J Plant Biotechnol (2019) 46: DOI: ISSN (Print) ISSN (Online) Research Article 딸기조

Size: px

Start display at page:

Download "J Plant Biotechnol (2019) 46: DOI: ISSN (Print) ISSN (Online) Research Article 딸기조"

괴옥 승
4 years ago
Views:

1 J Plant Biotechnol (2019) 46: DOI: ISSN (Print) ISSN (Online) Research Article 딸기조직배양시여러가지식물호르몬처리에따른기내증식및형태적, 유전적변이발생비교 김혜진 이종남 최미자 서종택 Comparison of in vitro propagation and occurrence of morphological and genetic variation in strawberry tissue culture with various plant hormone treatments Hye Jin Kim Jong Nam Lee Mi Ja Choi Jong Taek Suh Received: 25 February 2019 / Revised: 31 March 2019 / Accepted: 31 March 2019 c Korean Society for Plant Biotechnology Abstract The objective of this study was to carry out treatment of various plant hormones in order to determine morphological and genetic variation degree of tissue-cultured strawberry. The cultivar used in this experiment was Goha and Seolhyang, the plant hormones used for experiment were benzyladenine (BA), N-(2-Chloro-4 pyridyl)-n - phenylurea (CPPU) and thidiazuron (TDZ), and the concentrations were 0.5, 1.0, 2.0, 4.0 mg L -1 with each hormone. The BA treatment of the proliferation efficiency of tissuecultured strawberry Goha and Seolhyang was the highest. When processing BA, CPPU and TDZ, morphological variation and genetic variation happened in strawberry Goha and Seolhyang, especially, the variations appeared highly in CPPU treatment. The genetic variation in Goha appeared at the concentration more than BA 0.5 mg L -1 as 1.1%, appeared at the concentration of CPPU 0.5 mg L -1 as 15.3%, and at the concentration of TDZ 2.0 mg L -1 as 1.2%. The genetic variation in Seolhyang appeared at the concentration of BA 4.0 mg L -1 as 2.3%, and at the concentration of CPPU 0.5 mg L -1 as 14.3%. Therefore, CPPU should not be treated during strawberry tissue culture, and BA and TDZ should be treated at low concentration. H. J. Kim ( ) J. N. Lee M. J. Choi J. T. Suh 국립식량과학원고령지농업연구소 (Highland Agricultural Research Institute, National Institute of Crop Science, Pyeongchang 25342, Korea) heijin79@korea.kr Keywords Benzyladenine, Fragaria ananassa, N-(2-Chloro-4 pyridyl)-n -phenylurea, Thidiazuron, Propagation efficiency 서언 현재재배종딸기 (Fragaria ananassa Duch.) 의대부분은배수성이 8 배체 (2n=8x=56) 로영양번식을통해자묘를증식하여재배에이용한다. 영양번식작물의증식시모주의갱신없이장기간번식에이용할경우, 병원균또는바이러스등에감염되어자묘생산량이줄어들뿐만아니라자묘로병원균이나바이러스가전이되어재배시생산량, 품질등에나쁜영향을미친다 (Martin and Spiegel 1998; Martin and Tzanetakis 2006; Mellor and Krczal 1987; Thompson and Jelkman 2003). 조직배양기술은식물의잎, 줄기, 뿌리및생장점등의조직을이용하여새로운개체를만들어내는기술로대부분의영양번식작물에서대량생산또는 virus-free 묘를생산하기위하여많이이용되어왔다 (Badoni and Chauhan 2009; Boxus 1989; Pant et al. 2015). 딸기는조직배양시품종본연의특성을유지하기위해생장점배양만을통해조직배양묘를생산해왔는데, 증식률이 1.8 배로매우낮아 (Lee et al. 2010), 대량증식이어려워식물호르몬등을처리하여증식률을향상시켜왔다 (Ashrafuzzaman et al. 2013; Boxus 1999; Marandi et al. 2011) 년대에우리나라의딸기조직배양묘의보급은호르몬처리를통해대량증식하여조기보급에성공하였으나, 생산력및후대검정을거치지않고조직배양묘가농가로직 This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 J Plant Biotechnol (2019) 46: 접보급되면서종묘사고가발생하여조직배양을통한딸기종묘보급체계가사라졌다. 그후 2000 년대초반부터딸기조직배양묘의보급이다시이뤄지고있으나, 2013 년에민간조직배양업체에서보급한딸기조직배양묘에서변이주가발생함으로써딸기재배농가의피해가매우컸다. Koruza and Jeleska (1993) 는조직배양시나타나는대부분의변이는후생적으로 (epigenetic), 시간이지나면사라진다고보고하였으나, 그외의많은연구자들은삽입, 결손, 점돌연변이와재배열같은유전적변이가조직배양중에일어나며 (Anderson et al. 1991; Kane et al. 1992), 이로인해나타나는표현형적증상들이유전된다 (Karp 1995; Sansavini et al. 1990) 고보고하였다. 딸기의경우식물호르몬종류및농도, 계대배양횟수등에따라변이체가발생할수있는데 (Faedi et al. 2002), 특히식물호르몬중조직배양묘대량증식에주로이용되는시토키닌류를고농도로사용할경우체세포변이발생률이높아진다 (Sansavini et al. 1990) 고보고하였다. 그러나현재까지딸기조직배양시식물호르몬종류에따른조직배양묘의기내증식률정도, 변이발생및검정에관한연구는미흡한실정이다. 따라서본연구는딸기조직배양묘의안정적인대량증식을위해조직배양에주로사용되고있는여러가지식물호르몬을농도별로처리하여품종별증식률을비교하고, 식물호르몬처리에따른형태적, 유전적변이발생정도를확인하고자실시하였다. 재료및방법 공시품종및식물호르몬처리 본연구에사용된공시품종은사계성 (ever-bearing) 딸기 고하 와일계성 (june-bearing) 딸기 설향 이었다. 고하 와 설향 의포복경의선단으로부터생장점을적출하여배지 (1/3MS 무기염, 30 g L -1 sucrose, 8 g L -1 plant agar, ph ) 에치상하여 6 주간배양하여기내유식물체를얻었다. 본실험에사용된식물호르몬은 benzyladenine (BA), N-(2- Chloro-4 pyridyl)-n -phenylurea (CPPU) 및 thidiazuron (TDZ) 이며, 종류별로 0.5, 1.0, 2.0, 4.0 mg L -1 의농도로처리하였으며, 각처리별로 indole-3-butyric acid (IBA) 를 0.1 mg L -1 의농도로혼합처리하였다. 생장점에서발아된유식물체의뿌리와잎을제거한후식물호르몬이첨가된배지에치상하여, 각처리별로 6 주간배양후기본배지 (MS 무기염 (Murashige and Skoog 1962), 30 g L -1 sucrose, 8 g L -1 plant agar, ph ) 에 4 주간격으로 3 회계대배양하여하나의온전한조직배양묘 (whole plant) 를생산하였다. 온실순화및형태적변이주선발 식물호르몬처리에의해증식된유식물체는온실에서딸기전용상토 푸르미 ( 서울바이오 ( 주 )) 를충진한흑색비닐포트 (3 치, 접은윗지름 13 cm 높이 6.8 cm 펼친윗직경 9 cm) 에순화하였다. 순화후일주일간 50% 차광막으로차광하고, 상대습도를 80% 이상으로유지한후서서히제거하고 6 주간육묘후본포에정식하였다. 본포에정식후딸기전용양액인 PBG 액 (Proefstation voor Bloemisterij en Glasgroente, Netherlands) (Sonneveld and Straver 1994) 을전기전도도 (EC, electrical conductivity) 0.8 ds m -1 로맞추어 1 일 4-5 회관수하며재배하였다. 전재배기간동안화방출뢰성 ( 불연속출뢰또는불출뢰 ), 비정상과일출현, 초세등을바탕으로형태적변이주를선발하였다. DNA 추출및유전적변이검정 선발된형태적변이주의어린잎을채취하여 NucleoSpin PlantⅡ Kit (Macherey-Nagel, Germany) 를사용하여 genomic DNA 를추출하였다. 추출한 DNA 는분광광도계 (DS-11+ Spectrophotometer, DeNovix, USA) 로 DNA 양을측정하여 10 ng μl -1 로정량하여분석에이용하였다. 본실험에사용한 SSR 마커는 Govan et al. (2008) 과 Honjo et al. (2011) 이사용한 4 개의마커정보를수집하여프라이머를제작하였으며, 프라이머의정방향에 5-FAM (Bioneer, Korea) 으로형광표지한다음 SSR 분석을실시하였다 (Table 1). PCR 반응은 genomic DNA 20 ng, 2X TOPsimple TM PreMix-nTaq (Enzynomics, Korea) 10 μl, forward 와 reverse primer 각 1 μl (10 pm μl -1 ) 를넣고증류수를첨가하여전체부피를 20 μl 로조절하였다. PCR (Veriti TM 96-Well Thermal Cycler, Applied Table 1 The Primer sequences, repeat motif, and annealing temperature of 4 SSR markers used in the analysis of genetic variation plants Marker a Forward primer Reverse primer Repeat motif Tm ( C) FxaHGA02P13 F:ccaggcgcttggtcttgtactact R:cccatttcccccaaatctaacaat - 59 FxaAGA21F11 F:caattcacaatggctgatgacgat R:gcactcagacatattttgggaggg - 59 EMFv104 F:tggaaacattcttacatagccaaa R:cagacgagtccttcatgtgc (AG) EMFvi136 F:gagcctgctacgcttttctatg R:cctctgattcgatgatttgct (TC) Direct 54 a SSR markers have been cited in Govan et al. (2008) and Honjo et al. (2011)

108 J Plant Biotechnol (2019) 46:106 113 Biosystems, USA) 증폭조건은 95 에서 15 분동안변성시킨후, 95 C 에서 30 초, 65 C 에서 30 초 ( 반복당 1 C 씩감소 ), 72 C 에서 30 초간 25 회반복한후, 95 C 에서 30 초, 55 C 에서 30 초, 72 C 에서 30 초간 30

3 108 J Plant Biotechnol (2019) 46: Biosystems, USA) 증폭조건은 95 에서 15 분동안변성시킨후, 95 C 에서 30 초, 65 C 에서 30 초 ( 반복당 1 C 씩감소 ), 72 C 에서 30 초간 25 회반복한후, 95 C 에서 30 초, 55 C 에서 30 초, 72 C 에서 30 초간 30 회반복한후 72 C 에서 5 분간처리하였다. PCR 이완료된후 5 μl 의증폭산물을 1.5% (w/v) agarose gel 에서전기영동하여증폭여부를확인한후 PCR 증폭산물 0.5 μl (50 ng μl -1 ), GeneScan 500 LIZ dye Size Standard (Applied biosystems, USA) 0.5μL 와 Hi-Di Formamide (Applied biosystems, USA) 9 μl 를혼합하여 95 C 에서 3 분간변성시킨후 4 C 에서 1 분간안정화시켰다. 변성시킨 PCR 산물은자동염기서열분석기 (DNA Analyzer 3730xl, Applied Biosystems, USA) 를활용하여전기영동한다음 Gene Mapper 프로그램 (Applied Biosystems, USA) 을사용하여마커별로분석하여유전적변이검정을실시하였다. 결과및고찰 식물호르몬종류별기내증식주수비교 딸기조직배양시여러가지식물호르몬처리에따른신초증 Table 2 The number of new shoots with various plant hormone treatment of strawberry plant via tissue culture Concentration of No. of new shoots plant hormone a (mg L -1 ) Goha Seolhyang BA IBA ±3 b 40±2 BA IBA ±2 22±1 BA IBA ±1 31±1 BA IBA ±1 42±1 Average 36.0± ±2 CPPU IBA ±1 14±2 CPPU IBA ±1 36±4 CPPU IBA ±1 30±3 CPPU IBA ±2 27±3 Average 22.3±1 26.8±3 TDZ IBA ±1 - c TDZ IBA ±1 - TDZ IBA ±2 - TDZ IBA ±1 - Average 21.3±1 - a Various plant hormone treated tissue culture plants Goha and Seolhyang. BA is Benzyladenine, CPPU is N-(2-Chloro-4 pyridyl)-n -phenylurea, TDZ is Thidiazuron, and IBA is Indole-3-butyric acid b mean ± standard error c Do not tested in Seolhyang 식을비교한결과 (Table 2), BA 처리시 고하 는기내유식물체 1 주당평균 36.0 개, 설향 은 33.8 개가발생되었고, CPPU 처리시 고하 는 22.3 개, 설향 은 26.8 개발생되었으며, TDZ 처리시 고하 에서 21.3 개가발생되었다. 신초발생은품종에관계없이 BA 처리가가장많이발생하였고, CPPU 처리, TDZ 처리순으로나타났다. 지금까지딸기의기내유식물체의대량증식에는처리시증식효율이높다고보고된 benzylaminopurine (BAP) 을주로사용하였는데 (Ahmad 2013; Marcotirigiano et al. 1984; Żebrowska et al. 2003), 본실험에서도 benzyladenine (BA) 처리에서증식효율이가장높게나타나딸기의기내조직배양묘의증식에 BA 가가장적합한것으로판단되었다. 그리고 Fatemeh et al. (2010) 은딸기의경우절편체종류및유전적배경이다른품종의종류에따라식물호르몬처리에따른재분화반응이다르게나타난다고보고하였지만, 본연구에서고하는생태형이사계성이고, 설향은생태형이일계성으로유전적배경이매우다름에도불구하고, 재분화반응이비슷하게나타나는상반된결과를보였다. 현재까지딸기조직배양시식물호르몬의처리에따른증식률향상연구만진행되어 (Ashrafuzzaman et al. 2013; Boxus 1999; Marandi et al. 2011), 식물호르몬처리에따른조직배양변이발생에관한연구는매우미비한실정이다. 딸기조직배양시발생하는변이를검정하는방법에는표현형적, 세포학적, 생화학적방법및유전적방법등이있다 (Kaeppler et al. 2000). 그중표현형적분석은기본적이고필수적인분석방법으로원종식물과변이체의형태적특성을비교하여구분하는 1 차적인방법이다. Cameron and Hancock (1986) 외여러학자들은딸기조직배양시나타나는변이로주로엽색변이체, 왜화식물체등이나타난다고보고하였으나 (Irkaeva and Matveena 1997; Sansavini et al. 1990; Swartz et al. 1981), 고하 의형태적변이주는전재배기간동안화방이출현하지않아 (Fig. 1D) 영양생장이과도하여잎이크고두꺼운형태였으며 (Fig. 1E), 정상과의모양이원추형인것에비해 (Fig. Fig. 1 Comparison of morphological traits with plant hormone treatment of strawberry Goha. (A) Normal fruit. (B and C) Abnormal fruits. (D) Do not appear flower cluster. (E) A leaf characteristics of normal plant (right) and variation plant (left)

J Plant Biotechnol (2019) 46:106 113 109 Fig. 2 Comparison of morphological traits with plant hormone treatment of strawberry Seolhyang. (A) Normal fruits. (B) Abnormal fruits.

4 J Plant Biotechnol (2019) 46: Fig. 2 Comparison of morphological traits with plant hormone treatment of strawberry Seolhyang. (A) Normal fruits. (B) Abnormal fruits. (C) An abnormal flower without anther 1A) 변이주의과일모양은닭벼슬모양이나과탁이길어지는등의비정상적인과일의모양을지속적으로생산하였다 (Fig. 1B, 1C). 그리고 설향 의형태적변이주들은약 ( 葯 ) 이소실된꽃 (Fig. 2C) 이피고그로인해수정이불량하여기형과 (Fig. 2B) 등이발생하는경향을보였다. 이것은조직배양시식물호르몬처리에의해나타나는형태적변이가매우다양하며, 이러한형태적변이는후생적변이 (epigenetic variation) 와유전적변이 (genetic variation) 를모두포함하고있으므로 (Zhang 2014) 우량묘생산을위해서는반드시유전적변이검정을실시해야할필요성이있음을시사하는것이다. 여러가지식물호르몬처리에따른형태적변이발생정도를비교한결과, 고하 는무처리에서 0.0%, BA 처리에서 4.9%, CPPU 처리에서 8.3%, TDZ 처리에서 5.3% 로무처리에비해식물호르몬처리에서형태적변이가많이발생하였으며, 특히 CPPU 처리가가장높게나타났다 (Fig. 3A). 설향 은무처리에서 0.0%, BA 처리에서 2.8%, CPPU 처리에서 18.7% 로 CPPU 처리에서형태적변이가매우높게발생하였다 (Fig. 3C). 이렇게선별된형태적변이개체를 SSR 마커를이용하여분석한결과, 고하 의유전적변이율은무처리에서 0.0%, BA 처리에서 1.1%, CPPU 처리에서 5.6%, TDZ 처리에서 0.3% 로나타났고 (Fig. 3B), 설향 의유전적변이율은무처리에서 0.0%, BA 처리에서 0.6%, CPPU 처리에서 5.6% 로나 Fig. 3 Comparison between morphological and genetic variation rate of tissue cultured strawberry with respect to BA, CPPU and TDZ treatment. (A) Morphological variation rate of strawberry Goha. (B) Genetic variation rate of strawberry Goha. (C) Morphological variation rate of strawberry Seolhyang. (D) Genetic variation rate of strawberry Seolhyang

5 110 J Plant Biotechnol (2019) 46: Fig. 4 Comparison between morphological and genetic variations of tissue cultured strawberry with respect to concentration of BA and CPPU. (A) Morphological variation rate of strawberry Goha and Seolhyang. (B) Genetic variation rate of strawberry Goha and Seolhyang 타났다 (Fig. 3D). 본실험의결과, 품종에관계없이식물호르몬처리시형태적및유전적변이가발생하며, 특히 CPPU 처리시타식물호르몬에비해현저히높은변이발생을보였다 (Fig. 3). 고하 에 BA 를농도별로처리한결과 (Fig. 4), 형태적변이는 0.5 mg L -1 에서 10.8% 로가장높게나타났으나그중 1.1% 만이유전적변이임을확인하였다. 그러나 고하 에 CPPU 0.5 mg L -1 을처리했을때형태적변이가 15.3% 로매우높게나타났을뿐만아니라형태적변이를보인모든개체가유전적변이임을확인할수있었다. 설향 에 BA 를농도별로처리한결과 (Fig. 4), 형태적변이발생은 0.5 mg L -1 에서 5.0% 로가장높게나타났고, 유전적변이발생은 4.0 mg L -1 에서 2.3% 로가장높게나타났다. 설향 에 CPPU 를농도별로처리한결과, 형태적변이발생은 4.0 mg L -1 에서 24.5% 로가장높게나타났고, 유전적변이발생은 0.5 mg L -1 에서 14.3% 로가장높게나타났다. 고하 및 설향 모두 CPPU 처리에서형태적, 유전적변이발생이높았고, 특히 CPPU 0.5 mg L -1 의저농도에서도유전적변이발생이많은것을확인할수있었다 (Fig. 4B). 고하 및 설향 의유전적변이체를 SSR 분석한결과 (Table 3 과 Table 4), 4 개의 SSR 마커에서 고하 대조는총 26 개의대립유전자를보인반면에 BA 처리구는 33.6 개, CPPU 처리구는 30.5 개, TDZ 처리구는 35 개의대립유전자를보였다. 설향 대조는총 27.0 개의대립유전자를보였으며, BA Table 3 The number of alleles and allele size range by treatment of different plant hormones in tissue culture of strawberry Goha Marker Allele size range (bp) CONTROL a BA CPPU TDZ Allele size range (bp) Allele size range (bp) Allele size range (bp) FxaAGA21F FxaHGA02P EMFv EMFvi Total a Do not treat any plant hormone Table 4 The number of alleles and allele size range by treatment of different plant hormones in tissue culture of strawberry Seolhyang Marker Allele size range (bp) CONTROL a BA CPPU Allele size range (bp) Allele size range (bp) FxaAGA21F FxaHGA02P EMFv EMFvi Total a Do not treat any plant hormone

J Plant Biotechnol (2019) 46:106 113 111 Fig. 5 Peak of alleles of genetic variants by treatment of different plant hormones in tissue culture of strawberry Goha and Seolhyang. (A) cv.

6 J Plant Biotechnol (2019) 46: Fig. 5 Peak of alleles of genetic variants by treatment of different plant hormones in tissue culture of strawberry Goha and Seolhyang. (A) cv. Goha and used EMFv104 marker. (B) cv. Seolhyang and used EMFv104 marker. (C) cv. Seolhyang and used EMFvi136 marker 처리구는 29.0 개, CPPU 처리구는 29.5 개의대립유전자를보였다. 특히 고하 는 EMFv104 마커를이용한분석에서대조에비해 bp 사이에많은수의대립유전자가나타나는것을확인하였고 (Table 4, Fig. 5A), 설향 은 EMFv104 마커를이용한분석에서 BA 처리는 64, 98 bp 의대립유전자가추가되었으며, CPPU 처리는 72, 82, 84 bp 의대립유전자가추가적으로나타났다 (Fig. 5B). 또한 EMFvi136 마커를이용한분석에서 CPPU 처리는대조에비해 133 bp 의대립유전자가결손된것을확인하였다 (Fig. 5C). Karp and Bright (1985) 외몇몇연구자들은식물호르몬이흔히조직배양에서유전적변화의원인임을시사하였다 (Gould 1986; Karp 1989). 특히여러학자들은부적당한혹은최적이상의농도의식물호르몬사용시재분화식물체에서변이를유발하는것을밝혀냈으며 (Evans and Bravo 1986; Karp and Bright 1985; Orton 1983; Varga et al. 1988), Nehra et al. (1992) 는고농도의 BA 처리 (20μM) 시왜화식물체가약 10% 정도야기된다고보고하였다. 따라서본실험에서 고하 및 설향 의조직배양시 BA, CPPU 및 TDZ 을처리하여형태적, 유전적변이가나타남으로써앞선연구와마찬가지로식물호르몬이식물체의유전적변화를일으키는원인임을확인할수있었다. 따라서딸기조직배양시식물호르몬을처리할경우형태적, 유전적변이가나타날수있으며, 특히 BA 나 TDZ 에비해 CPPU 는품종이나호르몬농도에관계없이변이발생이높게나타나므로딸기조직배양묘대량증식을위한식물호르몬의사용을주의해야하며, 반드시후대검정을통해품종본연의특성이유지되는지확인해야한다. 또한, 본실험에서선별된변이개체의형태적, 유전적특성이후대에도지속적으로나타나는지에대해추후후대검정연구가필요할것으로판단된다. 적요 본실험은딸기조직배양시여러가지식물호르몬의농도별처리에따른증식률및형태적, 유전적변이발생정도를확인하고자실시하였다. 본실험에사용된공시품종은 고하 와 설향 이며, 본실험에사용한식물호르몬은 BA, CPPU 및 TDZ 로, 농도는 0.5, 1.0, 2.0, 4.0 mg L -1 였다. 고하 와 설향 의조직배양묘증식률은 BA 처리시가장높았다. BA, CPPU 및 TDZ 처리시 고하 및 설향 에서형태적및유전적변이가발생하였고, 특히품종에관계없이 CPPU 처리에서변이가

7 112 J Plant Biotechnol (2019) 46: 높게나타났다. 고하 의유전적변이는 BA 0.5 mg L -1 이상의농도에서 1.1% 로나타났고, CPPU 0.5 mg L -1 에서 15.3% 로나타났으며, TDZ 2.0 mg L -1 에서 1.2% 로나타났다. 설향 의유전적변이는 BA 4.0 mg L -1 에서 2.3% 로나타났고, CPPU 0.5 mg L -1 에서 14.3% 로나타났다. 따라서딸기조직배양시, CPPU 는처리하지않는것이좋을것으로판단되고, BA 나 TDZ 또한저농도로처리하는것이바람직할것으로판단된다. 사사 본논문은농촌진흥청연구사업 ( 세부과제명 : 수출딸기유망품종조직배양묘안정생산기술개발, 과제번호 : PJ ) 의지원에의해이루어진것임. References Ahmad SS (2013) In vitro shoot proliferation of strawberry using stem plantlet explants derived from meristem culture. Widyariset 16: (Abstr.) Anderson G, Lewis-Smith AC, Chamberlain M, Smith SM (1991) Variation in organization and copy number of ribosomal RNA genes in Petunia hybrida somaclones. Biologia Plantarum 33: Ashrafuzzaman M, Faisal SM, Yadav D, Khanam D, Raihan F (2013) Micropropagation of strawberry (Fragaria ananassa) through runner culture. Bangladesh J. Agril. Res. 38: Badoni A and Chauhan JS (2009) Effect of growth regulators on meristem-tip development and in vitro multiplication of potato cultivar Kufri Himalini. Nature and Science 7:31-34 Boxus P (1989) Review on strawberry mass propagation. Acta Hort. 265: Boxus P (1999) Micropropagation of strawberry via axillary shoot proliferation. In: Plant Cell Culture Protocols. Methods in Molecular Biology. Part Ⅲ. Plant propagation in vitro. Hall RD (ed.). Humana Press Inc., Totowa NJ 111: Cameron JS and Hancock JF (1986) Enhanced vigor in vegetative progeny of micropropagated strawberry plants. HortScience 21: Evans DA and Bravo JE (1986) Phenotypic and genotypic stability of tissue culture plants. In: Zimmerman RH, Griesbach RJ, Hammerschlag FA, Lawson RH (eds.). Tissue Culture as a Plant Production System for Horticultural Crops (p 73-94). Martinus Nijihoff Publishers, Dordrdcht Faedi W, Mourgues F, Rosati C (2002) Strawberry breeding and varieties: situation and perspectives. Acta Hort. 567:51-59 Fatemeh H, Maheran AA, Ghizan S, Azmi AR, Hossein K (2010) Micropropagation of strawberry cv. Camarosa: Prolific shoot regeneration from in vitro shoot tips using thidiazuron with N6-benzylamino-purin. HortScience. 45: Govan GL, Simpson DW, Johnson AW, Tobutt KR, Sargent DJ (2008) A reliable multiplexed microsatellite set for genotyping Fragaria and its use in a survey of 60 F. ananassa cultivars. Mol. Breeding 22: Gould AR (1986) Factors controlling variability in vitro. In: Vasil IK (Ed.) Cell Culture and Somatic Cell Genetics of Plants, Vol 3: Academic Press, New York Honjo M, Nunome T, Kataoka S, Yano T, Yamazaki H, Hamano M, Yui S, Morishita M (2011) Strawberry cultivar identification based on hypervariable SSR markers. Breeding Sci. 61: Irkaeva NM and Matveeva TV (1997) Response of strawberry (Fragaria vesca L.) strains to cytokinin in vitro. (Russian with English abstract) Genetika 33: Kaeppler SM, Kaeppler HF, Rhee Y (2000) Epigenetic aspects of somaclonal variation in plants. Plant Mol. Biol. 43: Kane EJ, Wilson AJ, Chourey PS (1992) Mitochondrial genome variability in Sorghum cell culture protoclones. Theor. Appl. Genet. 83: Karp A (1989) Can genetic instability be controlled in plant tissue cultures. IAPTC Newsletter 58:2-11 Karp A (1995) Somaclonal varation as a tool for crop improvement. Euphytica 85: Karp A and Bright SWJ (1985) On the causes and origins of somaclonal variation. In: Miflin BJ (ed). Oxford Survey of Plant Molecular and Cell Biology, Vol.2: Oxford University Press, Oxford Koruza B and Jeleska S (1993) Influence of meristem culture and virus elimination on phenotypical modifications of grapevine (Vitis vinifera L., cv. Refosk). Vitis 32:59-60 Lee JN, Kim HJ, Kim KD, Kwon YS, Im JS, Lim HT, Yeoung YR (2010) In vitro mass propagation and economic effects of bioreactor culture in ever-bearing strawberry Goha. Kor. J. Hort. Sci. Technol. 28: Marcotirigiano M, Swartz HJ, Gray SE, Tokaricky D, Popenoe J (1984) The effect of benzylaminopurine on the in vitro multiplication rate and subsequent field performance of tissue culture propagation strawberry plant. Adv. Strawberry Prod. 3:23-25 Marandi JR, Naseri L, Mohseniazer M, Hajitagiloo R, Marhamati MR (2011) Investigation on interaction effect of benzyladenine and chitosan on in vitro proliferation of strawberry (Fragaria ananassa cv. Selva). Agricultural Biotechnology 10:27-34 (Abstr.) Martin RR, Tzanetakis IE (2006) Characterisation and recent advances in detection of strawberry viruses. Plant Disease 90: Martin RR, Spiegel S (1998) Strawberry mottle virus. In:JL Mass (ed.). Compendium of strawberry diseases. Sec. ed. Am. Phytopato. Soc Mellor FC, Krczal H (1987) Strawberry mottle. In: RH Converse (ed.), Virus diseases of small fruits. United States Department of Agriculture, Agriculture Handbook No. 631, Washington, D. C., Nehra NS, Kartha KK, Stushnoff C, Giles KL (1992) The influence of plant growth regulator concentrations and callus age on

8 J Plant Biotechnol (2019) 46: somaclonal variation in callus culture regenerants of strawberry. Plant Cell Tiss. Org. Cult. 29: Orton TJ (1983) Experimental approaches to the study of somaclonal variation. Plant Mol. Biol. Rept. 1:67-76 Pant M, Lal A, Jain R (2015) A simple cost effective method for mass propagation of Chrysanthemum morifolium and antibacterial activity assessment of in vitro raised plantlets. Journal of Applied Pharmaceutical Science 5: Sansavini S, Rosati P, Gaggioli D, Toshi MF (1990) Inheritance and stability of somaclonal variation in micropropagated strawberry. Acta Hort. 280: Sonneveld C and Straver N (1994) Nutrient solutions for vegetables and flowers grown in water ore substrates, (tenth edition). Proefstation voor Tuinbouw onder glas te Naaldwijk, The Netherlands, Series Voedingsoplossingen Glastuinbouw No.8: 45pp Swartz HJ, Galletta GJ, Zimmerman RH (1981). Field performance and phenotypic stability of tissue culture-propagated strawberries. J. Am. Soc. Hort. Sci. 106: Thompson JR, Jelkman W (2003) The detection and variation of strawberry mottle virus. Plant disease 87: Varga A, Thoma LH, Bruinsma J (1988) Effects of auxins and cytokinins on epigenetic instability of callus-propagated Kalanchoe blossgeldiana pollen. Plant Cell Tiss. Org. Cult. 15: Żebrowska JI, Czernaś J, Gawroński J, Hortyński JA (2003) Suitability of strawberry (Fragaria ananassa Duch.) microplants to the field cultivation. Food, Agriculture & Environment 1: Zhang Z (2014) Epigenetic and genetic variation in micro-propagated strawberry plants. Acta Hort. 1049:63-66

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected