 1.2 mg/kg/day나안전하다고되어있는하루허용가능한용량 (TDI) 의 BPA를복강내주사로투여했을때간에서미토콘드리아의기능적, 구조적장애를유발함을확인하였다. 또한 BPA는전염증성사이토카인과간의산화스트레스를증가시키는반면간내항산화효소의발현은저하시켰다. 이런결과에서 NOAEL보다저용량의 BPA에서도간에장애를유발할수있음을확인하였다. 이전에는미토콘드리아기능장애와관련된 BPA의효과에대해 in vitro 연구결과만있었는데 (Nakagawa 등, 2000), 본연구에서는출생후시기에 NOAEL보다저용량의 BPA에노출되더라도미토콘드리아의기능장애를유발할수있다는것을 in vivo 연구를통해증명하였다. 최근 BPA가 ROS 생성을증가시켜간세포의세포사멸을유발하고 (Asahi 등, 2010) 산화스트레스를증가시켜간에부작용을유발한다 (Bindhumol 등, 2003) 는연구결과들이보고되었다. 증가된산화스트레스는미토콘드리아손상을유발할수있고반면손상된미토콘드리아는더많은 ROS를생산할수있다. 세포에는미토콘드리아에서 ATP 합성과정중만들어지는 ROS를제거하고산화손상을복구할수있는항산화시스템이있다. 하지만이시스템에문제가생기거나불균형이초래되면미토콘드리아는 ROS에매우취약한상태가된다 (Turrens 등, 1997). ROS에의한산화손상이복구되지않고미토콘드리아에축적되면결국기능장애와 30

43 미토콘드리아 DNA소실, 세포사멸이초래될수있다 (Ott 등, 2007). 본연구에서는 NOAEL 미만인 1.2 mg/kg/day의 BPA를주사후 MDA가대조군에비해 BPA 투여군에서증가됨을관찰하였다. 이는심지어 BPA를투여하고 1 시간후부터관찰되었다. 또한안전하다고되어있는하루허용용량인 50 μg/kg/day의 BPA를주사하고관찰했을때, 1.2 mg/kg/day 용량을주사했을때와는달리미토콘드리아의기능이나구조에서일관된차이를발견하진못했지만산화스트레스가증가되고항산화효소의발현이감소된것을관찰할수있었다. 이상에서, 비록인과관계를명확히하기위해선좀더연구가필요하겠지만, BPA에의한미토콘드리아기능장애에산화스트레스가하나의기전으로서작용한다고제안할수있겠다. 본연구에서는 BPA를투여한경우 IL-6와 TNF-α가증가된것을관찰하였다. ROS가전염증성사이토카인을증가시킬수도있지만 (Dong 등, 1998), 전염증성사이토카인자체가산화스트레스를유발할수도있다 (Babbar 등, 2006). 실험결과에서 IL-6의간내발현및혈중수치는 BPA 주사 1, 6 시간후에증가되었으나혈중 MDA는시간경과에따라 24 시간후까지점진적으로증가되는것을관찰하였다. 이는 IL-6가 BPA에의해유도된미토콘드리아기능장애나 ROS 형성에관여할가능성을시사한다. 세포는산화스트레스에대해카탈라제, GPX3와같은 ROS를제거하는효소를포함하여다양한방어기제를가지고있다. 본연구에서 BPA를처리했을때 GPX3의간내발현이감소된것을관찰하였다. 이는 ICR 생쥐의간과신장을이용한연구 (Kabuto 등, 31

44 2003) 나 Wistar 쥐의정자를이용한연구결과 (Chitra 등, 2003) 와일치하는소견으로 BPA 노출이항산화효소를억제시키거나고갈시켜더욱 ROS를증가시킬수있다는사실을시사한다. BPA를 1.2 mg/kg/day로 1회복강내주사후관찰시간효소의증가소견이관찰되었으나, 5 일간복강내주사후관찰시간효소는대조군과큰차이가없었다. 이는 BPA가급성으로간독성을유발하긴하지만아마도이를극복할수있는보상기전들이있어 BPA의간독성효과가이런보상기전에의해정상으로회복되는것으로생각해볼수있다. 물론본연구에서이과정에대해서조사하지못했기에추후연구가필요할것으로생각된다. 사람에서는주로경구섭취로 BPA에노출되는데본연구에서는 BPA를복강내주사로투여하였다. 노출되는경로가달라지면 BPA의대사와생물학적작용이달라지기때문에 (Pottenger 등, 2000) 이점은본논문의제한점이라할수있다. 그러나 BPA의약물동력학을고려시본실험에서복강내주사로사용한 BPA 용량은경구섭취시에 150 μg/kg/day와 4 mg/kg/day에해당되어여전히 NOAEL보다낮은용량이었다. 결론적으로출생후시기의생쥐에서, NOAEL보다저용량의 BPA에노출되어도간에서미토콘드리아의기능장애를유발하고이는산화스트레스와전염증성사이토카인의증가와연관되어있음을확인하였다. 32

45 제 2 장. 하루허용용량의 BPA 12 주경구투여가 당대사에미치는영향 33

46 서론 인슐린저항성이제2형당뇨병이나심혈관계질환의위험을증가시킴은널리알려져있고이에대해많은연구가이루어져왔다 (DeFronzo 등, 1999). 그러나인슐린저항성의병인에대해서는아직정확히규명되지않고있으며매우다양한기전들이관여할것으로예상되고있다. 이런인슐린저항성과더불어췌장베타세포의기능이저하되면제2형당뇨병이발생한다. 제2형당뇨병은최근매우빠른속도로증가하여 2005년 WHO 발표에따르면전세계적으로약 1억 8천만명이당뇨병을앓고있으며이중 90% 가제2형당뇨병이고매년 2백 9천만명이당뇨병으로인해사망한다 (WHO, 2005). 당뇨병발병에는유전적소인과더불어비만, 고지방고칼로리의식이및운동부족과노화등의환경적인요인이주요하게관여할것으로생각되나그원인에대해서는아직완전히규명되지않고있다. 당뇨병유병율증가를유전적인인자의변화로설명하기엔그증가속도가너무빨라보다유동적으로변화하는환경적인요인이더크게기여할것으로생각되고있다. 대개환경적요인이라고한다면고칼로리고지방식으로대표되는서구식식사나활동량부족, 비만및노화등을이야기한다. 그러나이외에도최근극심해지는환경오염을고려할때우리주변환경에산재되어있는여러화학물질의영향을중요한환경적요인의하나로생각해볼필요가있겠다. 2차세계대전때의놀라운 ' 화학혁명 ' 을이루면서등장한엄청난 34

47 화학물질은생활의편의를위해개발된것이긴하나, 미량이라도만성적으로체내로유입될경우인슐린저항성, 당뇨병, 각종암을비롯한여러질환의발생에관여할것으로예상된다 (Colborn 등, 1996). 이들중우리주변에서가장많이사용되는화학물질의하나로 BPA를들수있는데, 각종식기를비롯하여우리주변에서흔히접하는상당부분의물건들을통해노출될수있다. 많은종류의환경호르몬은 17ß-estradiol과비슷한작용을나타낸다 (Colborn 등, 1993). 당대사의관점에서여성호르몬은생리적인수치에서는정상적인인슐린민감도를유지하고베타세포기능에유리하게작용하는것으로알려져있다 (Livingstone 등, 2002; Louet 등, 2004). 그러나비정상적인수치의여성호르몬은사춘기나임신기와마찬가지로인슐린저항성을나타내게된다 (Hollingsworth, 1983; Amiel 등, 1991; Livingstone 등, 2002). 따라서여성호르몬처럼작용하는환경호르몬에오랜기간지속적으로노출될경우인슐린저항성이생길위험이증가할수있다. 최근에인체내에서 BPA의효과를살펴본대규모역학조사가발표되었는데소변이나혈중 BPA의농도와심혈관계질환, 당뇨병, 비만, 인슐린저항성의빈도가양의상관관계를보여 BPA 노출이이런질환들과연관되어있음을보였다 (Lang 등, 2008; Shankar & Teppala, 2011; Wang 등, 2012). 이들은단면적연구이므로인과관계를명확히규명할수는없으나최근발표된 BPA의동물실험과유사한결과들이인간에서도나타남이보고된것이기에, BPA가인체에악영향을미칠수있다는경각심을불러일으키고있다. 하지만미국, 중국과한국에서성인을대상으로한인구기반연구 35

48 결과에서는소변내높은 BPA 농도와제2형당뇨병사이에유의한연관성을찾을수없었다는결과도있어 (Melzer 등, 2010; Ning 등, 2011; Kim & Park, 2013) BPA 노출이인슐린저항성이나당뇨병을유발하는지에대해서는아직결론이나지않은상태이다. 이런역학연구결과들이외에동물실험에서도상반되는결과들이있다. Ryan 등은 CD-1 생쥐에서주산기에어미를 BPA에노출시킨후관찰하였을때자손에서당불내인성을유발하지않았다고보고하였다 (Ryan 등, 2010). 이와는반대로성인쥐에서 10 μg/kg의 BPA를한번주사했을때그리고 100 μg/kg/day의 BPA를 4일혹은 8일간복강내주사했을때인슐린저항성이유발되었다는연구결과들도있다 (Alonso-Magdalena 등, 2006; Batista 등, 2012). 이런실험결과의차이는연구마다 BPA 투여시기, 투여용량, 투여경로등에차이가있어영향을미쳤을것으로생각되며출생후시기에경구로 BPA에노출될경우당불내인성이생기는지에대해서는결과가더욱제한적이다. 미국 EPA는 50 μg/kg/day를 TDI 용량으로정하고 안전 하다고발표하였다. 그러나 Alonso-Magdalena등은 TDI이하의 10~50 μg/kg/day의 BPA도 Swiss albino OF1 수컷생쥐에서인슐린분비를증가시키고고인슐린혈증을유발한다고하였다. 게다가 Perreault 등은 6개월된 C57BL/6 수컷생쥐에서 TDI 용량으로 2주간짧게노출시켰을때간내글루코키나아제의활성과기능이감소한다고하였다 (Perreault 등, 2013). 이런결과들은미국 EPA가 해롭지않다 고하였던 TDI 용량이실제로는안전하지않을수도있다는것을시사한다. 36

49 최근고지방식이의소비가점점증가하면서당뇨병유병율의급격한증가를더욱가속화시켰고 (Hu 2011) 이런지방이풍부한식품들의소비는지방친화적인 BPA에더많이, 더쉽게노출될가능성이있다. 따라서고지방식이가 BPA 노출에의한부작용을악화시킬수있을것으로생각되나연구결과가많지않다. BPA가당불내인성을유발하는기전으로, 췌장도세포의기능장애 (Nadal 등, 2000; Alonso-Magdalena 등, 2006), 아디포넥틴의생산혹은분비저하 (Hugo 등, 2008; Kidani 등, 2010), 지방세포의분화촉진및지방축적 (Masuno 등, 2002; Masuno 등, 2005; Somm 등, 2009; Ohlstein 등, 2014) 및산화스트레스증가와미토콘드리아기능장애 (Nakagawa & Tayama, 2000; Bindhumol 등, 2003; Asahi 등, 2000) 등이제시되고있다. 인슐린은지방합성과축적에관여함은물론이고당대사에있어가장주요한호르몬이라할수있다. 따라서인슐린을분비하는췌장베타세포의기능유지는정상적인당대사에필수적이라할수있다. Alonso-Magdalena 등은생쥐에게 NOAEL보다저용량인 100 ug/kg/day의 BPA를 4일간복강내주사했을때췌장내인슐린함량의증가, 만성적인고인슐린혈증과인슐린저항성이유도되어 BPA가췌장베타세포에대해직접적인장애를유발한다는결과를보고하였다 (Alonso-Magdalena 등, 2006). TDI 용량으로경구로노출시에도췌장에동일한변화가일어나는지살펴볼필요가있겠다. 아디포넥틴은지방세포에서분비되는아디포카인으로서조직에서염증을감소시키고인슐린감수성을증가시켜 (Whitehead 등, 2006) 대사증후군에대해보호효과가있는호르몬으로알려져 37

50 있다 (Kadowaki 등, 2006). 따라서아디포넥틴의분비나합성을억제시키는인자는인슐린저항성을높여당대사장애를유발할수있다. Hugo 등은사람의지방세포에 BPA를처리했을때아디포넥틴의분비가억제된다고하였고 (Hugo 등, 2008) Kidani 등은 3T3-L1 세포를이용하여 BPA 처리시아디포넥틴의합성과분비가줄고인슐린신호전달체계에있는 Akt 신호전달이하향조절된다고하였다 (Kidani 등, 2010). 세포실험에서보인 BPA의아디포넥틴분비에미치는영향이체내에서는어떠한지확인이필요하겠다. 당뇨병이급속도로늘어나는것과함께비만률도최근매우빠른속도로증가하고있다. 복부비만은당뇨병, 고혈압, 심혈관계질환의위험인자이지만비만이어떻게이런질환들의발생을높이는지에대해서는잘알지못한다. 주로높은열량의식사와운동부족등의생활습관잘못이비만율증가의원인으로관심을받아왔다. 그러나최근 BPA가쥐의지방세포에서지질형성에문제를일으키면서당이나지질의대사에도영향을미친다하여 (Masuno 등, 2005; Alonso-Magdalena 등, 2006) 환경호르몬이비만율증가나비만관련질환의발생률증가에한원인일수있다는가설이신뢰를얻고있다. 당뇨병동물모델과당뇨병환자에서산화스트레스가증가된다는것이밝혀졌으나 (Hunt 등, 1998; Park 등, 2001; Shin 등, 2001; Frustaci 등, 2000) 반대로 ROS의과다한생성과그에대한방어기제의불균형으로산화스트레스가증가하고이것이인슐린저항성, 당뇨병과그합병증발생에중심적역할을할수도있다 (Calsson 등, 1999; Brownlee, 2001; Evans 등, 2002; Turrens 등, 2003; Frydlyand 등, 38

51 2005). 세포내에너지대사의중심에있는미토콘드리아에기능이상이생길경우인슐린저항성이생길수있음이보고되었는데 (Petersen 등, 2003), Lowell 등은근육내미토콘드리아결함으로인한지방산증가에의해인슐린저항성이일어난다는가설을제기하였다. 근육내미토콘드리아의기능소실은미토콘드리아에서지방산의분해를억제하여세포내지방산아실 CoA와디아실글리세롤의농도를상승시킨다. 이들분자는 protein kinase C(PKC) 를활성화하고, 세린키나아제의활성을증가시켜인슐린수용체의세린기에인산화를촉진시켜인슐린신호전달에장애를가져와결과적으로세포내포도당의흡수를방해하여인슐린저항성을유발한다 (Lowell 등, 2005). 따라서미토콘드리아의기능이상은인슐린저항성과밀접한연관성이있음을알수있다. Bindhumol 등은 30일간 TDI 용량이하의 BPA를경구로투여후간세포에서지방의과산화가증가되고항산화효소가감소됨을밝힌바있다 (Bindhumol 등, 2003). 본연구에서도 NOAEL보다저용량의 BPA를복강내로주사하였을때간내산화스트레스증가와미토콘드리아기능장애가유발됨을밝혔다. 따라서 BPA가산화스트레스와미토콘드리아의기능장애를유발하여당대사에이상을일으킬수있을것으로추정되나 BPA를장기간경구로투여했을때인슐린저항성과당불내인성이유발되는지그기전이무엇인지에대해선아직결과가없다. 따라서본연구에서는 해롭지않다 고알려진 TDI 용량인 50 µg/kg/day의 BPA를 12주동안경구로투여했을때당대사에어떤변화가생기는지그기전으로서무엇이관여하는지알아보고 39

52 고지방식이가이런 BPA 노출의부작용을악화시키는지에대해 알아보고자하였다. 40

53 연구재료및방법 1. 연구재료 1) 사용약제순도 99% 이상의 BPA를 Sigma(St. Louis, Mo, USA) 에서구입하여사용하였고극소량의 30% 에탄올에녹인후물에희석하여실험에적합한농도로만들어사용하였다. 2) 실험동물 BPA의가장흔한인체노출경로인경구로의노출에의한 BPA의영향을관찰하기위해미국 EPA에서제시한허용가능한하루복용량인 50 μg/kg/day의 BPA를 12주에걸쳐음수로투여하는방법을사용하였다. 모든쥐는임의로총 4개의군 : 1) 정상식이대조군, 2) 정상식이 BPA투여군 3) 고지방식이대조군, 4) 고지방식이 BPA 투여군으로나뉘어졌으며사료와물은제한없이공급하였다. 정상식이는 3.6 Kcal/g으로대략단백질 21%, 지방 12.5% 와탄수화물 66.5% 로, 고지방식이는 5.0 Kcal/g으로단백질 21%, 지방 66.5% 와탄수화물 12.5% 로구성되었다. 한우리에 4~6주령의쥐를 5마리씩사용하였고실험은최소 3번반복하였다. 모든쥐는적정온도 (23 ± 2 ), 적정습도 (60 ± 10%) 및정기적인공기순환시스템이갖춰진동물실험실에서 12시간밤낮의주기로사육하였다. 실험기간동안몸무게, 식이량과음수량은 3일마다측정하였다. 41

54 12주이후모든동물은 8시간동안금식을시킨후희생시켜조직을얻었다. 이후간, 골격근 (gastrocnemius), 부고환지방 (white adipose tissue, WAT) 을분리하여무게를잰후액체질소에넣어실험때까지 -80 에보관하였다. 췌장은즉시분리후무게를재고 10% 는 H&E, 면역조직화학염색, 전자현미경관찰용으로사용하였고 90% 는췌장내인슐린양을측정하기위해준비하였다. 조직검사를위해 10% 포름알데히드에 24~48시간동안고정시켰고전자현미경관찰용은췌장을최소한의압력으로 1x1 mm 크기로신속히절단하여산소와의접촉을최소화하면서 2.5% 글루타르알데히드에넣어슬라이드제작할때까지 4 에보관하였다. 모든동물실험은실험동물의관리와사용에관한표준지침을따랐으며분당서울대학교병원동물실험윤리위원회의승인을받아진행하였다 ( 승인번호 BA /021-01) 3) 세포주가. INS-1 세포주 37, 95% 공기와 5% CO 2 상태에서숯처리된 10% 우태아혈청, 10 mm HEPES (ph 7.4), 10.2 mm L-glutmine, 50mM sodium pyruvate, 2.5 mm β-mercaptoethanol, streptomycin(0.1 mg/ml) 과 penicillin(100 U/ml) 을 포함하는페놀레드가들어있지않은 RPMI-1640 배지 (Invitrogen, Carlsbad, CA, USA) 에서전배양하였다. 나. Rat 유래골격근세포주인 L6 세포주 37, 90% 공기와 10% CO 2 상태에서 10% 우태아혈청과 1% 42

55 streptomycin과 penicillin을포함한 Dulbecco s modified Eagle s medium(dmem)(gibco, San Diego, CA, USA) 에서배양하였다. 80% 의세포밀집도를보일때 37, 90% 공기와 10% CO 2 상태에서, 2% horse serum(invitrogen, Carlsbad, CA, USA) 을함유한 DMEM으로교환하여분화를유도하였다. 이후배지는격일마다교체하였다. 분화 5일째근관 (myotubes) 을실험에사용하였다 (Ohn 등, 2013). 2. 연구방법 1) 신체계측및당부하검사시행 연구종료시점에전신지방량측정을위해마취후이중에너지 방사선흡수법 (DXA, GE Lunar PIXImus, Fitchburg WI, USA) 을 시행하였다. 정중선복부절개를통해부고환지방을외과적으로 절제하여즉시무게를측정하였다. 12주이후당대사상태를알아보기위해각실험의종료시점에 복강내당부하검사를시행하였다. 모든동물은식이가끝나는 시점부터 8시간동안금식을시킨후몸무게를측정하고기초 혈당을꼬리정맥에서채혈하여측정하였다. 20% 포도당을 2 g/kg으로 계산하여 복강 내로 주사하고 15, 30, 60, 90및 120분에 꼬리정맥으로부터 채혈하였으며 혈중 포도당 농도는 혈당측정기 (ACCU-CHEK Active, Roche, Mannheim, Germany) 를 이용하였다. 2) 인슐린, 아디포넥틴과전염증성사이토카인측정 43

56 모든샘플은분석때까지 -80 에보관하였다. 혈중및췌장내, INS1 세포실험에서의인슐린과혈중아디포넥틴, IL-6와 TNF-α은 RIA commercial kit(linco Research, St. Charles, MO, USA) 를이용하여제조사의프로토콜에따라측정하였다. 3) 췌장내인슐린함유량측정연구종료시점에서각군당 5마리의쥐를 8시간동안공복시키고마취시킨후췌장을얻었다. 췌장의무게를측정한후 10% 는조직학적검사를위해처리하였고, 90% 의췌장을분석에이용하였다. 조직을준비된산성알코올용액 (75% 에탄올, 1.5% 염산, 23.5% 증류수 ) 5 ml에담아균질화시키고 4 에서흔들어주면서 24시간동안두었다. 이후 rpm에서 2분간원심분리하여상층액을모두얻어 -80 에보관하였다. 가라앉은침전물에위의용액 5 ml을다시첨가하여균질화하는과정부터시작하여위과정을 3회더반복하였다. 보관되어있던검체를 RIA commercial kit(linco) 를이용하여인슐린농도를측정하고다음의식을이용하여인슐린양을계산하였다. 4일간의샘플의값을합산하여총량을구하고그값을군별로비교하였다. Insulin dose (ng/ml) x dilution factor x total medium volume (ml) x (90% weight of the pancreatic tissue / total pancreatic tissue weight) 4) 베타세포의양적변화및췌도의형태변화 각군의 5 마리쥐모두에서시행하였다. 췌장을 4 의 4% 44

57 파라포름알데히드로 24~48시간고정하고흐르는물에수세한다음, 광학현미경표본제작과정을따라파라핀에포매하여 7 µm 두께절편으로제작하였다. 한개의췌장당두개의절편 ( 서로 300 µm이상떨어져있는두절편 ) 을슬라이드위에붙인후파라핀을제거하고함수과정을거친후다클론항인슐린항체 (Cell Signaling Technology) 를이용하여면역조직화학염색을시행하였다. 췌도질량은컴퓨터에연결된 Axio Observer microscope(carl Zeiss, Oberkochen, Germary) 과 AxioVision 4.7 software(carl Zeiss) 를이용하여 point counting법으로측정하였다 (Weibel, 1978). 먼저저배율 (40x) 에서췌장전체를찍은다음 450개의점으로이뤄진그리드를겹친이미지를얻었다. 췌도중량은전체췌장조직에해당하는점에대한췌도가차지하는점의비를구하여계산하였다. 전자현미경검사는제 1장연구방법중전자현미경파트에언급된방법으로처리후 20000x와 50000x 배율에서관찰하였다. 5) INS-1 세포에서 BPA 처리후포도당자극인슐린분비능및 ROS 측정계대번호 21~29의 INS-1 세포를이용하여 12 well 평판에분주하여 50 nm BPA를포함한배지에서 1, 6과 24 시간동안처리후인슐린분비능및 ROS를측정하였다. 약 1x10 6 개의 INS-1 세포를이용하여 4 mm과 16.7 mm 포도당을함유한 Krebs Ringer Bicarbonate Buffer (119 mm NaCl, 4.74 mm KCl, 2.54 mm CaCl 2, 1.19 mm MgCl 2, 1.19 mm K 2PO 4, 25 mm Na HCO 3, 10 mm HEPES, 0.2% BSA, ph 7.4) 에서 2 시간배양하였다. 배지를취하여 4 에서 10분간원심분리를시행한후상층액을모아 -20 에보관하여사용하였다. 보관되어있던검체를 45

58 RIA commercial kit(linco Research, St. Charles, MO, USA) 를이용하여인슐린을측정하였다. ROS 민감성형광지시약인 dihydroethidium(dhe)(sigma) 를이용하여 INS-1 세포내 ROS를평가하였다. 초과산화물표지자인 DHE는산화전에세포기질에서녹색형광을발하고산화되어세포의 DNA에삽입되면핵을밝은적색형광으로염색한다. 세포는 10 mg/l DHE와섞어 37 에서 30분간반응시키고 PBS로 2차례세척해준후세포에 50 nm의 BPA 시간별로처리하고형광현미경으로이미지를얻었다. 6) 실시간정량중합효소연쇄반응분석법 (RT PCR) Pphosphoenolpyruvate carboxykinase (PEPCK), glucose-6 phosphatase (G6Pase), glycogen synthase(gs) 와 phosphofructokinase(pfk) 의발현을평가하기위해총 RNA는 RNeasy protocol(qiagen, Hilden, Germany) 을이용하여간, 근육, 백색지방조직에서추출하였다. 각샘플에서 1 µg의 total RNA를조류골수아세포종바이러스역전사효소와 oligo-dt 프라이머를이용해 20 µl에서제조사의매뉴얼에따라 cdna로역전사시키고 PCR은아래의프라이머를이용하였다. mouse PEPCK (131 base pairs) 5 - ATCATCTTTGGTGGCCGTAG -3 (forward) 5 - ATCTTGCCCTTGTGTTCTGC -3 (reverse) mouse G6Pase (172 base pairs) 5 - TCTGTCCCGGATCTACCTTG -3 (forward) 46

59 5 - GTAGAATCCAAGCGCGAAAC -3 (reverse) mouse PFK (158 base pairs) 5'- GGCGGAGGAGAGCTAAAACT-3' (forward) 5'- ATACCAACTCGGACCACAGC -3' (reverse) mouse GS (264 base pairs) 5'- TCCTCAGACCCCATCTTGAC -3' (forward) 5'- CTCCATAAAGCAGCCAAAGC -3' (reverse). RT PCR 의조건은 95 에서 3 분 1 주기로시작하고이후에 96 에서 30 초, 55 에서 45 초, 72 에서 45 초로 30 주기를시행하고 72 에서 5분 1 주기로마무리하였다. PCR분획은브롬산에티디움을함유하는 1.5% 한천겔에서분리시키고 UV 하에서관찰하였다. GAPDH 프라이머 (Clontech, Heidelberg, Germany) 를양성대조로이용하였다. 7) 단백질정량근육조직은용해용액 (Cell Signaling Tech., Davers, MA, USA) 으로균질화시킨후단백질측정키트 (Pierce Biotechnology, Rockford, IL, USA) 를이용하여측정하였다. 실험은제 1장연구방법중단백질정량파트에언급된방법으로진행하였다. 1차항체로는 pakt (Thr308), Akt (Cell Signaling Technology), pgsk-3β (Ser9) (Cell Signaling Technology), GSK-3β(BD Transduction Laboratories, San Jose, CA, USA), γ-tubulin(sigma-aldrich) 와 actin(42 kda, 47

60 Sigma) 을사용하였고 2 차항체는 anti-rabbit, anti-goat, anti-mouse antibody 였다. 8) L6 세포에서 deoxyglucose uptake 측정 분화유도된 L6 cells 을 12 well 평판에서배양하여실험을 진행하였다. 50 nm 의 BPA 를 6 시간, 24 시간처리하고 PBS 로 2 회세척해주었다. 100 nm 의인슐린을 20 분간전처리한군과처리하지않은군으로나누어실험하였다. Salt-HEPES 완충액 (130 mm NaCl, 4.7 mm KCl, 1.25 mm CaCl 2, 1.2 mm MgSO 4, 2.5 Mm NaH 2PO 4, and 10 mm HEPES) 에 0.2 Ci 의 [ 3 H] deoxy-glucose 넣고잘섞어준후 well 당 1 ml 씩넣어주고 37 o C 에서 15 분간반응시켰다. 완충액을흡인하여반응을중단시키고차가운 PBS 로 5 회세척해주었다. 세포는 0.5 N NaOH 로용해시킨후, 400 µl 의세포용해물에 1 N HCl 200 µl 를섞고 scintillation solution 2 ml 을넣어 beta counter 로측정하였다. 9) 통계분석대조군과실험군간의비교는비모수검정법인 Mann-Whitney and Kruskal-Wallis test를이용하였고 P값이 0.05 미만인경우를통계적유의성이있는것으로간주하였다. 48

61 연구결과 주간 TDI 용량인 50 μg/kg/day 의 BPA 경구 투여가생쥐의당대사에미치는영향 1) BPA투여후몸무게와총지방량의변화몸무게는대조군과 BPA를투여한군을비교시정상식이군은 29.7 ± 0.7 g과 28.6 ± 0.6 g, 고지방식이군은 45.3 ± 0.8 g과 43.6 ± 1.4 g으로통계적으로유의한차이는없었다 ( 그림 2.1A와그림 2.1B). 정상식이군에서몸무게로보정한백색지방조직의무게는 3.5 ± 0.8 % 과 2.3 ± 0.7%(P=0.004) 로총지방량도 30.0 ± 1.5 % 와 21.4 ± 3.4%(P=0.001) 로 BPA 투여군에서유의하게낮았다 ( 그림 2.1C와그림 2.1D). 그러나고지방식이를한경우는대조군과 BPA 복용군에서백색지방조직은 5.2 ± 1.2% 와 4.7 ± 1.3% 로총지방량은 56.0 ± 2.7% 와 52.4 ± 3.8% 로유의한차이는없었다 ( 그림 2.1C와그림 2.1D). 대조군과 BPA 투여군의 12주동안식이섭취량을살펴보았을때정상식이군은 ± 0.27 kcal/mouse/day과 ± 1.32 kcal/mouse/day (P=0.29), 고지방식이군은 ± 0.2 kcal/mouse/day와 ± 2.83 kcal/mouse/day(p=0.69) 로, 두식이군모두대조군과 BPA투여군간에유의한차이는관찰되지않았다. 2) BPA 투여후혈당과혈중인슐린의변화 고지방식이군에서 BPA 를투여한경우복강내당부하검사곡선 49

62 Figure 2.1 Long-term exposure to bisphenol A had no effect on body weight or fat mass. (A) Growth curves in mice that received standard chow diet (CD) (open square), CD +bisphenol A (BPA) (open circle), high-fat diet (HFD) (filled square), or HFD+BPA (filled circle). (B) Body weight. (C) Percentage of white adipose tissue (WAT). (D) Percentage of body fat. Data are presented as means±s.e.m. P =0.004, # P= compared to control. Bwt, body weight; CON, control; BPA, bisphenol A; DXA, dual-energy X-ray absorptiometry. 50

63 아래면적이 ± 16.8 mm/mim로고지방식이만투여한군의 97.9 ± 18.2 mm/min에비해유의하게큰것을관찰할수있었다 (P=0.027; 그림 2.2A). 혈중인슐린은정상식이군에서 0.32 ± 0.04 ng/ml과 0.30 ± 0.00 ng/ml로 BPA에따른차이가없었고, 고지방식이군의경우 0.44 ± 0.14 ng/ml과 0.52 ± 0.29 ng/ml로 BPA를투여한경우더증가되는경향이관찰되었으나통계적유의성은없었다 ( 그림 2.2B) 3) BPA 투여후인슐린신호전달체계의변화고지방식이군에서 BPA 투여시악화된당불내인성이인슐린저항성과관련되었는지보기위해인슐린신호전달쳬계의주요한인자인 Akt의인산화상태를평가하였다. 고지방식이군에서 BPA 투여시인슐린자극후 Thr308 위치에서 Akt의인산화가감소됨을골격근에서관찰하였고 ( 그림 2.3A 와 2.3B) Akt 신호전달의하부에있는 GSK-3β의 Ser9위치에서인산화가골격근에서유의하게감소되어있음을관찰하였다 ( 그림 2.3C와 2.3D). 그러나간과 WAT에서 Akt의인산화상태를평가하였을때유의한차이는관찰할수없었다. 간의포도당신생과정에주요한효소인 PEPCK와 G6Pase 의간발현정도를보았을때 BPA 복용여부에따른차이는관찰되지않았다 ( 그림 2.4A). PFK와 GS의근육발현을평가하였을때도 BPA 투여여부에따른차이를발견하지못하였다 ( 그림 2.4B). 골격근에서 BPA에의해인슐린저항성이유도되는기전의하나로전염증성사이토카인과아디포카인의영향을알아보기위해혈중 IL-6, TNFα와아디포넥틴을측정하였다. 고지방식이군에서 BPA 투여시 IL-6와 TNFα는증가하고아디포넥틴은감소되는경향을 51

64 Figure 2.2 Long-term exposure to bisphenol A aggravated glucose intolerance in mice that received a high-fat diet (HFD). (A) Intraperitoneal glucose tolerance tests (IPGTTs) (D-glucose: 2g/kg body weight) were performed in 16- to 18-week-old male mice that received standard chow diet (CD) (open square), CD + bisphenol A (BPA) (open circle), HFD (filled square), or HFD + BPA (filled circle). P < 0.05 compared to HFD only (B) Measurement of the area under the curve (AUC) of the IPGTT in HFD and HFD + BPA mice. # P = compared to HFD only (C) Fasting insulin levels. Data are presented as means±s.e.m. 52

65 Figure 2.3 Long-term exposure to bisphenol A impaired insulin signaling in skeletal muscle. (A) Protein analysis of Akt phosphorylation at positions Thr308 in skeletal muscle. (B) Densitometry of Akt phosphorylation at position Thr308. P <0.05 compared to HFD only. (C) Protein analysis of GSK-3β protein levels and its phosphorylation at position Ser9. # P <0.05 compared to HFD only. Five mice were used in each group. The experiment was performed 3 times. Data are presented as means±s.e.m. 53

66 Figure 2.4 Long-term exposure of BPA did not change the hepatic expression of PEPCK and G6Pase nor the expression of GS and PFK in skeletal muscle. (A) Expression of PEPCK and G6Pase in hepatic tissue after treatment with BPA (B) Expression of glycogen synthase and phosphofructokinase in skeletal muscle after treatment with BPA. Five mice were used in each group. The experiment was performed 3 times. Data are presented as means±s.e.m. 54

67 보였으나통계적인유의성은없었다 ( 그림 2.5). BPA가골격근에미치는직접적인영향을확인하고자쥐의골격근세포주인 L6 세포를이용하여 in vitro 실험을진행하였다. 50 nm의 BPA를 6, 24시간처리하고 3 H-deoxyglucose uptake를측정하였을때대조군과비교하여유의한차이는관찰할수없었다 ( 그림2.6 A). T hr 308 위치에서 Akt 인산화를평가하였을때 0.01~100 nm의 B P A 를 2, 6, 2 4 시간처리후관찰하였을때유의한차이를발견할수없었다 ( 그림 2.6B). 4) BPA 투여후췌장의도세포면적이나췌장의인슐린함량의변화고지방식이군에서 BPA에의해악화된당불내인성의유발요인으로서, 근육조직에서의인슐린저항성과더불어췌장자체의장애도작용하는지확인하기위해췌장내도세포면적과췌장내인슐린양을검사하였다. 췌장면적당도세포면적은 BPA 투여군에서대조군과비교하여큰차이를관찰할수없었으며췌장내인슐린양또한차이가없었다 ( 그림 2.7A와 2.7B). 전자현미경검사를통해도세포를관찰하였을때 BPA 투여여부에따라미토콘드리아의형태나수는차이가없었다 ( 그림 2.7C와 2.7D). 2. INS-1 세포에서 BPA 처리에따른인슐린분비능 변화와산화스트레스의변화 55

68 Figure 2.5 Bisphenol A does not increase serum IL-6 and TNF-α levels nor decrease serum adiponectin levels. (A) Serum IL6 levels. (B) Serum TNFα levels. (C) Serum adiponectin levels. Five mice were used in each group. The experiment was performed 3 times. Data are presented as means±s.e.m. 56

69 Figure 2.6 Deoxyglucose uptake and Akt phosphorylation in L6 cell were not affected by BPA treatment (A) Effect of BPA on 3 H-Deoxyglucose uptake in L6 cell treated with 50 nm BPA over 6hr and 24hr. (B) Protein analysis of Akt phosphorylation at positions Thr308 in L6 cell according to the concentrations and exposure time of BPA. Representative results from at least three individual experiments are shown 57

70 Figure 2.7 Long-term exposure to bisphenol A did not induce any detrimental changes in the islet cell area or morphology or the insulin content of pancreas. (A) Percentage of islet cell area. (B) Percentage of insulin content in pancreatic tissue. Five mice were used in each group. The experiment was performed 3 times. Data are presented as means±s.e.m. (C) Pancreatic islet cell morphology by electron microscopy in mice fed a high-fat diet (HFD) only (20000X magnification). (D) Pancreatic islet cell morphology in mice fed an HFD and bisphenol A (BPA) (20000X magnification) 58

71 췌도세포주 INS-1 세포를이용하여 BPA 가췌도세포에미치는 직접적인영향을확인하고자실험을진행하였다. 1) BPA 처리후포도당자극인슐린분비능검사 50 nm의 BPA를 1, 6, 24 시간처리하고포도당자극인슐린분비검사를시행하였을때 BPA 처리후 24 시간째인슐린분비가증가하는경향을보였으나통계적으로유의한차이는없었다 ( 그림 2.8A). 2) BPA 처리후시간별 ROS INS-1 세포에서 DHE를이용하여염색후 50 nm의 BPA를 1, 6, 24 시간처리하고 ROS 정도를평가하였을때 DHE의적색형광이시간이지남에따라증가하는것을관찰할수있었다 ( 그림 2.8B). 59

72 Figure 2.8 Effect of BPA on GSIS and ROS production over time in INS-1 cells treated with 50 nm BPA. (A) BPA did not increase insulin secretion stimulated with glucose. (B) Fluorescence after DHE staining. Control (B1), 1 hr (B2), 6 hr (B3) and 24hr (B4) after the treatment of 50 nm BPA. 60

73 고찰 본연구는출생후시기의생쥐에서 12주동안경구로 BPA에노출시고지방식이군에서당불내인성이악화되고인슐린저항성을보임을관찰할수있었으나이는지방조직량이나비만도와는연관되어있지않았다. 12주간 BPA를경구투여시골격근에서 Akt 인산화는감소되었고 Akt 신호전달의하부에있는 GSK-3β의 Ser9위치에서인산화도골격근에서유의하게감소되어있음을관찰하였다. 하지만간이나백색지방조직에서 Akt 인산화는차이가없었고간에서포도당신생성에관여하는효소의유전자발현이나췌장의도세포면적및췌장내인슐린함량의변화도관찰할수없었다. BPA에의해유도된골격근의인슐린신호전달체계의장애는 L6세포실험을통해 BPA의골격근세포에미치는직접적인효과는아님을확인하였다. 당뇨병의두가지주요병인으로인슐린분비부족과인슐린저항성증가를들수있다. 본연구에서는출생이후 12주라는비교적오랜기간동안 TDI용량인 50 μg/kg/day의 BPA를경구로노출시켰을때췌장도세포의면적이나췌장내인슐린함량에영향이아닌인슐린저항성을증가시킴으로써당불내인성이유발됨을처음으로관찰하였다. BPA가당불내인성이나인슐린저항성을증가시킨다는결과는이전에발표된역학연구 (Lang 등, 2008; Shankar & Teppala, 2011; Wang 등, 2012) 나동물실험결과들 (Alonso-Magdalena 등, 2006; Wei 등, 2011; Batista 등, 2012) 과일치하는소견이다. 61

74 본연구 1장에서 BPA는간세포내미토콘드리아의구조손상과기능장애를유발하고산화스트레스표지자인 MDA와전염증성사이토카인인 IL-6와 TNF-α를증가시킴을밝혔다. 염증은인슐린저항성발생에매우주요한역할을한다. IκB kinase beta (IKK-β) / NFκB 경로는특히인슐린저항성의분자적중재자로 (Shoelson 등, 2003; 2006) IL-6와 TNF-α와같은전염증성사이토카인의증가는 c-jun NH2-terminal kinase(jnk) &/or IKK-β경로를유도하는것으로알려져있다. IKK-β와 JNK는잘알려진세린인산화효소로서 IRS1의세린기를인산화시켜인슐린의신호전달을저해한다 (Kim 등, 2008; Muoio & Newgard, 2008; Samuel & Shulman, 2012). 본연구에서장기간 50 μg/kg/day의 BPA를경구로노출시켰을때혈중 IL-6와 TNF-α가증가되는경향은관찰하였으나통계적유의성을확인하지는못하였다. 이는생체연구에서흔히나타나는실험동물들사이의개체차이때문일수도있고혹은사이토카인을측정한시점의한계일수도있다. 제 1장에서 BPA를 1회복강내로주사하고시간별로관찰하였을때 IL-6와 TNF-α는 6시간까지는증가하다 24시간째에는정상화되는것을확인하였다. 하지만이번연구에서전염증성사이토카인은 12주간의 BPA복용후연구종료시점에서샘플을얻었기때문에이런사이토카인의최대증가시점을놓쳤을가능성이있다. 전염증성사이토카인인 IL-6와 TNF-α는잘알려진아디포카인들이다. 염증이나산화스트레스와더불어체지방률의증가와아디포넥틴, 렙틴, IL-6및 TNF-α와같은아디포카인의변화는인슐린저항성에영향을미치는요인들이라알려져있다. Rubin & 62

75 Soto(2009) 의연구결과에따르면출산전후시기에 BPA에노출될경우노출된용량과비례해서, 특히여성에서체중이증가하였는데이런경향은지방세포의분화와지방축적에미치는 BPA의영향때문일수있다 (Masuno 등, 2002; Ben-Jonathan 등, 2009; Somm 등, 2009; Ohlstein 등, 2014). 따라서본연구에서도체중이나전신지방량에 BPA가어떤영향을미치는지조사하였으나대조군과비교하여체중이나지방량에뚜렷한증가를일으키지는않았고이는 Batista 등 (2012) 의연구결과나 Ding 등 (2014) 의연구결과와일관되는소견이었다. 본연구에서아디포카인을조사하였을때혈중아디포넥틴은감소하는경향을보인반면 IL-6와 TNF-α와같은전염증성사이토카인은증가하는경향을보였다. 비록지방세포에서아디포카인의분비를직접측정하지는않았지만 BPA와연관되어발생하는인슐린저항성에아디포카인이중요한역할을할수있을것으로추정해볼수있다. 그러나통계적인유의성은찾지못하였기에장기간의 BPA 경구투여와연관된인슐린저항성에미치는아디포카인의영향에대해결론을내기위해서는좀더많은연구가필요할것으로생각된다. 인슐린저항성이생기면 IRS-1과 Akt를통하는인슐린신호전달이약화된다. BPA는당부하검사나인슐린내성검사에서고일슐린혈증이나인슐린내성을보인다고알려져왔다 (Alonso- Magdalena 등, 2006; Batista 등, 2012). 그러나인슐린신호전달체계에 BPA가어떤영향을미치는지에대해서는결과가많지않다. 본연구에서는 BPA에노출시골격근에서 Akt 인산화를감소시킴을밝혔다. 이는최근 Batista 등 (2012) 이성인쥐에서 100 μg/kg의 63

76 BPA를 8일동안피하주사후인슐린자극시, 골격근에서인슐린수용체 β 아단위의티로신인산화와 Thr308위치에서 Akt인산화가손상된것을보인결과와일관된다. 또한저자들은간에서도인슐린수용체베타아단위의티로신인산화가감소됨을밝혔으나본연구에서는 BPA 처리후간이나지방조직에서 Akt인산화에유의한차이를발견하지는못하였다. 또다른연구로 Kidani 등 (2010) 은 3T3-L1 지방세포에 24시간동안 80 μm의 BPA를처리하고관찰시, Akt는 46%, Akt인산화는 29% 감소한다고보고하였다. 본연구에서는 BPA가 Ser9위치에서골격근의 GSK-3β의인산화를감소시키는것을확인하였고이는 GSK-3β의활성을증가시켜인슐린저항성을유발할수있다. 비록증거가충분하지는않지만다른연구의결과들과본연구의결과에근거하여 BPA가인슐린신호전달체계에교란을일으켜인슐린저항성을유발한다고볼수있겠다. 또한인슐린신호전달체계의교란을일으키는것이 BPA의직접적인효과인지관찰하기위해쥐의골격근세포주인 L6 세포로실험하였을때 3 H-deoxyglucose 섭취율이나 Akt 인산화에유의한차이를관찰할수없었다. 이는 BPA가분자적수준에서직접적으로인슐린저항성을유발한다기보다는어떤간접적인기전이작용할것이라생각해볼수있다. 본연구에서는당불내인성기전중하나로서 BPA가췌장에어떤장애를일으키는지살펴보기위해췌장도세포면적과모양, 그리고췌장내인슐린함량을조사하였으나대조군과비교하여유의한차이를발견하지못하였고도세포를전자현미경으로관찰하였을때도큰차이를발견하지는못하였다. 도세포에대한직접적인 64

77 작용을알아보기위해 INS-1 세포에서 50 nm의 BPA를처리하고관찰시 ROS 증가소견은관찰되었지만포도당자극인슐린분비능을조사했을때 24시간째인슐린분비가증가하는경향은관찰했으나통계적으로유의하지는않았다. Ding 등 (2014) 은수컷 Wistar rat에 BPA 50 μg/kg/day의용량을식이에섞어 35주간투여했을때고지방식이군에서당불내인성의악화가관찰되었고 BPA 투여군에서췌장의인슐린함량과도세포면적이유의하게증가되었는데이는췌장도세포의 ER 스트레스와자가탐식현상표지자인 Lc3/Atg8와자가탐식현상관련단백인 Beclin 1의증가와연관되어있었다고하였다. 본연구에서는췌장에서의산화스트레스나자가탐식현상관련실험을진행하지는않았으나 INS-1 세포에서 ROS증가를확인하여 BPA가도세포에서산화스트레스를증가시키는것을확인하였다. 본연구에서도세포면적이나인슐린함량의차이를확인하지못한것은 12주라는 BPA처리기간이 Ding의연구에비해짧았던것이한요인일수있겠다. 이상의두연구결과를바탕으로고려시골격근에서인슐린저항성이선행하여발생하고췌장에서인슐린합성과분비가증가되면서산화스트레스가증가되며, 저항성이지속될경우보상작용으로췌장에서도세포의인슐린함량증가와도세포면적증가가유도될수있을것으로생각된다. Alonso-Magdalena 등 (2006; 2010) 이보고한바에따르면 BPA가도세포에서인슐린분비나산화스트레스에변화를일으켜당불내인성과인슐린저항성을유발한다고하였다. 본연구에서는간에서포도당신합성이나인슐린의민감도를직접적으로측정하는더욱정확한방법인인슐린내성검사를 65