최종보고서 은나노물질의유해성자료생산 2009 년 11 월 국립환경과학원 - 1 -

Transcription

1 최종보고서 은나노물질의유해성자료생산 2009 년 11 월 국립환경과학원 - 1 -

2 최종보고서 은나노물질의유해성자료생산 2009 년 11 월 연구기관 : 동덕여자대학교산학협력단 국립환경과학원

3 제출문 국립환경과학원장귀하 본보고서를 은나노물질의유해성자료생산 과제의최종보고서 로제출합니다 년 11 월 연구기관 : 동덕여자대학교산학협력단

4 참여연구진 총괄책임연구원박광식교수동덕여자대학교약학대학 연구원 박은정박사 동덕여자대학교약학대학 노부연연구보조원 동덕여자대학교약학대학 오지승연구보조원 동덕여자대학교약학대학 자문위원 김영훈교수 광운대학교 류덕영교수 서울대학교 박철범박사 한국화학시험연구원 배희경박사 TO21 서영록교수 경희대학교 - 4 -

5 I II III , ph, 9. in vitro in vitro 12. in vivo intratracheal instillation ( ) 18. (in vivo ) , 21.,, Toxicokinetic parameter

6 IV in vitro 44. in vivo intratracheal instillation Toxicokinetic parameter IV

7 < > OECD 8 (Steering Group, SG ). SG4 14. SG4 DDP (Dossier Development Plan) DDP (lead sponsor)...,. (,,, )

8 o. o 50 nm, 90 nm, 250 nm, Phosphate Buffered Saline (PBS) Fetal Bovine Serum (FBS) (DMEM) FBS 1%. o TWEEN 80 TWEEN Carboxy methyl cellulose (CMC) Dimethylsulfoxide (DMSO) TWEEN 80.. o Sphere type - Seed (seed mediated growth method) 20 nm. Seed 10 nm seed seed. - Sodium citrate nm

9 .. o rod type - 50 nm.,. Sodium citrate. o plate type - Murphy seed-mediated growth method, sodium citrate 3 4 nm seed 50nm nm. o Soduim citrate Polyvinylpyrrolidone -,. CTAB. CTAB. Soduim citrate(sc) Polyvinylpyrrolidone(PVP). 2.. in vitro o ( 70 nm) RAW264.7 ( : - 5 -

10 10% FBS DMEM),. o GSH NO TNF-a. MMP.. in vivo o 105 nm 5 (200, 400, 800mg/kg). IL-6, IL-12, IL-4 cytokine. o 22, 42, 71, 323nm 1 mg/kg 14,,. IgE.,,, o 50 nm 0.25, 0.5, 1 mg/kg 28.. AST ALT. pro-inflammatory cytokines (IL-1, TNF-α, IL-6), Th1-type (IL-12, IFN-γ), Th2-type (IL-4, IL-5, IL-10) TGF-β.,,,,,,

11 3. o PBS 243nm 0.5 mg/kg 1, 7, 14, 28 BAL. 1. o granuloma (Saa3), (MMP), (mesothelin) o (intratracheal instillation), in vivo in vitro. 4. (Toxicokinetics) o Citrate coated ABC nanoparticle 1 mg/kg ( ) 10mg/kg( ) 1, /. - 10, 1, 2, 4, 8, 24, o.,

12 o AUC (Bioavailability) citrated coating ABCNanotech 1.2%, 4.2%. o Cmax μg/ml 8 Cmax μg/ml 4. o Tmax o,..,. o %, 54%

13 o %, 10% ( ).. o ABC Nanotech g 378 μg, 1,663 μg. o o. ABC Nanotech citrate coating. coating (liphophilic) coating

14 I o OECD 8 (Steering Group, SG). SG4 14 DDP (Dossier Development Plan). o 14 Fullerenes (C60), Single-walled carbon nanotubes (SWCNTs), Multi-walled carbon nanotubes (MWCNTs), Silver nanoparticles, Iron nanoparticles, Carbon black, Titanium dioxide, Aluminium oxide, Cerium oxide, Zinc oxide, Silicon dioxide, Polystyrene, Dendrimers, Nanoclays o OECD DDP lead sponsor co-sponsor, DDP. DDP lead sponsor. o, in vivo, EH OECD in vitro. o In vitro OECD TG. in vitro OECD TG - 1 -

15 Fig.1-1. OECD Steering Groups for Nanomaterials - 2 -

16 Tab1-1. Sponsor countries for DDP of nanomaterials Nanomaterials Lead sponsor(s) Co-sponsor(s) Contributors Fullerenes(C60) Japan, US Denmark, China SWCNTs Japan, US Canada, France, Germany, EC, China, BIAC MWCNTs Japan, US Korea, BIAC Canada, Germany, France, EC, China, BIAC Silver nanoparticles Korea, US Canada, Germany, Nordic Country Australia, France, EC, China Iron nanoparticles China BIAC Canada, US, Nordic Council of Ministers Carbon black Denmark, Germany, US Titanium dioxide Germany Canada, Korea Spain, US, BIAC Denmark, China Aluminium oxide Germany, US Cerium oxide US, UK/BIAC The Netherlands Australia, Germany, EC Zinc oxide UK/BIAC US, BIAC Australia, Canada Silicon dioxide EC Korea, BIAC Denmark, France Polystyrene Korea Dendrimers Spain US Nanoclays Denmark, US - 3 -

17 3. o (,,, ), OECD SG4 (Steering Group 4) DDP (Dossier Development Plan) 4. OECD o - - o (Stability) - / / (,, ) - OECD DDP (,, ) - 4 -

18 in vitro in vivo o (,, ) - (descriptive toxicology) o OECD DDP. In vitro Fig.1-2. Physicochemical characteristics of nanoparticles and toxicity tests - 5 -

19 Fig.1-3. Morphology of nanoparticles and toxicity tests OECD DDP lead sponsor DDP DDP DDP 최종성과물은국제적인학술지에투고하여세계적전문가들의검증을 받아논문으로출판 OECD DDP 에서인용 우리나라국가위상제고 - 6 -

20 Tab.1-2. Fields of OECD DDP for nanoparticles Physical-Chemical Propertics Agglomeration/ aggregation Water solubility Environment Fate Dispersion stability in water Biotic degradability Environmental toxicity Effects on pelagic species Effects on sediment species Mammalian Toxicity Pharmacokinetics / toxicokinetics (ADME) Acute toxicity Crystalline phase Ready biodegradability Effects on soil species Dustiness Representative TEM picture Particle size distribution Specific surface area Simulation testing on ultimate degradation in surface water Soil simulation testing Sediment simulation testing Sewage treatment simulation testing Effects on terrestrial species Effects on microorganisms Other relevant information (when available) Repeated dose toxicity Chronic toxicity Reproductive toxicity Developmental toxicity Genetic toxicity Zeta potential (surface charge) Photocatalytic activity Pour density Porosity Octanol-water partition coefficient, where relevant Redox potential Identification of degradation product(s) Further testing of degradation product(s) as required Abiotic Degradability and Fate Hydrolysis, for surface modified nanomaterials Adsorption-desorption Adsorption to soil or sediment a) In vitro Genotoxicity b) In vitro Somatic Cell Genotoxicity c) In vitro Genetic toxicity d) In vivo Germ Cell Mutagenecity Experience with human exposure Other relevant test data Radical formation potential Other relevant information (where available) Bioaccumulation potential Other relevant information (when available) - 7 -

21 II. 1. o o o (alternative) 2.. o, ph, o In vitro. o,, o in vitro. (alternative) o. o (SCI), OECD Fig.2-1. Validation and review system for the toxicity data of nanoparticles - 8 -

22 ., ph, (1) o 99% (CatNo G). Tetrahydro furane (THF, CatNo T5267-1L). Dulbecco s modified eagle s medium (DMEM, GIBCO) Fetal Bovine Serum (FBS) GIBCO. o (THF) 3 24 THF. 2 THF THF. THF nanofilteration. 50 nm, 90 nm, 250 nm. o,, Dynamic lighter scattering (DLS,, ). (2 ) FBS. FBS. 96. TEM (80kV, JEM 1010, JEOL). (2) o in vitro in vivo,,,, (tap water) - 9 -

23 . o agglomeration aggregation micrometer. o,. o agglomeration/aggregation. - o. Tab Vehicles for toxicity test of nanoparticles 독성분야 용매 생태독성 정제수 인체독성 시험 경기관지 복강 정맥주사 경구투여 또는생리식염수생리식염수또는정제수 시험 세포배양배지 혈청농도. In vitro o aggregation.,. CMC (carbonyl metyl cellulose), Tween

24 . o,.. 2. 독성반응성비교연구개요 Fig. 3-1a. Flow of toxicity tests for silver nanoparticles

25 Fig. 3-1b. Flow of toxicity tests for silver nanoparticles in vitro in vitro RAW (1) 96 well plates ~ cells/ml 37, 5% CO , 48, 72, 96, 2 mg/ml MTT well 40 µl DMSO well 150 µl nm. (2) ROS, DCFH-DA PBS 1 1 M NaOH 96 well black plate 480 nm (Ex.) 530 nm(em.). ROS

26 DCFH-DA PBS. (3) GSH, caspase enzyme activity phthaldialdehyde (Sigma-Aldrich, Cat No. P0657). Caspase-3 activity R&D system capase-3 colorimetric assay kit. (4) DNA DAPI Genomic DNA purification kit DNA ethidium bromide (10 mg/ml) 0.02% 1.5% DNA Image VisualizerTM (Seoulin Bioscience Co. Seoul, Korea). DAPI PBS 4% paraformaldehyde 5 DAPI (4',6-diamidino-2-phenylindole). (5) PCR RNA RT-PCR RNA 1 µg oligo dt, reverse transcriptase nucleotide 20 µl RT-PCR premix tube ( ) (,, Cat No. K-2041) cdna 1 µl Taq polymerase nucleotide PCR premix tube(,,, Cat NO. K-2016) primer 95 1, 55 1, ~30 ethidium bromide (10 mg/ml) 1.5% TAE. (6) RNA. RNA

27 , RNA ABI DNA. /. (7) Cytokine Assay IL-1, IL-4, IL-5, IL-6, IL-10, IL-12 TNF-α, IFN-r cytokine ebioscience (CA, USA) ELISA kit., coating buffer capture Ab well 100 µl 4 overnight. 1 assay diluent well 200 µl 1, standard well 100 µl 2. 1 assay diluent detection Ab well 100 µl 1 1 assay diluent avidin-hrp well 100 µl 30. substrate solution well 100 µl 15, stop solution well 50 µl 450 nm. (8) NO cells/ml o C, 5% CO µl well. Griess reagent 100 µl 540 nm. NaNO2 NO

28 . in vivo Fig Outline of in vivo toxicity tests for silver nanoparticles (1) ICR ( ) (Gyunggi-do, Korea). (22 25 C), (5.5 %), 12 /.,, , 1... ( : ) (2) (Serum biochemical value) Retro orbital plexus EDTA

29 (TP), (A), (AST, aspartate aminotransferase; ALT, alanine aminotransferase), (ALP, alkaline phosphatase),, (BUN, blood urea nitrogen). (3). :,,,,, /,,,, (4) 10%.. - :,,,,,,,, ( ) - : (5),,,,,,,, ( mg ) 65 % 7 ml 30 % 1 ml µl 10 ml (250 ). ICP-MS. (6) ebioscience ELISA kit. IL-1β, TNF

30 α, IL-6, IL-2, IL-12, IL-4, IL-5, TGF-β.. Coating buffer capture Ab well 100 µl 4. 1 Assay diluent well 200 µl 1, well 100 µl 2. 1 Assay diluent detection Ab well 100 µl 1 1 Assay diluent Avidin-HRP well 100 µl 30. well 100 µl 15, well 50 µl 450 nm. (7) ebioscience(san diego, CA, USA) T cells (CD3, 1:50), B cells(cd19, 1:50) and NK cells(dx5, 1:100), CD4+ T cells(cd4+, 1:160), CD8+ T cells(cd8+, 1:50) Fc-block 4 C 20. Fluoroscence Activated Cell Sorter (FACS) buffer, FACS lysis buffer(bd Bioscience, Franklin Lakes, NJ, USA) 5 10 lysis FACS buffer. 1 % paraformaldehyde, FACSCalibur system (BD Biosciences, Franklin Lakes, NJ, USA). CellQuest software (Becton Dickinson, Franklin Lakes, NJ, USA). (8) IgE IgE ELISA Core kit.. Coating buffer (1:100) coating Ab well 100ul 4. Washing buffer

31 blocking solution well 200 µl 1 well 100 µl 1. Assay diluent detection Ab well 100 µl 1 washing buffer 3 5 well 100 µl M H 2 SO 4, 450 nm. 3. (alternative) 대체시험법개념 Fig.3-3 Overview of alternative toxicity test for nanoparticles. intratracheal instillation ( ).... (intratracheal instillation, )

32 /. in vivo toxicity endpoints. ICR ( ) (Kyunggi, Korea), (22 25 C), (5.5 %), 12 / PBS intratracheal instillation 0.5 mg/kg 1. PBS PBS 50 nm 200 nm. ( in vivo ). (in vivo ) In vivo,. in vivo (animal welfare). in vivo in vitro DNA chip..,,,. in vivo in vitro. RNA, RNA ABI DNA. /

33 4.. ABC nanotech. ABC Nanotech spec. citric acid coating.., ionic strength (PBS ). - coating material: citrate - average size: 8-12 nm - stock concentration : 20% (200,000ppm) - synthesis : aquous reduction - dispersion : monodispersed with citrate capping - form : amorphous type Fig TEM diameter distribution of ABC Silver nanoparticles

34 Fig TEM image of ABC silver nanoparticles., SD (250 g ) 4. ABC silver nanoparticles stock.. 1 mg/kg 10 mg/kg.. (PBS, Saline ).,, time 0 10, 60 (1 ), 120 (2 ), 240 (4 ), 480 (8 ),

35 (24, 1 ), 2880 (48, 2 ), 5760 (96, 4 ) ,,,. Tab. 3-2 Blood samples and tissue samples for toxicokinetics of silver nanoparticles 그룹 whole blood organ urin feces Total 대조군 8tubes 간, 신장, 폐, 각 1tube, 총 32tubes 8tubes 8 tubes 112 tubes 10 min 16 tubes N/A N/A N/A 16 tubes 1 h 16 tubes N/A N/A N/A 16 tubes 2 h 16 tubes N/A N/A N/A 16 tubes 4 h 16 tubes N/A N/A N/A 16 tubes 8 h 16 tubes N/A N/A N/A 16 tubes 24 h 16 tubes 간, 신장, 폐, 고환각 1tub e, 총 64tubes 16 tubes 16 tubes 224 tubes 48 h 16 tubes N/A N/A N/A 16 tubes 96 h 16 tubes 간, 신장, 폐, 고환각 1tub e, 총 64tubes N/A N/A 144 tubes. 10, 1, 2, 4, 8, 24, ml ( time 0, ). 0.5 ml (whole blood) ( )., ( )

36 ( mg, 0.5 ml ) 7 ml 70% 1ml H 2 O ICP-MS. 1 ml μg (μg/ml) 1 μg (μg/g). 1 ml μg 1 μg.. Toxicokinetic parameter BA Calc AUC (Area Under the Curve) Cmax, Tmax, T1/2. AUC (Bioavailability)

37 . (1) o. o PBS FBS. FBS FBS 1%. (Tab. 4-1, Fig. 4-1) o 90 nm FBS 10% (Fig. 4-1d). o DMEM PBS FBS (Fig. 4-2). DMEM FBS 10% DMEM PBS. (2) o FBS, FBS. FBS (Fig, 4-3)

38 o FBS, PBS DMEM -15 mv -10 mv ~ -15 mv. FBS FBS. (3) o 3 (50 nm, 90 nm, 250 nm), DMEM PBS ( ) (Fig. 4-4). o DMEM PBS DMEM PBS. FBS. (4) o (50 nm ) FBS., FBS DMEM FBS DMEM. PBS (Fig.4-5). o, FBS nm., FBS DMEM

39 (5) o DEME PBS.. FBS Fig.4-6. o FBS (Fig. 4-6a-b), (Fig. 4-6c-d). o FBS (10%) ( ) (Fig. 4-6e-h). (6) (Tween80, DMSO, CMC) o Tween80 CMC. (Fig.4-7a). o DMSO. -20 ~ +10 mv FBS (Fig.4-7b). o Tween 80.. CMC DMSO. o, Tween

40 Tab. 4-1 Experimental conditions for agglomeration test of silver nanoparticles (AgNPs) No AgNPs size, nm Ag + ion ratio, % Ag conc n, mg/l FBS conc n, % Medium Exposure time Stabilizer 1) Agglomeration rate < PBS, DMEM ) Surface charge (zeta potential) , 90 < PBS, DMEM <10 min ) Agglomerate size according to AgNPs size , 90, 250 < PBS, DMEM <10 min ) Agglomerate size monitoring of AgNPs mixed with FBS < PBS, DMEM 0 96 h ) Suspension stability with chemical stabilizer < PBS 24 h TWEEN DMSO 5-3 CMC

41 Hydrodynamic diameter, nm (a) Diameter Accum. Ave. Diameter (b) Diameter Accum. Ave. Diameter Hydrodynamic diameter, nm (c) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (d) Exposure Time, min Exposure Time, min Fig.4-1. Agglomeration of AgNPs with FBS in PBS 7.4 buffer; (a) 0%, (b) 1%, (c) 5%, and (d) 10% of FBS

42 (a) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (b) Hydrodynamic Diameter, nm (c) Diameter Accum. Ave. Diameter Diameter Accum. Ave. Diameter (d) Hydrodynamic Diameter, nm Time, min Time, min Fig.4-2. Agglomeration of AgNPs with FBS in DMEM medium (a) 0%, (b) 1%, (c) 5%, and (d) 10% of FBS

43 0-5 DMEM PBS Zeta Potential, mv Zero FBS% mv for DMEM mv for PBS FBS Concentration, % Fig.4-3. Zeta potential measurement of AgNPs in cases of mixing with FBS in DMEM and PBS medium

44 Agglomerate Size, nm (a) FBS 0.0% FBS 0.5% FBS 1.0% FBS 5.0% FBS 10.0% Ave. Diameter of AgNPs, nm Agglomerate Size, nm (b) FBS 0.0% FBS 0.5% FBS 1.0% FBS 5.0% FBS 10.0% Ave. Diameter of AgNPs, nm Fig.4-4. Hydrodynamic diameter change according to size of AgNPs; (a) PBS and (b) DMEM

45 Hydrodynamic Diameter, nm (a) day 2 day 3 day 4 day 5 day 10.0 FBS Concentration, % Hydrodynamic Diameter, nm (b) 1 day 2 day 3 day 4 day 5 day FBS Concentration, % Fig.4-5. Stability monitoring of AgNPs suspension in (a) PBS and (b) DMEM

46 200 nm 200 nm (a) (b) 200 nm 500 nm (c) (d) Fig.4-6. Agglomerate of AgNPs in the test media; (a-b) 0.25 %, (c-d) 1%, (e-f) 5%, and (g-h) 10% of FBS

47 200 nm 2 탆 (e) (f) 0.5 탆 0.5 탆 (g) (h) Fig.4-6 (continued). Agglomerate of AgNPs in the test media; (a-b) 0.25 %, (c-d) 1%, (e-f) 5%, and (g-h) 10% of FBS

48 Zeta Potential, mv (b) Tween80 DMSO CMC Concentration, mg/l Ratio of Diffusion Coefficient, D i /D (a) Concentration, mg/l Tween80 DMSO CMC Fig.4-7. Suspension stability of AgNPs using chemical stabilizers; (a) ratio of diffusion coefficient and (b) ξ-potential

49 Fig.4-8. TEM image of AgNPs with chemical stabilizers; (a) TWEEN 80, (b) DMSO, and (c) CMC

50 . (1) 20 nm o Seed. Seed 10nm, Seed. Seed 20 nm. o 0.25 mm AgNO mm Sodium Citrate 200 ml., 0.01M NaBH ml... 5,,. 20 nm UV 380 nm, TEM. Fig.4-9 Preparation of sphere type AgNPs (less than 20 nm)

51 (2) 50~100 nm o 50~100 nm.,. Sodium Citrate. o 0.5 mm AgNO ml., Sodium Citrate, nm. UV TEM. 420nm UV, TEM 50nm. Fig.4-10 Preparation of sphere AgNPs (size : 50~100 nm)

52 (3) Phosphate Buffered Saline o PBS,. PBS. o, PBS. 20 nm UV 380 nm 400 nm, 50~100 nm 400 nm 410 nm. UV. PBS UV. PBS. Fig.4-11 UV spectrometry of AgNPs in distilled water and Phosphate buffered saline (PBS) : (A) size: less than 20 nm (B) size: 50~100 nm

53 (4) o 50 nm.,. Sodium Citrate,. o.,.. Fig.4-12 Images of rod type AgNPs in sphere type nanoparticles

54 (5) Soduim Citrate Polyvinylpyrrolidone o,. CTAB. CTAB. Soduim Citrate(SC) Polyvinylpyrrolidone(PVP). o 0.01 M AgNO 3 SC PVP 20ml. 0.1 M Ascorbic acid 0.5 ml 0.06 ml Seed,. 1 M NaOH 0.1 ml. o UV Spectrometer. UV peak. 420 nm 690 nm peak. TEM. Fig.4-13 Preparation of AgNPs using sodium citrate and PVP

55 (5) 50nm 50~100nm o Murphy seed-mediated growth method, sodium citrate. 3~4 nm seed. o,.,. o. 3 peak, TEM. o Seed,. Seed ml. 0.5 ml 669 nm 50~100 nm, 1.5 ml 571 nm 50 nm. Fig.4-14 Preparation of AgNPs using various amount of Ag seed

56 (6) o Sodium citrate (SC). SC., SC. Fig.4-15 Preparation of AgNPs using various amount of sodium citrate o SC.,.. Fig.4-16 Stability variation graph of AgNPs

57 2.. In vitro o 90nm (AgNPs) in vitro (DMEM, 10%FBS). 70nm. 10%FBS DMEM 100nm. Fig.4-17 Size distribution of AgNPs in DMEM (10%FBS) for in vitro toxicity test. o SEM 100nm.. Fig.4-18 TEM image of AgNPs in the culture medium DMEM (10 % FBS)

58 o RAW , 0.4, 0.8, 1.6 ppm 24, 48, Fig.4-19 Decreased cell viability by AgNPs Cell viability was measured by the MTT assay and the viability of the treated group (0.2, 0.4, 0.8, and 1.6 ppm ) was expressed as a percentage of the control group. *; P<0.05, **; P<

59 o 0.4, 0.8, 1.6 ppm 24 RAW , 0.8 ppm G1 G1 arrest. 1.6ppm DNA Sub G1. Fig.4-20 Cell cycle changes of cultured RAW cells treated with AgNPs Cells were treated with AgNPs and were harvested at 24 h after treatment. The cell cycle was analyzed by measuring the DNA content with PI staining and RNase digestion in the FACSCalibur system

60 o glutathione. (, ROS). ROS. o RAW264.7 (0.2, 0.4, 0.8, 1.6 ppm, 24 ) Glutathione.. Fig Decreased level of intracellular GSH in cultured RAW cells by AgNPs Cells were treated for 24 hours with AgNPs. Intracellular glutathione was measured using o-phthaldialdehyde by substrate. Results were calculated as nmol of glutathione per mg of protein. *; P<0.05, **; P<

61 o. (0.2, 0.4, 0.8, 1.6 ppm, 24 ) NO. o NO. Fig Increased level of NO secretion by AgNPs NO (nitrogen oxide) production was quantified spectrophotometrically using the Griess reagent. *, P<0.05. Cells were treated with AgNPs with the indicated concentrations for 24 h

62 o NO (0.2, 0.4, 0.8, 1.6 ppm, 24 ) TNF-a. TNF-a. A) B) Con (ppm) TNF alpha Fig Induction of TNF-α protein level and gene expression by AgNPs A) Cells were treated with AgNPs with the indicated concentrations for 24h. TNF-α secretion waseremeasured by ELISA. *; P<0.05. B) Increase of TNF-α gene expression

63 o PCR. o matrix MMP (matrix metalloproteinase). TMIP (tissue inhibitor of matrix metalloproteinase). Fig Change of gene expression related with cell membrane damage RNA was extracted from the RAW264.7 cells treated with AgNPs (0, 0.2, 0.4, 0.8, 1.6 ppm) for 24 h and amplified by RT-PCR using the respective primers described in Table 1. Results were confirmed by several separate experiments and representative images were shown. Tab. 4-2 Primer sequences used in this study Primer name TNF-α MMP-3 MMP-11 MMP-19 Timp 1 Primer sequences R: TTGACCTCAGCGCTGAGTTG L: CCTGTAGCCCACGTCGTAGC R: GGCAGCATCGATCTTCTTCA L: GTTCTGGGCTATACGAGGGC R: GCTGTGGTGTGTTGTAGCCC L: CCCATGCCTTCTTCCCTAAG R: GAGTAACGTCCCCGGTTGAT L: GGCCAGAACTGACCTTAGCC R: CCTGATCCGTCCACAAACAG L: TATGCCCACAAGTCCCAGAA

64 o RAW ppm. 3 activation. activation spreading. o 24 RAW264.7 uptake. Fig Uptake of AgNPs from media into the cytoplasm of cultured RAW cells RAW264.7 cells were treated with AgNPs of 1.6 ppm for 3h and 24h, respectively. Changes of morphology were observed using phase-contrast microscope (200); representative photos are shown. (A) control group, (B) activated cells by phagocytosis of AgNPs after 3h (C) dead cells after 24h, (D) cells releasing of AgNPs into media after death

65 o uptake dark field. Fig Dark-field images of AgNPs treated to the cultured cells. RAW264.7 cells were treated for 24 h with AgNPs of 1.6 ppm. The presence of AgNPs in the culture medium were observed by dark-field optical microscope. Representative photos are shown. (A) control (100), (B) release of silver NPs from cells (400), (C) phagocytosis of AgNPsby RAW264.7 (100). White arrows represent phagocytosis of AgNPs

66 . In vivo (1) 5 ( - ) o ( 90nm).. o 105nm. Fig.4-27 Size distribution of AgNPs in the distilled water (vehicle for oral administration) for 5-day repeated dose toxicity test

67 o (200 mg/kg), (400 mg/kg) (800 mg/kg) 3 ( 5 ) 6 ICR 5 1 1,,,,,. o. o 5,. Tab. 4-3 Toxicological parameters observed in AgNPs-treated group after 5 day repeated treatment. parameters Dose 200 mg/kg 400 mg/kg 800 mg/kg dead animal No No No body weight N N N water, diet consumption N N N behavioral observation N N N macroscopic observation N N N histological observation (liver and kidney) N N N N: no difference was observed compared to the control group. o 5.,

68 o IL-6, IL-12, IL-4 TNF-a, TGF-b. IgE.. Fig Cytokine levels after oral administration of AgNPs for 5 days. Serum was obtained and pooled after treatment of AgNPs with dose of 200 mg/kg, 400 mg/kg, and 800 mg/kg, respectively

69 (2) 14 ( ) o 6 ICR ( 5 ) 14 (1 mg/kg),, /,,,,. 10. o.,. Tab. 4-4 Toxicological parameters observed in AgNPs-treated group after 14 day repeated treatment. parameters Average Size 22 nm 42 nm 71 nm 323 nm dead animal No No No No body weight N N N N weight ratio (organ/body) N N N N water, diet consumption N N N N behavioral observation N N N N macroscopic observation N N N N histological observation (liver and kidney) N N N N N: no difference was observed compared to the control group

70 o day 14 day 40 Body weight (g) control 22 nm 42 nm 71 nm 323 nm Size Fig The increase of body weight in AgNPs-treated group. o 14,,,, liver kidney testis brain lung Tissue weight/body weight control AgS1 AgS2 AgS4 AgS3 Fig The ration of organ weight to body weight in AgNPs-treated group

71 o. o, 14 ( ). o,.,,,,,... o. Toxicokinetic. ( citrate bare silver nanoparticles ) con 22 nm 42 nm 323 nm 간신장폐고환뇌 Fig Distribution of AgNPs after oral administration for 14 days. Small size particles (22, 42 nm) were absorbed and distributed in liver, kideny, lung, testis and brain but microsized particles (323 nm) were not measured in the tissues

72 o IL-6, IL-12 TNF-a, TGF-b 22, 42, 71 nm 323 nm. IgE. o.,. o. 323 nm control 22 nm 42 nm 71 nm 323 nm pg/ml 0 TNF-a IL-6 IL-12 TGFb IgE Fig Cytokine levels after oral administration of AgNPs for 14 days. Serum was obtained and pooled after treatment of AgNPs with different sizes (Average size : 22, 42, 71, 323 nm, 1 mg/kg for 14 days)

73 (3) 28 (,, 50 nm size) o 50nm (0.25 mg/kg) (0.5 mg/kg) (1 mg/kg) 28 (1 1, 7 ),, /,,,,. o. /,,,. Tab. 4-5 Toxicological parameters observed in AgNPs-treated group after 28 day repeated treatment. parameters Dose 0.25 mg/kg 0.5 mg/kg 1 mg/kg dead animal No No No body weight N N N water, diet consumption N N N behavioral observation N N N macroscopic observation N N N histological observation (liver and kidney) N N N N: no difference was observed compared to the control group

74 o. Tab. 4-6 Body weights of male and female mice after AgNPs-treatment for 28 days. Dosage Male (Ave±SD) Female (Ave±SD) Con ± g ± g 250 ug/kg ± g ± g 500 ug/kg ± g ± g 1000 ug/kg ± g ± g Tab. 4-7 Ratio of organ weights to body weight in male mice after AgNPs-treatment for 28 days. Male Heart Liver Lung Kidney Spleen Brain Thymus Testis Epididy mis Control ± ± ± ± ± ± ± ± ± μg/kg ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±0.001 ±0.000 ±0.001 ± μg/kg ±0.002 ±0.001 ±0.001 ±0.001 ±0.000 ±0.001 ±0.001 ±0.001 ± μg/kg ±0.001 ±0.002 ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±0.001 ±0.000 Tab. 4-8 Ratio of organ weights to body weight in female mice after AgNPs-treatment for 28 days. Female Heart Liver Lung Kidney Spleen Brain Thymus Uterus Control ± ± ± ± ± ± ± ± μg/kg ±0.000 ±0.003 ±0.001 ±0.001 ±0.001 ±0.001 ±0.000 ± μg/kg ±0.001 ±0.004 ±0.001 ±0.001 ±0.001 ±0.001 ±0.000 ± μg/kg ±0.001 ±0.002 ±0.001 ±0.002 ±0.001 ±0.001 ±0.000 ±

75 o 28. Alkaline phosphatase. AST (Aspartate transaminase), ALT (Alanine transaminase). Tab. 4-9 Serum biochemistry in male mice after oral administration of AgNPs for 28 days Groups TP (mg/dl) ALB (mg/dl) AST (IU/l) ALT (IU/l) ALP (IU/l) Creatinine (mg/dl) BUN (mg/dl) Control 6.07 ± ± ± ± ± ± ± μg/kg 5.73 ± ± ± ± ± ± ± ± 3.00 ± ± ± ± 0.33 ± ± μg/kg ± 2.97 ± ± ± ± 0.37 ± ± μg/kg * ** *; P<0.05, **; P<0.01. Tab Serum biochemistry in female mice after oral administration of AgNPs for 28 days Groups TP (mg/dl) ALB (mg/dl) AST (IU/l) ALT (IU/l) ALP (IU/l) Creatinine (mg/dl) BUN (mg/dl) Control 5.63 ± ± ± ± ± ± ± μg/kg 5.67 ± ± ± ± ± ± ± μg/kg 5.73 ± ± ± ± ± ± ± μg/kg 6.00 ± ± ± 57.18** ± 13.05** ± 51.51** 0.37 ± ± 1.40 **; P<

76 o pro-inflammatory cytokines (IL-1, TNF-a, IL-6), Th1-type (IL-12, IFN-r), Th2-type (IL-4, IL-5, IL-10) TGF-b. o. o IgE. Fig Changes of cytokine and IgE levels in the blood after oral administration for 28 days Serum harvested from male (n=7) and female (n=7) was pooled for analysis. The concentrations of cytokines (concentration unit ; pg/ml) and IgE (concentration unit ; ng/ml) in blood harvested at day 28 after repeated oral administration were determined using ELISA kits. *; P<0.05, **; P<

77 o B cell. NK, NKT, B cell T cell 3.97%, 1.30%, 58.29%, 36.45%. (1000 ug/kg) 4.05%, 1.28%, 62.13%, 32.54%., B cell 58% 62% Fig.4-33 IgE. o T cell subtype helper cell CD4+ cytotoxic effect CD8+ CD4+/CD CD4+ CD8+. Control group Treated grooup Fig Analysis of lymphocyte phenotypes in blood after oral administration for 28 days Blood harvested from male (n = 7) and female (n = 7) mice was pooled for analysis. All monoclonal antibodies were identified using directly conjugated anti-mouse antibodies, and flow cytometry analysis was performed on the FACSCalibur system. Control samples were matched for each fluorochrome

78 o.,,,,,,,. o,,... Tab Tissue distribution of AgNPs after oral treatment for 28 days (dose: 1mg/kg) (Unit : μg/kg) Control 250 μg/kg 500 μg/kg 1 mg/kg Kidney ND ND ND Lung ND Heart ND ND ND ND Brain ND ND Spleen ND ND ND ND Liver ND ND ND ND Thymus ND ND ND Uterus ND ND ND Testis ND ND Epididymis ND ND ND ND

79 o,,... Fig Histopathology of kidney tissues after oral administration for 28 days Tissue sections were stained with hematoxylin and eosin stains (x200). (A): control group, (B): treated group (1 mg/kg group). Arrow indicate infiltrated mononuclear cells

80 3.. (intratracheal instillation) /. In vivo,. in vivo (animal welfare). in vivo in vitro DNA chip... intratracheal instillation ( ) o PBS. PBS. o 50nm PBS 200nm.. PBS 200 nm. FBS. FBS FBS ( ) FBS. o PBS ICR (6 ) 0.5 mg/kg

81 1, 7, BAL (Bronchoalveolar lavage) fluid. o BAL fluid pro-inflammatory cytokines (IL-1 TNF-a), Th1-type cytokines (IL-12, IFN-r), Th2-type cytokines (IL-4, IL-5, IL-10) IL-6, IL-2, TGF-b. Fig Cytokine levels in BAL fluid after a single intratracheal instillation of AgNPs (0.5 mg/kg) Sample was harvested and pooled at the designated day after instillation. Cytokine concentrations were determined using ELISA kits. *; P<0.05, **; P<

82 o PBS ICR (6 ) 0.5 mg/kg 1, 7, retroorbital plexus. pooling. o pro-inflammatory cytokines (IL-1 TNF-a), Th1-type cytokines (IL-12, IFN-r), Th2-type cytokines (IL-4, IL-5, IL-10) IL-6, IL-2, TGF-b BAL fluid. Fig Cytokine levels in serum after a single intratracheal instillation of AgNPs (0.5 mg/kg) Sample was harvested and pooled at the designated day after instillation. Cytokine concentrations were determined using ELISA kits. **; P<

83 o PBS ICR (6 ) 0.5 mg/kg 1, 7, BAL (Bronchoalveolar lavage) fluid IgE. o BAL fluid IgE. IgE BAL fluid. Fig IgE levels in BAL fluid and in blood after a single intratracheal instillation of AgNPs (0.5 mg/kg) BAL fluid and serum was harvested and pooled on the respective sacrifice days after instillation, and IgE concentration in each samples were determined using commercially available kits. *; P<0.05, **; P<

84 o PBS ICR (6 ) 0.5 mg/kg 1 NK, NKT, B, T cell. 28 T cell subtype CD4+ CD8+. o NK, NKT, B, T cell 4.03%, 0.90%, 63.91%, 31.16% 1.44%, 0.54%, 74.74%, 23.27%., B 63.91% 74.74% T. o CD4+/CD CD8+. Fig Analysis of lymphocyte phenotypes in blood after a single instillation of AgNPs All monoclonal antibodies were identified using directly conjugated anti-mouse antibodies, and flow cytometry analysis was performed on the FACSCalibur system. Control samples were matched for each fluorochrome

85 o PBS ICR (6 ) 0.5 mg/kg 1, o 1. peri-termianl bronchioles. 1. Tab Histopathology of lung tissues after instillation of AgNPs Infiltration of alveolar Control Day 1 Day 14 Day 28 macrophages, peri-terminal bronchioles -: Not remarkable Grade + : mild Fig Histopathology of lung tissues after instillation of AgNPs Lung sections obatained at day 1 were stained with hematoxylin and eosin stains ( 200). AgNPs were instilled at doses of 500 μg/kg at day 0. (A); control, (B); treated group

86 . o. in vivo in vitro in vivo in vitro. DNA chip. o 500 ug/kg 1 microarray granuloma Saa3, Loricrin Timp, Slpi., MWCNT mesothelioma mesothelin

87 Tab Up-regulated genes in lung by a single intratracheal instillation of AgNPs SYMBOL ACCESSION Average Ag 1st Ag 2nd Saa3 NM_ Krt13 NM_ Lor NM_ Krtdap NM_ Lcn2 NM_ Serpinb12 NM_ Cnfn NM_ Asprv1 NM_ Lypd3 NM_ Krt14 NM_ Lce3b NM_ F04Rik NM_ Lce3b NM_ Lce1c NM_ LOC XM_ Lce3c NM_ Crct1 NM_ Orm1 NM_ Ada NM_ Lce1d NM_ Rptn NM_ Lce1b NM_ Serpinb3a NM_ Them5 NM_ Sprr3 NM_ Lce1a2 NM_ I15Rik NM_ Krt4 NM_ Defb4 NM_ Slpi NM_ Retnla NM_

88 Tab 4-13 (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd Orm2 NM_ Serpinb3c NM_ Cdsn NM_ Psapl1 NM_ Lgals7 NM_ Dmkn NM_ Igtp NM_ Gm94 NM_ OTTMUSG NM_ Dmkn NM_ Timp1 NM_ Ly6g6c NM_ Lce1f NM_ Ctsk NM_ J15Rik NM_ Arg1 NM_ Rptn NM_ Timp1 NM_ Lce1a1 NM_ Prcp NM_ Iigp2 NM_ Calm4 NM_ Lrg1 NM_ Lce3a NM_ Gbp2 NM_ Hist1h2ad NM_ Tapbp NM_ Cd274 NM_ Ly6d NM_ Ccl7 NM_

89 Tab (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd Krt78 NM_ Fetub NM_ EG NM_ Hist1h2ak NM_ Ltf NM_ Hsd17b11 NM_ Cxcl1 NM_ Hist1h2ah NM_ Smarce1 NM_ Mt4 NM_ Mfsd2 NM_ Pkp1 NM_ Chi3l1 NM_ BC NM_ Itih4 NM_ Ly6d NM_ Plunc NM_ Gipc1 NM_ S100a9 NM_ Defb14 NM_ Cxcl17 NM_ Hpx NM_ Msln NM_ Krt15 NM_ Serpina3n NM_ Bglap1 NM_ Clec4n NM_ Cd177 NM_ Ada NM_ Tnnc2 NM_

90 Tab Down-regulated genes in lung by a single instratracheal instillation of AgNPs SYMBOL ACCESSION Average Ag 1st Ag 2nd H2-Ea NM_ Chka NM_ BC NM_ Heg1 NM_ Hbb-b1 NM_ Angptl7 NM_ Rhbdl2 NM_ Tnnc1 NM_ Ang4 NM_ Zxda NR_ Prf1 NM_ H2-Eb1 NM_ Rpl23 NM_ Edn1 NM_ Cops8 NM_ Rgs9 NM_ Dpysl2 NM_ Slc38a2 NM_ Mybphl NM_ Fgfr1op2 NM_ Myh6 NM_ Slc4a1 NM_ Myl4 NM_ EG NR_ Dctn4 NM_ BC NM_ E330018D03Rik NM_ Myl7 NM_ Ppnr NM_ Spnb2 NM_

91 Tab (Continued) SYMBOL ACCESSION Average Ag 1st Ag 2nd BC NM_ Alas2 NM_ Erdr1 NM_ Ifngr2 NM_ Ankmy2 NM_ Fabp3 NM_ Vtn NM_ Faim3 NM_ Acaa1b NM_ BC NM_ Mapt NM_

92 4.. Toxicokinetic parameter o ABCNanotech (citrated coated silver nanoparticles, ) SD (8, 250 g, 4 ) ( : 1 mg/kg, : 10 mg/kg) ( :1 mg/kg, : 10 mg/kg). 5 ml/kg. o ( ) ( 4, : 10, 1, 2, 4, 8, 24, ). 5 ml 0.5 ml. ( ) o Tab o Tab citrate. o

93 8. o (Entero-hepatic circulation). -. Tab Blood concentration of AgNPs after oral/vein administration at the indicated times (µg/ml) group 0 h 10 min 1h 2h 4h 8h 24h 48h 96h P.O 1 mg/kg ± ± ± ± P.O. 10 mg/kg ± ± ± ± ± ± ± ±0.032 I.V. 1 mg/kg ± ± ± ± ± ± ± ±0.042 I.V. 10 mg/kg ± ± ± ± ± ± ± ±1.176 o AUC (last), AUC (inf), Cmax, Tmax. AUC (Bioavailability) (Tab.4-16). o Tab.4-14 AUC (last), AUC (inf) AUC (last) AUC (inf)

94 o, AUC (last), AUC (inf) AUC (last) 27,569.7 AUC (inf) default AUC (last) o AUC 1.2%. 4.2%. - Bioavailability ( ) = oral AUC (last) /i.v. AUC (last) o Cmax ug/ml 8 Cmax ug/ml 4. o Tmax. 30. o 10, 2880 (48 ) o

95 1 mg/kg (p.o.) ug/ml time (hour) Fig Changes in blood AgNPs level with time following a single oral administration (1 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h)

96 10 mg/lg (p.o.) ug/ml time (hour) Fig Changes in blood AgNPs level with time following a single oral administration (10 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h)

97 1 mg/kg (i.v.) ug/ml time (hour) Fig Changes in blood AgNPs level with time following a single intraveous administration (1 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h)

98 10 mg/kg (i.v.) 8 6 ug/ml time (hour) Fig Changes in blood AgNPs level with time following a single intraveous administration (10 mg/kg) AgNPs were meaured as total silver concentration by ICP-MS. Treated animals were sacrificed at the designated time (10 min, 1h, 2h, 4h, 8h, 24h, 48h, 96h, n=4). Animals of control group were sacrificed after vehicle treatment (designated as time 0 h)

99 Tab Toxicokinetic parameters of AgNPs in rats p.o i.v Cmax Tmax Groups AUC (last) AUC (inf) (ug/ml) (min) T 1/2 (min) 1 mg/kg mg/kg mg/kg mg/kg o 1 mg/kg, 10 mg/kg 24 96, ( ). o Tab. 4-17,..,. o %, 54% %, 10% ( )

100 - ( ). Tab Tissue distribution of AgNPs in lung, kidney, and liver (μg/g). Lung Kidney Liver p.o. 1 mg/kg p.o. 10 mg/kg i.v. 1 mg/kg i.v. 10 mg/kg 0h 24h 96h 0h 24h 96h 0h 24h 96h 1.9± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± (1) o (Tab.4-18) g 378 μg, 1,663 μg. o

101 (2) o (Tab. 4-18) o. -. Tab Excretion of AgNPs through urine and feces p.o. 1 mg/kg p.o. 10 mg/kg i.v. 1 mg/kg i.v. 10 mg/kg treated group (24h) control group Urine (µg/ml) Feces (µg/g) ± ± ± ± ± ± ± ±

102 V. 1.. o. o 50 nm, 90 nm, 250 nm, Phosphate Buffered Saline (PBS) Fetal Bovine Serum (FBS) (DMEM) FBS 1%. o Tween 80 Tween Carboxy methyl cellulose (CMC) Dimethylsulfoxide (DMSO) Tween 80.. o Sphere type - Seed (seed mediated growth method) 20 nm. Seed 10 nm seed seed

103 - Sodium citrate nm... o rod type - 50 nm.,. Sodium citrate. o plate type - Murphy seed-mediated growth method, sodium citrate 3 4 nm seed 50nm nm. o Soduim Citrate Polyvinylpyrrolidone -,. CTAB. CTAB. Soduim citrate(sc) Polyvinylpyrrolidone(PVP)

104 2.. in vitro o ( 70 nm) RAW264.7 ( : 10% FBS DMEM). o GSH NO TNF-a. MMP.. in vivo o 105 nm 5 (200, 400, 800mg/kg). IL-6, IL-12, IL-4 cytokine. o 22, 42, 71, 323nm 1 mg/kg 14,,. IgE.,,, o 50 nm 0.25, 0.5, 1 mg/kg 28.. AST ALT. pro-inflammatory cytokines (IL-1, TNF-α, IL-6), Th1-type (IL-12, IFN-γ),

105 Th2-type (IL-4, IL-5, IL-10) TGF-β.,,,,,,. 3. o PBS 243nm 0.5 mg/kg 1, 7, 14, 28 BAL. 1. o granuloma (Saa3), (MMP), (mesothelin) o (intratracheal instillation), in vivo in vitro. 4. (Toxicokinetics) o Citrate coated ABC nanoparticle 1 mg/kg ( ) 10mg/kg ( ) 1, /. - 10, 1, 2, 4, 8, 24,

106 . o., o AUC citrated coating ABCNanotech 1.2%, 4.2%. o Cmax μg/ml 8 Cmax μg/ml 4. o T max o,..,. o

107 %, 54%. o %, 10% ( ).. o g 378 μg, 1663 μg. o o