식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio
|
|
- 효서 선
- 4 years ago
- Views:
Transcription
1 식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea * *Corresponding author Tel: Fax: jinsunghong@kangwon.ac.kr Eun-Kyoung Kim, Jae-Won You, Ji-Soo Park, Dong-Joo Min, Suk-Hyun Park, and Jin-Sung Hong* Department of Applied Biology, Kangwon National University, Chuncheon 24341, Korea Received November 3, 2017 Revised November 30, 2017 Accepted December 4, 2017 Chinese artichoke (Stachys sieboldii Miq.) belongs to herbaceous perennial plants of Labiatea and is cultivated as edible and medicinal crops in China, Japan and Korea. A Chinese artichoke plant showing virus-like symptoms was collected in Chungju, Korea. Plant sap of the sample was inoculated in Nicotiana tabacum cv. Xanthi-nc, Chenopodium quinoa and Chenopodium amaranticolor. Necrotic local lesions were observed in the inoculated leaves of N. tabacum cv. Xanthi-nc and C. amaranticolor, C. quinoa with systemic chlorotic spots and mosaic symptoms on the upper leaves. The disease reactions on indicator plants suggested that the collected Chinese artichoke sample was mixed-infected with different viruses. We detected three viruses by RT- PCR analysis using genus- and species-specific primer sets for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV) and Tobacco mosaic virus (TMV). This study is the first report of a mixed infection of three viruses in Chinese artichoke in Korea. Keywords: Alfalfa mosaic virus, Chinese artichoke, RT-PCR, Cucumber mosaic virus, Tobacco mosaic virus Alfalfa mosaic virus (AMV) Bromoviridae, Alfamovirus,. (Mueller Grau, 2007; Hiruki Hampton, 1990). Cucumber mosaic virus (CMV) Bromoviridae, Cucumovirus, 100 1,200 subgroup IA, subgroup IB subgroup II (Choi, 1990; Douine, 1979; Kaper Waterworth, 1981; Research in Plant Disease pissn , eissn Owen Palukaitis, 1998; Palukaitis Garcia-Arenal, 2003). CMV 75 (Francki, 1979). 5 ( ), CMV (Kim, 2012). Tobacco mosaic virus (TMV) Virgaviridae, Tobamovirus.,, (Broadbent, 1965; Hollings Huttinga, 1976; Taylor, 1961). (Stachys sieboldii Miq.) (Labiatea),,. The Korean Society of Plant Pathology This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 82 Research in Plant Disease Vol. 24 No. 1 복용하면 간경화, 지방간, 뇌경색, 동맥경화, 노인성 치매의 예방 모자이크바이러스(Alfalfa mosaic virus, AMV)가 초석잠에 감염하는 및 치료, 기억력 증진에 효과가 있는 것으로 알려져 있다(Back 등, 것으로 보고되어 있다(Lirong 등, 1986; Fuji 등, 2003). 본 연구에서 2004). 국내에는 중국과 일본에서 유입된 품종이 자생하고 있으며 는 최근( 년) 충북 충주에서모자이크 병징을 보이는 초 최근 초석잠의 효능이 알려지면서 재배면적이 증가하고 있다. 국내 석잠에서 바이러스를 분리하여 TMV, AMV 및 CMV를 동정하였다. 에서는 현재까지 초석잠에 감염하는 바이러스가 보고되지 않았 의 경우, Potyvirus 속에 속하는 초석잠모자이크바이러스(Chinese 기주식물반응. 2016년과 2017년 충북 충주에서 바이러스 에 감염된 것으로 추정되는 초석잠을 채집하였다(Fig. 1). 모자 artichoke mosaic virus, ChAMV)와 Tobamovirus 속의 담배모자이 이크 병징을 보이는 초석잠 잎 100 mg과 0.01 M 인산완충액 크바이러스(Tobacco mosaic virus, TMV), Alfamovirus 속의 알팔파 (Phosphate buffer, ph7.2) 1 ml을 멸균한 막자사발로 마쇄하여 고, 초석잠의 바이러스병에 대한 정보 또한 부족한 실정이다. 국외 Fig. 1. Symptoms on the leaves of a Chinese artichoke plant. (A) Chinese artichoke showing mosaic symptoms. (B) Mosaic symptoms on upper leaves. The symptomatic leaf samples were collected from Chungju in Fig. 2. Symptoms on the leaves of indicator plants induced by mechanical sap-inoculation. Photographs were taken at 14 days post inoculation (dpi). Necrotic local lesions on the inoculated leaves of N. benthamiana (A), N. tabacum cv. Xanthi-nc (B), C. quinoa (C) and C. amaranticolor (D). Mosaic symptoms on the upper leaves of N. benthamiana (E) and N. tabacum cv. Xanthi-nc (F) and C. quinoa (G). C. amaranticolor was induced chlorotic spots on the upper leaves (H).
3 Research in Plant Disease Vol. 24 No Nicotiana benthamiana, N. tabacum cv. Xanthi-nc, Chenopodium quinoa, C. amaranticolor. 3 N. tabacum cv. Xanthi-nc TMV, C. amaranticolor CMV. 7 C. quinoa AMV (Fig. 2). (TMV, CMV, AMV). RT-PCR. N. benthamiana Plant RNA Prep Kit (BIO CUBE, Suwon, Korea) Total RNA. degenerate primers (Table 1). Tobamovirus Cucumovirus, Ilarvirus-degenerate primer 1a. Reverse Transcription-Polymerase Chain Reaction (RT-PCR), Potyvirus Cucumovirus, Ilarvirus, Tobamovirus positive control (Fig. 3A). PCR (Macrogen), Ilarvirus-degenerate Table 1. Primers designed for RT-PCR amplification of different four viruses Genus Primer Sequence (5 3 ) * Expected size (bp) References Cucumovirus Cucumo-F ASYTTTDRGGTTCAATTCC Cucumo-R GACTGACCATTTTAGCCG 950 Choi et al. (1999) CMV CP-F ATGGACAAATCTGAATCAACCAG CMV-R TGGTCTCCTTTGGAAGCCC 970 ** Ilarvirus Ilar-F GCNGGWTGYGGDAARWCNAC Ilar-R AMDGGWAYYTGYTYNGTRTCACC 306 Untiveros et al. (2010) Alfamovirus AMV-F ATGAGTTCTTCACAAAAGAAAGC AMV-R TCAATGACGATCAAGATCGTC 655 ** Potyvirus Poty-F GTITGYGTIGAYGAYTTYAAYAA Poty-R TCIACIACIGTIGAIGGYTGICC 350 Zheng et al. (2010) Tobamovirus Tobamo-F GTYGTTGATGAGTTCRTGGA Tobamo-R ATTTAAGTGGASGGAAAAICACT 800 Letschert et al. (2002) TMV-F ATGTCTTACAGTATCACTACTC TMV-R TCAAGTTGCAGGACCAGAG 480 ** Internal control Nb-Actin-F ATCGGAATGGAAGCTGCTG Nb-Actin-R GTACCACCACTGAGGACAATG 110 ** * I: Inosine, Y: C/T, R: A/G, D: G/A/T, M: A/C, N: A/C/G/T, W: A/T, K: T/G. Designed in this study. Fig. 3. Agarose gel electrophoresis analysis of the PCR products obtained using degenerate primers (A) and specific primers (B). (A) M: 100 bp, Lane 1: Cucumovirus (950 bp), Lane 2: Ilarvirus (390 bp), Lane 3: Potyvirus (700 bp), Lane4: Tobamovirus (800 bp), Lane 5: Healthy, N: Negative control, P: Positive control. (B) M: 100 bp, Lane 1: CMV (1,050 bp), Lane 2: AMV-CP (670 bp), Lane 3: TMV-CP (480 bp), Lane 4: healthy, N: negative control, P: positive control.
4 84 Research in Plant Disease Vol. 24 No. 1 primer, AMV. Alfamovirus Ilarvirus Bromoviridae AMV 1a. specific primer RT-PCR, 3 (CMV, AMV, TMV) (Table 1, Fig. 3B). 3 CMV-Cha, AMV-Cha TMV-Cha.. (NCBI) BLAST, TMV-Cha Zehenfeng (HE818459) 97%, AMV-Cha Joe Davis (HQ185569) 99%. CMV-Cha RP20 (KC527749) 98%. CMV, AMV TMV, CMV-Cha, (Fig. 4). TMV AMV CMV.. Fig. 4. Phylogenetic analysis of each coat protein gene of CMV (A), AMV (B) and TMV (C) isolated from Chinese artichoke. The phylogenetic tree was reconstructed by the maximum likelihoods test using Mega 7 program with 1,000 bootstrap replication. The number at each branch shows bootstrap value. GenBank accession numbers; Fny (D10538), Mf (AJ27648), Y (D12499), Nt9 (D28780), SD (AB008777), Tfn (Y16926), LS (AF127976), Q (M21464), S (U37227), PSV (JN135292), 425 Madison (K02703), KR2 (AF294433), Lst (FN667967), 195AN (AJ130705), Ca616 (DQ314756), Lyh1 (AJ130709), Dac16 (AJ130708), Ca616 (DQ314756), VRU (AF015716), TSV (AF400664), TMV-152 (AF395129), Bacgiang (AM412008), K3 (AJ310339), YN (AJ239099), LCGM (KC572633), KMAN (KC572627), TOM (AF103779), SD1 (DQ014551), THN1 (LN651240), PMMoV (KY288633) , RT-PCR 3 (AMV, CMV, TMV). 3 CMV. Conflicts of Interest No potential conflict of interest relevant to this article was reported.
5 Research in Plant Disease Vol. 24 No Acknowledgement This study was carried out with the support of Cooperative Research Program for Agricultural Science & Technology Development (Project No. PJ ) in Rural Development Administration, Republic of Korea and 2016 Research Grant from Kangwon National University. References Back, H. S., Na, Y. S., Kim, D. H., Lee, C. H., Lyu, B. H. and Song, S. K Antioxidant activities of Stachys sieboldii MIQ roots. J. Life Sci. 14: 1-7. Broadbent, L The epidemiology of tomato mosaic. Ann. Appl. Biol. 56: Choi, J. K., Kwon, S. B., Lee, S. Y. and Park, W. M Some properties of two isolates of Cucumber mosaic virus isolated from Aster yomena Makino and Commelina communis L. Korean J. Plant Pathol. 6: Choi, S. K., Choi, J. K., Park, W. M. and Ryu, K. H RT-PCR detection and identification of three species of cucumoviruses with a genus-specific single pair of primers. J. Virol. Methods 83: Douine, L., Quiot, J. B., Marchoux, G. and Archange, P Recensement des espèces végétales sensibles au Virus de la Mosaïque du Concombre (CMV) Etude bibliographique. Ann. Phytopathol. 11: Francki, R. I. B., Mossop, D. W. and Hatta, T Cucumber mosaic virus. In: CMI/AAB Descriptions of Plant Viruses, 213 pp. Fuji, S., Yamamoto, H., Furuya, H. and Naito, H Characterization of a new potyvirus isolated from Chinese artichoke in Japan. Arch. Virol. 148: Hollings, M. and Huttinga, H Tomato mosaic virus. In: CMI/ AAB Descriptions of plant viruses, 156 pp. Hiruki, C. and Hampton, R. O Diseases caused by viruses and viruses infectious to alfalfa. In: Compendium of Alfalfa Diseases, pp American Phytopathological Society. Kaper, J. M. and Waterworth, H. E Cucummoviruses. In: Handbook of Plant Virus Infections: Comparative Diagnosis. Kim, J. S., Lee, S. H., Choi, H. S., Kim, M. K., Kwak, H. R., Kim, J. S. and Choi, G. S characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 18: (In Korean) Letschert, B., Adam, G., Lesemann, D. E., Willingmann, P. and Heinze, C Detection and differentiation of serologically crossreacting tobamoviruses of economical importance by RT-PCR and RT-PCR-RFLP. J. Virol. Methods 106: Lirong, C. M. Z. G. J. and Jiyan, Q Meristem-tip culture and value of application of virus-free clone in Chinese artichoke. Acta Agric. Bor. Sin., 2: Mueller, E. E. and Grau, C. R Seasonal progression, symptom development, and yield effects of Alfalfa mosaic virus epidemics on soybean in Wisconsin. Plant Dis. 91: Owen, J. and Palukaitis, P Characterization of Cucumber mosaic virus I. Molecular heterogeneity mapping of RNA 3 in eight CMV strains. Virology 166: Palukaitis, P. and García-Arenal, F Cucumoviruses. Adv. Virus Res. 62: Taylor, R. H., Grogan, R. G. and Kimble, K. A Transmission of tobacco mosaic viras in tomato seed. Phytopathology 51: Untiveros, M., Perez-Egusquiza, Z. and Clover, G PCR assays for the detection of members of the genus Ilarvirus and family Bromoviridae. J. Virol. Methods 165: Zheng, L., Rodoni, B. C., Gibbs, M. J. and Gibbs, A. J A novel pair of universal primers for the detection of potyviruses. Plant Pathol. 59:
01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More informationDBPIA-NURIMEDIA
식물병연구 Res. Plant Dis. 17(2) : 211 215 (2011) http://dx.doi.org/10.5423/rpd.2011.17.2.211 단보 Open Access Research in Plant Disease The Korean Society of Plant Pathology 열무에서분리한오이모자이크바이러스분리주의특성 이선주 홍진성 1
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information식물병연구 Note Open Access Res. Plant Dis. 22(1): (2016) 서향에서분리한신종포티바이러스 (Daphne Mottle Virus) 의동정 Identi
식물병연구 Note Open Access Res. Plant Dis. 22(1): 59-63 (2016) http://dx.doi.org/10.5423/rpd.2016.22.1.59 서향에서분리한신종포티바이러스 (Daphne Mottle Virus) 의동정 Identification of Daphne Mottle Virus Isolated from Daphne
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Incidence Rates of Major Diseases o
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 175-181 (2018) https://doi.org/10.5423/rpd.2018.24.3.175 Incidence Rates of Major Diseases on Green-Fleshed Kiwifruit cv. Hayward and Yellow-Fleshed
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information03-15(3)-04(고숙주).fm
Res. Plant Dis. 15(3) : 175-182 (2009) Research in Plant Disease The Korean Societ of Plant Patholog ZYMV»ƒ e w š *Á½ Á Á½ šá 1 Á 1 û» e, 1 w Effect of the Infection Times b Zucchini ellow mosaic virus
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information식물병연구 Note Open Access Res. Plant Dis. 20(4) : (2014) Brugmansia mosaic virus Characterization of B
식물병연구 Note Open Access Res. Plant Dis. 20(4) : 307-313(2014) http://dx.doi.org/10.5423/rpd.2014.20.4.307 Brugmansia mosaic virus Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp.
More information식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu
식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information13장문현(541~556)ok
A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).
식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information(2)-02(최경자).fm
Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More information(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
More informationJkcs022(89-113).hwp
대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo
More informationResearch in Plant Disease Vol. 23 No 요배추과등작물들을비롯한잡초들을포함한 300여종이상의식물들을감염시킬수있으며약 90여종의진딧물을통한비영속적전반으로포장에서퍼져나가는것으로알려져있다 (Choi와 Choi, 1992; Raybould
식물병연구 Note Open Access Res. Plant Dis. 23(1): 60-64 (2017) https://doi.org/10.5423/rpd.2017.23.1.60 순무모자이크바이러스에대한무육종계통저항성평가 Resistance Evaluation of Radish (Raphanus sativus L.) Inbred Lines against Turnip
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<C7A5C1F620BEE7BDC4>
연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationKIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti
식물병연구 Note Open Access Res. Plant Dis. 23(1): 69-74 (2017) https://doi.org/10.5423/rpd.2017.23.1.69 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecting Foxtail Millet (Setaria italica) in South Korea
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information민속지_이건욱T 최종
441 450 458 466 474 477 480 This book examines the research conducted on urban ethnography by the National Folk Museum of Korea. Although most people in Korea
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More informationDBPIA-NURIMEDIA
식물병연구 Res. Plant Dis. 17(2) : 196 204 (2011) http://dx.doi.org/10.5423/rpd.2011.17.2.196 보문 Open Access Research in Plant Disease The Korean Society of Plant Pathology 2006 년과 2007 년상주와구례에서발생한오이바이러스병의병징특성
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information퇴
YONSEI ALLWAYS Contents 6 10 42 44 46 12 48 50 20 22 24 26 28 30 32 34 36 38 40 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 4 YONSEI UNIVERSITY YONSEI All-Ways+ 5 88 90 92 94 96 98 100 102 104
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information