Microsoft Word - 09-김영권.doc

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Microsoft Word - 09-김영권.doc"

Transcription

1 J. Exp. Biomed. Sci. 2012, 18(2): 152~159 pissn : Original Article Prevalence and Antimicrobial Susceptibility of Erythromycin-Resistant Campylobacter jejuni and Campylobacter coli Isolated from Swine Mi-Rai Choi 1, Shin-Moo Kim 2, Sang-Ha Kim 3, Wan-Soo Choi 4 and Young-Kwon Kim 5, 1 Department of Public Health and Welfare, Graduate school of Konyang University, Daejeon , Korea 2 Department of Clinical Laboratoty Scinence, Wonkwang Health Scinence University, Iksan , Korea 3 Department of Public Health and Welfare Graduate School of Konyang University, Daejeon , Korea 4 Department of Clinical Laboratoty Scinence Dong-eui Institute of Technology, Busan, , Korea 5 Department of Biomedical Laboratory Science, Konyang University, Daejeon , Korea Campylobacter species are known to the high optimum growth temperature (42 ) and the cause of enteritis in people. Erythromycin has a curative effect for enteritis caused by the bacteria. However, the rate of erythromycin-resistant bacteria was not well known until recently in Korea. Swine are one of sources of the infection with a Campylobacter species which cause the symptom of a high temperature. In this study, we cultured rectum fecal specimens of 100 pigs in an area of Buan-gun, Jeonbuk Province during July As a result, the detection rate of C. jejuni and C. coli and the rate of erythromycin-resistant bacteria for the separated Campylobacter species on the condition of high temperature were investigated. The possession or not of hipo and glya gene and ciprofloxacin-resistant gene gyra was also reviewed with biochemical characteristics and PCR. Key Words: Campylobacter species, C. jejuni, C. coli, Erythromycin resistant, hipo, Gene gyra 서 호열, 미산소성그람음성굽은막대균인 Campylobacter jejuni와 Campylobacter coli는각종야생동물과가축의장관내에널리분포되어있으며, 특히돼지를비롯한닭, 칠면조, 개, 소, 고양이등에보균률이높은것으로보고되고있다 (Smith et al., 1999; Friedman et al., 2000; Allos, 2001). Campylobacter 장염은사람에게서 Salmonella, Shigella, Yersinia, Escherichia coli 보다더높은장염을일으키는장염의중요한원인균으로알려져있다 (Gaunt et al., 1996; Altekruse et al., 1999). Campylobacter 감염에대한치료제로는 fluoroquinolones, erythromycin, ciprofloxacin이선택되어사용되어왔으나, * Received: 23 March, 2012 / Revised: 7 June, 2012 Accepted: 7 June, 2012 Corresponding author: Young-Kwon Kim. Korea Culture Collection of Medical Fungi (KCMF), Dean of Medical Science College, Konyang Univ. 685 Gasuwon-dong, Seo-gu Daejon , Korea. Tel: , Fax: C The Korean Society for Biomedical Laboratory Sciences. All rights reserved. 론 1980년이후특히유럽지역을중심으로 fluoroquinolone 내성이증가하고있으며 (Smith et al., 1999), 벨기에의 Vanhoof 등은사람에서분리된 C. jejuni 중 8.4% 가 erythromycin에내성임을보고하였고 (Vanhoof et al., 1978), 기타여러나라에서보고된 C. jejuni와 C. coli의 erythromycin 내성률은 Table 1과같이보고하였다 (Gilbreel and Taylor, 2006). Erythromycin 내성 C. coli는돼지에서높은분리율을나타내고, C. jejuni는닭에서높은분리율을나타내고있어 (Arestrup et al., 2001; Chuma T et al., 2001; Van Looveren M et al., 2001), 사람에게서분리되는 Campylobacter species 감염에대한치료과정중 macroride계항균제에대한내성이나타날수있기때문에, 이들항균제에대한내성패턴의연구와감시가요구되고있다. 또한, Campylobacter species에대한배양과항균제감수성검사가매우까다롭기때문에우리나라의임상미생물검사실에서는 Campylobacter species에대한일상적인검사가이루어지고있지않고, 경험적항균제치료에의존하고있어, Campylobacter species에대한정확한항균제치료의가이드라인이절실하게요구되고있다. 따라서본연구에서는사람에게중요한 Campylobacter species의감염

2 Table 1. Sequence of oligonucleotides Primer name Target gene Sequence (5' to 3') Amplicon size (bp) CJF C. jejuni ACTTCTTTATTGCTTGCTGC CJR hipo a GCCACAACAAGTAAAGAAGC 323 CCF C. coli GTAAAACCAAAGCTTATCGTG CCR glya a TCCAGCAATGTGTGCAATG 126 CampyMAMAgryA1F TTTTTAGCAAAGATTCTGAT gyra b CampyMAMAgryA5R CAAAGCATCATAAACTGCAA 265 a Wang et al., 2002, b Zirnstein et al., 원인돼지로부터호열성 (42 ) Campylobacter species를분리하여검출률을조사하였으며, 항균제감수성검사를실시하여 Campylobacter species의치료에사용하는항균제들에대한내성률을조사하여항균제치료에대한참고자료를제시하고자하였다. 연구대상및방법돼지에서 Campylobacter jejuni와 C. coli의분리 Campylobacter jejuni와 C. coli의생화학적성상. 본연구에사용한시료는 2009년 7월 2일부터 7일사이에전북부안지역일개농장의돼지 100마리를대상으로직장변검체를면봉으로채취하여 Stuart 수송배지 (BBL, Copan, Italy) 에넣어보존수송하였다. Campylobacter의분리를위해선택배지인 Preston agar (Oxoid, Basingstoke, UK) 에면봉으로도말한후백금이로획선접종하였다. 10.0% CO 2 배양기에 42, 48시간배양한후, 용혈이없고원형의회백색집락을재차분리하였다. 순수분리된집락중그람음성, 굽은막대균, oxidase 양성, hippurate hydrolysis 양성, 30 μg의 nalidixic acid 디스크에내성, 30 μg의 cephalothin 디스크에내성인성상을 C. jejuni로예비동정하였고, 위성상중 hippurate hydrolysis 음성인균주를 C. coli로예비동정하였다. 분리된균주는 10.0% CO 2 조건에서 37, 48시간 blood agar plate (BAP) 에배양하였고, 배양된균체는 15.0% glycerol이포함된 BHI broth 1 ml에현탁하여다음실험시까지 -70 에냉동보관하였다. Campylobacter jejuni와 C. coli의 hipo, glya 유전자의검출. C. jejuni의확인동정을위해 hipo 유전자를, C. coli는 glya 유전자를대상으로 PCR을수행하였다. BAP 배지에 C. jejuni와 C. coli를각각접종하여 42, 10.0% CO 2 배양기에서 48시간배양한후집락을증류수에현탁시켰다. 균현탁액을 100 에서 10분간끓인다음 10,000 rpm 에서 5분간원심분리한후상층액을 PCR을위한주형 DNA로사용하였다. 본실험에사용된 primer의염기서열은 Table 1과같으며 Genotech Co. (Daejeon, Korea) 에의뢰하여합성하였다. PCR을위한반응액조성은 primer 각 1 μl, PCR mastermix (dntp, taq polymerase, MgCl 2, Daejeon, Korea) 4 μl, 8-MOP 12 μl, 주형 DNA 2 μl를넣어최종 20 μl로하였다. PCR 반응은 thermal cycler (GeneAmp system, PerkinCetus, Norwalk. CT, USA) 를사용하였다. 유전자증폭을위한반응조건은 predenaturation 95 에서 5분, denaturation 95 에서 30초, annealing 50 에서 30초, extention 72 에서 30초간 30회반복하였고, 72 에서 5 분간 last extention 시킨후 4 에서보관하였다. 증폭된 PCR 반응산물은 2.0% agarose gel (Cambrex bion science inc. Rockland, USA) 상에서전기영동하여확인하였다. 항균제감수성시험 Erythromycin 과 quinolone 내성균의분리. 내성균의분리를위해표준디스크확산법 (Clinical and Laboratory Standards Institute, 2012) 을수행하였다. 배지는 5.0% 면양혈액을넣은 Mueller-Hinton agar (MHA, Difco Laboratories, Sparks, MD, USA) 를사용하였다. 순수배양된집락을 Tryptic soy broth (TSB, Difco) 2 ml에현탁하여 1 McFarland 탁도로맞추고, 면봉으로배지의표면에고루바른후디스크를놓고 37, 10.0% CO 2 배양기에서 48시간배양후결과를판독하였다. 디스크는 amikacin 30 μg, ampicillin 10 μg, cephalothin 30 μg, ciprofloxacin 5 μg, erythromycin 15 μg, imipenem 10 μg, nalidixic acid 30 μg, tetracycline 30 μg (Becton-Dickinson, Cockeysville, MD, USA) 를사용하였다. 우무희석법 (Agar dilution method) 을위한배지는 CLSI 표준방법에따라 5.0% 혈액을첨가한 MHA 평판배지를사용하였다. 항생제는 ampicillin, cephalothin, clindamycin,

3 Table 2. Antimicrobials usceptibility patterns of C. jejuni isolated from swine MIC (µg/ml) Percentage of Organisms (No. tested) Antimicrobial agent Range 50% 90% resistant (%) Erythromycin-resistant (26) Ampicillin 2~ Cephalothin 64~ Ciprofloxacin 4~ Clindamycin 8~ Erythromycin Imipenem Nalidixic acid 32~ Tetracycline 4~ Erythromycin-susceptible (7) Ampicillin 4~ Cephalothin Ciprofloxacin 8~ Clindamycin 0.5~ Erythromycin 2~ Imipenem Nalidixic acid 128~ Tetracycline 8~ erythromycin, gentamicin, nalidixic acid, ciprofloxacin, tetracycline (Sigma Chemical, St. Louis, MO, USA) 및 imipenem (Merk Sharp & Dohme, Rahway, NJ, USA) 을사용하였다. 순수배양된집락을 TSB 2 ml에현탁하여 1 McFarland 탁도로맞추고, replicator 로접종하여 37, 10.0% CO 2 배양기에서 48시간배양후증식을억제시킨항균제의최소농도를최소발육억제농도 (minimum inhibitory concentration, MIC) 로측정하였다. 정도관리를위해 Escherichia coli ATCC 25922를동시에시험하였다. Ciprofloxacin 내성 gyra 유전자의검출. Ciprofloxacin 내성 Campylobacter의확인을위해서 gyra 유전자를 PCR 법으로확인하였다. PCR 반응조건은 hipo와 glya 유전자에사용된방법과동일하며, 사용한 primer 의염기서열은 Table 1과같다. 결과돼지에서 C. jejuni와 C. coli의분리 2009년 7월 2일부터 7일사이에부안지역일개농장에서돼지 100마리의직장변검체에서분리된 Campylobacter species의검출률은 55주 (55.0%) 이었으며, 이중 C. jejuni는 33주 (33.0%), C. coli는 22주 (22.0%) 가분리되었다. C. jejuni와 C. coli의생화학적성상. 돼지에서분리한 C. jejuni 33주와 C. coli 22주의생화학적성상은 Catalase 양성, Urease 음성, Oxidase는양성을보였으며, hippurate hydrolysis 시험에서는 C. jejuni는진한자주색을보여양성이었고, 무색인 C. coli는음성을보였다. Inodoxyl acetate hydrolysis는두균주모두양성을보였으며, TSI의 H 2 S 성상은모두음성이었다. Nalidixic acid와 Cephalothin 감수성시험은두균주모두내성으로동정되었다. 항균제감수성시험 Erythromycin 과 quinolone 내성균의분리. Campylobacter 균종감염의장염치료제로사용되고있는 erythromycin 을포함한 8종의항균제에대한감수성시험에서 erythromycin 내성률, MIC 범위, MIC 50 및 MIC 90 은 Table 2, 3과같다. 본시험에사용된 C. jejuni에대한 erythromycin의 MIC 범위는 128 μg/ml, MIC 90 은 128 μg/ml이었고, erythromycin 내성균주에대해가장항균력이높은것은 imipenem이었으며, 그 MIC 범위는 μg/ml, MIC 90 은 μg/ml이었고, ampicillin의 MIC 범위는 4~ 8 μg/

4 Table 3. Antimicrobial susceptibility patterns of C. coli isolates from swine MIC (µg/ml) Percentage of Organisms (No. tested) Antimicrobial agent Range 50% 90% resistant (%) Erythromycin-resistant (14) Ampicillin 2~ Cephalothin 64~ Ciprofloxacin 8~ Clindamycin 0.5~ Erythromycin Imipenem 0.06~ Nalidixic acid 128~ Tetracycline 0.5~ Erythromycin-susceptible (8) Ampicillin 4~ Cephalothin Ciprofloxacin 4~ Clindamycin 16~ Erythromycin 0.5~ Imipenem 0.06~ Nalidixic acid 64~ Tetracycline 2~ ml, MIC 90 은 8 μg/ml이었으며, tetracycline의 MIC 범위는 4~128 μg/ml, MIC 90 은 128 μg/ml, clindamycin 의 MIC 범위는 8~64 μg/ml, MIC 90 은 64 μg/ml이었다. 본시험에사용된 Erythromycin 내성 C. coli에대한 erythromycin의 MIC 범위는 128 μg/ml, MIC 90 은 128 μg/ml이었으며, erythromycin 내성균주에대해항균력이높은것은 ampicillin, clindamycin, imipenem이었으며, imipenem의 MIC 범위는 0.06~0.125 μg/ml, MIC 90 은 μg/ml이었고, ampicillin 의 MIC 범위는 2~ 8 μg/ml, MIC 90 은 8 μg/ml이었으며, tetracycline의 MIC 범위는 0.5~128 μg/ml, MIC 90 은 128 μg/ ml, clindamycin의 MIC 범위는 0.5~4 μg/ml, MIC 90 은 4 μg/ ml이었다. C. jejuni의 erythromycin 감수성균주에대해항균력이높은것은 imipenem이었으며, imipenem의 MIC 범위는 μg/ml, MIC 90 은 μg/ml이었고, erythromycin 의 MIC 범위는 2~4 μg/ml, MIC 90 은 4 μg/ml이었으며, ampicillin clindamycin의 MIC 범위는각각 4~64 μg/ml와 0.5~1 μg/ml, MIC 90 은 64 μg/ml와 1 μg/ml이었고, tetracycline 의 MIC 범위는 8~128 μg/ml, MIC 90 은 128 μg/ml이었다. Imipenem은 erythromycin 내성과감수성 Campylobacter 균종에서가장낮은 MIC 90 를보였으며, erythromycin 내성 Campylobacter 균종의장염치료제는 ampicillin이추천되었다. 또한 erythromycin 감수성 Campylobacter 균종에 대한 clindamycin은낮은 MIC 90 을보였다. 모든 Campylobacter 균종은 ciprofloxacin에내성이었으며, erythromycin 내성과감수성 C. jejuni는 tetracycline에각각 38.5% 와 71.4% 의내성률을, erythromycin 내성과감수성 C. coli는 tetracycline에각각 64.3% 와 62.5% 의내성률을보였다. C. jejuni와 C. coli의 hipo, glya와 gyra 유전자의검출. 생화학적동정시험에서 C. jejunie로동정된 33균주는모두 C. jejunie 특이유전자인 hipo를확인할수있었으며, C. coli로동정된 22균주는모두 C. coli 특이유전자인 glya를확인할수있었으며, nalidixic acid와 ciprofloxacin에내성을나타내는 C. jejuni와 C. coli의모든균주에서변이된유전자인 gyra가 266 bp에서관찰되어, ciprofloxacinresistant Campylobacter species임을알수있었다 (Table 4, Fig. 1-3). 고찰 Campylobacter는닭, 칠면조, 돼지, 개, 소, 고양이등에서보균률이높으며, 각종야생동물및가축의장관내에널리분포한다. 특히 C. jejuni는닭과소에서주로보균하고있으며, C. coli는돼지에서많이보균하고있어이

5 Table 4. Detection of hipo, glya and grya gene for C. jejuni and C. coli isolated from swine Source of isolation Detection of indicated genes by PCR hipo glya gyra CJ-01 * CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CJ CC CC CJ CC CJ CJ CJ CC CJ CJ CC CJ CC CC CC CJ CJ CC CC CJ CC CC CC CJ Table 4. Detection of hipo, glya and grya gene for C. jejuni and C. coli isolated from swine (contineued) Source of isolation Detection of indicated genes by PCR hipo glya gyra CC CC CC CC CJ CC CJ CJ CC CC CJ CJ CC CC Total * NO. of isolates tested. CJ, Campylobacter jejuni; CC. Campylobacter coli. 러한동물들로부터사람에감염되어 Campylobacter 장염을일으키는것으로알려져있다 (Guévremont et al., 2006; Shin et al., 2010). 이세균들은공기중의노출이나건조, 낮은 ph, 가열에대한저항성이낮으며, 식품중에는증식하기어려우나, 적은세균수의감염으로도장염을일으킬수있어, 여러나라에서세균성식중독의빈번한원인균으로보고되어왔다 (Pedersen, et al., 2003). Campylobacter 균종의감별을위한동정실험은생화학적성상으로쉽지않은것으로알려져왔으며, C. jejuni와 C. coli의분리동정법으로 hippurate hydrolysis 시험, nalidixic acid와 cephalothin 감수성시험이사용되어왔으나, nalidixic acid와 cephalothin에대한내성균주의출현으로인하여그이용가치가점차적어지고있다. Dassanayake 등은 C. jejuni의 13.0% 는 hippurate hydrolysis 음성이라고보고하여기존의생화학적동정실험만으로는정확한동정을기대할수없게되었다. Wang 등은 C. jejuni만이보유하고있는특이유전자를 hipo 유전자로확인이가능하며, C. coli만이보유하고있는특이유전자인 glya로유전자로확인이가능하다고보고한이래 hipo 유전자와 glya 유전자의검출은 C. jejuni와 C. coli 를동정하는데중요한지표로사용되고있다 (Wang et

6 Fig. 1. Agarose gel electrophoresis of PCR products by using primer pairs hipo gene for identification of C. jejuni. Lane 1 to 12, C. jejuni; M, size marker; lane 1, strain no. CJ-1; lane 2, strain no. CJ-2; lane 3, strain no. CJ-3; lane 4, strain no. CJ-4; lane 5, strain no. CJ-5; lane 6, strain no. CJ-6; lane 7, strain no. CJ-7; lane 8, strain no. CJ-8; lane 9, strain no. CJ-9; lane 10, strain no. CJ-10; lane 11, strain no. CJ-11; lane 12, strain no. CJ-12. Fig. 2. Agarose gel electrophoresis of PCR generated by using primer pairs for glya gene for identification of C. coli. Lane M, size marker; lane 1, strain no. CC-18; lane 2, strain no. CC-19; lane 3, strain no. CC-21; lane 4, strain no. CC-25; lane 5, strain no. CC-28; lane 6, strain no. CC-30; lane 7, strain no. CC-31; lane 8, strain no. CC-32; lane 9, strain no. CC-35; lane 10, strain no. CC-36; lane 11, strain no. CC-38; lane 12, strain no. CC-39; lane 13, strain no. CC-40; lane 14, strain no. CC-42; lane 15, strain no. CC-43; lane 16, strain no. C. coli ATCC Fig. 3. Agarose gel electrophoresis of PCR products by using primer pairs grya gene for detection of ciprofloxacin-resistant Campylobacter species Lane 1 to 12, Campylobacter species; M, size marker; lane 1, strain no. CJ-1; lane 2, strain no. CJ-2; lane 3, strain no. CJ-3; lane 4, strain no. CJ-4; lane 5, strain no. CJ-5; lane 6, strain no. CJ-6; lane 7, strain no. CJ-7; lane 8, strain no. CJ-8; lane 9, strain no. CJ-9; lane 10, strain no. CJ-10; lane 11, strain no. CJ-11; lane 12, strain no. CJ-12. al., 2002). 1994년 Sánchez 등은 Campylobacter 감염치료에널리사용되는 ciprofloxacin에대한내성조사보고에의하면스페인에서분리한균주중에는 ciprofloxacin 내성균이분리되지않았지만, 1992년에서는 49균주가내성임을보고하였으며, ciprofloxacin에대한내성은변이된 gyra 유전자에기인하는것으로보고하였다. 따라서 Campylobacter 균종의동정과 ciprofloxacin 내성연구에서 여러가지유전자검출방법들이보고되어왔으나, 본연구에서는 Wang 등이보고한 hipo와 glya 유전자중 hipo 양성은 C. jejuni로, glya 양성은 C. coli로동정하였으나 (Wang et al., 2002), Zirnstein 등은 ciprofloxacin 내성을나타내는균주에서변이된 gyra 유전자를검출하여 C. jejuni와 C. coli의 ciprofloxacin 내성세균의지표유전자로확인하였다 (Zirnstein et al., 1999)

7 Fluoroquinolone이개발된초기에는여러균종에대한항균력이높아 (Segreti et al., 1989) Campylobacter 장염치료에유용하게사용되었으며 (Goodman et al., 1990), fluoroquinolone이널리사용됨에따라서 fluoroquinolone 내성균주가증가하고있음이보고되었다 (Zirnstein et al., 1999). Payot 등 (2004) 은프랑스돼지에서분리한 C. coli 균주중 fluoroquinolone 내성 Campylobacter 균주가 65.8% 임을보고하였고, Kim 등 (2008) 은우리나라익산지역의닭과환자에서분리한 C. jejuni가모두 nalidixic acid와 ciprofloxacin 내성임을보고하였다. 본연구에서돼지를대상으로분리된 C. jejuni와 C. coli에서는 nalidixic acid와 ciprofloxacin에모두내성을나타내었으며, nalidixic acid의 MIC 50 와 MIC 90 은각각 128 μg/ml이었다. Ciprofloxacin 내성유전자인 gyra 유전자가본연구에서분리한 C. jejuni와 C. coli 모두에서검출되어, Campylobacter 감염치료에 fluoroquinolone을사용할수없을뿐만아니라, nalidixic acid 디스크시험은 Campylobacter species 감별에도이용할수없으며, Campylobacter 감염치료에 fluoroquinolone을사용할때에는항균제감수성시험이반드시필요할것으로사료된다. 본실험에사용된 Campylobacter 균종 55주는 cephalothin, ciprofloxacin, erythromycin, nalidixic acid에내성이었고, erythromycin 내성 C. jejuni는 ampicillin에는 3.8%, clindamycin에 88.4%, imipenem에 0%, tetracycline에 38.5% 가내성이었으며, 가장낮은 MIC 90 를보인항균제는 ampicillin이었다. Erythromycin 감수성 C. jejuni는 ampicillin에 14.2%, clindamycin 과 imipenem에 0%, tetracycline에는 71.4% 가내성이었으며, 가장낮은 MIC 90 를보인항균제는 clindamycin이었다. 한편 erythromycin 내성 C. coli는 ampicillin, clindamycin, imipenem은 0%, tetracycline은 64.3% 가내성이었고, 가장낮은 MIC 90 를보인항균제는 clindamycin이었으며, erythromycin 감수성 C. coli는 ampicillin과 imipenem은 0%, clindamycin은 92.8%, tetracycline은 62.5% 가내성이었으며, 가장낮은 MIC 90 를보인항균제는 erythromycin 으로나타났다. 따라서본연구에사용된 Campylobacter species 55주모두에서퀴롤론계항균제에대해서 100.0% 내성을나타내앞으로 Campylobacter species 감염치료에사용할수없다는결론을얻었으며, erythromycin과 tetracycline에대해서도내성균이점차증가하고있어 Campylobacter species 감염에대한치료시에는반드시항균제감수성시험이나관련유전자의검출시험을한후에치료가필요할것으로사료된다. REFERENCES Allos BM. Campylobacter jejuni Infections: update on emerging issues and trends. Clin Infect Dis : Altekruse SF, Stern NJ, Fields PI, Swerdlow DL. Campylobacter jejuni an emerging foodborne pathogen. Emerg Infect Dis : Arestrup FM, Engberg J. Antimicrobial resistance of thermophilic Campylobacter. Vet Res : Chuma T, Ikeda T, Maeda T, Niwa H, Okamoto K. Antimicrobial susceptibilities of Campylobacter strains isolated from broilers in the southern part of Japan from 1995 to J Vet Med Sci : Clinical and Laboratory Standards Institute: Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline. CLSI Document M45-A, Dassanayake RP, Zhou Y, Hinkley S, Stryker CJ, Plauche G, Borda JT, Sestak K, Duhamel GE. Characterization of cytolethal distending toxin of Campylobacter species isolated from captive macaque monkeys. J Clin Microbiol : Gaunt PN, Piddock LJ. ciprofloxacin resistant Campylobacter species in humans: an epidemiological and laboratory study. J Antimicrob Chemother : Goodman LJ, Trenholme GM, Kaplan RL, Segreti J, Hines D, Petrak R, Nelson JA, Mayer KW, Landau W, Parkhurst GW, Stuart Levin. Empiric antimicrobial therapy of domestically acquired acute diarrhea in urban adults. Arch lntern Med : Guévremont E, Nadeau E, Sirois M, Quessy S. Antimicrobial susceptibilities of thermophilic Campylobacter from humans, swine, and chicken broilers. Can J Vet Res : Kim SM, Kim EC, Choi MR, So HA, Shim ES, Kim ES, Park SC, Seong CN, Chong Y. Cytolethal Distending Toxin Production, Genotypes and Atimicrobial Susceptibility of Campylobacter jejuni Isolates from Diarrhea Patients and Chickens. Journal of Bacteriology and Virology : Payot S, Avrain L, Magras C, Praud K, Cloeckaert A, Chaslus- Dancla E. Relative contribution of target gene mutation and efflux to fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of Campylobacter coli. Int J Antimicrob Agents :

8 Pedersen K, Wedderkopp A. Resistance to quinolones in Campylobacter jejuni and Campylobacter coli from Danish broilers at farm level. J Appl Microbiol : Sánchez R, Fernández-Baca V, Díaz MD, Muñoz P, Rodríguez- Créixems M, Bouza E. Evolution of susceptibilities of Campylobacter species to quinolones and macrolides. Antimicrob Agents Chemother : Segreti J, Nelson JA, Goodman LJ, Kaplan RL, Trenholme GM. In vitro activities of lomefloxacin and temafloxacin against pathogens causing diarrhea. Antimicrob Agents Chemother : Shin E, Lee Y. Characterization of erythromycin-resistant porcine isolates of Campylobacter coli. Microb Drug Resist : Smith KE, Besser JM, Hedberg CW, Leano FT, Bender JB, Wicklund JH, Johnson BP, Moore KA, Osterholm MT. Quinolone-resistant Campylobacter jejuni infections in Minnesota, Investigation Team. N Engl J Med ; 340: Van Looveren M, Daube G, De Zutter L, Dumont JM, Lammens C, Wijdooghe M, Vandamme P, Jouret M, Cornelis M, Goossens H. Antimicrobial susceptibilities of Campylobacter strains isolated from food animals in Belgium. J Antimicrob Chemother : Wang G, Clark CG, Taylor TM, Punknell C, Barton C, Price L, Woodward DL, Rodgers FG. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis and C. fetus subsp. J Clin Microbiol : Zirnstein G, Li Y, Swaminathan B, Angulo F. Ciprofloxacin resistance in Campylobacter jejuni isolates: detection of gyra resistance mutations by mismatch amplification mutation assay PCR and DNA sequence analysis. J Clin Microbiol :

Microsoft PowerPoint - PDFCoTemp.PPT

Microsoft PowerPoint - PDFCoTemp.PPT 주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

03_01_HM _rev2_ hwp

03_01_HM _rev2_ hwp Korean Journal of Microbiology (2013) Vol. 49, No. 3, pp. 228-236 DOI http://dx.doi.org/10.7845/kjm.2013.3030 Copyright c 2013, The Microbiological Society of Korea 보문 경기도내에서분리한캠필로박터제주니균의유전적특성및항생제내성연구

More information

ORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist

ORIGINAL ARTICLE   Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

임상병리검사과학회지 : 제 28 권제 1 호 닭에서 Camphylobacter jejuni/ coli 의 분리빈도와시험관내항균력 원광보건전문대학임상병리과 검신무 정수진 Prevalence and in Vitro Antimicrobial Activity Aga

임상병리검사과학회지 : 제 28 권제 1 호 닭에서 Camphylobacter jejuni/ coli 의 분리빈도와시험관내항균력 원광보건전문대학임상병리과 검신무 정수진 Prevalence and in Vitro Antimicrobial Activity Aga 임상병리검사과학회지 : 제 28 권제 1 호 1996. 닭에서 Camphylobacter jejuni/ coli 의 분리빈도와시험관내항균력 원광보건전문대학임상병리과 검신무 정수진 Prevalence and in Vitro Antimicrobial Activity Against Campylobacter jejuni/ coli from Chickens. Kim,

More information

03(12-65)p fm

03(12-65)p fm 한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>

< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770> 대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

< D34312D303228B0ADC1F6BBF32CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770>

< D34312D303228B0ADC1F6BBF32CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770> 대한임상검사학회지 : 41권제2호, 47-51, 2009 ISSN 1738-3544 소변검체에서분리된 Cysteine 요구성 Escherichia coli 1 예 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 강지상 1 주세익 1 김의종 1,2 A Case of Cysteine-Requiring Escherichia coli Isolated

More information

untitled

untitled 理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated

Evaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated 대한진단검사의학회지제 29 권제 3 호 2009 Korean J Lab Med 2009;29:212-7 DOI 10.3343/kjlm.2009.29.3.212 Original Article Clinical Microbiology 폐렴알균의항균제감수성검사를위한 Phoenix System 의평가 이교관 1 류남희 2 김성태 1 채석래 1 허희진 1 동국대학교일산병원진단검사의학과

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d 연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in

More information

<3037C1D6BCBCC0CD2E687770>

<3037C1D6BCBCC0CD2E687770> 대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

12(2) fm

12(2) fm Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA JFM SE, 29(3), pp. 834~846, 2017. www.ksfme.or.kr 수산해양교육연구, 제29권제3 호, 통권87 호, 2017. http://dx.doi.org/10.13000/jfmse.2017.29.3.834 2016 년도제주지역양식넙치(Paralichthys olivaceus ) 에서분리된어병세균의 tetracycline 내성유전자분포

More information

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h

2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h 1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

#111-131 ¸®´õ½ÊÆ÷Ä¿½º_07-2

#111-131 ¸®´õ½ÊÆ÷Ä¿½º_07-2 CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH CHURCH GROWTH 112 118 122 127 132 June 2012 113 114 July 2012 July 2012 115 116 July 2012 July 2012 117

More information

Microsoft Word - 05-김종배.doc

Microsoft Word - 05-김종배.doc J. Exp. Biomed. Sci. 11 (2005) 447 453 Patterns of Antimicrobial Resistance and Detection of meca Gene from Methicillin Resistant Staphylococcus aureus Isolated from Healthcare Facilities and U.S. Military

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김

한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김 한수지 49(5), 582-588, 206 Original Article Korean J Fish Aquat Sci 49(5),582-588,206 곰소만해역해수에서분리한장염비브리오 (Vibrio parahaemolyticus) 의항균제내성및최소발육억제농도의구명 김태옥 엄인선 김희대 박권삼 * 군산대학교식품생명공학과, 충북도립대학바이오생명의약과 Antimicrobial

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

<303120C6AFC1FD20B9E8C7F6C1D62E687770>

<303120C6AFC1FD20B9E8C7F6C1D62E687770> 대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo

More information

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770>

< B3E2BAB8B0C7BFF8BAB828BAB8B0C72CC3E0BBEA29312E687770> 부산광역시보건환경연구원보제 14 권 (I), 15~27, 2004 Rep. Busan Inst. Health & Environ, Vol.14, 15~27, 2004 미생물과 이주현 Study on the Antimicrobial Susceptbility of Vibrio spp. Isolated from Environmental source and Patients

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

A C O N T E N T S A-132

A C O N T E N T S A-132 C O N T E N T S -2 SC2 Series -3 SC2 Series -4 SC2 Series SC2 B 40 B 100 S I SC2 B 40 B 100 RO R S I SC2-2 B 40 B 100 HOY R S I -5 SC2 R0 40 SW R0 SC2 R 40 SC2 Series SW RB SW R SC2-2 H0 40 SW H0 SC2-2

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

<31335FB1C7B0E6C7CABFDC2E687770>

<31335FB1C7B0E6C7CABFDC2E687770> 에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.

More information

< D34312D303328C0CCC7F62CC0CCB4F6C8F12CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770>

< D34312D303328C0CCC7F62CC0CCB4F6C8F12CC1D6BCBCC0CD2CB1E8C0C7C1BE292E687770> 대한임상검사학회지 : 41권제2호, 52-56, 2009 ISSN 1738-3544 당뇨병환자의연조직염에서분리된 Arcanobacterium haemolyticum 1 예 서울대학교병원진단검사의학과 이현 1 이덕희 1 주세익 1 김의종 1,2 A Case Report of Arcanobacterium haemolyticum Isolated from Diabetic

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information

Viridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과

Viridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과 대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae

More information

ca_02.hwp

ca_02.hwp SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: * A Study on Good School

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI:   * A Study on Good School Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.1-16 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.1 * A Study on Good School and School Evaluation Purpose: This study was to examine

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

untitled

untitled Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location

More information

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017

674 권순재ㆍ정연중ㆍ윤현진ㆍ목종수ㆍ권지영,.., (Watts et al., 2017)., 70% (Kummerer, 2009). (Witte, 2000)., (Souli et al., 2008)., % ,113 (NIFS, 2017 한수지 51(6), 673-681, 2018 Original Article Korean J Fish Aquat Sci 51(6),673-681,2018 용남광도해역의굴 (Crassostrea gigas) 및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 정연중 윤현진 목종수 1 권지영 * 국립수산과학원남동해수산연구소, 1 국립수산과학원식품위생가공과

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Microsoft Word - 05-이영주.doc

Microsoft Word - 05-이영주.doc Journal of Bacteriology and Virology 2006. Vol. 36, No. 2 p.73 78 닭분변유래 Enterococcus spp. 의 Fluoroquinolone 계내성관련 gyra 및 parc Gene 의변이 대구광역시보건환경연구원 1, 경북대학교수의과대학 2, 국립수의과학검역원 3 조재근 1 김기석 2 이영주 2* 박청규 2

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

(59-69)Kjcm13.hwp

(59-69)Kjcm13.hwp Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook

More information

Çмúº¸°í6ÇÏÇý¹Î

Çмúº¸°í6ÇÏÇý¹Î 병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부

More information

( ).fm

( ).fm Korean J. Food Sci. An. Vol. 33, No. 1, pp. 133~138(2013) DOI http://dx.doi.org/10.5851/kosfa.2013.33.1.133 ARTICLE 시판축산물및수산물에서 Enterococcus faecalis 와 Enterococcus faecium 분포및항생제감수성에관한연구 성창현 천정환 곽효선 1

More information

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et

398 이다원ㆍ전려진ㆍ김승민ㆍ정준범 (Lee and Kim, 2013)., Em (Lee et al., 2016) Korean statistical information service (KOSIS),,., Em (Han et al., 2012; Sung et 한수지 51(4), 397-403, 2018 Original Article Korean J Fish Aquat Sci 51(4),397-403,2018 제주지역양식넙치 (Paralichthys olivaceus) 에서분리한어병세균내 Erythromycin 내성유전자분석 이다원 전려진 김승민 1 정준범 * 제주대학교해양의생명과학부, 1 주식회사우진비앤지 Analysis

More information

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과

Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30

More information

141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)

141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3) 141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932

More information

untitled

untitled ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution

More information

untitled

untitled Korean J Clin Microbiol Vol. 12, No. 4, December, 2009 Colonization Rate, Serotypes, and Distributions of Macrolide-Lincosamide-Streptogramin B Resistant Types of Group B Streptococci in Pregnant Women

More information

A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소 1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지

More information

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>

<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770> 대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

42(3)-11(p ).fm

42(3)-11(p ).fm The Korean Journal of Microbiology, Vol. 42, No. 3, September 2006, p. 199-204 Copyright 2006, The Microbiological Society of Korea e ³ w ³ w Á Á½ Áx Á 1 Á 2, * w w w w w w e ³ ³ w p w. e ³ w ù š» 30 cm.

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부 大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

untitled

untitled 병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은

More information

(2005\263\342\271\351\274\255_final.hwp)

(2005\263\342\271\351\274\255_final.hwp) 제 2 절 식 의약품 종합정보서비스 243 제1장 평 가 분 야 제1절 식품규격평가 분야 제2절 식품안전평가 분야 제3절 의약품평가 분야 제4절 생약평가 분야 제5절 생물의약품평가 분야 제6절 의료기기평가 분야 제 1 절 식품규격평가 분야 245 제1장 평가분야 제1절 식품규격평가 분야 제1 항 식품의 기준 규격 1. 식품공전 식품의 기준 규격은 식품위생법

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., - THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta

More information