Microsoft Word - 1-이영미

Save this PDF as:

Size: px
Start display at page:

Download "Microsoft Word - 1-이영미"

Transcription

1 JMLS [Journal of Marine Life Science] October 2016; 1(2): 카드뮴이해양섬모충 (Euplotes crassus) 의 ABC Transporters 와 GST 유전자발현에미치는영향에관한연구 김호균 김세훈 김지수 이영미 * 상명대학교자연과학대학생명과학과 Effect of Cadmium on the Expression of ABC Transporters and Glutathione S-transferase in the Marine Ciliate Euplotes crassus Hokyun Kim, Se-Hun Kim, Ji-Soo Kim, Young-Mi Lee * Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul 03016, Korea Corresponding Author Young-Mi Lee Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul 03016, Korea Received : September 28, 2016 Revised : October 05, 2016 Accepted : October 11, 2016 카드뮴과같은중금속은독성이높아수서생물과인간에게해로운영향을미친다고알려져있다. 본연구에서는해양섬모충 Euplotes crassus 에서카드뮴이해독기전에관여하는 ABC transporters (ABCs) 와 glutathione S-transferase (GST) 의유전자발현에미치는영향을조사하였다. 총 7 개의 ABCs 유전자와 1 개의 GST 유전자일부를클로닝하여유전자분석을실시하였고, 카드뮴 (0.1~1 mg/l) 노출에따른이들유전자의발현양상을 quantitative real time RT-PCR (qrt-pcr) 을이용하여분석하였다. 염기서열분석과계통분석결과이들 ABCs 유전자가 ABC transporter 의특징을가지며, ABC-B/C family 에속하는것을확인하였고, GST 유전자는 theta isoform 과유사한것으로나타났다. 카드뮴에 8 시간노출시킨결과 ABC transporter 유전자의경우 ABCB21 유전자를제외하고는대부분농도의존적으로유전자발현이유의하게증가하였다. GST 유전자는 0.5 mg/l 에서가장높은유전자발현양상을보였으며, 1 mg/l 에서는발현량이대조군수준으로감소되었다. 본연구결과는 E. crassus 의 ABC transporter 와 GST 유전자가카드뮴에의해유도되는독성에대한방어기전에참여하는것을의미한다. Heavy metals such as cadmium (Cd) are highly toxic to aquatic organisms and human, even at trace concentration. Herein we investigated the effect of Cd on the gene expression of ATP-binding cassette (ABC) transporters and glutathione S-transferase (GST) in marine ciliate Euplotes crassus. Seven ABC transporters and one GST genes were partially cloned and sequences, and thereafter, transcriptional modulation of these genes after exposure to Cd for 8 h was investigated using quantitative real time RT- PCR (qrt-pcr). As results, sequence analysis and phylogenetic study revealed that E. crassus ABCs are likely typical ABC transports, in particular, B/C family, and GST gene may be similar to GST theta isoform. A significant increase in the expression of ABCs, except for ABCB21 was observed in a concentration dependent manner after exposure to Cd (0.1 and 0.5 mg/l) for 8 h. The GST mrna level was the highest at 0.5 mg/l Cd and then reduced until control level. These findings suggest that ABCs and GST may be involved in a protective mechanism against Cd-mediated toxicity in E. crassus. Keywords: Ciliate( 섬모충 ), Euplotes crassus, Cadmium( 카드뮴 ), ABC transporter, Glutathione S-transferase, Quantitative real time RT-PCR 서론 카드뮴은주로폴리염화비닐 (PVC), 염료, 합금, 니켈-카드뮴전지등의제조에사용되며수서생물과인간에게높은독성을나 타낸다고알려져있다 (Järup, 2003). 카드뮴을포함하는중금속은생체내에서활성산소 (ROS) 를생성하여산화적스트레스를유발할수있다. 이러한 ROS 는세포내고분자물질인단백질, 지질, 탄수화물, 핵산을공격하여노화와질병의원인이되며, 나아가세

2 80 김호균 김세훈 김지수 이영미 포사멸을유도할수있다. 따라서산소를소비하는생물에서는이를극복하기위한방어기전으로서 superoxide dismutase (SOD), catalase, Glutathione S-transferase (GST) 와같은항산화단백질을다양하게발달시켜왔다. 특히 GST는 phase II enzyme 으로 phase I enzyme (e.g. cytochrome P450) 에의해생성되는반응성높은대사산물의해독에도중요한역할을한다. ATP-binding cassette (ABC) transporters 는가장큰단백질 superfamily 중하나로원핵생물부터인간까지모든생물에서나타난다. 이들단백질은막관통단백질로 ATP 를소비하면서이온, 아미노산, 펩티드, 당, 약물등다양한기질의이동에관여한다. 구조는기본적으로소수성막관통부위 (transmembrane domain, TMDs) 와뉴클레오티드결합부위 (nucleotide-binding domain, NBDs) 로구성되어있으며각각 2개씩갖는경우 full transporter [(TMD- NBD) 2 ] 라하고, 하나씩만갖는경우를 half transporter [(TMD-NBD)] 라한다 (Dean et al., 2001). 구조와기능상의유사성을토대로 ABC transporters는 7~8 subfamilies (A to G or H) 를갖는데 (Klein et al., 1999; Dean et al., 2001), 이들중 ABC-B와 ABC-C subfamilies 는세포내반응성높은대사물질과외래물질의해독에주로관여한다고알려져있다. 특히카드뮴은 glutathione (GSH) 의 thiol- 기와결합하여 bis (glutathionato)-cadmium 복합체 (Cd-GS 2 ) 를형성하며 (Pastore et al., 2003), 이복합체는인간에서 MRP1으로알려져있는 ABC-C transporter를통해배출되기때문에이 transporter를 GS-X 펌프라고도한다 (Li et al., 1997). 특히, MRP를통한중금속의배출에환원형 GSH와 GST가중요하다고알려져있다 (Brambila et al., 2002). 한편으로 Timofeyev et al. (2007) 은카드뮴이인간에서 MDR (ABCB) 로알려져있는 P-glycoprotein (P-gp) 과관련있는 multixenobiotics resistance (MXR) 의기질이라고제시한바있다. 그러나해독기전에관여하는단백질의중요한기능에도불구하고섬모충에서는관련연구가매우미흡하다. 단세포진핵생물인섬모충은환경내분포범위가넓고, 수서환경내에서에너지전달자로서그리고 benthic microecosystem 의구성원으로서중요한역할을담당하고있다. 특히단세포생물이기때문에다세포진핵생물에비해환경스트레스에민감하게반응하며, 진핵생물로서의특성을갖기때문에이들의생물학적반응을통해고등한진핵생물의영향을예측할수있어생태독성학적분야에서모델생물로서간주되고있다 (Gomiero et al., 2012, 2013). 우리의이전연구에서카드뮴이 ROS를생성할수있으며, glutathione reductase (GR) 와 glutathione peroxidase (GPx) 같은항산화효소의활성과유전자발현을유도할수있다는것을확인한바있다 (Kim et al., 2011a, 2014). 또한구리, 아연, 납등의중금속에노출된 E. crassus에서 GST 유전자의발현이크게증가하는것을확인하였다 (Kim et al., 2011a). 따라서본연구에서는해양섬모충 E. crassus에서 7개의 ABC transporter 유전자와 1개의 GST 유전자를클로닝하고염기서열을 분석하였고, 추가로카드뮴노출에대한이들유전자의발현양상을조사하였다. 본연구의목적은카드뮴에대한독성기전을분자적수준에서이해하고자하며, 중금속오염에대한모니터링을위한분자마커로써이들유전자의잠재성을평가하는것이다. 재료및방법 1. 배양 Euplotes crassus Dujardin (1842) 는여과된 30 psu 인공해수에서, 22, 12시간 : 12시간의광주기하에서 Kim et al. (2011a) 의방법에따라상명대학교유전학실험실에서배양되고있는것을사용하였다. 종동정은형태적특징과분자마커 (18S rrna) 를이용하여수행했다 (Kim et al., 2011b). 2. 카드뮴노출실험모든시약은분자생물학등급을사용하였으며특별한언급이없는한 Sigma-Aldrich Co. (St. Louis, Mo, USA) 으로부터구입하였다. 카드뮴의 stock solution (1 g/l) 은 CdCl 2 를증류수에녹여서제조하였다. 24시간순치시킨후, 지수기의 E. crassus (2 x 10 3 cells/ ml) 를 10-ml conical tube에서카드뮴 (0.1, 0.5 mg/l for ABC transporters; 0.125, 0.25, 0.5, 1 mg/l for GST) 에 8시간노출시켰다. 카드뮴의농도는이전연구를통해아치사농도에서결정하였다 (Kim et al., 2014). 모든실험은 3반복으로수행하였다. 3. Total RNA 추출및 cdna 합성카드뮴에노출후세포를수확하고, 5배용량의 TRIzol reagent (Thermo Fisher Scientific Inc., USA) 를넣어균질화시켰다. Total RNA는제조사의지시에따라추출되었으며, 추출된 RNA의정량및정성분석은 1% agarose gel에서전기영동후 UV transilluminator 에서확인하였고, spectrophotometer 의 A 260 값과 A 280 값을이용하였다. cdna 합성은 ReverTra Ace qpcr RT Master Mix (Toyobo Corp. Ltd, Japan) 를이용하였고, 1 μg의 total RNA로부터합성하였다. 4. Polymerase chain reaction (PCR) amplification 과염기서열분석 ABC transporter 유전자와 GST 유전자의부분서열을 E. crassus 전사체로컬데이터베이스 ( 상명대학교, 유전학실험실 ) 로부터확보한후서열정보를확인하기위하여 PCR 분석을수행하였다. 모든 PCR 반응은 1 μl의 cdna와 0.2-μM primer set를사용하였으며, PCR 반응조건은다음과같다. 즉, 95 /5 min; 35 cycles of

3 31 October 2016; 1(2): 카드뮴이해양섬모충 ABC Transporters 와 GST 유전자발현에미치는영향 /1 min, 55~60 /1 min, 72 /2 min; 72 /10 min. PCR은 MyCycler TM (Bio-rad Inc., CA, USA) 에서진행되었고, 반응이끝난후 PCR 산물은 1% agarose gel에서가시화한후, QIAquick Gel Extraction Kit (Qiagen GmbH, Hilden, Germany) 를이용하여정제하고염기서열분석에사용하였다. 아미노산서열은 ExPASy translate tool ( 을통해 euplotid nuclear를위한 genetic code를이용하여얻었고, NCBI (National Center for Biotechnology Information) BlastP 를통해유전자동정을하였다. 계통분석은아미노산서열을다른종의것들과 Clustal X ( 를통해비교한후, Mega 6 ( megasoftware.net) 에서 neighbor-joining method (bootstrap 1000 replicates) 를이용하여계통수를작성하였다. 5. Real-time reverse transcriptase polymerase chain reaction (qrt-pcr) cycles of 95 /30 s, 55 /30 s, 72 /30 s; 72 /10 min. 특정한산물의증폭을확인하기위하여 melting curve를다음조건에따라진행하였다. 즉, 95 /1 min, 55 /1 min, 65 /10 s( 초당 0.1 증가 ). SYBR Green (Molecular Probes Inc., Invitrogen) 은특정한증폭산물을확인하기위해사용하였고, SYBR Green - labeled products 의증폭과탐지는 CFX96 TM real-time PCR system (Bio-Rad, Hercules, CA, USA) 에서수행되었다. 각실험에서얻은데이터는각시료간의발현량보정을위하여, E. crassus 18S rrna 유전자의발현수준에대해상대적으로나타내었다. 모든실험은 3반복으로진행되었으며, 데이터는 threshold cycle (C T ) 값으로얻어서각시료의 C T 값을계산하는데사용하였다. 상대적인유전자발현에서 fold-change 는 2 Ct 방법을이용하여계산하였다 (Livak and Schmittgen, 2001). 6. 통계분석 모든 PCR 반응은 1 μl의 cdna와 0.2-μM primer set (Table 1) 를사용하였으며, PCR 반응조건은다음과같다. 즉, 95 /5 min; 40 데이터는 3반복의평균 ± 표준편차 (S.D.) 로나타내었다. 상대적인 mrna 발현량은 Turkey's test 후 one-way analysis of variance Table 1. Primer list for real time RT-PCR used in this study Gene Oligo name Sequence (5' 3') Amplicon size ABCB9 (KT778257) EC_ABCB9_RT_F1 EC_ABCB9_RT_R1 CTGATGAGCAATCCTCCAGA GGACAATCAGGCTCTCCTTC 98 bp ABCB21 (KT778258) EC_ABCB21_RT_F1 EC_ABCB21_RT_R1 CGTCTGGTTCAGATACCCAA CGAGTCCGACACACTCATTC 89 bp ABCB4 (KT778260) EC_ABCB4_RT_F1 EC_ABCB4_RT_R1 CTGACGCCACTGAAGATGAG CTCCAGCATTGGTCTTGATG 99 bp ABCB5 (KT778262) EC_ABCB5_RT_F1 EC_ABCB5_RT_R1 AGGTCATGATCCAGAAGATCAA TTATTAACAGCTTGAAGACTCTTTCC 120 bp ABCC2 (KT778263) EC_ABCC2_RT_F1 EC_ABCC2_RT_R1 AGGCTCTCCAATATCTCGCT GAGGATTTCCCACTTCCAAC 80 bp ABCC3 (KT778264) EC_ABCC3_RT_F1 EC_ABCC3_RT_R1 GCCTGCTACCTGCTAGTGAA GGTGATCCTCGGAGAAGAAG 87 bp ABCC8 (KT778265) EC_ABCC8_RT_F1 EC_ABCC8_RT_R1 GCAAGTTCATTCGCTGCTAT AGTTCTGGATCCGATTCATTG 118 bp GST (JN872739) EC_GST_RT_F1 EC_GST_RT_R1 CCAACGTTTGGACCTGCTTA TGGGTTGCTTCATCTCCTTC 86 bp 18S-rRNA (AY007440) Ec_18S_RT_F Ec_18S_RT_R ACAATTGGAGGGCAAGTCTG CCAGAAATCCAACTACGAGCA 104 bp

4 82 김호균 김세훈 김지수 이영미 Table 2. BlastP result for 8 different ABC transporters and GST in the marine ciliate E. crassus Genes Closely matched gene Identity Accession No E-value Ec-ABC B4 Oxytricha trifallax putative ABC transporter B 42% EJY Ec-ABC B5 Stylonichia lemnae ABC transporter B family 29% CDW e-33 Ec-ABC B9 Oxytricha trifallax putative ABC transporter B 33% EJY Ec-ABC B21 Oxytricha trifallax putative ABC transporter B 44% EJY Ec-ABC C2 Oxytricha trifallax MRP, putative 49% EJY e-48 Ec-ABC C3 Stylonychia lemnae ABC transporter C family 38% CDW e-51 Ec-ABC C8 Biomphalaria glabrata MRP 7-like 35% XP_ e-25 Ec-GST Tetranychus urticae GST 1, isoform C-like 33% XP_ e-15 (one-way ANOVA) 으로비교하였다. 통계분석은 PASW statistics 18.0 (SPSS Inc., Chicago, IL, USA) 을사용하였고, 0.05보다낮은 p 값을통계적으로유의한것으로간주하였다. 결과 1. ABC transporters와 GST의염기서열분석 본연구에서는총 7개의 ABC transporter 유전자와 1개의 GST 유전자의부분염기서열을 E. crassus transcriptome local database 로부터확보하여이들의아미노산서열을이용하여 NCBI BlastP 데이터베이스를통해유전자동정을실시하였다. 그결과 4개의유전자는 ABC transporter B family (ABCB4, ABCB5, ABCB9, ABCB21) 에속하였고, 3개의유전자는 ABC transporter C family (ABCC2, ABCC3, ABCC8) 에속하는것으로확인되었다. 유전자서열정보는 NCBI GenBank 에등록하였으며 Accession Number 는 Table 1에나타냈다. 이들유전자는 ABC transporter에서진화적으로보전되어있는 domain/motif, 특히 signature 서열 (C-helix라고도함 ) (LSGGQ), Walker B(hhhD, h는소수성잔기를의미함 ), Q-loop 서열이 ABCB5, ABCC3, ABCC8을제외한유전자에서확인되었으며, Walker A (GXXGXGK(S/T)) 서열은 ABCC8을제외한모든유전자에서확인되었다. ABCC8 의경우 TMD2 부분의서열이어서상기의보존된서열은확인되지않았으나 ABC-membrane superfamily domain을갖는것으로확인되었다. 이들유전자를 BlastP 분석한결과각각다른종의 ABCB 또는 ABCC 의것들과상대적으로높은 identity 를보였다 (Table 2). 이들유전자들중 ABCB9-like 와 ABCB21 유전자에대해 E. crassus ABCB1과함께다른종의 ABCB 유전자의아미노산서열을이용한 multiple alignment 결과에서 NBD1과 NBD2의 conserved domain/motif의위치를 Fig. 1에표시하였다. GST 유전자의경우 Thioredoxin-like superfamily과 C-terminal domain을확인하였고, 기질결합부위인 H-site가 75, 79, 80번아미노산잔기에서확인되었다 (Fig. 2A). BlastP 분석결과 twospotted spider mite Tetranychus urticae의 GST 1와 33% 의 identity 를보였고, Drosophila melanogaster의 GST T3와 31% 의 identity 를보였다. E. crassus GST의아미노산서열을다른종의 GST isoforms와비교하여계통분석을한결과 GST-theta isoform 과같은 cluster 를형성하였다 (Fig. 2B). 2. 카드뮴노출에따른 ABC transporters와 GST 유전자발현양상카드뮴에의한 ABC transporters 와 GST 유전자의발현변화를조사하기위하여 ABC transporter 유전자의경우 E. crassus에카드뮴 (0.1, 0.5 mg/l) 을 8시간처리하였고, GST 유전자의경우카드뮴 (0.125, 0.25, 0.5, 1.0 mg/l) 을 8시간동안처리하였다. Fig. 3에서보는바와같이, ABC transporter B family 유전자들의발현이 ABCB21를제외한모든유전자에서농도의존적으로유의하게증가하였으며, ABCB21의경우에는 0.5 mg/l 카드뮴노출에서유의하게감소하였다 (Fig. 3A). ABC transporter C family의경우에도 ABCC2 와 ABCC3 mrna 발현은농도의존적으로유의하게증가하였으며, ABCC8 의경우에는 0.1 mg/l Cd에서유의하게증가하였다가, 0.5 mg/l Cd에서대조군수준으로감소하는경향을보였다 (Fig. 3B). E. crassus GST 유전자의발현수준은농도의존적으로증가하다가 0.5 mg/l Cd 노출에서가장높은발현량 ( 약 2배증가, p < 0.05) 을보였고, 1.0 mg/l에서는대조군수준으로감소하는양상을보였다 (Fig. 4).

5 31 October 2016; 1(2): 카드뮴이 해양 섬모충 ABC Transporters와 GST 유전자 발현에 미치는 영향 83

6 84 김호균 김세훈 김지수 이영미 고찰 생물은내적및외적환경스트레스에저항하기위한다양한방어기전을가지고있다. 특히 ABC transporters 와 GST는대사상에생성되는유해한중간대사산물뿐아니라외래에서유입되는약물등여러가지기질의해독에관여하는것으로알려져있다. 이들의생물학적중요성에도불구하고섬모충에서는방어기전에관여하는단백질의존재여부및유전자 / 단백질의특성연구가매우부족하다. 현재까지담수섬모충인 Tetrahymena thermo- philia 에서유전체분석을통해 ABC transporters 의존재와특성이보고된바있다 (Xiong et al., 2010). 특히화학물질에대한분자적수준에서의연구는 DDT 노출에따른 T. thermophilia ABC transporter 유전자의발현변화를보고한것이전부이다 (Ning et al., 2015). 이들섬모충은 Alveolate 를구성하는그룹으로서진화학적으로도중요한의미를가지며, 추가적인연구가필요하다는것을의미한다. 본연구에서는 7개의 ABC transporter 유전자의부분서열을확보하였고, 이들의대부분은진화적으로보존된 domain 들, 특히

7 31 October 2016; 1(2): 카드뮴이해양섬모충 ABC Transporters 와 GST 유전자발현에미치는영향 85 signature 서열, Walker A, Walker B, 그리고 Q-loop 를모두혹은적어도하나를가지고있는것으로확인되었다. Signature 서열은모든 ABC subunits 에서나타나는서열로 ATP 가결합된상태에서 nucleotide 와결합하는부위이다 (Hollenstein et al., 2007). 유전자서열분석과 BlastP 분석결과를통해이들유전자가 ABC transporter B와 C family 에속하는것으로나타났다. 또한 E. crassus GST의경우에도보존된 domains 을가지고있으며, 계통분석결과 GST-theta isoform 과상대적으로가까운것으로나타났다. 그러나 Table 2에서보는바와같이 E. crassus 유전자와가장높은 identity 를보이는유전자의경우에도그값이상당히낮다는것을알수있다. ABC transporter 의경우에는 NBD에서는보존된서열이존재하는반면 TMD 서열의보존정도는매우낮아서열전체의유사도가낮다고보고된바있다 (Luckenbach and Epel, 2008). 특히섬모충은다른진핵생물에비해유전체의진화율이상당히높은것으로알려져있다 (Zufall et al., 2006). 이는섬모충의유전적특성에서기인하는데, 이들은 2개의핵, 즉전사적으로활성을갖는대핵 (macronucleus) 과생식에만관여하는소핵 (micronucleus) 을가지고있다 (Katz, 2001). 대핵의유전체는무성분열이일어나는동안염색체절편화, 증폭, 염색체특정부위의손실등큰변화를겪게된다 (Jahn and Klobutcher, 2002). Zufall et al. (2006) 은섬모충에서단백질진화가높게나타나는것이대핵유전체의이러한변화와관련이있다고보고한바있다. 카드뮴노출에따른 ABC transporters 의발현증가에대한연구는여러수서생물에서알려져왔다. 예를들어카드뮴은 Euglena ABCB1 의발현을유도했으며 (Einicker-Lamas et al., 2003), Copepod Tigriopus japonicus 에서도카드뮴노출에의해 P-gp의유전자및단백질발현이유도되었다고보고된바있다 (Jeong et al., 2014). ABCC family 인 MRP는 glutathione (GSH) 와같은기질과결합한외래물질의이송에관여하는것으로알려져있으며 (Homolya et al., 2003), 카드뮴에노출된 Zebrafish 세포와배아에서 ABCC 유전자들의발현이보고되었다 (Long et al., 2011). 이러한연구결과는 ABC transporter B와 C family 가카드뮴의해독에관여한다는것

8 86 김호균 김세훈 김지수 이영미 을의미한다. 본연구결과에서도 E. crassus의 ABCB4, ABCB5, ABCB9, ABCC2, ABCC3, ABCC8 유전자들의발현이농도의존적으로유의하게증가하였으며, 이는오히려발현이감소한 ABCB21 유전자보다이들세유전자가카드뮴해독에서보다중요한역할을담당한다는것을의미한다. 카드뮴은 GS-X 펌프로알려져있는 MRP를통해해독되며이때 GSH와 GST가필요하다고알려져있다 (Brambila et al., 2002). 우리의이전연구에서 E. crassus에카드뮴을노출시켰을때 total GSH 농도가 0.1 mg/l Cd 노출시유의하게증가하다가 0.5 mg/l에서는감소하는결과를보였다 (Kim et al., 2014). 이는높은농도의카드뮴노출은세포내 GSH의고갈을유도하고이러한결과는본연구결과에서 1 mg/l 카드뮴노출시 GST mrna 발현억제에기여한것으로판단된다. GSH의고갈과 GST 발현의억제는카드뮴해독에대한 MRP 작용을억제할수있을것이다. 우리의이전연구결과에서도 0.5 mg/l 이상의카드뮴에노출되었을때 ABC transporter의 efflux 기능이억제되는것을확인한바있다 (unpublished data). 본연구에서는해양섬모충 E. crassus에서 7개의 ABC transporter 유전자와 1개의 GST 유전자를동정하고, 카드뮴노출에따른이들유전자의발현변화를조사하였다. 염기서열분석결과 E. crassus ABC transporters가외래물질의해독에관여하는 B 와 C family에속하며, GST 유전자의경우 theta isoform과유사한것으로나타났다. 카드뮴에의한유전자발현연구결과는 E. crassus ABCB21을제외한 6개의유전자가카드뮴해독에참여하는것으로보이며, GST 유전자역시카드뮴해독기전에참여하는것으로확인되었다. 이러한결과는이들유전자가카드뮴이유발하는독성영향으로부터세포방어에관여한다는것을의미하며, 중금속오염지역의모니터링과수서생물의건강성평가를위한분자마커로써의잠재적가치가있음을나타낸다. 참고문헌 Brambila EM, Achanzar WE, Qu W, Webber MM, Waalkes MP Chronic arsenic-exposed human prostate epithelial cells exhibit stable arsenic tolerance: mechanistic implications of altered cellular glutathione and glutathione S transferase. Toxicol Appl Pharmacol 183: Dean M, Rzhetsky A, Allikmets R The human ATP-binding cassette (ABC) transporter superfamily. Genome Res 11: Einicker-Lamas M, Morales MM, Miranda K, Garcia-Abreu J, Oliveira AJF, Silva FLS, Oliveira MM P-glycoprotein-like protein contributes to cadmium resistance in Euglena gracilis. J Comp Physiol B 173: Gomiero A, Dagnino A, Nasci C, Viarengo A The use of protozoa in ecotoxicology: Application of multiple endpoint tests of the ciliate E. crassus for the evaluation of sediment quality in coastal marine ecosystems. Sci Total Environ 442: Gomiero A, Sforzini S, Dagnino A, Nasci C, Viarengo A The use of multiple endpoints to assess cellular responses to environmental contaminants in the interstitial marine ciliate Euplotes crassus. Aquat Toxicol 114: Hollenstein K, Frei DC, Locher KP Structure of an ABC transporter in complex with its binding protein. Nature 446: Homolya L, Varadi A, Sarkadi B Multidrug resistanceassociated proteins: export pumps for conjugates with glutathione, glucuronate or sulfate. Biofactors 17: Jahn CL, Klobutcher LA Genome remodeling in ciliated protozoa. Annu Rev Microbiol 56: Järup L Hazards of heavy metal contamination. Br Med Bull 68: Jeong CB, Kim BM, Kim RK, Park HG, Lee SJ, Shin KH, Leung KM, Rhee JS, Lee JS Functional characterization of P- glycoprotein in the intertidal copepod Tigriopus japonicus and its potential role in remediating metal pollution. Aquat Toxicol 156: Katz LA Evolution of nuclear dualism in ciliates: a reanalysis in light of recent molecular data. Int J Syst Evol Microbiol 51: Kim SH, Kim SJ, Lee J-S, Lee YM Acute effects of heavy metals on the expression of glutathione-related antioxidant genes in the marine ciliate Euplotes crassus. Mar Pollut Bullet 85: Kim SH, Jung MY, Lee YM. 2011a. Effect of heavy metals on the antioxidant enzymes in the marine ciliate Euplotes crassus. Toxicol Environ Health Sci 3: Kim SJ, Choi JK, Ryu S, Min GS. 2011b. Single-cell PCR on protargol-impregnated euplotid ciliates: a combined approach of morphological and molecular taxonomy. Anim Cells Syst 15-3: Klein I, Sarkadi B, Varadi A An inventory of the human ABC proteins. Biochim Biophys Acta 1461: Li ZS, Lu YP, Zhen RG, Szczypka M, Thiele DJ, Rea PA A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis (glutathionato) cadmium. Proc Natl Acad Sci USA 94: Livak KJ, Schmittgen TD Analysis of relative gene expression

9 31 October 2016; 1(2): 카드뮴이해양섬모충 ABC Transporters 와 GST 유전자발현에미치는영향 87 data using real time quantitative PCR and the 2 -ΔΔCt method. Methods 25: Long Y, Li Q, Wang Y, Cui Z. 2011b. MRP proteins as potential mediators of heavy metal resistance in zebrafish cells. Comp Biochem Physiol Part C 153: Luckenbach T, Epel D ABCB-and ABCC-type transporters confer multixenobiotic resistance and form an environmenttissue barrier in bivalve gills. Am J Physiol Regul Integr Comp Physiol 294: R1919-R1929. Ning Y, Dang H, Liu G, Xiong J, Yuan D, Feng L, Miao W ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena. Sci China Life. Sci 58: Pastore A, Federici G, Bertini E, Piemonte F Analysis of glutathione: implication in redox and detoxification. Clin Chim Acta 333: Timofeyev MA, Shatilina ZM, Bedulina ZM, Menzel R, Steinberg CEW Natural organic matter (NOM) has the potential to modify the multixenobiotic resistance (MXR) activity in freshwater amphipoids Eulimnogammarus cyaneus and E. verrucosus. Comp Biochem Physiol Part B 146: Xiong J, Feng L, Yuan D, Fu C, Miao W Genome-wide identification and evolution of ATP-binding cassette transporters in the ciliate Tetrahymena thermophila: A case of functional divergence in a multigene family. BMC Evol Biol 10: 330. Zufall RA, McGrath CL, Muse SV, Katz LA Genome architecture drives protein evolution in ciliates. Mol Biol Evol 23:

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

<35BFCFBCBA2E687770>

<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

디지털포렌식학회 논문양식

디지털포렌식학회 논문양식 ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information

Microsoft PowerPoint - 27.pptx

Microsoft PowerPoint - 27.pptx 이산수학 () n-항관계 (n-ary Relations) 2011년봄학기 강원대학교컴퓨터과학전공문양세 n-ary Relations (n-항관계 ) An n-ary relation R on sets A 1,,A n, written R:A 1,,A n, is a subset R A 1 A n. (A 1,,A n 에대한 n- 항관계 R 은 A 1 A n 의부분집합이다.)

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

BSC Discussion 1

BSC Discussion 1 Copyright 2006 by Human Consulting Group INC. All Rights Reserved. No Part of This Publication May Be Reproduced, Stored in a Retrieval System, or Transmitted in Any Form or by Any Means Electronic, Mechanical,

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

개최요강

개최요강 55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

Product A4

Product A4 2 APTIV Film Versatility and Performance APTIV Film Versatility and Performance 3 4 APTIV Film Versatility and Performance APTIV Film Versatility and Performance 5 PI Increasing Performance PES PPSU PSU

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

<3136C1FD31C8A35FC3D6BCBAC8A3BFDC5F706466BAAFC8AFBFE4C3BB2E687770>

<3136C1FD31C8A35FC3D6BCBAC8A3BFDC5F706466BAAFC8AFBFE4C3BB2E687770> 부동산학연구 제16집 제1호, 2010. 3, pp. 117~130 Journal of the Korea Real Estate Analysts Association Vol.16, No.1, 2010. 3, pp. 117~130 비선형 Mankiw-Weil 주택수요 모형 - 수도권 지역을 대상으로 - Non-Linear Mankiw-Weil Model on Housing

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

<352EC7E3C5C2BFB55FB1B3C5EBB5A5C0CCC5CD5FC0DABFACB0FAC7D0B4EBC7D02E687770>

<352EC7E3C5C2BFB55FB1B3C5EBB5A5C0CCC5CD5FC0DABFACB0FAC7D0B4EBC7D02E687770> 자연과학연구 제27권 Bulletin of the Natural Sciences Vol. 27. 2013.12.(33-44) 교통DB를 이용한 교통정책 발굴을 위한 통계분석 시스템 설계 및 활용 Statistical analytic system design and utilization for transport policy excavation by transport

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

..........

.......... 통권 제101호(2007년 10월호) 특허가족 건강길라잡이(비만 시리즈4) 특허가족 건강길라잡이 (비만 시리즈 4) 변리사 김 일 성 킴스국제특허법률사무소 2. 비만과 영양소 4. 무기질(Minerals) 무기질은 단백질, 당질, 지질들과 달리 에너지를 낼 수 없고, 비타민류와 달리 조리과정에서 파괴되지 않는다. 그러나 물에 용해되므로 조리 중의 용액을 버리

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

분석결과 Special Edition 녹색건물의 가치산정 및 탄소배출 평가 이슈 서 민간분야의 적극적인 참여 방안의 마련이 필요하다. 또한 우리나라는 녹색건축의 경제성에 대한 검증에 대 한 연구가 미흡한 실정이다. 반면, 미국, 영국, 호주 등은 민간 주도로 녹색건축물

분석결과 Special Edition 녹색건물의 가치산정 및 탄소배출 평가 이슈 서 민간분야의 적극적인 참여 방안의 마련이 필요하다. 또한 우리나라는 녹색건축의 경제성에 대한 검증에 대 한 연구가 미흡한 실정이다. 반면, 미국, 영국, 호주 등은 민간 주도로 녹색건축물 기획특집Ⅱ 1 지속가능성 평가기반 에너지효율등급인증 건축물 가치산정에 관한 연구 지속가능성 평가기반 에너지효율등급인증 건축물 가치산정에 관한 연구 * 유 영 준 부연구위원 한국감정원 녹색건축센터 녹색건축연구단 신 성 은 연구원 한국감정원 녹색건축센터 녹색건축연구단 박 아 름 연구원 한국감정원 녹색건축센터 녹색건축연구단 윤 종 돈 부장 한국감정원 녹색건축센터

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: (LiD) - - * Way to

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI:   (LiD) - - * Way to Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.353-376 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.353 (LiD) -- * Way to Integrate Curriculum-Lesson-Evaluation using Learning-in-Depth

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

발간등록번호

발간등록번호 발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -

More information

<BBFDC8ADC7D02E687770>

<BBFDC8ADC7D02E687770> 대상본과 1 학년담당교수손정원 2014. 4. 1. 3/4 교시장소 1 의학관제 1 강의실 2. 수업주제 단백질 folding, targeting, 분해 1) 단백질 folding의기본동력에대해서이해한다. 2) chaperone의종류와작용기전에대하여설명한다. 3) proteasome의구조와 proteasome에의한단백질분해에대하여설명한다. 4) ER targeting

More information

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( : 27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,

More information

A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

........

........ Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering

More information

지난 2009년 11월 애플의 아이폰 출시로 대중화에 접어든 국내 스마트폰의 역사는 4년 만에 ‘1인 1스마트폰 시대’를 눈앞에 두면서 모바일 최강국의 꿈을 실현해 가고 있다

지난 2009년 11월 애플의 아이폰 출시로 대중화에 접어든 국내 스마트폰의 역사는 4년 만에 ‘1인 1스마트폰 시대’를 눈앞에 두면서 모바일 최강국의 꿈을 실현해 가고 있다 : * 30~40.,, 30~40 646.,..,.,.,,,.. * (2014) 30~40. :,, (120-728) 34 Tel : 02-300-0899, E-mail : hyhong@mju.ac.kr 2009 11 4 1 1, (2014) 2014 8 4,000. (, 2012).. (2013) 77.4%, 53.9%. 61.6%, 11.5%, 1% (,

More information

10 (10.1) (10.2),,

10 (10.1) (10.2),, Chapter 16 Precipitation Equilibria Copyright 2001 by Harcourt, Inc. All rights reserved. Requests for permission to make copies of any part of the work should be mailed to the following address: Permissions

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

도비라

도비라 광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

<31362DB1E8C7FDBFF82DC0FABFB9BBEA20B5B6B8B3BFB5C8ADC0C720B1B8C0FC20B8B6C4C9C6C32E687770>

<31362DB1E8C7FDBFF82DC0FABFB9BBEA20B5B6B8B3BFB5C8ADC0C720B1B8C0FC20B8B6C4C9C6C32E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 4 pp. 1525-1531, 2012 http://dx.doi.org/10.5762/kais.2012.13.4.1525 저예산 독립영화의 구전 마케팅을 위한 스마트폰 모바일 애플리케이션 모델 개발 연구 김혜원 1* 1 청운대학교

More information

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * , 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley

More information

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: / ,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information