05 (09-29-수정).hwp

Size: px
Start display at page:

Download "05 (09-29-수정).hwp"

Transcription

1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 4(1), ~9(214) 퇴행성골관절염에대한 의효과 나지영 1 송기쁨 1 김석호 1 권영배 2 김대기 이준경 4 조형권 4 권중기 1 1 전북대학교수의과대학실험동물의학교실, 2 전북대학교의학전문대학원약리학교실 전북대학교의학전문대학원면역학교실, 4 한풍제약 Effects of on Degenerative Osteoarthritis Ji-Young Na 1, Ki-Bbeum Song 1, Sukho Kim 1, Young-Bae Kwon 2, Dae-Gi Kim, Jun-Kyoung Lee 4, Hyoung-Kwon Jo 4, and Jungkee Kwon 1 1 Dept. of Laboratory Animal Medicine, College of Veterinary Medicine, 2 Dept. of Pharmacology, Institute for Medical Science, and Dept. of Immunology, Institute for Medical Science, Chonbuk National University, Jeonbuk , Korea 4 Central Research and Developement, Hanpoong Pharm & Foods, Jeonbuk , Korea ABSTRACT HanPoong Leading (HPL)-4 were prepared with different oriental medicines (balk of Kalopanax pictus balk, Chaenomelis Fructus, Angelica gigas root, Zingiber officinale, Raphanus sativus Linne and Saururus chinensis Baill.) to investigate the protective effects of on cartilage degradation in knee osteoarthritis (OA). Rat articular chondrocytes incubated with rhil-1α markedly increased matrix metalloproteinase (MMP)-2 and 9 activities, decreased cell viability and reduced chondrogenic gene expression. -(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, MMP-2 and 9 activities and real time RT-PCR indicated that counteracted these harmful effects in dose-dependent manner. In addition, for experimental OA in vivo, monosodium iodoacetate (,.5 mg/5 μl) was injected into knee joints of rats and administered to rats for 4 consecutive weeks after treatment. The experimental data showed that treatment with significantly prevented of MMP-2 and 9 activities in articular cartilage. Histopathological and micro-ct evaluations of the knee joints also revealed that effectively ameliorated -induced degenerative OA. In conclusion, has potential applicability for the prevention and treatment of degenerative OA. Key words:, osteoarthritis, monosodium iodoacetate, chondrocytes, matrix metalloproteinase 서 최근들어한의학에서도 EBM( 근거중심의학 : evidence based medicine) 에입각한연구및교육그리고의사의수행평가필요성이제기되고있다. 근거중심의학 (EBM) 은권위가아닌근거에입각하여치료하고, 그치료를 DB화하여체계적으로관리하면서의사의수행평가와대학교육에도반영하는것을말한다 (1-). 한의학의과학화및표준화 와 한의약의 EBM 도입 은교육및임상수행평가뿐만아니라연구개발방법론에서도새로운방향을제시하고있으며이러한노력과시도를통해천연물신약개발에새로운가능성을제시하고자한다. (HanPoong Leading- 4) 처방은이러한 EBM에입각하여철저한고문헌사료조사와기초실험문헌, 임상자료및임상활용현황등의자료들을수집하고조사, 분석하여선정된골관절염의개선및 Received 2 September 21; Accepted 1 November 21 Corresponding author. Phone: 론 치료또는관절건강에도움을주는천연물유래기능성복합처방이다. 골관절염은퇴행성관절염 (degenerative arthritis) 으로도불리는흔한관절질환이지만통상적으로노화에따른퇴행현상으로보는시각이있기때문에치료나질병관리에서간과되어온면이있다 (4). 하지만골관절염은고령화사회와비만인구의증가로인해유병률이지속적으로증가하고있으며국민건강영양조사를기초로한보고에따르면 28년기준한국성인중 1.7% 가골관절염을앓고있으며연령에따라비율이증가하여 8대에서는 4.5% 에이르는것으로추정된다 (5). 주로연골하부와골소주및관절연골의병리적대사로발생하며경증의활막염증, 관절연골의국소적인퇴행성변화, 연골하골의비대, 주변골연골부의과잉골형성, 관절의변형등과함께통증이동반되는질환이다 (6,7). 골관절염의원인과병태생리는다양하며현재까지도정확하게알려져있지않지만성인특히중장년층에게흔하게나타나는대표적인노인성질환으로써연령과비만도가증가할수록증가되며, 발병과악화에있어특정관절의과도한

2 퇴행성골관절염에대한 의효과 1 사용과반복적인자세및외상등생활요인과도관련성이높다고알려져있다 (8,9). 골관절염의치료는비약물적치료, 약물치료, 수술적치료세가지가있으며약물치료로써흔히쓰이는아세트아미노펜및비스테로이성항염제 (NSAID; non-steroidal anti-inflammatory drug) 는소화기계및혈액응고기전의부작용으로장기복용시속쓰림, 위출혈등을유발할수있으며, 질병완화골관절염치료제 (disease modifying osteoarthritis drugs) 의경우질환의초기에사용되어관절의파괴를예방하는데일부유효성에대한논란이있으며골수억제, 간기능손상과더불어발암의가능성이있다 (1). 이처럼현재까지골관절염의적절한치료법은미흡한수준이며, 특히기존약물들에대한부작용으로인하여한약재및생약등의천연물신약치료제를개발하려는노력이최근활발하게진행되고있다 (11-1). 한의학적관점에서관절염은크게는비증 ( 痺證 ), 작게는관절풍 ( 關節風 ) 에해당하는질병으로볼수있다 (14). 비증 ( 痺證 ) 이나관절풍 ( 關節風 ) 은인체의정기가허한상태에서기육 ( 肌肉 ) 과경락 ( 經絡 ) 에풍한습 ( 風寒濕 ) 의사기 ( 邪氣 ) 가침습하여발생하는질환이며, 실증인경우와허증인경우에따라증상에차이를나타내지만동통, 종창, 발적, 발열및운동장애등의관절염과비슷한양상을나타낸다. 처방은한의학적으로는거풍습 ( 祛風濕 ) 효능으로허리및무릎등의관절통을치료하는해동피와뭉친근육을이완시키고붓기를가라앉히는모과, 보혈 ( 補血 ) 및온경지통 ( 溫經止痛 ) 의효능으로혈액순환을돕고통증을멎게하는당귀, 해독소종 ( 解毒消腫 ) 의효능으로염증을억제하는삼백초 ( 三白草 ) 등 (15) 6가지약재로구성되어진골관절염개선및치료또는관절건강에도움을주는천연물유래기능성복합처방이며, 본실험에서는골관절염동물모델을이용하여 의유효성및과학적근거를확립하기위하여다음과같이실시하였다. 재료및방법 제조본실험에사용한 처방의구성약물은옴니허브및원광허브 (Iksan, Korea) 에서구입하여정선한후사용하였다. 각각원료들의원료시험성적서를통해기원을확인하였으며잔류농약, 잔류이산화황, 중금속시험등의유해물질검사에서모두적격품임을확인한후 제조에사용하였다. 각각의 6가지생약을해동피, 모과, 당귀, 내복자, 삼백초, 생강각각의생약원료에 1배수의정제수를넣고 95~1 C, 시간환류추출 2회실시후추출액을 25 μm 필터로여과한후여과액을 6 C 이하에서감압농축 건조하여각각의건조엑기스를얻었고, 각각의해동피 : 모과 : 당귀 : 생강 : 내복자 : 삼백초를 Table 1과같은비율로혼합하여건조엑기스를제조하였다. Table 1. The composition of Herbal medicine name Kalopanax pictus bark Chaenomelis Fructus Angelica gigas root Saururus chinensis Raphanus sativus Zingiber officinale Ratio 슬관절에서연골세포의분리연골채취를위한실험동물은 ~4주령무게약 18~2 g 정도의 male Sprague-Dawley rat(damul science, Dae jeon, Korea) 을경추탈구하여 7% 알코올로피부를소독하여절개한후관절연골을 2~ mm 정도크기로채취하였고채취한연골조직은 phosphate buffer saline(pbs) 용액에서보관하여 clean bench로옮겼다. 2 mg/ml collagenase type Ⅱ(Sigma-Aldrich Co., St. Louis, MO, USA) 를첨가하여 shaker에 1,2 rpm으로 시간동안처리하였다. 이렇게해서얻어진세포부유액을 7 μm pore size cell strainer(bd Falcon, Flanklin Lakes, NJ, USA) 에여과한후 1,6 rpm으로 1분간원심분리하여원심분리된세포를 PBS로 회세척한후연골세포를분리하였다. 분리된연골세포는 1% FBS와 DMEM에 1% penicillinstreptomycin을첨가하여 75T flask에넣고 7 C, 5% CO 2 의조건하에서배양하였다. 이때 2~일에한번씩배지를갈아주고약 4~5일에계대하여사용하였다. 약물독성및세포생존율측정세포독성및세포생존율을측정하기위해 MTT assay 를실시하였다 cells/well의세포를 96 well plate에넣어준뒤 24시간안정화시켜준다. 안정화된세포는농도별로 (1~2 µg/ml) 를 24시간동안단독처리한군과 (1~2 µg/ml) 를 1시간전처리한뒤 rhil-1 α(5 ng/ml) 를넣고 24시간동안배양한다. 24시간뒤에 2 µl MTT solution을처리하여최대 시간 7 C incubator 에서배양한후배지와 MTT 시약을제거하고 DMSO 시약 2 μl를가하여 microplate reader(biotek, Winooski, VT, USA) 를이용하여 56 nm에서흡광도를측정하였다. 연골흡수지표 (matrix metalloproteinase(mmp)-2, 9) 활성측정 MMP-2, 9의발현확인을위해실험동물에서분리한연골세포를 96 well plate에 cells/well의농도로 1% FBS를첨가한 DMEM 배양액에분주하여 12시간동안안정화시킨후 HPL-, 를농도별로처리하고 rhil-1 α(5 ng/ml) 를처리하여 24시간배양한후에상층액을이용해 MMP-2, 9를측정하였다 MMP-2, 9 측정을위해 MMP ELISA kit(mybiosource, San Diego, CA, USA) 를이용하 2 2 2

3 2 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 Table 2. Primer sequences for real-time reverse transcription polymerase chain reaction Gene name Sequences Collagen type Ⅱ SOX9 Aggrecan β-actin Forward: GAGTGGAAGAGCGGAGACTACTG Reverse: CTCCATGTTGCAGAAGACTTTCA Forward: AGAGCGTTGCTCGGAACTGT Reverse: TCCTGGACCGAAACTGGTAAA Forward: GATGTCCCCTGCAATTACCA Reverse: TCTGTGCAAGTGATTCGAGG Forward: ATCGTGGGCCGCCCTAGGCA Reverse: TGGCCTTAGGGTTCAGAGGGG 였고 general ELISA protocol을따라서실험한뒤 56 nm 에서흡광도를측정하였다. 연골형성지표 (collagen type II, SOX9, aggrecan) 활성측정실험동물에서분리한연골세포를 6 well plate에 cells/well의농도로 1% FBS를첨가한 DMEM 배양액에분주하여 24시간동안안정화시킨후 를농도별로 1시간전처리해준뒤 rhil-1α(5 ng/ml) 를연골세포에 24 시간동안처리한후세포를수집하여 Ribo EX(GeneAll, Daejeon, Korea) 로제조사의 manual에따라 total RNA를추출하고 cdna의합성을위해 iscript Select cdna synthesis kit(maxime RT PreMix; Intron, Seongnam, Korea) 를이용하였다. 각 primer의염기서열은 (Table 2) primer express software(applied Biosystems, Carlsbad, CA, USA) 를이용해디자인되었다. Real-time PCR 실험시사용한기계는 Step One Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) 이며 SYBR Green Supermix(BIO-RAD, Hazelwood, MO, USA) 로제품의 protocol에따라반응하였다. PCR은 48 well plate에서 ABI Step One Plus Sequence Detection System (Applied Biosystems) 을사용하였다. 동물실험에사용된 rat는 SD-rat 8주령 (25~28 g) 이고모두수컷을사용하였다. 좌측슬관절에연골연화성관절염을유도하였으며우측슬관절은비교군으로사용하였다. 모든대상실험쥐는사료와음수를사육기간에마음대로섭취하도록하였으며사육장내에서제한없이운동하도록하였다. 퇴행성골관절염모델은 monosodium iodoacetate().5 μg/5 μl를슬관절관절낭에직접투여하여유발시켰다. 약물투여및관절염유발실험동물은군당 5마리씩 4그룹으로구분하였고모든투여군에서는 를멸균증류수에용해시켜존데가부착된 1 ml 주사기를이용하여경구투여하였다. 실험동물실에 (A) (B) Fig. 1. A schematic diagram of degenerative osteoarthritis induced by intra-articular injection of monosodium iodoacetate (). 서적응된 rat은조레틸 (zoletil) 로전신마취후수술대에고정시키고 를왼쪽슬관절의슬개골인대를통해관절낭내주사 (intraarticular injection) 를실시하였다. 는 sterile saline에마리당.5 mg/5 μl의농도로 26 gauge 를이용하여주사하였다. 정상군은동일한위치에 sterile saline 5 μl씩주사하였다 (Fig. 1). 연골흡수지표 (MMP-2, 9) 활성측정연골염증성인자중 MMP-2, 9의발현확인을위해 rat 에서분리한연골을 phosphate buffer saline로세척한후분쇄기로잘게분쇄해준다. 분쇄된연골은 RIPA buffer를처리해준뒤에 15, rpm에서원심분리후상층액을이용해 MMP-2, 9를측정하였다. MMP-2, 9 측정을위해 MMP ELISA kit(mybiosource) 를이용하여 general ELISA protocol을따라서실험한뒤 56 nm에서흡광도를측정하였다. 슬관절 micro CT를이용한평가모든실험쥐들은 주입및 의경구투여 4주후에조레틸 (zoletil) 로마취시킨뒤양쪽슬관절에대해각각관절면을중심으로 micro-ct(skyscan, Aartselaar, Belgium) 촬영을시행하였다. 조직학적관찰및평가관절염유발 4주째치료종료후모든 rat을부검하여슬관절을군별로채취하였다. 채취한슬관절은 1% 포르말린으로 24시간고정하였고그후파라핀포매전 1% formic acid로 72시간동안탈회하였다. 탈회후파라핀블록을제작하였고 5 µm로박절하여슬라이드에부착시켰다. 슬관절절편은관절조직및주변조직의염증성침윤 (inflammation) 정도를평가하기위해슬라이드에부착시켜 hematoxylin&eosin(h&e) 염색을실시하였고연골의퇴행성정도를측정하기위하여 safranin-o fast green(sofg) 염색을실시하였다. 또한퇴행성골관절염부위의보호정도를평가하기위하여조직병리학적평가를 개의등급에의해

4 퇴행성골관절염에대한 의효과 표현하였다. 등급은 Medplan Pathology Laboratories (Seoul, Korea) 에의해실시하였다 (16). 통계학적분석모든실험결과는평균 ± 표준오차로표시하였다. 그리고각실험군간의차이를검정하기위하여 Student's t-test를실시하였다. 실험의분석시유의수준은 P<.5로설정하여검정하였다. 결과세포독성및생존율평가 Primary culture된연골세포에대한 의세포독성및생존율을평가하기위해 MTT assay를수행하였다. rhil-1α를단독처리한군에서는생존율이유의성있게증가하였고, (1 µg/ml) 를 1시간전처리후 rhil-1 α(5 ng/ml) 를 24시간처리한군에서는생존율이유의성있게감소하는것이보였다 (Fig. 2A, B). 본실험의결과 HPL- 4가 rhil-1α에의해감소되는세포생존율을증가시키는것으로사료된다. In vitro에서염증성인자인 MMP-2, 9의활성도평가 rhil-1α는연골염증성인자인 MMP-2, 9를유발시킨 다. rhil-1α를단독처리한군에서는 MMP-2, 9이증가하였고, (1 µg/ml) 를 1시간전처리후 rhil-1α(5 ng/ml) 를 24시간처리한군에서는 MMP-2, 9가감소하는것이보인다 (Fig. 2C, D). 본실험의결과 가 rhil- 1α에의해유발된염증성인자인 MMP-2, 9의활성도를감소시키는것으로사료된다. 에대한연골형성지표 (collagen typeⅡ, SOX9, aggrecan) 활성화평가 rhil-1α(5 ng/ml) 를단독처리한군에서는연골유전인자인 collagen type Ⅱ, SOX 9 및 aggrecan의활성도가감소하는반면에 (1~2 μg/ml) 를 1시간전처리하고, rhil-1α(5 ng/ml) 를 24시간처리한군에서는연골유전인자 collagen type Ⅱ, SOX 9 및 aggrecan의활성도가증가하는것으로보인다. 이두군을비교하였을때 rhil-1α 를단독처리한군보다 를처리해준군에서연골형성유전인자인 collagen type Ⅱ, SOX 9 그리고 aggrecan 이활성화되는것으로보아, 가연골세포보호효과가있는것으로사료된다 (Fig. ). In vivo에서염증성인자인 MMP-2, 9의활성도평가 는연골파괴를일으키는물질이며연골염증성인자인 MMP-2, 9를유발시킨다. 를단독투여한실험군에 (A) 12 (B) 12 Cell viability (% of control). (C) Absorbance (ng/ml) μg/ml ug/ml MMP-2 (1) (1) (2) Cell viability (% of control). (D) Absorbance (ng/ml) (1) (1) MMP-9 (1) (1) (1) Fig. 2. Effects of on cell viability and MMP-2, 9 activity in chondrocytes incubated with or without rhil-1α on concentration. (A) Chondrocytes were treated with 1~2 μg/ml for 24 h. The cell viability was assessed with a MTT assay. (B) Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. (C, D) Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. MMP-2, 9 activity was assessed with ELISA kit. P<.5, as compared with control; P<.5, as compared with positive control (rhil-1α alone treatment). (2) (2)

5 4 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 (A) 1.4 Collagen type II (B) 1.2 SOX9 Relative expression Relative expression (1) (1) (2) (1) (1) (2) (C) 1.2 Aggrecan Relative expression (1) (1) (2) Fig.. Effects of on chondrogenic gene expression in chondrocytes incubated with or without rhil-1α on concentration. Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. P<.5, as compared with control; P<.5, as compared with positive control (rhil-1α alone treatment). (A) 18 MMP-2 (B) 14 MMP-9 Absorbance (ng/ml) Absorbance (ng/ml) (1) () (.5 μg/5 μl) (1) (1) () (.5 μg/5 μl) (1) Fig. 4. Effects of on cartilage MMP-2, 9 activity on -treated knee joint. Rats were administrated with 1~1 mg/kg for 4 weeks prior to treatment. MMP-2, 9 activity was assessed with ELISA kit. Data are presented as mean±sem (n=5). P<.5, as compared with control; P<.5, as compared with positive control ( alone treatment). 서는 MMP-2, 9가증가하였고 (1,, 1 mg/ kg) 를 4주간투여후 rhil-1α(5 ng/ml) 를 24처리한군에서는 MMP-2, 9가감소하는것이보인다. 본실험의결과 가 에의해유발된염증성인자인 MMP-2, 9의활성도를감소시키는것으로사료된다 (Fig. 4). 조직학적평가본연구에서는 로유도된골관절염에 가미치는영향을확인하기위하여골관절염유발 4주째실험종료후각실험군의무릎관절 H&E 염색을실시하여조직학적으로관찰하였다 (Fig. 5). 그결과 주입후 투여 4주째인골관절염유발군의무릎관절에서는관절연골의파괴와골침식등의소견을관찰할수있었으며 투여군에서의연골은골침식등의연골의변성이정상군과유사한것을확인할수있었다. 또한 safranin-o fast green 염색을실시하여 proteoglycan의함유량을확인하였다. 연골의침습정도를관찰한결과정상군의관절연골은적색으로전층이염색되어 proteoglycan 함유량이풍부한상태로관찰되었으며 투여군에서는관절연골의파괴나미란이심하고정상군에비해서 proteoglycan의소실이많았다. 투여군에서는정상군과유사하게연골의손상이회복되었으며 proteoglycan의소실이줄어들었음을확인할수있었다 (Fig. 5). 마지막으로전체적인 pathologic finding scores를볼때.5 mg/5 μl 단독처리군과 처리군에서각각 15.8±.5과 1.4±.4의수치가나왔다 (Table ). 따라서본연구결과 는

6 퇴행성골관절염에대한 의효과 5 (1) (1) H&E Safranin-O Coronal -D Fig. 5. Effect of on -treated degenerative osteoarthritis. Histopathological (H&E and safranin-o stain) and micro-ct (coronal and D analyses) evaluation of -injected knee joint. -treated cartilages represent severely damaged cartilage showing marked cartilage loss, fibrillation and the depletion of proteoglycan (H&E and safranin-o stain). Micro-CT of -treated knee joint shows a severely damaged joint with rough edges around the tibia and femur, indicative of bone lysis, swelling and tendency of patellar displacement. However, these damages were reduced significantly by treatment with 1 mg/kg. Scale bar: 2 μm. 에의해유도된골관절염에서 proteoglycan의소실을줄임으로써퇴행성관절염을완화시키는데효과가있는것으로사료된다. 골소주평가 Micro-CT 횡단면영상에서경골골단의원통형 VOI에서얻은골소주지표값들에대해 단독투여군과 HPL- 4 투여군의슬관절을비교하였을때 BV, BV/TV, Tb.Th 수치는 단독투여군에서증가하는것이관찰되었고 Tb.N과 Tb.Sp 값은감소하는경향을보였으나, 투여후 투여군에서는 BV, BV/TV, Tb.Th 수치를정상군에가깝게감소시켰으며 Tb.N과 Tb.Sp 값은정상군에가깝게수치를증가시켰다 (Fig. 6). 결과적으로골소주를비교분석한결과 투여는 에의해유발된경골골단의여러지표의변화를억제해주는것으로사료된다. 고찰퇴행성관절염환자의 8% 이상이움직임의제한을겪고있으며, 25% 에서는일상생활수행에도영향을받고있다. 퇴행성관절염은관절연골세포와세포외기질간의형태적, 생화학적, 분자적그리고생역학적변화가분명하고임상적으로관절통, 압통, 움직임의제한, 뼈마찰음, 염증등을특징으로한다 (17). 에서많은부분을차지하는해동피의주성분으로는 saponin, phenolic 배당체등의성분이알려져있으며사포닌성분가운데 kalopanaxsaponin A가분리되었으며류마티스성관절염에억제효과가있다는연구가있다 (18). 해동피는소염작용, 진통작용, 항기생충작용등이알려져있으며민간에서는해동피를신경통의치료및당뇨병과성인병치료에널리사용되고있다 (18). 실제임상에서퇴행성관절염환자에게여러가지한약성분들이

7 6 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 Table. Summary of microscopic findings Structural changes in the joint Surface irregularities Fibrillation of cartilage surface Disorganization of chondrocytes Exposure of subchondral bone Degeneration/necrosis Safranin-O staining Reduction of staining in cartilage /5 /5 5/5 /5 4/ /5 /5 5/5 (1 mg/kg) /5 /5 5/5 4/5 /5 1.8 Total pathology score (average±se) 15.8±.5 1.4±.4 : mild, : moderate, : severe. Significantly different (P<.1) from vehicle-treated. /5 1.6 /5 2.4 /5 / /5 / 치료에이용되고있으나해동피를포함하는기능성복합처방을가지고연골세포와동물실험에서의평가는미비하다. 연골의항상성유지에중요한연골세포의변화와사멸로인하여 collagen type Ⅱ, aggrecan, SOX 9 등세포외기질의생산이감소하고분해가촉진되면연골의기본구조가파괴되어관절은체중부하를견디지못한다 (19). 본실험에서연골조직세포에대한 rhil-1α 5 ng/ml의처리는유의적인 collagen type Ⅱ의발현을감소시킨것으로확인되었고 (Fig. A), 를처리한결과 2 μg/ml의농도에서거의정상세포의수준으로유의적인증가를나타낸것이확인되었다. 또한 를처리한후 rhil-1α를처리하여 SOX9 유전자의발현을측정한결과 2 μg/ml 범위에서유의적으로증가한것으로나타났으며 (Fig. B), 를처리한후 rhil-1α를처리하여 aggrecan의발현을측정한결과 2 μg/ml 범위에서유의적으로증가한것으로나타났다 (Fig. C). 염증성관절에서연골및골파괴에중요한역할을하는것이 matrix metalloproteinase(mmp) 같은단백분해효소이며그작용은 tissue inhibitor of metalloproteinases(timp) system에의해길항된다 (2). MMP는생체내에서 extracellular matrix protein으로작용하고골관절염에서는 proteoglycan의분해와관련이있으며 (21), MMP 활성조절이관절염치료에서중요하다 (22). 본실험에서 MMP-2, 9의유전자발현을측정한결과, 전반적으로 rhil-1α의처리는 MMP-2, 9의발현이정상세포군에비해증가한것으로확인되었다. 반면에 MMP-2, 9의두경우 를처리한결과, rhil-1α 단독처리군에비해 2 μg/ml의농도에서정상세포군의수준으로유의성있게감소시킨것으로확인되었다 (Fig. 2C, D). 이러한결과는 가 MMP-2, 9의유전자발현을억제함으로연골세포조직의파괴를억제시키는효과가있을것으로생각된다. In vitro 상의연구결과를토대로하여 in vivo 상에서사람과유사한퇴행성골관절염동물모델을제작하여조직학적평가를실시하였다. 골관절염유발물질로사용된

8 퇴행성골관절염에대한 의효과 7 (A) (1) (1) (B) BV (mm 2 ) BV/TV (%) Tb.Th (μm) Tb.N (1/mm) Tb.Sp (μm) Fig. 6. Plots of morphometric parameters of subchondral trabecular bone determined by micro-ct. BV, bone volume; BV/TV, bone volume fraction; Tb.Th, trabecular thickness; Tb.N, trabecular number; Tb.Sp, travecular spasing. Data are presented as mean±sem (n=5). P<.5, as compared with control; P<.5, as compared with positive control ( alone treatment). 는관절연골세포의해당과정의 glyceraldehyde--phosphate dehydrogenase 활성을억제하여변성을일으켜골관절염을유발시키는물질로, 쥐를대상으로한골관절염유발실험에서관절연골의손상, 관절의기능장애, 통증등이인체의골관절염과매우유사하다고알려져있다 (2). 에의한골관절염은 proteoglycan의소실 (24) 과연골및연골하골의기질붕괴가일어나며 MMP, 아교질분해효소, gelatinase의활성이증가한다 (25). 또한파골세포와골아세포의활동이증가하면서관절연골의소실로인해연골하골에부하가증가하여변형및경화와골곡형성등이 보고되고있다 (19,26). 본연구에서도 in vitro 실험결과와유사한결과를보였다. 동물실험에서 MMP-2, 9의경우도 (.5 mg/5 μl) 단독처리군에비해 1 mg/kg의농도에서정상군의수준으로유의성있게감소가확인되었다 (Fig. 4A, B). Micro-CT 촬영분석결과 군이대조군에비해연골량파괴가현저하게감소하였으며 H&E 및 safranin-o 염색을통한병리 조직학적검사에서도 군이증가된 proteoglycan 양과감소된염증세포소견을보여활막의손상정도를감소시켰다 (Fig. 5). 또한골소주지표값들을

9 8 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 분석한결과에서는 BV, BV/TV, Tb.Th 수치는 단독투여군에서증가하는것이관찰되었고 Tb.N과 Tb.Sp 값은감소하는경향을보였으나, 투여후 투여군에서는 BV, BV/TV, Tb.Th 수치가정상군에가까운수치를보였으며 Tb.N과 Tb.Sp 값도정상군에가까운수치로회복되었다 (Fig. 6B). 이는 가뼈와연골의침윤을감소시켜골관절염의진행을억제하고있다는것을의미한다. 본연구의결과를바탕으로 는 로유도된퇴행성관절염에서연골의변성과퇴행을줄이고 proteoglycan의소실을줄이는등퇴행성골관절염예방과치료에뛰어난효과가있다고사료된다. 요 본연구에서는 가골관절염의예방및치료약물로서의가능성을탐색하여다음과같은결론을얻었다. HPL- 4는연골세포생존율과연골형성과관련된 collagen type Ⅱ, SOX 9 그리고 aggrecan의유전자발현을유의성있게증가시킬뿐만아니라염증성인자와관련있는 MMP-2, 9도유의성있게감소시켰다. 는 에의해유도된퇴행성골관절염에서관절연골의파괴와골침식등연골의변성을억제했으며 proteoglycan의소실을유의성있게감소시켰다. 이에본연구는 가부작용이적고약리효과가뛰어나골관절염예방및치료제개발에활용될수있을것으로본다. 약 감사의글 본연구는지식경제부, 한국산업기술진흥원, 호남광역경제권선도산업지원단의광역경제권선도산업육성사업으로수행된연구결과임. REFERENCES 1. Jang JH, Kawakita K, Hahn SK, Park HJ, Lee SD, Kim YS, Takahashi N, Shichidou T, Itoh K, Sumiya E, Furuya E, Yamashita H. 26. Report: report of the rd Japan- Korea workshop on acupuncture and EBM-protocol development for the acupuncture trial on the osteoarthritis of the knee. J Korean Acupuncture & Moxibustion Medicine Society 2: Lee KG, Huang DS, Yu YB, Ma JY, Ha HK, Shin HK. 26. A study on compositions, dosages and usages of Sagunjatang, Samultang, Palmultang, Sipjeondaebotang in literature. J Oriental Medical Classics 19: Lee RM, Nam SS, Lee SH, Kim YS. 29. Research trends in evidence based medicine on acupuncture -Randomized controlled trial-. J Korean Acupuncture & Moxibustion Medicine Society 26: Jang YO. 27. Pathogenesis of osteoarthritis. Diagnosis and Treatment 27: Jhun HJ, Ahn K, Lee SC. 21. Estimation of the prevalence of osteoarthritis in Korean adults based on the data from the fourth Korea national health and nutrition examination survey. Anesth Pain Med 5: Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, Christy W, Cooke TD, Greenwald R, Hochberg M, Howell D, Kaplan D, Koopman W, Longley III S, Mankin H, McShane DJ, Medsger Jr T, Meenan R, Mikkelsen W, Moskowitz R, Murphy W, Rothschild B, Segal M, Sokoloff L, Wolfe F Development of criteria for the classification and reporting of osteoarthritis: classification of osteoarthritis of the knee. Arthritis Rheum 29: The Korean Orthopaedic Association Orthopedics. 4th ed. Newest Medicine Company, Seoul, Korea. p Janf SK. 27. The effect on intra-articular administration of hyaluronic acid and growth hormone on arthritis in osteoarthritis rat model. MS Thesis. Dongshin University, Naju, Korea. 9. Das SK, Faroqi A. 28. Osteoarthritis. Best Pract Res Clin Rheumatol 22: Yoon CH Current clinical practice: osteoarthritis update. Korean J Med 82: Wenz W, Breusch SJ, Graf J, Stratman U. 22. Ultrastructural findings after intraarticular application of hyaluronan in a canine model of arthropathy. J Orthop Res 18: Zahmatkash M, Vafaeenasab MR Comparing analgesic effects of a topical herbal mixed medicine with salicylate in patients with knee osteoarthritis. Pak J Biol Sci 14: Lechner M, Steirer I, Brinkhaus B, Chen Y, Kirst-Dungl C, Koschier A, Grantschacher M, Neumann K, Zauner- Dungl A Efficacy of individualized Chinese herbal medication in osteoarthritis of hip and knee: a double-blind, randomized-controlled clinical study. J Altern Complement Med 17: Jang JK JoongKyung collection. Daesung press, Seoul, Korea. p Herbal medical professor coeditorship Herbal medicine. YoungLim, Seoul, Korea. p Kobayashi K, Imaizumi R, Sumichika H, Tanaka H, Goda M, Fukunari A, Komatsu H. 2. Sodium iodoacetate-induced experimental osteoarthritis and associated pain model in rats. J Vet Med Sci 65: An HJ, Lee CK, Park JH, Kim KH, Lee WR, Park IY, Han SM, Lee KG, Park KK Effects of bee venom on papain-induced osteoarthritis in an animal model. Korean J Phamacogn 4: Kim TJ Korean resources plants. Seoul National University Press, Seoul, Korea. p Guzman RE, Evans MG, Bove S, Morenko B, Kilgore K. 2. Mono-iodoacetate-induced histologic changes in subchondral bone and articular cartilage of rat femorotibial joints: an animal model of osteoarthritis. Toxicol Pathol 1: Bresnihan B Pathogenesis of joint damage in rheumatoid arthritis. J Rheumatol 26: Nagasa H, Woessner JF Matrix metalloproteinases. J Biol Chem 274: Halliwell B. 2. Oral inflammation and reactive species: a missed opportunity? Oral Dis 6: Cho HJ, Chang CB, Jung JW, Seong SC, Kim TK. 29. Prevalence of radiographic knee osteoarthritis in elderly Koreans. Knee Surgery & Related Research 21: Kim W, Choi J. 21. Effects of bee venom and Cervi cornu parvum pharmacoacupuncture in monosodium iodoacetate ()-induced osteoarthritis rat. The Korean Academy of

10 퇴행성골관절염에대한 의효과 9 Oriental Rehabilitation Medicine 2: Janusz MJ, Hookfin EB, Heitmeyer SA, Woessner JF, Freemont AJ, Hoyland JA, Brown KK, Hsieh LC, Almstead NG, De B, Natchus MG, Pikul S, Taiwo YO. 21. Moderation of iodoacetate-induced experimental osteoarthritis rats by matrix metalloproteinase inhibitors. Osteoarthritis Cartilage 9: van der Kraan PM, Vitters EL, van de Putte LB, van den Berg WB Development of osteoarthritis lesions in mice by "metabolic" and "mechanical" alterations in the knee joints. Am J Pathol 15:

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

( ) Jkra076.hwp

( ) Jkra076.hwp Vol. 11, No. 4, December, 2004 Objective: Ultrasonography (USG) of joints has a unique position for the diagnosis of joint diseases. Bone surface, cartilage, periarticular soft tissue and their pathologic

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

109~120 õÃʾàħ Ä¡·á

109~120  õÃʾàħ Ä¡·á 109 DOI : 10.3831/KPI.2010.13.3.109 Received : 10. 08. 13 Revised : 10. 09. 06 A Case Study Of Patients With Knee Joint Pain Treated With Rubiae Radix Pharmacopuncture Accepted : 10. 09. 07 Key Words:

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현

원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

16_이주용_155~163.hwp

16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

페링야간뇨소책자-내지-16

페링야간뇨소책자-내지-16 야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence

More information

Kaes010.hwp

Kaes010.hwp 갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

■ 경희대학교 약사

■ 경희대학교 약사 연 혁 경희대학교 한의과대학 경희대학교 약( 略 史 ) 한의과대학 연혁 역대 한의과대학 보직교수 경희대학교 약 ( 略 史 ) 경희대학교의 연원은 1946년에 설립된 배영대학관과 1947년에 설립된 신흥전문관이 합병하여 1949년 5월에 발족한 신흥초급대학(2년제 가인가)에서 시작되었다. 그러나 이 대학은 다음해에 6.25 전쟁을 맞아 심한 운영난에 부딪혔으며

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

Jkafm093.hwp

Jkafm093.hwp 가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,

More information

Microsoft PowerPoint - 발표자료(KSSiS 2016)

Microsoft PowerPoint - 발표자료(KSSiS 2016) Sang Jun Kim, MD, PhD Application of 3D Printing in the Orthotic Fields Hallux Valgus, Charcot Marie Tooth, ADL Kit, Foot Insole, Wrist Pain, Foot Drop Development of Automated Program for Ankle Foot Orthosis

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

μ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상 6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

6-20 (69-85).hwp

6-20 (69-85).hwp J Korean Med. 2013;34(3):69-85 pissn 1010-0695 eissn 2288-3339 Original Article 안순선, 허동석 대전대학교한의과대학한방재활의학과교실 Effects of Kyejiinsam-tang in MIA-Induced Osteoarthritis Rats Soon-sun An, K.M.D, Dong-seok

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 정복이 안된 상태로 치료 시에는 추후 지속적인 족부 동통의 원인이 되며, 이런 동통으로 인해 종골에 대해 구제술이나 2차적 재건술이 필요할 수도 있다. 2) 경종골 거주상 관절 탈구는 외국 문헌에 증례

종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 정복이 안된 상태로 치료 시에는 추후 지속적인 족부 동통의 원인이 되며, 이런 동통으로 인해 종골에 대해 구제술이나 2차적 재건술이 필요할 수도 있다. 2) 경종골 거주상 관절 탈구는 외국 문헌에 증례 CSE REPORT 대한족부족관절학회지 제16권 제4호 2012 J Korean Foot nkle Soc. Vol. 16. No. 4. pp.270-275, 2012 종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 인제대학교 의과대학 일산백병원 정형외과 차성무 장보훈 서진수 Treatment of Talonavicular Subluxation

More information

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770> 醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>

<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770> 2012 개원의와함께하는임상강좌 경희대학교의학전문대학원류마티스내과학교실 홍승재 진단의중요성 치료의첫단계 : 정확한진단은아무리강조해도지나치지않음 감별진단의중요성 : 진단이달라짐에따라치료시기와약제의선택, 진행경과, 합병증여부, 예후및삶의질에차이가있다. 류마티스관절염 (Rheumatoid arthritis) : 비교적젊은나이에발병하며, 진단초기부터관절염증에의한골파괴소견이가능함.

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

16(2)-7(p ).fm

16(2)-7(p ).fm w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

대한한의학원전학회지23권3호(최종)_100531.hwp

대한한의학원전학회지23권3호(최종)_100531.hwp 鄭澣1 趙學俊1* 世明大學校 韓醫科大學 原典醫史學敎室1 A Study on the Life, Works and Distinctive Features of Gogobong(高鼓峰)'s medicine Jung Han1 Jo Hak-jun1* 1 Dept. of Korean Medical Classics & Medical History, Semyung University

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

untitled

untitled Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom

More information

(5차 편집).hwp

(5차 편집).hwp (215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)

More information

레이아웃 1

레이아웃 1 대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou

제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou 제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuous vs single injection, interscalene vs supraclavicular approach 의정부성모병원

More information

<B0A3C3DFB0E828C0DBBEF7292E687770>

<B0A3C3DFB0E828C0DBBEF7292E687770> 초청연자특강 대구가톨릭의대의학통계학교실 Meta analysis ( 메타분석 ) 예1) The effect of interferon on development of hepatocellular carcinoma in patients with chronic hepatitis B virus infection?? -:> 1998.1 ~2007.12.31 / RCT(2),

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( ) . 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( : 27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: * The Effect of Paren

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   * The Effect of Paren Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.95-116 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.95 * The Effect of Parent Education Program Using Action Learning on Family

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

1

1 - MEDIC (MEDical Intelligent wheelchair ) MedicalIntelligent, Wheelchair MEDIC. MEDIC LG Global Challenger 2003 - 1. 3 2. 4 2.1 4 (1) 4 (2) 5 2.2 6 (1) 6 (2) 6 (3) 7 3. 8 3.1 8 3.2 10 3.3 11 4. 12 4.1

More information