|
|
- 오중 홍
- 4 years ago
- Views:
Transcription
1
2
3
4
5
6
7
8
9 mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions Qsepharose051229manual001:1_Logbook Manual run 3:1_Logbook mau %B 400 S-300 SDS cut kda kda Waste kda min con min 17 kda 72 kda 10 kda 34 kda 25 kda 15 kda 10 kda Silver Staining of rllc1 (15% Acrylamide gel)
10 Immunized with rllc1 Spleen Cell Fusion HPRT- Myeloma 43 kda 34 kda 26 kda Hybridoma Cells HAT selection 17 kda 11 kda ELISA screening Sample: Ad-LLC1 H : uninfected + : infected Western blotting
11 A549 A549 LLC1 DAPI Merge vector LLC1 WI26 WI26 LLC1 DAPI Merge vector LLC1
12 Lung Salpinx Skin
13 Ad-LacZ Ad-LLC1 Con (pfu/cell) H1588 PARP-48 hr Beta-Actin PARP, 48 hr Beta actin H1703 Caspase 3 Caspase 9 (47/37 kda)
14 O.D. 0.2 M O I 0.8 M O I 3.2 M O I O.D. G F P L L C 1-G F P 0 G F P L L C - G F P G F P L L C - G F P G F P L L C - G F P MOI c o lo n y n u mb e r ( V e cto r L L C 1 co lo n y n u m b er (n ) mm< = 4mm 3mm 1~2mm 300 H v e c to r L L C 1 H1299 c o lo n y n u m b e r v e c to r L L C 1 H520 4mm 3mm 1~2mm c o lo n y n u m b e r v e c to r LLC 1 A549 4mm 3mm 1~2mm
15 300 c o lo n y n u m b e rb m m 4 m m 3 m m 1 ~ 2 m m 0 v e c to r L L C 1 Vector LLC1 Negative Control
16
17 #! + - #1 : yeast transformant of C20orf85 bait + : Positive control of protein-protein interaction - : Negative control of protein-protein interaction Master plate lacz expression SD-L.W. Filter assay ADE2 expression URA3 expression SD-L.W.A SD-L.W.U. The PBN204 yeast strain has lacz, URA3 and ADE2 as reporters. μ
18 lacz expression URA3 expression ADE2 expression Filter assay SD-LWU SD-LWA Master plate With bait With vector With bait + With vector - - : Negative control of protein-protein interaction + : Positive control of protein-protein interaction Prey plasmids were prepared by conventional E. coli transformation with yeast DNAs from 15 Ura + lacz + Ade + colonies. SD-LW Number of Colonies Library A Library B Library C 1 st 2 nd Reporter I (URA3) Reporter II (lacz) Reporter III (ADE2) Real Positives
19 Genomic DNA Targeting vector BamHI/XhoI cut BamHI RI KpnI XhoI RI XhoI RI probe 4.3kb RI RI RI RI RI neo DT Targeted locus BamHI/XhoI cut BamHI RI KpnI RI XhoI RI 8.6kb neo Targeting vector Digested by EcoRI 4.8kb 3.1kb 1.3kb 1kb
20
21 SAGE (Serial Analysis of Gene Expression) cdna synthesis Concatamer NlaIII digestion Linker Ligation BsmFI digestion and gap filling Sequencing and counting Tag frequency Ditag formation PCR amplification and Nla III digestion Log(Relative LLC-1 expression) H1703 H358 A549 H1299 Hop92 H226 H2170 H520 H522
22 13 adenocarcinoma, 9 squamous carcinoma: no expression 1 squamous and 1 adeno-carcinoma: weak and diffuse staining GATGAGCAAATGGGCCTAGAGGTGGACAAAGGGCCCAGAC*GTGAGCAAAGGATGGCAGCAAGCCC*GG ACCCAAGC*GAC*GC*GGC*GAAAGCACAGC*GACCCCACCCTC*GCCAGGTGCAGAGCCATTTCC*GCCTC C*GAGTCCTGC*GTTGCCTGGCAACC*GGTCTCCCAGGAGAC*GC*GAGAC*GCTGAGCCCAGGGCCAGAG CTTGC*GGGGCGCACAGAGCCCCCAGGCCTCATGGCGCAGAAACCTCTCAGCACCGCGGCGGCTGAACGC A Promoter GCCCGGACCCAAGCGACGCGGCGAAAGCACAGCGACCCCACCCTCG Unmethyl GTTTGGATTTAAGTGATGTGGTGAAAGTATAGTGATTTTATTTTTG Methylat GTTCGGATTTAAGCGACGCGGCGAAAGTATAGCGATTTTATTTTCG B H358 m CpG CpG H23 H1299 H522 Hop92
23
24
25
26
27
28
29
30
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information시작하기 시작할 준비가 되었으면 다음 설명에 따라 설문조사를 실시한다. 1단계: 허락받기 클럽을 떠나는 회원에게 에 응해 줄 것인지 물어본다. 이 설문 조사는 클럽의 문제점을 보완해 향후 같은 이유로 이탈하는 회원들이 없도록 하기 위한 것이며, 응답 내용은 대외비로 처
떠나는 이유 알아보기 왜 클럽을 떠나는가? 이는 클럽을 떠나기로 결심한 동료들에게 반드시 물어봐야 할 질문이다. 그리고 그 답이 무엇이든 다시는 같은 이유로 클럽을 떠나는 회원이 없도록 개선책을 마련해야 한다. 를 사용해 왜 회원들이 클럽을 떠나는지, 그리고 앞으로 회원들의 이탈을 막으려면 어떻게 해야 할 것인지 논의를 시작한다. 클럽 회원위원회는 이 설문조사를
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationPowerPoint Presentation
Interchapeter B : 핵산생물공학기술 (part A) Recombinant DNA techniques - 전기영동 - 제한효소 - 클로닝 - 대장균을이용한단백질대량생산 Agarose mesh DNA 분리기술 : Agarose Gel Electrophoresis ( 수평형 ) _ + DNA is negatively charged from the phosphate
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information(specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements) 11 (location selection) 12 (storage bin) 12 (i
SERVICE MANUAL N200M / N300M / N500M ( : R22) e-mail : jhyun00@koreacom homepage : http://wwwicematiccokr (specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements)
More informationPCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error
TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationSMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
More informationSMARTer Sequencing Kits for Next Generation Sequencing
Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationKH100¼³¸í¼�
9 PC 뷰어 9 PC 뷰어 재생 목록 전/후방 캡쳐 KV100 뷰어의 창 조정 버튼 중 전/후방 영상 버튼 을 누르면 나타납니다. 정지된 영상의 일부를 확대하거나 선명하게 보거나 파일로 저장, 인쇄 등을 할 수 있습니다. 창 크기 조절 우측 하단을 좌측 마우스 버튼을 누른채 늘이면 많은 양의 목록을 볼 수 있음 항목 39 명 칭 설 명 불러온 파일의 유형을
More informationSurpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,
More informationMicroarray 기초 및 응용
Microarray 기초및분석 이바이오젠 목 차 마이크로어레이기초 정의 / 분류 / 제작기술 / 원리 Gene Expression 실험분석 시료준비 RNA QC 실험분석과정 데이터분석 -2- 바이오칩 & 마이크로어레이 - 정의 1. 유리, 실리콘, 플라스틱등의매체위에생체 분자를집적하여만든것 2. 현재 DNA, 단백질, 화학물질, 유기물질등바 이오소재를집적하여만든
More information01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More informationITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot
2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library
More informationPRO1_18E [읽기 전용]
: S700 Siemens AG 999 All rights reserved Date: 0009 File: PRO_E Information and S7300 S7300 CPU () 3 S7300 CPU () S700 CPU () 5 S700 CPU () 6 S700 7 S700 : 9 CPU : 0 CPU : CPU : 3 SFC 35 5 ST7PRO : S700
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More informationPowerPoint Presentation
GE Healthcare Life Sciences 재교육프로그램 실험장비활용을위한재교육이필요하신고객님을위해본사의 Applications Specialists 가여러분의실험실로방문해서재교육서비스를제공해드립니다. 교육참여인원은가급적 3 명이내로제한해야의미있는 Hands-on 교육이될수있음을알려드립니다. 장비의보증기간이만료되었고, 서비스계약이체결되어있지않은고객님께는소정의교육비가부과됩니다.
More information2004 9 60 500 2004 11 1945 10 15 1963 1965 1974 12 2006 6 28 2008 1988 1982 1996 1991 1994
T H E N A T I O N A L L I B R A R Y O F K O R E A T H E N A T I O N A L L I B R A R Y O F K O R E A THE NATIONAL LIBRARY OF KOREA www.nl.go.kr 2004 9 60 500 2004 11 1945 10 15 1963 1965 1974 12 2006 6
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection)
SERVICE MANUAL (Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) 12 (Storage Bins) 12 (Ice Machine)
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information<3230303420B0B3C0CEC1A4BAB8BAD0C0EFC1B6C1A4BBE7B7CAC1FD2E687770>
인터넷 전화/팩스/이메일 방문 접수통보 분쟁조정 신청 및 접수 Case Screening 불만의 해소, 타기관 이첩 등 증거수집, 전문가 자문 등 사실조사 조정전 합의권고 YES 합의 NO 조정결정 NO 민사소송 또는 포기 YES 종료 200 180 190 180 160 163 140 120 100 80 60 40 20 116 100 57 93
More informationReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long
2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H
More information제11회 재외동포 문학상 수상집 재외동포 문학의 창 2009년 11월 30일 발행 발행처 재외동포재단 발행인 권영건 주소 서울시 서초구 서초2동 1376-1(외교센터 6층) 전화 (02)3415-0100 팩스 (02)3415-0119 http://www.korean.n
재외동포 문학의 창 제11회 재외동포 문학상 수상집 재외동포 문학의 창 2009년 11월 30일 발행 발행처 재외동포재단 발행인 권영건 주소 서울시 서초구 서초2동 1376-1(외교센터 6층) 전화 (02)3415-0100 팩스 (02)3415-0119 http://www.korean.net 제작 소통(02-895-3080) 비매품 ISBN 978-89-93454-19-2
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information,,,,,,,, (), BOD,,,,,,,,,
- 1 - ,,,,,,,, (), BOD,,,,,,,,, - 2 - - 3 - 3) 4) 5) 6) 7) - 4 - - 5 - (Analytical Spectrum) 1 Biosensors 2 Electro Analysis 3 Environmental 4 Drug Discovery 5 Food Quality and Safety 6 Gas and Liquid-phase
More information2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua
2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal
More information160215
[ 진경준, 대한민국 검사의 민낯! ] 진경준 검사 정봉주 : 진경준 검사장 사건이 충격적인가 봐요. 고위공직자 비리수사처 얘기도 나오는 걸 보니까. 왜 그래요, 느닷 없이? 김태규 : 공수처는 여러 검찰개혁안 중의 하나였죠. 검찰의 기 소독점주의를 견제하기 위해서는 공수처를 도입해야 한다 는 얘기가 오래 전부터 나왔고. 그런데 지금 정권이 레임 덕에 막 빠지려고
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More information203044-3.hwp
(a) Xbal BamHll pbi101 Stsy(896bp) GUS(1800bp) Nos3 GTCGACTCTAGACTGAAA-----------ATGGCTGGATCCCCGGGTGGTCAGTCCCTTATGTTACGT XbaI BamHI GUS start codon 250 200 intensity 150 100 50 0 1 2 3 4 5 6 7 8 9 10
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information歯320.PDF
Thermo Orion Model 320 PerpHecT Meter I. 1 II. A. 2 B. Keypad 3 III. A. 4 B. 4 IV. A. 5 B. 5 C. setup 6 V. ph A. 7 B. ph 8 VI. LogR ph A. 10 B. LogR? 11 C. LogR 12 VII. mv/ ORP/ A. mv 13 B. (, ) 13 VIII.
More informationA
2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4
More information1020041200.hwp
20 2004-7-1 21 22 2004-7-1 23 B M B P C B C C C C C Co M B P M B P B FC P B: C: M: P: C C FC C M FC : Co : :, 2004. 24 2004-7-1 25 1999 2000 2001 2002 26 2004-7-1 27 28 2004-7-1 29 30 2004-7-1 31 32 2004-7-1
More information歯김유성.PDF
BIT/ST/LSCO/MgO Variations of Microstructures and Electrical Properties of BIT/ST/LSCO/MgO Epitaxial Films by Annealing 2003 2 BIT/ST/LSCO/MgO Variations of Microstructures and Electrical Properties of
More information<BAB0C3B7322E20B7CEB5E5B8CABCBCBACEB0FAC1A62E687770>
별첨 2 1. 상품개발 자율성 제고 1 보험상품 신고제도 개선 1 2 표준약관제도 전면 정비 4 보험산업 경쟁력 강화 로드맵 세부 과제 3 보험상품 설계기준 자율화 5 4 부당상품 제조 판매에 대한 사후적 책임 강화 8 5 상품심의위원회 신설 9 6 배타적 사용권 확대 10 7 경험위험률 조정주기 자율성 확대 12 8 위험률 조정한도 폐지 13 9 위험률 안전할증
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information<3036B3E231C7D0B1E220B0ED31B1E2B8BBB0EDBBE7B4EBBAF1C6AFB0AD20B1B9BEEE28BBF32931B0AD2D33B0AD2D5BB1E8C0AFB5BFBCB1BBFDB4D45D2E687770>
2006년 1학기 기말고사 대비 EBS 고1 특강 국어-상 강의 교재 EBS 국어( 상) 특강 김유동 강의 전 일러두기 -------------------------------------------------------------------- 학습 범위는 교육부에서 지정한 수업 시간을 기준으로( 총 32 시간) '5. 능동적인 의사 소통 ~ 8. 언어와 세계'
More informationApplication of bioassay for endocrine disrupting chemicals( ) B.C.Lee, S.J.Kim, J.H.Yoon, Duong N.C., K.E.Jung, I.S. Choi, C.R.Cho, J.C.Cho, E.J.Kim,
Application of bioassay for endocrine disrupting chemicals( ) 2009 Application of bioassay for endocrine disrupting chemicals( ) B.C.Lee, S.J.Kim, J.H.Yoon, Duong N.C., K.E.Jung, I.S. Choi, C.R.Cho, J.C.Cho,
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information2014 LEADERSHIP SEMINAR AMWAY CRUISE OKINAWA SHANGHAI 암웨이라는 항해, 암웨이라는 도전, 암웨이라는 인생! 그래서 더 가치 있는 크루즈 리더십 세미나 HIGH SOCIETY FOR PROFESSIONAL 17세기 유럽의 귀족들
Amway Success Business Partner FEBRUARY 2014 VOL. 8 2014 LEADERSHIP SEMINAR AMWAY CRUISE OKINAWA SHANGHAI 암웨이라는 항해, 암웨이라는 도전, 암웨이라는 인생! 그래서 더 가치 있는 크루즈 리더십 세미나 HIGH SOCIETY FOR PROFESSIONAL 17세기 유럽의 귀족들은
More informationDisclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,.
PanGen Biotech Inc. INVESTOR RELATIONS 2015 Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,. Pangen BIOTECH INVESTOR RELATIONS 2015 Prologue Chapter 01. Chapter 02., Chapter 03.,
More information21세기 바이오 혁명
1865, 1990, HGP 1953, & DNA 1977, & DNA 2001, 99% 1983, PCR 2003, How many genes in the human genome? cdna sequencing Genomic sequencing Structural Genomics What is the role of each gene? Tissue distribution
More information1. 2. 3. 4. 5. 6. 7. 8. 9. 1. 과학 1. 성격 3 10. 1, 2 2, 3 I, I, I, I,,,,.,,,,..,,,.,,,,..,,,. 2. 목표,. 2.,..,..,..,,. 3. 내용 가. 내용체계 3 4 5 6 7 8 9 10 나. 학년별내용 .. 3.,.,,.,,.....,.. 4...,,..,.,.., 5....,,
More information170 김위식ㆍ김기홍ㆍ김춘섭ㆍ오명주, (LaPatra, 1996; Watanabe et al., 1998; 2000; Kibenge et al., 2002). ELISA, 2 IgM. ELISA IgM (monoclonal antibody, MAb). IgM manna
한수지 50(2), 169-174, 2017 Original Article Korean J Fish Aquat Sci 50(2),169-174,2017 넙치 (Paralichthys olivaceus) 의 immunoglobulin M 에대한단클론항체생산 김위식 김기홍 김춘섭 1 오명주 * 전남대학교수산생명의학과, 1 엔바이로젠 Production of Monoclonal
More informationMON89788
2009 2 < 차례> 1 요약서 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 3 (1) 분류학적특성( 일반명, 학명, 계통분류등) 3 (2) 재배및품종개량의역사 4 (3) 기지의독성또는알레르기유발성
More informationBenchtop Flow Cytometry guava easycyte Systems 머크밀리포아의 guava easycyte System 은특허받은 microcapillary 기술을이용한컴팩트한시스템으로다양하고복잡한세포분석이가능합니다. Cell Health Cell S
Benchtop Flow Cytometry guava easycyte Systems 머크밀리포아의 guava easycyte System 은특허받은 microcapillary 기술을이용한컴팩트한시스템으로다양하고복잡한세포분석이가능합니다. Cell Health Cell Signaling Stem Cells Immunology Cell Counting & Viability
More information1) 음운 체계상의 특징 음운이란 언어를 구조적으로 분석할 때, 가장 작은 언어 단위이다. 즉 의미분화 를 가져오는 최소의 단위인데, 일반적으로 자음, 모음, 반모음 등의 분절음과 음장 (소리의 길이), 성조(소리의 높낮이) 등의 비분절음들이 있다. 금산방언에서는 중앙
금산 은 상위의 중부방언에 속한다. 충청남도의 핵방언권 중 (A)지역, 즉 충청 남도의 남부이며 전라북도와 주로 접경을 이루는 방언권이다. 그중 충청남도의 최 남단에서 전라북도와 경계를 이루고 있는 지역이 금산 이라는 점은 주목할 만하 다. 금산 지역이 전라북도와 지리적으로 인접해 있어 문화 등 제반 교류의 가능성 을 엿볼 수 있고, 이는 곧 금산과 전북방언과의
More informationDNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo
2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme
More information09 ½ÅÇù3¿ùb63»ÁöÃÖÁ¾FFš
2009 +03 Special Story 04 06 08 In Happy 10 14 17 18 20 22 With 24 27 28 30 31 32 34 2009. 03 Vol.423 Story 1 Story 2 Story 3 04 Special Story1 MARCH 2009 05 Special Story 2 01 06 02 03 MARCH 2009 07
More information연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진
연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진 요약문 i ii 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 iii iv 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 v vi 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인
More information증정 Bio-Rad 가제안하는 FAST Western Blot! FAST Western Blot 기존 acrylamide/bis solution FastCast TM TGX acrylamide solution Gel 준비 (Gel solution 준비 - casting
Bio-Rad 연말할인행사 기간 : 2015 년 10 월 19 일 ~ 12 월 18 일까지 FAST Western Blot Best Western Blot 을위한시약 & 소모품 Real-Time PCR Reagents 행사제품 400 만원이상구매시, Integra PIPETBOY ACU 증정 ( 색상랜덤 ) 증정다양한 application 에따라흡입 / 분주속도조절가능
More information<C3D6C1BEBAB8B0EDBCAD2E687770>
Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)
More informationPowerPoint 프레젠테이션
Product News Letter 4 호 User s Guide for Ligation Independent Cloning Inspect into "Overlap Cloner" Cloning 의일반적인방법 미래기술 Recombineering "Overlap Cloner" 의원리와응용분야 자주하는질문 Trouble Shooting 은단백질전문기술기업입니다기술혁신형중소기업입니다고객상담전화
More information歯TC프로그래밍매뉴얼
Turning Center (TC) HX - Programming Manual Serial No. : PG-20011119 HX - Programming Manual Turning Center (TC) 1...!. 2 (Program)...19 3 (G )...33 4 (Interpolation Functions)...37 5 (Feed Function)...73
More information한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium
More informationBIONEER CORPORATION Preface 본책자는포스트게놈시대의생명공학연구실의필수적인연구장비인 ExiProgen 에관한설명서입니다. ExiProgen 은무세포 transcription, translation 반응과 magnetic affinity purification 을이용하여 DNA 로부터다양한단백질들을전자동으로합성하고고순도로정제할수있어생명공학의획기적인발전을가져올수있는신개념의장비입니다.
More information09 ½ÅÇù2¿ùÈ£b63»ÁöÁ¤¸»ÃÖÁ¾š
2009 +02 Special Theme 04 06 08 In Happy 10 14 17 18 20 22 With 24 27 28 30 31 32 34 2009. 02 Vol.422 Theme 1 Theme 2 Theme 3 04 Special Theme1 FEBRUARY 2009 05 Special Theme2 06 FEBRUARY 2009 07 Special
More informationÁÖºÎ10º»¹®-ÃÖÁ¾
2009 10 4 6 8 10 12 14 16 2009 10 18 20 22 24 26 28 29 30 31 50 Consumer News Consumer News Health News Health News Food News Food News 음이야기/음별 궁합② 내가 먹는 수산물과 찰떡궁합 인 음 음으로 고치 못하는 병은 약으로도 고치 못한다고
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information: : : : : : : : : : : : - 1 -
: : : : : : : : : : : : - 1 - Ⅰ Ⅱ Ⅲ - 2 - Ⅳ - 3 - Ⅴ - 4 - - 5 - - 6 - - 7 - - 8 - 제 1 장 연구개발과제의개요 μm mm cm cm - 9 - - 1 - - 11 - - 12 - - 13 - - 14 - 제 2 장 국내외기술개발현황 - 15 - - 16 - - 17 - - 18 - - 19 -
More information슬라이드 1
DNA technology (DNA 조작기술 ) 유전자 cloning Cloning & Plasmid Joshua Ledergerg & Edward Tatum, 1946 두종류의다른유전자를가진대장균사이에유전자의재조합이일어나새로운대장균이만들어지는것을발견했다. 이원리를바탕으로 1970 년대에 DNA 재조합기술이발전하게되었다. 원핵생물에서 DNA 의이동방법 플라스미드를이용한
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information15_3oracle
Principal Consultant Corporate Management Team ( Oracle HRMS ) Agenda 1. Oracle Overview 2. HR Transformation 3. Oracle HRMS Initiatives 4. Oracle HRMS Model 5. Oracle HRMS System 6. Business Benefit 7.
More information<30342E494244C1BEC7D5C3D6C1BEBAB8B0EDBCAD28B1E8BCB1C1DF292E687770>
최 종 연구보고서 닭 전염성 낭병(Infectious bursal disease)의 진단법 및 백신개발 Development of Diagnostic Methods and Vaccine for Avian Infectious Bursal Disease 연 구 기 관 서 울 대 학 교 농 림 부 제 출 문 농림부 장관 귀하 본 보고서를 닭 전염성 낭병(Infectious
More information전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기
국순당 배중호 대표의 우리 술 강좌 : 백세주 성공신화, 그 비결 전체 목차 1. 주류 일반 2. 기능성 3. 숙취 4. 주세법 5. 주류 일반 상식 6. 우리술 즐기기 1. 주류 일반 술 소비량으로 본 세계지도 집값으로 본 세계지도 군사비 지출로 본 세계지도 1. 주류 일반 주류일반 전통주 정의 전통주 특징 전통주 역사 국순당과 전통주 계승 전통주 담그기
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationPowerPoint Presentation
GE Healthcare Life Sciences 재교육프로그램 실험장비활용을위한재교육이필요하신고객님을위해서본사의 Applications Specialists 가여러분의실험실로방문해서재교육서비스를제공해드립니다. 재교육은기본교육과, 교육과정에서고객님의시료를적용하는고급교육으로나누어제공합니다. 교육참여인원은가급적 3 명이내로제한해야의미있는 Hands-on 교육이됨을알려드립니다.
More information<BAB9C0E2B0E820B3D7C6AEBFF6C5A9BFCD20B5A5C0CCC5CD20B0FAC7D0C0C720B1B8C1B6BFCD20C6AFC2A15FC1A4C7CFBFF528BCF6C1A4292E687770>
복잡계 네트워크와 데이터 과학의 구조와 특징 정하웅(KAIST, 물리학과) 2015.12. 1 I. 서론 II. 본론 1. 세상은 복잡계로 이루어져 있다 가. 복잡계란 무엇인가? 나. 복잡계를 이해하기 위한 몇 가지 네트워크 사례들 2. 네트워크의 이해를 위한 전제들 가. 네트워크의 분류 나. 네트워크의 대부분을 차지하는 항공망 네트워크 다. 네트워크는 왜
More information*통신(중)1607_01-도비라목차1~10
ISSN 5-693 16. 7 16. 7 1 15 16...6 3.9. 1. 1.1.9 1.7. 1.5 1.3 1.7...5 5. -1.7 1.7-1.8 1.9 7.3 6.9 7. 7. 6.9 6.8 6.7 1 11 1 9 8 7 6 5 3 1 i 6 15 1 5 3 3 - - -5-1 -6-15 -8 - -1-5 1 6 1,3 1 1, 1,1
More informationBio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미
Bio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미지획득까지! Gel Doc EZ system "UV tray 포함 " 스마트한개인용 PCR
More information분 기 보 고 서 (제 55 기 1분기) 사업연도 2015년 01월 01일 2015년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2015년 05월 15일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 현대증권 주식회사 대 표 이
목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...17 3. 자본금 변동사항...19 4. 주식의 총수 등...20 5. 의결권 현황...21 6. 배당에 관한 사항 등...21 II. 사업의 내용...23 III. 재무에 관한 사항...73 1. 요약재무정보...73 2. 연결재무제표...78
More informationWestern Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch
2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information슬라이드 1
TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)
More information교육정책연구 2000-특-28 지식기반사회의 교육이념과 교육정책 연구책임자 : 정범모 (대한민국학술원 회원) 공동연구자 : 박영식 (대한민국학술원 회원)
교육정책연구 2000-특-28 지식기반사회의 교육이념과 교육정책 대한민국학술원 정 범 모 교 육 인 적 자 원 부 교육정책연구 2000-특-28 지식기반사회의 교육이념과 교육정책 연구책임자 : 정범모 (대한민국학술원 회원) 공동연구자 : 박영식 (대한민국학술원 회원) 이 연구는 2000년도 교육인적자원부 교육정책 연구과제에 의해 연구되었음. 이 연구는 교육인적자원부
More information생명의 신비를 푸는 화학
빅뱅의 세 기둥_김희준(서울대학교 화학부 명예교수) 탈레스 등 고대 그리스의 철학자들로부터 출발한 인류의 과학은 2500년 정도의 역사를 지녔고, 갈릴 레오에 의해 근대 과학이 출발한 지도 500년이 지났습니다. 이러한 과학 전체의 역사를 통틀어서 가장 위대한 발견을 하나만 꼽으라면 인간이 우주 자체의 기원을 발견한 것이라고 볼 수 있습니다. 우주의 기 원에
More information