DBPIA-NURIMEDIA
|
|
|
- 문영 탁
- 4 years ago
- Views:
Transcription
1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 39(4), 595~601(2010) DOI: /jkfn Multiplex Polymerase Chain Reaction(PCR) 법을이용한 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus 의다중동시검출 정유석 1 정희경 1 전원배 2 서화정 2 홍주헌 3 1 ( 재 ) 대구테크노파크바이오산업지원센터 2 대구경북과학기술원 3 대구가톨릭대학교외식식품산업학부 Simultaneous Detection of Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus by Multiplex Polymerase Chain Reaction Yoo Seok Jeong 1, Hee Kyoung Jung 1, WonBae Jeon 2, HwaJung Seo 2, and JooHeon Hong 3 1 Bio Industry Center, Daegu Technopark, Daegu , Korea 2 Daegu Gyeongbuk Institute of Science & Technology, Daegu , Korea 3 Dept. of Food Science and Technology, Catholic University of Daegu, Gyeongbuk , Korea Abstract This study was conducted to detect and identify Staphylococcus aureus, Vibrio parahaemolyticus, and Salmonella enterica subsp. using simultaneous multiplex polymerase chain reaction (multiplex PCR) assay. 23S rrna partial gene (S. aureus), tox R gene (V. parahaemolyticus), and inv A gene (S. enterica subsp.) as diagnostic marker gene were suggested, and their amplicon sizes were 482 bp, 368 bp, and 284 bp, respectively. Non specific amplicons by STA5F/STA5R primer, ToxRF/ToxRR primer, and 139/141 primer were not observed in genomic DNA of pathogen bacteria as Bacillus cereus, Listeria monocytogenes, Escherichia coli, Proteus vulgaris, Streptococcus pyogenes, Candida albicans, and Shigella sonnei. The extracted crude DNA of targeted bacteria was detected as PCR template successfully. The detection limits were 10 5 ~10 4 CFU/mL and 10 pg of purified genomic DNA of S. aureus, V. parahaemolyticus, and S. enterica subsp. by using simultaneous multiplex PCR. Key words: Staphylococcus aureus, Vibrio parahaemolyticus, Salmonella enterica subsp., multiplex PCR 서론사람이식품에오염된화학적독소, 자연적독소및위해미생물을섭취함으로써발생하는질병을식중독이라하는데국내식중독사고는 1990년대비 2006년에환자수는 618 명에서 10,833명으로 16년사이 17배가증가하였으며, 식중독사고 1건당환자의발생비율도 41명으로약 2.16배가증가하였다 (1). 또한단체급식의증가와외식산업의발달로식중독발생건당그규모가커지고발생건수에서도증감을반복하며지속적으로발생하고있다. 이에따라먹거리에대한국민의불안감이고조되고건강한삶의영위를위해식품으로부터오는위해를사전에예방하거나최소화하는등식품의안전성확보에대한중요성이높아졌다. 국내식중독현황을보면, 발생되는 80~90% 가세균성식중독이차지하고있으며 Salmonella, Vibrio parahaemolyticus, Staphylococcus aureus 균의순서로발생하고있다. Staphylococcus aureus는병원내감염의주요원인균외에 도사람과동물의화농성상처를통해서식품으로오염되는대표적인독소형식중독균으로알려져있으며 (24), Salmonella는급성패혈증, 심한위장염증상과발열, 구토를동반하는식중독균으로유제품이나가금류, 즉석식품등에서발생되며국내외에서식중독을일으키는가장큰주요원인균으로알려져있다 (58). 국내수산물에의한위장염의 30% 를차지하고있는 Vibrio parahaemolyticus는해수온도가상승하면균수가급격히증가하며여름철해수에서빈번히분리되어지고있다 (9,10). 지구온난화로인하여계절에관계없이연중식중독이발생할뿐만아니라 (11), 농 축산물원료및가공식품의수출입자유화에따른국제간의교류확대및식생활패턴변화에의한단체급식, 가공식품, 냉장및냉동식품, 즉석식품등의소비증가가다발적인집단식중독발생증가의주요요인이되고있다 (12). 식품으로부터경제적, 사회적으로문제가되는병원성세균검출을위한노력들이시도되었으며, 생화학적특성을이용한전통적분석방법에서부터최근에는분자생물학적 Corresponding author. jhhong@cu.ac.kr Phone: , Fax:
2 596 정유석 정희경 전원배 서화정 홍주헌 방법까지다양하게개발되어졌다 (13). 전통적인식중독균검사방법은장기적인시간과많은노동력등이요구되어늘어나는검사수요를감당할수없을뿐만아니라신속성이낮아조기발견으로의역할은미비하다. 최근의분자생물학중심으로연구되어진병원성세균검출법을살펴보면, 항체를이용하여균주의특이적항원을측정하는면역학적방법으로면역크로마토그래피 (14), 면역리포좀 (15) 등이개발되었다. 또한유전학적방법으로일반적으로 Polymerase Chain Reaction(oly) 을이용하여균주의특정 DNA 서열을증폭시켜진단하는것으로대상유전자들은주로병원성균주의독소유전자 (1618) 나병원균에서발현하는고유단백질유전자, 원시핵세포의 genome상에간헐적으로분산되어있는반복적인 DNA sequence를 16S rrna 유전자등을사용한연구도있다 (19,20). 개발되어진유전학적검출법은오판정확률과미량검출이어렵다는이유등으로산업적으로활성화가미약하며, 따라서시장에서는검출결과의정확성및검출비용의절감과함께새로운검출법요구가지속적으로이루어지고있다. 본연구에서는국내식중독주요원인균으로보고되어지고있는 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus의검사시간및비용절감을통해국내식품업계의경제적인식중독검출을위한기반을마련하고자 PCR을이용한다중동시검출에대해조사하였다. 재료및방법사용균주및배양조건식중독주요원인균인 Staphylococcus aureus(s. aureus), Salmonella enterica subsp.(s. enterica subsp.), Vibrio parahaemolyticus(v. parahaemolyticus) 에대한검출의지표가되는바이오마커유전자검출을위해본연구에서사용되어진균주들은한국생명공학연구원생물자원센터 (KCTC) 와한국미생물보존센터 (KCCM) 에서분양받아사용하였다. 사용된균주와배양조건은 Table 1과같다. Genomic DNA 및 crude DNA 추출사용되어진균주들로부터정제된 genomic DNA와 crude DNA를추출하여 PCR을위한 template로써사용하였다. 각균주의배양액을 5 ml씩취하여 12,000 rpm으로원심분리한후상층액을제거하고회수한균체를 1 ml의멸균증류수로현탁시킨후자동핵산추출기 (Magtration system 6GC, PSS, Chiba, Japan) 를사용하여 genomic DNA를추출및정제하였다. 각균주의 genomic DNA는 Nanodrop(ND1000, Thermo, Waltham, USA) 을이용하여 260 nm에서정량하였으며, 10배단계희석을통해 10 ng/μl에서 1 pg/μl 농도까지 PCR 반응으로검출한계를확인하였다. 즉, spectrophotometer(secomam, UVIKON, Leeds, UK) 를이용하여흡광도 600 nm에서 0.666의각균주배양액 ( 10 8 CFU/mL) 을 10배단계희석을통해 10 6 ~10 2 CFU/mL로준비하였으며각균액 100 μl를 Fig. 1과같은방법으로 crude DNA를추출하여 PCR을위한 template로사용하였다. 동일부피의희석되어진균액을고체배지에도말하여 plate counting 방법으로균수를개수하여 CFU/mL 값으로검출한계를확인하였다. Harvest of Bacteria (12000 rpm, 20 min, cfg) Washing with 2.5% NaCl (12,000 rpm, 20 min, cfg) Treatment of achromopeptidase (250 U/mL) 55 o C, 30 min Treatment of proteinase K and 10% Chelex 60 o C, 30 min 95 o C 10 min Ice 2 min 8,000 rpm, 2 min, cfg Supernant (=crude DNA sample) 3 repeat Fig. 1. Extraction of crude DNA as template. Table 1. Pathogenic bacteria and media used for experiments Strain Media Incubation temperature Staphylococcus aureus subsp. aureus (KCTC 1621) Vibrio parahaemolyticus (KCTC 2471) Salmonella enterica subsp. (KCTC 2514) Bacillus cereus (KCTC 1012) Proteus vulgaris (KCTC 2433) Escherichia coli (KCTC 2593) Listeria monocytogenes (KCTC 3569) Streptococcus pyogenes (KCTC 3096) Candida albicans (KCTC 7965) Shigella sonnei (KCCM 41282) Trypticase soy media Marine media Brain heart in fusion media Brain heart in fusion media Yeast mold media 30 o C 30 o C 25 o C
3 PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 597 Table 2. Oligonucleotide primer sequences used in this study Strain Gene (PCR product size) Primer DNA sequence (5'3') Temp. ( o C) Staphylococcus aureus Vibrio parahaemolyticus Salmonella enterica subsp. 23s rrna (482 bp) toxr (368 bp) inva (284 bp) STA5F (forward primer) STA5R (reverse primer) TOXF (forward primer) TOXR (reverse primer) 139 (forward primer) 141 (reverse primer) TGGATTGCACGTCTAAGCAG TTACCCGACAAGGAATTTCG GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC Primer set 식중독주요원인균인 S. aureus, S. enterica subsp., V. parahaemolyticus를검출하고자선별되어진특이적 primer set은 Table 2와같다. V. parahaemolyticus는 TOXF/ TOXR primer set(21), S. enterica subsp. 는 139/141 primer set(22) 를사용하여특이적검출을위해유전자를증폭하고자하였다. S. aureus는 23S rrna gene의특이적부분을증폭시킬수있는유전자로본연구에서신규디자인하였으며사용되어진 primer는 Bioneer(Daejeon, Korea) 에합성을의뢰하여사용하였다. PCR 조건 Singleplex PCR의조성은 0.2 ml tube에 template DNA 1 μl, 각 forward와 reverse primer(10 pmol/μl) 1 μl씩, 2 Taq premix(solgent, Daejeon, Korea) 12.5 μl와최종반응액이 25 μl가되도록멸균 3차증류수를첨가하여 iq5 system(biorad, Chicago, USA) 을이용하여표적유전자를증폭시켰으며검출한계및비특이적 PCR반응을조사하였다. S. aureus, S. enterica subsp., V. parahaemolyticus 균주들의다중동시검출을위한 simultaneous multiplex PCR의조성은각균주의 template DNA 1 μl씩, 각 3개의 forward와 reverse primer set(10 pmol/μl) 1 μl씩, 2 Taq premix(solgent) 12.5 μl와최종반응액이 25 μl가되도록멸균 3차증류수를첨가하여검출한계를알아보았다. PCR 반응조건은 95 o C에서 3분 predenaturation 후 95 o C 1분, 61 o C 30초, 72 o C 30초를 1 cycle로하여총 30 cycle 반응후, 마지막으로 72 o C에서 50초수행하였다. PCR 산물들은 ethidium bromide를포함한 1.8% agarose gel에서각균주표적유전자의예상되어진 size를확인하였다. 또한증폭되어진 PCR products를 Tvector(Promega Co., Madison, USA) 에클로닝하여 sequencing 의뢰 (Solgent) 를통해염기 서열을분석한결과를 NCBI의 blast search( nih.gov/) 의표적유전자염기서열과의비교하여확인하였다. 결과및고찰 S. aureus, S. enterica subsp., V. parahaemolyticus 의다중동시검출을위한 primer set 구성 PCR 방법에의하여 S. aureus, S. enterica subsp., V. parahaemolyticus를다중동시검출하고자각각식중독원인균주의특이적유전자를조사하였다. 따라서바이오마커용유전자의검출을위한 primer set을구축하고자하였으며, S. enterica subsp의경우, 균침입성인자관련유전자인 inva 유전자부위를증폭시킬수있는 139/141 primer를 V. parahaemolyticus는독소유전자인 toxr 유전자부위를증폭시킬수있는 ToxRF/ToxRR primer를각균의검출을위한 primer로선정하였다. 또한 S. aureus에서는 23S rrna gene의특이적유전자를증폭시킬수있는 STA5F/ STA5R primer를본연구에서신규로디자인하여선정하였다. PCR 증폭을통해각균주 genomic DNA로부터특이적으로증폭되어진바이오마커유전자, 즉각기다른 size의예상되어진 PCR 산물들을 agarose gel 상에서 284 bp(s. enterica subsp.), 368 bp(v. parahaemolyticus), 482 bp(s. aureus) 로확인하였다. Tvector에클로닝되어진각 PCR 산물의 sequencing을통한염기서열분석으로표적유전자임을확인하였으며, 또한각 primer set들은해당균주외다른두식중독원인균에대하여비특이적인교차반응이일어나지않음을확인하였다 (Fig. 2). S. aureus, S. enterica subsp., V. parahaemolyticus 검출 primer set의특이성구축되어진 primer set의특이성을확인하고자타병원성균주인 Bacillus cereus, Listeria monocytogenes, Escherichia Fig. 2. Agarose gel electrophoresis of PCR fragment generated by PCR amplification with STA5F/STA 5R, 139/141 and TOXF/TOXR primer. Lane 1: STA5F/STA5R primer, lane 2: ToxRF/ToxRR primer, lane 3: 139/141 primer, lane M: 100 bp ladder. A: a PCR fragment generated by PCR amplification from genomic DNA of S. aureus, V. parahaemolyticus and S. enterica subsp. with primer. B: a nonspecific PCR products of S. aurues, V. parahaemolyticus and S. enterica subsp. with each non targeted primer set.
4 598 정유석 정희경 전원배 서화정 홍주헌 Fig. 3. Agarose gel electrophoresis of PCR fragment generated by PCR amplification with STA5F/STA5R, 139/141, and TOXF/ TOXR primer. Lane 1: Bacillus cereus (KCTC 1012), lane 2: Listeria monocytogenes (KCTC 3569), lane 3: Escherichia coli, lane 4: Proteus vulgaris (KCTC 2433), lane 5: Streptococcus pyogenes (KCTC 3096), lane 6: Candida albicans (KCTC 7965), lane 7: Shigella sonnei (KCCM 41282), lane M: 100 bp ladder. Table 3. Singleplex PCR for detection of specific gene in various bacteria strain Strain Staphylococcus aureus subsp. aureus (KCTC 1621) Vibrio parahaemolyticus (KCTC 2471) Salmonella enterica subsp. (KCTC 2514) Bacillus cereus (KCTC 1012) Listeria monocytogenes (KCTC 3569) Escherichia coli (KCTC 2593) Proteus vulgaris (KCTC 2433) Streptococcus pyogenes (KCTC 3096) Candida albicans (KCTC 7965) Shigella sonnei (KCCM 41282) 1) STA5F (forward)/sta5r (reverse) primer. Target gene 23S rrna 1) toxr 2) inva 3) + 2) ToxRF (forward)/toxrr (reverse) primer. 3) 139 (forward)/141 (reverse) primer. + + coli, Proteus vulgaricus, Streptococcus pyogenes, Candida albicans, Shigella sonnei의 genomic DNA를주형으로 PCR 을통해확인한결과, 각 primer set들은타병원성균주에대한비특이적반응을일으키지않았다 (Fig. 3, Table 3). S. aureus, S. enterica subsp., V. parahaemolyticus의 multiplex PCR법에의한다중동시검출에있어서는 template DNA 또는 primer set들이혼합된상태에서정확한검출과동정이이루어져야한다. 따라서 primer set들간의비특이적인유전자증폭반응과 template DNA 간에비특이적유전자증폭반응에대하여조사하였으며, simultaneous multiplex PCR 방법으로재현성과정확성에대해조사하였다. 그결과, 각 primer set들간에그리고각균주의 genomic DNA 간에비특이적인유전자증폭반응이발생하지않음을확인하였으며 (Fig. 4, lane 1, 2), 세종류의 primer set와한균주의 genomic DNA의 PCR 반응시표적되는유전자를특이적으로각각예상되어지는유전자크기로써증폭하였으며균종을검출및동정할수있었다 (Fig. 4, lane 3~5). 또한세균주의 genomic DNA와각각한종류의 primer set 반응시표적되는유전자를특이적으로각각예상되어지는유전자크기로써증폭하였으며균종을검출및동정할수있었다 (Fig. 4, lane 6~8). S. aureus, S. enterica subsp., V. parahaemolyticus 세균주의 genomic DNA mixture와 3종류의 primer set mixture를이용한 simultaneous multiplex PCR을수행하였으며, 주형과 primer set 간에유전자증폭이경쟁적으로일어나거나다량의유전자증폭에의하여 multiplex PCR 반응의저해가우려되었다. 하지만각각식중독균의바이오마커유전자, 즉 S. aureus의 23S rrna Fig. 4. Agarose gel electrophoresis of specific PCR fragment generated by multiplex PCR amplification with STA5F/ STA5R, 139/141 and TOXF/TOXR primer. Lane M: 100 bp ladder, lane 1: STA5F/STA5R, 139/141 and ToxRF/ ToxRR primer, lane 2: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp., lane 3: Genomic DNA of S. aereus with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 4: Genomic DNA of V. parahaemolyticus with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 5: Genomic DNA of S. enterica subsp. by STA5F/STA5R, 139/141 and ToxRF/ToxRR primer, lane 6: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp. with STA5F/STA5R primer, lane 7: Genomic DNA of S. aereus V. parahaemolyticus, and S. enterica subsp. with ToxRF/ToxRR primer, lane 8: Genomic DNA of S. aereus, V. parahaemolyticus, and S. enterica subsp. with 139/141 primer, lane 9: Genomic DNA of S. aereus, V. parahaemolyticus, and S. enterica subsp. with STA5F/STA5R, 139/141 and ToxRF/ToxRR primer. partial gene(482 bp), V. parahaemolyticus의 toxr gene(368 bp), S. enterica subsp. inva gene(284 bp) 의특이적 size를가지는 PCR 산물을성공적으로증폭시켰다 (Fig. 4, lane 9). 따라서본연구에서구축되어진 ToxRF/ToxRR, STA 5F/STA5R, 139/141 primer는 S. aureus, S. enterica subsp., V. parahaemolyticus의다중동시검출을위한적합한 pri
5 PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 599 mer set 구성임을확인할수있었다. Singleplex 및 multiplex PCR 방법에의한 genomic DNA 의검출한계 S. aureus, S. enterica subsp., V. parahaemolyticus 세식중독원인균주에서분리정제되어진 genomic DNA의농도에따른검출한계를확인하고자정제되어진 DNA를 10배단계희석하여 singleplex PCR 반응결과를조사하였다. 그결과, S. aureus, S. enterica subsp., V. parahaemolyticus의 genomic DNA를 10 pg까지검출할수있었다. 또한희석되어진 genomic DNA 혼합액을 template로 multiplex PCR법으로유전자를증폭시킨결과, singleplex PCR에서보인동일한검출한계즉, 10 pg genomic DNA를다중동시검출을할수있었다. 약 800 bp size의비특이적유전자증폭이발생하였으나이는표적되어지는 PCR products의크기에해당되지않으며 singleplex와 multiplex PCR에서검출되어지는한계의동일성으로검출및동정에영향을주지않는것으로사료된다 (Fig. 5). Jeong 등 (18) 은 Salmonella의 PCR 검출시 genomic DNA 1 pg까지검출이가능하다고하였는데본연구에서는세균주모두 single 및 multiplex PCR법에의해 10 pg까지의낮은검출능을나타내었다. 이는 simultaneous multiplex PCR 반응시비특이적반응발생을방지하고자설정되어진본연구에서사용되어진 PCR 조건중증폭 cycle 수등의요인에의한것으로생각되며, 따라서 cycle 수와최적 primer 농도설정에따라그검출한계를높일수있을것이라사료된다. 생균수와 singleplex 및 multiplex PCR 방법의검출한계본연구에서는 S. aureus, S. enterica subsp., V. parahaemolyticus 의검출을위하여상업적 kit 및전통적인방법에의한 DNA 추출및정제방법이아닌 crude DNA 추출을통해비용절감과함께 PCR 검출한계를알아보고자하였다. 검출하고자하는식중독원인균중그람양성균인 S. aureus 를고려하여 achromopeptidase 처리를통해균량에비례되는 crude DNA를안정적으로추출하였다. 상업적 kit 사용에의한 DNA 추출과본연구에서사용되어진 DNA 추출프로토콜에의한시간적소비는큰차이를보이지않았으며, 비용면에서절감할수있었다. 추출되어진 crude DNA는 PCR 반응을위한 template로써성공적으로사용되어졌다. 각표적식중독원인균의희석배양액으로부터 plate counting 방법을통해얻어진생균수 (CFU/mL) 에대한검출한계를조사하였다. 그결과, S. aureus는 CFU/reaction 즉, CFU/mL까지검출확인이가능하였으며, V. parahaemolyticus는 CFU/reaction 즉, CFU/ ml까지검출이가능하였다. S. enterica subsp. 는 CFU/reaction 즉, CFU/mL까지검출이가능하였다. Simultaneous multiplex PCR법으로유전자를증폭시킨결과, singleplex PCR에서나타난각검출한계와동일하게다중동시검출되었다 (Fig. 6). Yoon 등 (22) 의 multiplex PCR 연구와비교시 Salmonella spp., S. aureus에있어생균수검출한계가 1 log 차이의낮은검출한계를보였다. PCR에의한검출한계및검출정확성은 Fig. 5. Detection limits for genomic DNA of S. aureus, V. parahaemolyticus and S. enterica subsp. by singleplex and multiplex PCR assay. Lane 1: 10 ng genomic DNA, lane 2: 1 ng genomic DNA, lane 3: 100 pg genomic DNA, lane 4: 10 pg genomic DNA, lane 5: 1 pg genomic DNA, lane M: 100 bp ladder. Fig. 6. Detection limits for viable count of S. aureus, V. parahaemolyticus and S. enterica sbusp. by singleplex and mutiplex PCR assay. Lane 1: 10 6 CFU/mL, lane 2: 10 5 CFU/mL, lane 3: 10 4 CFU/mL, lane 4: 10 3 CFU/mL, lane 5: 10 2 CFU/mL, lane M: 100 bp ladder.
6 600 정유석 정희경 전원배 서화정 홍주헌 PCR 조건에의해서도많은영향을받을수있으며, primer 사용농도, annealing 온도등에대한최적화로검출민감도를향상시킬수있을것이다. Lim 등 (17) 은혈청형별 E. coil O157:H7의동시검출최적화설정에있어 gradient PCR로최적 annealing 온도를선발하였으며, Park 등 (23) 은 multiplex PCR의각 primer의최적농도를다르게하여 multiplex PCR을수행하기도하였다. 본연구결과 PCR 조건최적화및시료부피보다농축된 crude DNA 추출로검출한계를향상시킬수있을것이라사료된다. 요 본연구는국내주요식중독원인균인 Staphylococcus aureus, Salmonella enterica subsp., Vibrio parahaemolyticus를동시에검출및동정할수있는 simultaneous multiplex PCR방법을개발하고자하였다. S. aureus 의 23s rrna 유전자 (482 bp), V. Parahaemolyticus의 toxr 유전자 (368 bp), S. enterica subsp. 의 inva 유전자 (284 bp) 를특이적으로검출및동정할수있는 3개 primer set 즉, STA5F/STA5R, ToxRF/ToxRR, 139/141을구축하였으며, 그결과정제되어진각식중독원인균의 genomic DNA를 template로하여세균주모두 10 pg까지다중동시검출이가능하였다. 생균수 (CFU) 와상응되는검출한계결과로써 10 1 ~10 2 CFU/reaction의검출한계를보였으며이는즉, S. aureus CFU/mL, S. enterica subsp CFU/mL, V. parahaemolyticus CFU/mL의검출한계를나타내었다. 균체회수부터 agarose gel 상에서검출및동정까지 3~4 hr의시간소요로 single tube 반응으로세식중독원인균의다중동시검출이가능하였다. 또한추가적인연구를통하여세식중독원인균주의검출을위한향상된민감도를가지는 multiplex PCR법및 real time PCR을이용한다중동시검출법개발을위한기초자료로서활용가능할것이라사료된다. 약 감사의글 본연구는대구경북과학기술원 (Daegu Gyeongbuk Institute of Science & Technology) 의연구비지원에의해이루어진연구결과의일부로이에감사드립니다. 문 1. Lee HJ Pathogenic agents and outbreak of foodborne diseases at home and abroad. Kor J Vet Publ Hlth 32: Jung HJ, Cho JI, Park SH, Ha SD, Lee KH, Kim CH, Song ES, Chung DH, Kim MG, Kim KY, Kim KS Genotype and phenotype characteristics of Staphylococcus aureus isolates from lettuces and raw milk. Korean J Food Sci Technol 37: 헌 3. Ingeborg H, Angelika L, Petra R, Kurt K, Ernst B, Marti W Comparison of different approaches to quantify Staphylococcus aureus cells by realtime PCR and quantitative PCR and application of this technique for examination of cheese. Appl Environ Microbiol 67: Le Loir Y, Baron F, Gautier M Staphylococcus aureus and food poisoning. Genet Mol Res 2: Yeh KS, Chen TH, Liao CW, Chang CS, Lo HC PCR amplification of the Salmonella typhimurium fim Y gene sequence to detect the Salmonella species. Int J Food Microbiol 78: Chiu TH, Chen TR, Hwang WZ, Tsen HY Sequencing of an internal transcribed spacer region of 16S23S rrna gene and designing of PCR primers for the detection of Salmonella spp. in food. Int J Food Microbiol 97: Jung SJ, Kim HJ, Kim HY Quantitative detection of Samonella typhimurium contamination in milk, using real time PCR. J Microbiol Biotechnol 15: Park HJ, Kim HH, Park SH, Shin EG, Kim JH, Kim HY Direct and quantitative analysis of Salmonella enterica serovar typhimurium using real time PCR from artificially contaminated chicken meat. J Microbiol Biotechnol 18: Oh EK, Yu HS, Shin SB, Son KR, Park KB, Kwon JY, Lee TS, Lee HJ Trimethoprim resistance of Vibrio parahaemolyticus isolated from the fish farm. J Kor Fish Soc 41: di Pinto A, Ciccarese G, de Corato R, Novello L, Terio V Detection of pathogenic Vibrio parahaemolyticus in southern Italian shelfish. Food Control 19: Kim MM, Oh MH, Lee GY, Hwang IG, Kwak HS, Kang YS, Koh YH, Jun HK, Kwong KS Analysis of major food borne pathogens in various foods in Korea. Food Sci Biotechnol 17: Choi KY, Kim BS, Bae WS, Jung WS, Cho YJ Developing the index of foodborne disease occurrence. Korean J Appl Statist 21: Adndreja R, Benaissa EM, Mieke U, Philippe B, Willy Z, Ernst H, Ellen F, Johan D Immunoquantitative real time PCR for detection and quantification of Staphylococcus aureus enterotoxin B in foods. Appl Environ Mircobiol 72: Kwak HS, Lee DH, Moon HS, Park JS, Woo GJ, Kim CM Evaluation of the efficiency of E. coli O157:H7 rapid detection kit using immunochromatography. J Fd Hyg Safety 18: Kim MH, Kim WJ, Sin WS, Son DH, Cha SG Feasibility study on the use of liposomes for detecting foodborne pathogenic bacteria. Korean J Food Sci Ani Resour 23: Jung HJ, Cho JI, Song ES, Kim JJ, Kim KS PCR detection of virulence genes encoding coagulase and other toxins among clinical methicillinresistant Staphylococcus aureus isolates. Kor J Microbiol Biotechnol 33: Lim JS, Yoon JH, Min BK, Hong KW Detection and identification of shigalike toxin producing Escherichia coli O157:H7 by multiplex PCR. Food Eng Prog 12: Jeong SH, Kim MY, Kim HJ, Kim TU, Yu SL, Kim HY Rapid detection of Salmonella species in foods using PCR. J Korean Soc Agric Chem Biotechnol 46: Han KH, Lee CW, Lee YS, Yang OS, Lim YK, Yoon BS Application of multiplex PCR using Lismix primers in food test and specific detection of Listeria ivanovii. J Fd Hyg Safety 16:
7 PCR 법을이용한 St. aureus, Sal. enterica subsp., V. parahaemolyticus 의다중동시검출 Seo HA, Park SH, Kim GS Optimization of the concentrations of ERICPCR components to simultaneously differentiate five foodborne pathogenic bacterial genera. J Fd Hyg Safety 18: Kim SS, Lee HM, Lee JB Molecular epidemiological characteristics of Vibrio parahaemolyticus as recently wildespreaded in Korea. Korean J Biotechnol Bioeng 18: Yoon JH, Lee SJ. Hong KW A multiplex PCR Assay for the direct detection of Salmonella spp., Yersinia enterocolitica, and Staphylococcus aureus in Food. Food Eng Prog 12: Park SH, Kim HJ, Kim HY Simultaneous detection of Yersinia enterocolitica, Staphylococcus aureus, and Shigella spp. in lettuce using multiplex PCR method. J Microbiol Biotechnol 16: (2009 년 11 월 9 일접수 ; 2010 년 3 월 16 일채택 )
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
PDFCoTemp.HWP
국립수의과학검역원 고시 제2010-2호 축산물가공처리법 제4조제2항의 규정에 의거 축산물의가공기준및성분규격을 다음과 같이 개정 고시합니다. 2010년 4월 7일 국립수의과학검역원장 축 산 물 의가 공 기 준 및 성 분 규 격 제1조(목적) 이 고시는 축산물가공처리법(이하 법 이라 한다) 제4조제2항의 규정에 의하여 축산물의 가공기준 및 성분규격을 규정함으로써
jaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
DBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70
경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법
보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
22(3)-07.fm
J. Fd Hyg. Safety Vol. 22, No. 3, pp. 179~191 (2007),QWTPCN QH (QQF *[IKGPG CPF 5CHGV[ Available online at http://www.foodhygiene.or.kr Î ÜôÚ ò Ù Â 1 Â 2 Âú äâ Ö 3 Â Ùý* w w w, 1 w tœw, 2 w yw, 3 w yl
03-2ƯÁý -14š
Management on hazardous chemicals for production of safe produce Namjun Cho, Sumyeong Hong, Wonil Kim, Byungjun Park Chemical Safety Division, National Academy of Agricultural Science, RDA * Correspondence
untitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
04-ƯÁý2b71Ú°æ½Äš
Safety Evaluation and Signal Analysis of Health/Functional Foods Kyoung Sik Park Nutrition&Functional Food Standardization Division, KFDA 1. Corresponding author : Kyoung Sik Park Tel : 02-380-1317 E-mail
(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
101~110 ¿õ´ã.¿ìȲ
101 DOI : 10.3831/KPI.2010.13.2.101 Received : 10. 05. 06 Accepted : 10. 05. 27 The Experimental Study on the Effect of Fel Ursi & Bovis Calculus Pharmacopuncture Solution in Bacterial Species which cause
한수지 51(5), , 2018 Original Article Korean J Fish Aquat Sci 51(5), ,2018 단순가공어류수산물제조공정중의식품학적위해요소분석 정민철 강민균 장유미 이도하 박슬기 신일식 1 김영목 * 부경대학교식품
한수지 51(5), 518-523, 2018 Original Article Korean J Fish Aquat Sci 51(5),518-523,2018 단순가공어류수산물제조공정중의식품학적위해요소분석 정민철 강민균 장유미 이도하 박슬기 신일식 1 김영목 * 부경대학교식품공학과, 1 강릉원주대학교해양식품공학과 Hazard Analysis of Food Safety
<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
한수지 52(2), , 2019 Note Korean J Fish Aquat Sci 52(2), ,2019 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 1 조용선 1 * 한국식품연구원식품표준센터, 1 한국식품연구원식품분석
한수지 52(2), 80-84, 209 Note Korean J Fish Aquat Sci 52(2),80-84,209 국내유통김 (Porphyra sp.) 의미생물오염도평가 노보영 황선혜 조용선 * 한국식품연구원식품표준센터, 한국식품연구원식품분석센터 Microbial Contamination Levels in Porphyra sp. Distributed in
제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
10 이지훈KICS2015-03-068.hwp
논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이
패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets
PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -
노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
슬라이드 1
03 식중독미생물 미리보기 1. 식중독 (Food poisoning) 의정의식품위생법제 2 조제 14 호식품의섭취로인하여인체에유해한미생물또는유독물질에의하여발생하였거나발생한것으로판단되는감염성또는독소형질환세계보건기구 (World Health Organization, WHO) 역학조사결과식품또는물이질병의원인으로확인된경우로서동일한식품이나공급원의물을섭취한후 2 인이상의사람이유사한질병을경험한사건
제 출 문 식품의약품안전청장 귀 하 이 보고서를 어묵류 등 6개 의무적용품목의 위해관리 지침서 개발 (한국보 건산업진흥원/천석조) 과제의 연구결과보고서로 제출합니다. 2004. 11. 주관연구기관명 : 한국보건산업진흥원 주관연구책임자 : 천 석 조 제 1세부과제명 :
최종보고서 정책-식품-2004-56 어묵류 등 6개 HACCP 의무적용품목의 위해관리 지침서 개발(자료편) Development of Guidelines on the Hazard Control of Mandatory HACCP Application Food Items(Database) 한국보건산업진흥원 식 품 의 약 품 안 전 청 제 출 문 식품의약품안전청장
12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
DBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의
K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting
DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
untitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
감염형식중독 독소형식중독 감염형식중독유발균 Salmonella, Clostridium perfringens, Vibrio parahaemolyticus, 병원성대장균 증상 : 위장염 (gastroenteritis) 독소형식중독유발균 Staphylococcus aureu
Chapter 10. 세균성식중독과곰팡이독 강의요점 Key word 감영형식중독과독소형식중독 ( 내독소, 외독소 ) 균주의특성 식중독미생물생리적특성 ( 증세및방지책 ) 곰팡이독소 : Aflatoxin, 황변미독소, 맥각중독등 1. 식중독미생물의생리적특성 1) Salmonella ( 살모넬라 ) : 살모넬라증 (Salmonellosis) 원인균 : S. enteritidis,
untitled
국내구토형바실러스세레우스감시및독소유형 Surveillance and toxin profile of emetic toxin producing Bacillus cereus in Korea 질병관리본부국립보건연구원감염병센터장내세균과 Ⅰ. 들어가는말 Bacillus 속의박테리아는대부분의환경속에존재하고있으며, 현재약 148개의종으로분류되고있다. 이중에서 Bacillus
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
Cloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
01_HM hwp
The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum
Microsoft Word - KSR2016S168
2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin
Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
(72) 발명자 오인환 서울 노원구 중계로 195, 101동 803호 (중계동, 신 안동진아파트) 서혜리 서울 종로구 평창14길 23, (평창동) 한훈식 서울 강남구 언주로71길 25-5, 301호 (역삼동, 영 훈하이츠) 이 발명을 지원한 국가연구개발사업 과제고유번호
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2014년04월14일 (11) 등록번호 10-1384704 (24) 등록일자 2014년04월07일 (51) 국제특허분류(Int. Cl.) F16L 9/18 (2006.01) F17D 1/00 (2006.01) F16L 3/00 (2006.01) (21) 출원번호 10-2012-0113933
fm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
09È«¼®¿µ 5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
DBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
2015한국기업총람 만호제강(주) 129 (주)메리츠금융지주 130 메리츠종합금융증권(주) 130 메리츠화재해상보험(주) 131 명문제약(주) 131 (주)모나리자 132 (주)모나미 132 (주)모토닉 132 무림페이퍼(주) 133 무림피앤피(주) 133 (주)무학
수록회사 차례 수록회사 차례 상 장 법 인 AK홀딩스(주) 27 AK홀딩스(주) 310 (주)BNK금융지주 31 CJ(주) 31 CS홀딩스(주) 32 (주)DGB금융지주 32 DRB동일(주) 32 DSR(주) 33 (주)E1 33 (주)GS 33 (주)GS리테일 34 (주)JB금융지주 34 JW중외제약(주) 35 (주)KB금융지주 35 KG케미칼(주) 35
System Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
67-72
40 1, 025 029 (2013) Korean J. Poult. Sci. Vol.40, No.1, 025 029 (2013) http://dx.doi.org/10.5536/kjps.2013.40.1.025 25 Assessment of Antimicrobial and Antioxidant Effects of Ripened Medicinal Herb Extracts
Microsoft Word - KSR2014S042
2014 년도 한국철도학회 춘계학술대회 논문집 KSR2014S042 안전소통을 위한 모바일 앱 서비스 개발 Development of Mobile APP Service for Safety Communication 김범승 *, 이규찬 *, 심재호 *, 김주희 *, 윤상식 **, 정경우 * Beom-Seung Kim *, Kyu-Chan Lee *, Jae-Ho
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
Microsoft Word - 5-장경수.doc
Journal of Bacteriology and Virology 2011. Vol. 41, No. 1 p.37 45 DOI 10.4167/jbv.2011.41.1.37 Original Article Genospecies Classification of Acinetobacter calcoaceticus- Acinetobacter baumannii Complex
(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection)
SERVICE MANUAL (Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) 12 (Storage Bins) 12 (Ice Machine)
디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
<32303131B3E2C1DFB5EEC0D3BFEB31C2F72DBFB5BEE72E687770>
2011학년도 중등교사신규임용후보자선정경쟁시험 영 양 1차 시험 2 교시 (전공) 40문항 80점 시험 시간 120 분 문제지 전체 면수가 맞는지 확인하시오. 문항의 배점이 1.5점과 2.5점인 문항에는 배점이 표시되어 있습니다. 나머지 문항은 2점입니다. 각 문항의 정답을 컴퓨터용 흑색 사인펜을 사용하여 OMR 답안지에 표시하시오. 4. 다음과 같은 영양교육을
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus)
한수지 47(5), 556-561, 2014 Original Article Kor J Fish Aquat Sci 47(5),556-561,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus) 의정량 김태옥 박권삼 * 군산대학교식품생명공학과 Quantification of Vibrio
DBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
untitled
Original Article Experiences of Unwed Mothers Choi, Yang-Ja 1) Kim, Kwuy-Bun 2) 1) Professor, Redcross College of Nursing, 2) Professor, Kyung Hee University, College of Nursing Science 1) 2) 1) 2) Purpose:
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
Special Issue Food borne Parasitic Diseases Jong Yil Chai, M.D. Department of Parasitology and Tropical Medicine Seoul National University College of
Special Issue Food borne Parasitic Diseases Jong Yil Chai, M.D. Department of Parasitology and Tropical Medicine Seoul National University College of Medicine E mail : cjy@snu.ac.kr Abstract This article
자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
.,. (2007) 36, 16 6 Enterobacter sakazakii 15 Bacillus cereus.,.,,,,.,.,, microwave,. UV-C DNA 253.7nm,. ( 1, 2). FDA,, - U V V - UV UV-C UV- UV- UV-C
Non-thermal treatment powdered food 송경빈충남대학교식품공학과 1. 1.1 연구목적 Non-thermal treatment UV-C,,. 1.2 연구배경,,,,, NEED,,,.,,,,..., Bacillus cereus,, 175 .,. (2007) 36, 16 6 Enterobacter sakazakii 15 Bacillus cereus.,.,,,,.,.,,
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
06.hwp
-Original Paper-35 41. 2009. 토양으로부터분리한토착유효미생물을이용한음식물쓰레기의자원화 이상우 함선녀 신택수 김혜경 연익준 * 김광렬 * (2008 8 21, 2009 1 23 ) Resource of Food Waste using Indigenous Bacteria Isolated from Soils Sang-Woo Lee Sun Nyeoo
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
DBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric