발간등록번호 보안과제 ( ), 일반과제 ( O ) 과제번호 SoltoB를이용한송아지호흡기및소화기질병예방효과규명 (Efficacy of SoltoB against respiratory and intestinal dis
|
|
- 용진 손
- 4 years ago
- Views:
Transcription
1 발간등록번호 보안과제 ( ), 일반과제 ( O ) 과제번호 SoltoB를이용한송아지호흡기및소화기질병예방효과규명 (Efficacy of SoltoB against respiratory and intestinal disease in calves) ( 주 ) 서봉바이오베스텍 농림수산식품부
2 제출문 농림수산식품부장관귀하 이보고서를 SoltoB 를이용한송아지호흡기및소화기질병예방효과 규명 과제의보고서로제출합니다. 제1세부연구과제 : SoltoB의세균의흡착력및면역증강효과규명제1협동연구과제 : 송아지의세균성설사및세균성호흡기증에대한 SoltoB의방어효과규명제2협동연구과제 : 송아지의바이러스성설사및바이러스성호흡기증에대한 SoltoB의방어효과규명 2011 년 5 월 11 일 주관연구기관명 : 서봉바이오베스텍주관연구책임자 : 정연권연구원 : 이창기제1협동연구기관명 : 서울대학교제1협동연구책임자 : 유한상연구원 : 정명환제2협동연구기관명 : 전남대학교제2협동연구책임자 : 이봉주연구원 : 정복기 - 1 -
3 요약문 Ⅰ. 제목 SoltoB 를이용한송아지호흡기및소화기질병예방효과규명 Ⅱ. 연구개발의목적및필요성 국내송아지폐사의가장중요한원인은바이러스나세균에의한폐렴과설사이다. 이러한질병은송아지의면역기능이감소하여발생하게되는데, 면역증강기능이있는 SoltoB를사료에첨가하여급여함으로써송아지설사와호흡기질병에대한저항력을증강시킬수있을것으로판단된다. 하지만송아지설사와호흡기질병예방을위한 SoltoB의적용에관한연구는전무한실정이다. 이에 SoltoB 급여를통한송아지면역증강효과를확인하고이를통한바이러스성, 세균성폐렴과설사에대한질병예방효과를확인하고자한다. Ⅲ. 연구개발의내용및범위 1. 1차년도가. SoltoB의면역기능증강효과를규명 (1) 마우스비장세포배양법으로면역유도활성평가 나. 송아지에서세균성및바이러스성설사에대한 SoltoB의방어효과를확인 (1) 국내송아지세균성설사원인체분석및인공감염을위한균주선발 ( 가 ) 국내송아지세균성설사원인체분석 ( 나 ) 송아지인공감염을위한균주선발 (2) 송아지바이러스성설사원인체검출기법확립 - 2 -
4 (3) 송아지에세균성및바이러스성설사원인체동시인공감염후, 임상증상및분변내인공감염원인체분비정도평가 ( 가 ) 세균성 (Escherichia coli, Salmonella Typhimurium) 및바이러스성 (Bovine rota virus, Bovine corona virus) 설사원인체동시인공감염실시 ( 나 ) 임상증상및원인체검출 2. 2차년도가. SoltoB의설사유발세균에대한 SoltoB의흡착효과를확인 (1) 송아지설사유발세균성병원체에대한 SoltoB의흡착력과성장억제력평가 나. 송아지에서세균성및바이러스성호흡기질병에대한 SoltoB의방어효과 (1) 송아지에세균성및바이러스성호흡기질병원인체동시인공감염후, 임상증상및분변내인공감염원인체분리정도평가 ( 가 ) 세균성 (Mannheimia haemolytica serotype A1, Pasteurella multocida type A) 및바이러스성 (Bovine herpesvirus 1) 설사원인체동시인공감염실시 ( 나 ) 임상증상및원인체검출 Ⅳ. 연구개발결과 1. 1차년도가. SoltoB의면역기능증강효과를규명 (1) Splenocyte에 SoltoB을처리한시, TNF-α의유도확인 나. 송아지에서세균성및바이러스성설사에대한 SoltoB의방어효과를확인 (1) 설사원인체에의한폐사율의감소 (2) 설사임상증상의완화 (3) 세균성 (Escherichia coli, Salmonella Typhimurium) 및바이러 - 3 -
5 스성 (Bovine rota virus, Bovine corona virus) 설사원인체에대한청소율증가 (3) 부검소견완화 (4) 조직학적소견완화 2. 2 차년도 가. SoltoB 의설사유발세균에대한 SoltoB 의흡착효과를확인 (1) 균성장억제력시험에서는 S. derby, S. Typhimurium 09-2b 와 E. coli 에서 SoltoB 처리에의해서대조군에비해균성장이억 제되는것을확인 나. 송아지에서세균성및바이러스성호흡기질병에대한 SoltoB의방어효과 (1) 세균성 (Mannheimia haemolytica serotype A1, Pasteurella multocida type A) 및바이러스성 (Bovine herpesvirus 1) 호흡기질병원인체에대한청소율증가 (2) 호흡기임상증상의완화 (3) 부검소견완화 (4) 조직학적소견완화 Ⅴ. 연구성과및성과활용계획 본연구를통해 SoltoB의면역강화기능에의하여송아지의소화기질병과호흡기질병에대한효과가입증되면송아지설사와호흡기전용사료첨가제로제품화하여판매할계획임. SoltoB는이미세계여러나라에수출되고있지만송아지의호흡기와소화기질병에효과를입증하게된다면더많은국가에더많은양을수출하여국가경제에공헌할것임. SoltoB에의해송아지의호흡기와소화기질병을예방할수있게되어이에따른인력및경비절감으로축산농가에막대한생산성향상을추구할수있음
6 SUMMARY I. Title Efficacy of SoltoB against respiratory and intestinal disease in calves II. Objectives and Requirements of Research and Development Bovine respiratory and diarrhea diseases, caused by bacteria and virus, are major economic problems in the cattle industry in Korea. These disease occur mainly relevance to immunosuppression. SoltoB, known as immune stimulator, could be used as feed supplement for controling these disease. However, SoltoB has not been studied for its prophylactic effect against bovine respiratory and diarrhea diseases when it is used as a feed supplement. In this study, the first analysis of the prophylactic effects of SoltoB against bovine respiratory and diarrhea diseases in experimentally infected calves were conducted. III. Reserch coverage and scopes 1. The first year A. Immunostimulating effects of SoltoB (1) Analysis of immunostimulating effects of SoltoB through mouse splenocyte primary culture B. Prophylactic effects of SoltoB against bacterial/viral diarrhea pathogens in calves - 5 -
7 (1) The pathogen analysis of bacterial diarrhea of calves in Korea and Selection of challenging bacterial pathogens for experimentally infecting calves and establishment of infection model of calves (A)The pathogen analysis of bacterial diarrhea of calves in Korea (B)Selection of challenging bacterial pathogens for experimentally infecting calves (2) Establishment of detecting method of viral diarrhea pathogens in calves (3) Following co-infection of bacterial/viral pathogens, monitoring of clinical signs and quantification of challenging bacterial/viral pathogens in calves (A)Co-infection of bacterial (Escherichia coli, Salmonella Typhimurium) and viral (Bovine rota virus, Bovine corona virus) pathogens (B)Monitoring of clinical signs and the quantification of shedding diarrhea pathogens in experimental co-infected calves 2. The second year A. Absorption efficacy of SoltoB against bacterial diarrhea pathogens (1) Analysis of efficacy of SoltoB as bacterial diarrhea pathogens absorbent and growth inhibitor - 6 -
8 B. Prophylactic effects of SoltoB against bacterial/viral respiratory pathogens in calves (1) Following co-infection of bacterial/viral pathogens, monitoring of clinical signs and quantification of challenging bacterial/viral pathogens in calves (A)Co-infection of bacterial (Mannheimia haemolytica serotype A1, Pasteurella multocida type A) and viral (Bovine herpesvirus 1) pathogens (B)Monitoring of clinical signs and the quantification of shedding respiratory pathogens in experimental co-infected calves Ⅳ. Results of Research and Development 1. The first year A. Immunostimulating effects of SoltoB (1) TNF-α expression in mouse splenocytes following stimulation of SoltoB significantly increased compared with the non-treatment group. B. Prophylactic effects of SoltoB against bacterial/viral diarrhea pathogens in calves (1) SoltoB decreases mortality in calves experimentally co-infected with diarrhea pathogens (2) SoltoB alleviates diarrhea symptom in calves experimentally co-infected with diarrhea pathogens (3) SoltoB enhances the clearance against bacterial (Escherichia coli, Salmonella Typhimurium) and viral (Bovine rota virus, Bovine corona virus) pathogens in calves experimentally - 7 -
9 co-infected with diarrhea pathogens 2. The second year A. Absorption efficacy of SoltoB against viral and bacterial diarrhea pathogens (1) SoltoB inhibits growth of S. derby, S. Typhimurium 09-2b and E. coli B. Prophylactic effects of SoltoB against bacterial/viral respiratory pathogens in calves (1) Solto B alleviates respiratory symptom in calves experimentally co-infected with respiratory pathogens (2) SoltoB enhances the clearance against (Mannheimia haemolytica serotype A1, Pasteurella multocida type A) and viral (Bovine herpesvirus 1) pathogens in calves experimentally co-infected with respiratory pathogens (3) Mild gross lesions was evident in the SoltoB-fed group compared with the control group (4) Mild histopathological lesions was evident in the SoltoB-fed group compared with the control group V. Research Performance and Plan of Research Performance use Commercializaion and sale of SoltoB as feed supplement for controling calf diarrhea and respiratory diseases caused by bacteria and virus An increase of SoltoB exportation and contribution to the national economy An increase of productivity in livestock farm through reduction of - 8 -
10 CONTENTS Chapter 1. Introduction 14 Section 1. The necessity of Research Project 14 Chapter 2. Result of Research Project 18 Section 1. Result of Research Project at the First Year 18 Section 1. Result of Research Project at the Second Year 55 Chapter 3. Goal Achievement and Contribution in This Field 79 Section 1. Goal achievement 79 Section 2. Contribution in this field 80 Chapter 4. Research Performance and Plan of Research Performance use 81 Section 1. Development and industrialization 81 Section 2. Use plan on further study 81 Chapter 5. References
11 목 차 제 1 장연구개발과제의개요 14 제 1 절연구의필요성 14 제 2 장연구개발수행내용및결과 18 제 1 절 1 차년도연구개발수행내용및결과 18 제 2 절 2 차년도연구개발수행내용및결과 55 제 3 장목표달성도및관련분야에의기여도 79 제 1 절연구개발목표달성도 79 제 2 절관련분야에의기여도 80 제 4 장연구개발성과및성과활용계획 81 제 1 절산업화계획 81 제 2 절추가연구, 타연구에활용계획 81 제 5 장참고문헌
12 제 1 장연구개발과제의개요 제 1 절연구의필요성 최근축산업은국민소득증가와식생활의서구화로비약적인성장을하여우리농업에매우중요한부문으로자리잡고있음. 하지만최근가축전염병이빈번히발생하여큰문제가되고있으며, 국제교역이점차증대되고밀집사육이보편화됨에따라우리나라에도가축질병의발생빈도가점차늘어나는추세임. 가축질병으로인한경제적손실을축산물생산액의약 20% 라고가정할경우그액수는 2조원에육박할정도이므로가축질병이경제에미치는양향은매우큼. 소산업은그동안비약적인발전을하였으며, 사양방식도예전의영세성에서현재대단위집단사육화되고있음. 하지만대단위집약사육에서문제점은악성전염병이발생하면농장전체에걸쳐만연화되어막대한경제적피해가발생한다는것임. 따라서개방화시대에서우리축산업이살아남기위해서는소의전염성질병을근절시킴으로써생산능력을향상시켜야함. 송아지의주요질병에관한국립수의과학검역원조사자료에의하면송아지 사육에있어가장치명적인질병은설사병과호흡기병으로송아지에서 발병하는질병의대부분을차지함 (Figure 1). Figure 1. Major diseases of calves
13 소의경우에 2005년기준한육우및젖소총생산액은각각 3조 1,479억원과 1조 5,831억원이었으며, 설사를유발한신생송아지의 15-30% 가폐사하였음. 폐사로인한직접적인손실액은 2,760억원으로추정되고있음 (Table1). Table 1. Economic loss by death of calves with diarrhea 구분피해액산출근거 바이러스성설사 1,680 억 100 만두 70% 발생 12% 폐사 200 만원 =1,680 억 세균성설사 1,080 억 100 만두 30% 발생 18% 폐사 200 만원 =1,080 억 합계 2,760 억 ( 가축질병의경제적영향분석, 2006 년, 한국농촌경제연구원 ) 국내에서송아지설사가크게문제되고있어서막대한경제적피해를유발하고있다고보고되었음. 설사병은송아지의체액상실로인한치명적인질병이며폐사의주원인이되며회복되어도성장장애등을일으켜경제적손실이큰질병임. 국내송아지사육농가대부분에서송아지장염이발생하고있으며, 더욱이송아지폐사의 70% 가세균성과바이러스성장염에의한다고함. 이러한송아지장염의주요원인체로세균성으로는대장균증및살모넬라증그리고바이러스성으로는소코로나바이러스와로타바이러스등이알려져있음. 어린송아지는체온조절중추가아직완전하게발달하지않았기때문에외부온도에대한방어기전이미흡하여소화기전이위축되어설사증을쉽게유발함. 송아지때설사가발생하면면역에관계되는흉선 (Thymus) 이위축되고싸이토카인 (Cytokine) 의방출이증가되어체력이약화되고면역력이떨어져호흡기발병율이높아지고, 성장율도현저하게저하됨. 신생송아지에있어서대장균과로타및코로나바이러스설사병이주로 문제가됨. 로타바이러스와코로나바이러스는소장의융모위축을통한 소화불량및흡수부전으로설사가발생됨. 대장균, 살모넬라설사증은이들 균주에서생산되는내독소에의해서전해질이과다분비하게되어설사가
14 발생됨. 송아지설사의원인체중단독감염과복합감염시의폐사율을보면, 로타바이러스와코로나바이러스함께대장균이감염되면 90% 이상폐사를 보임 (Table2) Table 2. Single or complex infection of calves diarrhea pathogens 단독감염 복합감염 (2개) 복합감염 (3개) 폐사율 (%) 폐사율 (%) 폐사율 (%) 로타바이러스 5 로타 + 로타 + 코로 55 대장균나 + 대장균 90 코로나바이러로타 + 로타 + 코로 스코로나나 +IBR 85 대장균 50 코로나 + 대장균 80 ( 미국수의사회지 Vol. 173 No. 5) 신생송아지에있어서호흡기질병은세균성인 Pasreurella multocida와 Mannheimia haemolytica와소의허피스바이러스에의한전염성비기관염 (IBR) 이가장중요한원인체임. 송아지에서폐렴이발생하는이유는여러복합적인원인에의해면역력이감소하게되면호흡기내에정상적으로서식하고있던파스튜렐라와같은세균이급격하게증식하면서폐렴이발생하게됨. 이렇게증식된세균에의해서기관지점막이파괴되고면역력이감소하게되면호흡기바이러스 (IBR 바이러스 ) 가점막에부착하여증시하면서심각한폐렴증상이발생하게됨. 상술한바와같이송아지의설사증과호흡기질병은국내에서아주중요한질병이며, 향후뚜렷한대책이없는한더욱기승을부릴것으로예상됨. 특히어린연령에서다발하고있는설사증과호흡기질병은 1) 증체율과면역기능을저하시켜, 2) 결국이유후에도충분한면역기능이형성되지않아, 3) 지속적으로전염성질환에감염되는악순환을유발케됨
15 문제는이러한바이러스성설사증과호흡기증의경우발생하면특별한치료제가없어수액공급과항생제투여가일반적인치료법임. 설사치료제로대부분사용되는항생제는세균에는효과를발휘하지만, 바이러스에는효과를나타내지못함. 뿐만아니라, 근래에들어사료첨가제로항생제의사용이그부작용에의해꺼려지고있어, 현실적으로항생제의사료첨가제로서의사용또한한계가있음. 치료목적으로써의항생제의사용또한내성균의발생이나 3일이상의장기간사용시신 ( 腎 ) 부전과같은부작용을불러올수있음. 바이러스성설사와호흡기질병발생시원인적치료법이없이대증치료법에의존하여결국폐사가일어나고있음. 바이러스질병치료법은동물이스스로바이러스와싸워이길수있도록면역력을항진시켜주는것이최선의방법임. 그러한측면에서면역증강효과가있는 SoltoB는아주효과적인송아지설사치료제로사용할수있도록연구가필요함. 가축에서소화기계질병을야기는원인체의주요감염경로는경구감염으로사료나음수를통한감염이됨. 이러한이유로오래전부터점토광물 (clay mineral) 을사료첨가제로혼합하여병원균을흡착시켜배출시킴으로써감염을억제하기위한시도들이행해지고있음. 따라서 SoltoB는주로면역증강효과가있지만부수적으로병원균의흡착효과를확인할필요가있음. 최근전세계적으로가축의성장촉진 (GPAs : Growth-promoting antibiotics) 용항생제사용을금지하는규제가강화되면서그대안으로천연물질을이용한면역증강효과를규명하는다양한연구가진행되고있음. 면역증강기능이있는 SoltoB를사료에첨가하여급여함으로써동물체내에서여러면역세포들의면역기능이강화된다면송아지설사와호흡기질병에대한저항력을증강시킬수있을것임. 하지만 SoltB를급여하여송아지설사와호흡기질병에대한연구는전무한실정임. 따라서본연구에서는 SoltoB를사료첨가제로사용하여송아지설사와호흡기질병예방효과를입증하고자함
16 제 2 장연구개발수행내용및결과 제 1 절 1 차년도연구개발수행내용및결과 가. SoltoB 의면역증강효과규명 (1). 마우스 splenocyte에서 SoltoB에의한 cytokine 생성면역세포에서 SoltoB에의한 cytokine 생성을측정하여 SoltoB의면역세포자극효과를규명하기위해 5주령의마우스의비장을적출한후, homogenizer로분쇄하고 RBC lysis buffer를처리하여적혈구를제거하였다. L-glutamine이포함된 RPMI 1640배지 (10% FBS, penicillin (50 U/ml) and streptomycin (50 g/ml)) 에비장에서유리된 splenocyte를부유한후 cell수를 cell/ml로희석하고, 6 well plate의각 well에 2ml씩분주하였다. 위에준비된 splenocyte에 SoltoB (0.1mg/ml) 을첨가하고, positive control 군으로 E. coli LPS (0.1mg/ml) 를처리하였다. 12시간별로각그룹당 3 well씩세포배양액을수거하고 4 C, rpm에서 10분간원심분리하여, 수거된세포배양상층액을이용, mouse IL-1β, IL-6, TNF-α (ebioscience) 에대한 ELISA를각각수행하였다. Figure 2에서처럼 SotoB는면역세포를자극하여 TNF-a 는유도되었으나, IL-1b 와 IL-6 는유도되지않았다. 이를통해 SoltoB가면역세포에직접적으로노출되었을경우면역세포를활성화하여염증반응을유도하고세포성면역을유도하는 TNF-a를분비를촉진시키는효과가있음을확인할수있었다 (Figure 2)
17 Figure 2. Cytokine expression in mouse splenocytes following stimulation of SoltoB. TNF-α expression significantly increased compared with the non-treatment group from 24 hr (**p < 0.01, non-treatment group vs. SoltoB stimulation). There are no differences in expressions of IL-6 and IL-1b between non-treatment and SoltoB groups
18 (2). SoltoB 급여후마우스 splenocyte에서 cytokine 생성 3주령의마우스를두개의실험군으로나누어 8주간대조군은일반마우스용사료를제공하고, SoltoB 섭취군은사료내 0.5% (w/w) SoltoB를첨가하여자유급식의형태로제공하였다. 이후각마우스의비장을채취하여마우스 splenocyte 배양하였다. 마우스 splenoctye의배양방법은상기에언급된바와같은방법으로실시하였다. 배양된 splenocyte에각각저농도의 LPS (1ug/mL) 를처리하여, 일정시간간격으로세포배양상층액을수거해 IL-6 ( 점막면역관련 cytokine) 의생성정도를확인하였다. LPS 처리시 control 군에서는 IL-6의생성이 ELISA에의해관찰되지않았으나 SoltoB 첨가군의마우스비장세포에서는 IL-6의생성이확인되었다. (Figure 3) 이를통해 SoltoB의경구투여를통해면역계를일부자극할수있음을확인할수있었다. Figure 3. IL-6 expression in splenocytes of SoltoB primed mouse by oral rout. splenocytes. The high expression level of IL-6 is observed in the SoltoB primed mouse group, compared with the control group
19 나. 송아지세균성및바이러스성설사에대한 SoltoB 의방어효과 (1) 국내송아지세균성설사원인체분석및인공감염을위한균주선발 ( 가 ) 국내송아지유래대장균의성상및주요병원성인자분석 1) 야외송아지가검물로부터대장균분리동정및항생제감수성검사가대장균분리동정현황야외송아지설사가검물로부터 MacConkey 및 EMB 배지에서의특이적인집락형성등배양성상, IMViC 및 VITEK 등을통하여대장균총 118개주를분리동정하였으며, 분리균주중 26개주에서용혈성이확인하였다. 나항생제감수성검사용혈성이파악된균주를위주로하여총 22개의균주를대상으로일반적으로많이상용화되어있는항생제에대한감수성검사를실시하였다. 항생제에대한감수성판정은감수성반응이 Intermediate 이상일경우실험한항생제에대한감수성이있다고판정하였다. 항생제감수성검사에서사용한항생제디스크종류와농도, 각항생제에대한저항성을나타낸균주의수를조사하였다 (Table 3, Table 4). 국내설사송아지분변에서분리된대장균의경우 Penicillin에대한저항성이높았으며 Amikacin( 광범위항생제 ) 이나 Norfloxacin에대한저항성은높지않은것을확인할수있었다. 다야외송아지설사가검물로부터바이러스성원인체검색송아지설사가검물에대하여바이러스성원인체의혼합감염여부를조사하기위하여추가적으로바이러스성설사유발원인체인 Coronavirus를 PCR을통해검색을실시하였다 (Table 5). Positive control로시중에판매되는 live vaccine주를이용하였으며가검샘플은분변을 PBS에충분히부유한뒤원심으로분변의이물질을제거한상층액을이용하였다. 대장균을분리한송아지에서는모두
20 coronavirus 음성의결과가나와송아지설사분변에 Coronavirus 혼 합감염되어있지는않은것을확인하였다 (Figure 4). Table 3. Kinds of antibiotic disc and its concentration. Ampicillin (10μg) Amikacin (30μg) Colistin (10μg) Erythromycin (15μg) Gentamycin (10μg) Kanamycin (30μg) Neomycin (30μg) Nalidixic acid (30μg) Norfloxacin (10μg) Penicillin (10 IU/IE/UI) Chloramphenicol (30μg) Sulfamethoxazole/Trimethoprim (23.75μg / 1.25μg ) Bacitracin (10 IU/IE/UI) Tetracyclin (30μg) Table 4. The number of antibiotic resistant E.coli. Antibiotics Quantity Antibiotics Quantity Ampicillin 17 Nalidixic acid 15 Amikacin 3 Norfloxacin 9 Colistin 12 Penicillin 19 Erythromycin 18 Chloramphenicol 10 Gentamycin 13 Sulfamethoxazole /Trimethoprim 14 Kanamycin 15 Bacitracin 17 Neomycin 11 Tetracyclin
21 Table 5. Corona virus detection condition Primer Sequence Product size Primer fwd Primer rev 5'-GCAATCCAGTAGTAGAGCGT-3' 5'-CTTAGTGGCATCCTTGCCAA-3' 730bp Synthesis of cdna RNA sample 10μl 70 5min 100pmole R-primer 2μl 4 10mi DW 4μl n 5X RT buffer 4μl M DTT 2μl 5min 10mM dntps 2μl 42 60mi n 20unit RNase 0.5μl 70 10mi Inhibitor n 200unit M-MLV 1μl DEPC min μl Sample 10X PCR buffer 10mM dntps PCR condition 5μl 5μl 2μl 94 1min 94 5min 100mM F-primer 1 μl 58 1min 35 cycles 100mM R-primer 5unit/ μl Tag DW Total vol. 1μl 0.5μl 35.5μl 50μl 72 2min 72 7min
22 Figure 4. PCR results of corona virus detection (P: positive control; N: negative control) 라야외분리대장균에서병원성인자검색 송아지의설사를유발할수있는대장균에서의병원성인자분포를분 석하기위하여기발표된논문등자료를바탕으로병원성대장균중하 나인 enterotoxigenic Escherichia coli (ETEC) 에서 fimbrial adhesin 과 enterotoxin 의분포를조사하였다. Fimbrial adhesins : ETEC 의병원성인자로 ETEC 가소장의상 피세포내의미세융모에부착하고점막상피에서증식을하는데중요한역할을하며알려진것으로 F4 (K88), F5 (K99), F6 (987P), F18, F41 가있음. Enterotoxin : ETEC 의또다른병원성인자로일반적으로 heat-stable(sta, STb) 와 heat-labile(lt) 로나뉘며 shinga toxigenic E. coli (STEC) 의 STX2e, enteroaggregative E. coli (EAEC) 의 enteroaggregatie E. coli heat-stable enterotixin 1 (EAST1) 도병원성인자로알려져있음. 송아지분리대장균에서밝혀진병원성인자및진단법 - 여러대장균의병원성인자중현재까지송아지에서문제시되며, 송아지분리대장균에서밝혀진병원성인자로는 Table 6 과같음
23 - 현재가장널리사용되는병원성인자확인방법은각병원성인자를발현하는유전자를 PCR을통해확인하는것이며, 각병원성인자의유전자를확인하는데가장적합한 PCR 조건은 Table6와같음. Table 6. PCR detection condition of virulence factor of E.coli. Target genes F5 F41 STa Oligonucleotide sequences (5`-3`) TTGGGCAGGCTGCTATTAGT TAGCACCACCAGACCCATTT GGAGCGGGTCATATTGGTAA CTGCAGAAACACCAGATCCA GAAACAACATGACGGGAGGT GCACAGGCAGGATTACAACA Product size 222 bp 941 bp 229 bp PCR condition of F5 and F41 Sample 2μl 94 10min 10X PCR buffer 5μl 95 10mM dntps 1μl 30sec 20pmole F-primer 1μl 61 30sec 20pmole R-primer 1μl 72 5unit/ μl Tag DW Total vol. 1μl 39μl 50μl PCR condition of Enterotoxin (Sta) 30sec 72 10min 4 Sample 2 μl 94 10min 35 cycles 10X PCR buffer 10mM dntps 20pmole F-primer 20pmole R-primer 5unit/ μl Tag DW Total vol. 5μl 1μl 1μl 1μl 1μl 39μl 50μl 95 30sec cycles 30sec 72 30sec 72 10min
24 (2) 송아지바이러스성설사원인체검출기법확립 ( 가 ) Bovine rotavirus 1) 접종실험하기위한소로타바이러스배양액확보가 Bovine rotavirus : Reoviridae에속하며, 심각한설사를동반하는송아지급성장염의주요원인체이다. 외피를갖지않는분절형 RNA virus로주요항원으로캡시드외단백질인 VP4와 VP7, 캡시드내단백질인 VP6 등이있다. 본연구에서는야외분리주 (NCDV) 를사용하였다. 나로타바이러스배양은 TF-104 (African green monkey kidney cell) 에 trypsin 을처리한후배양하여사용함. TF-104 cell 을 10% (v/v) FBS (Fetal Bovine Serum) 와 1% (v/v) antibiotics 가첨가되어있는 alpha-mem 배지를이용하여 monolayer 로배양하였음. Bovine Rotavirus (BRV) 는 10ul/ml 농도의 trypsin 으로세포에접종 전에 30 분간감작시킨다. Trypsin 에미리감작된 BRV 를 0.1 MOI 로 Monolayer confluent 로 성장한 TF-104 에접종한다. 1 시간동안 37 o C, 5% CO 2 의조건에서배양하며 10 분간격으로 rocking 을실시한다. 1ul/ml 농도의 trypsin 과 1% (v/v) antibiotics 가함유된 alpha-mem 배지를첨가하고 37 o C, 5% CO 2 의조건으로배양하여 virus 를증식시 킨다. 다바이러스농도를 1X 10 8 PFU/ml 이상되도록배양하여총 2L 의 배양액확보 2) Plaque assay 법확립 가송아지에 rotavirus 를인공감염시킨후분비되는바이러스수를
25 조사하기위하여 plaque assay 법을확립하였음 TF-104 를 24 well tissue culture plate 에배양한다. Alpha-MEM 배지로각 well 을 washing 한후, 1ul/ml 농도의 trypsin 과 1% (v/v) antibiotics 가함유된 alpha-mem 배지를이용해 10-fold serial dilution 한 BRV 를 0.1ml 씩을각 well 에접종한다. 1 시간동안 37, 5% CO 2 에서배양하며, 10 분간격으로 rocking 해준다. Virus 접종액을제거하고, 1ug/ml trypsin 과 0.003% Netral red 가함유된 alpha-mem 배지에 0.8% (v/w) Sea-plaque agar 를첨 가한용액을 virus 를흡착시킨세포위에올려놓고 7, 5% CO 2 에서 3~4 일간배양한다. 3~4 일후, 투명하게나타난 BRV plaque 의수를개수하고단위를 pfu (plaque form unit)/ml 로나타낸다. 나 plaque assay 법의적용실험을위해서송아지분변에 로타바이러스를혼합한후 항생제함유배지에희석하고원심 분리하여상층액을 plaque assay 에사용하여분변으로분비되는 바이러스양을측정하였음. 3) Real-time PCR법확립가분변에서분비되는바이러스농도측정을위해서 Real-time PCR법을확립 Plasmid DNA standard 구성 - BRV로부터 viral RNA 추출이후, 아래 primer set으로 PCR 증폭을실시하였다. Rotavirus fwd: 5'-TTTAAAACGAAGTCTTCRACATGGAKGTYCTGTA-3' Rotavirus rev: 5'-TAATTGGTAGATTACCAATTCCTCCAGTTTG-3'
26 Amplicon length: 189bps - 증폭된 PCR product를 pgem-t easy vector에 TA cloning을실시하여삽입하였다. - 재구성된 plasmid를 copies으로 10-fold dilution하여 real-time PCR의 standard로사용하였다. Real-time PCR amplification - 분변시료에서분리해낸 viral RNA를이용하여 Real-time PCR을실시한다. - primer와 probe의 sequence는다음과같다. Rotavirus fwd1: 5'-GGATGTCCTGTACTCCTTGTCAAAA-3' Rotavirus fwd2: 5'-GGAGGTTCTGTACTCATTGTCAAAAA-3' Rotavirus rev1: 5'-TCCAGTTTGGAACTCATTTCCA-3' Rotavirus rev2: 5'-TCCAGTTTGAAAGTCATTTCCATT-3' Rotavirus probe1 (VIC): 5'-ATAATGTGCCTTCGACAAT-3' Rotavirus probe2 (VIC): 5'-AATATAATGTACCTTCAACAAT-3' - Real-time PCR thermal cycling conditionn은다음과같다. : 2min at 50 o C, 10min at 95 o C, and 40 cycles of 15s at 95 o C and 1min at 60 o C 나분변에서 RNA를추출하여 real-time PCR을이용하여분변에서분비되는바이러스양을측정함
27 ( 나 ) Bovine Coronavirus 1) 접종실험하기위한소코로나바이러스배양액확보가 Bovine coronavirus : Coronaviridae에속하며, 신생송아지의설사, 성우의겨울철적리 (Winter dysentery) 등의원인체이다. 외피를갖는비분절형 RNA virus로주요항원으로는 nucleocapsid (N) protein, transmembrane (M) protein, hemagglutinin/esterase (HE) protein, spike (S) protein, small membrane (E) protein 등이있다. 본연구에서는야외분리주 (KWD4) 를사용하였다. 나코로나바이러스배양은 HRT-18G (Human rectal tumor cell) 에 pancreatin 을처리한후배양하여사용함 HRT-18G (Human rectal tumor cell) 를 DMEM (10% FBS, 1% Antibiotics) 을사용하여 37, 5% CO 2 에서배양한다. Bovine Coronavirus (BCV) 를 DMEM (1% Antibiotics) 으로 희석하여 0.1 MOI로 HRT-18G monolayer에접종한다. 1시간동안 37, 5% CO 2 에서배양하며, 15분간격으로 rocking 해준다. DMEM (5ug/ml Pancreatin, 1% Antibiotics) 를첨가하고 37, 5% CO 2 에서배양하여 virus를증식시킨다. 다코로나바이러스농도를 1X 10 8 PFU/ml 이상되도록배양하여총 2L 의배양액확보 2) Plaque assay 법확립가송아지에코로나바이러스를인공감염시킨후분비되는바이러스수를조사하기위한 plaque assay 법확립 HRT-18G를 24 well tissue culture plate에배양한다
28 각well을 DMEM으로 washing 한후, DMEM (1% Antibiotics) 으로계단희석된 BCV를 0.1ml씩접종한다. 1시간동안 37, 5% CO 2 에서배양하며, 10분간격으로 rocking해준다. 1시간후, DMEM (0.6% agar, 5ug/ml Pancreatin, 1% Antibiotics) 1ml를첨가한다. 37, 5% CO 2 에서 3~4일간배양한후, 10% Formalin으로고정한다. 1% Crystal violet으로염색하여 plaque 수를개수하고단위를 pfu (plaque form unit)/ml로나타낸다. 나송아지분변에코로나바이러스를혼합하여 palque assay 법을적용실험다항생제함유배지에희석하여원심분리후에상층액을 plaque assay에사용하여분변으로분비되는바이러스양을측정함. 3) Real-time PCR법확립가분변에서분비되는코로나바이러스농도측정을위해서 real-time PCR을확립 Plasmid DNA standard 구성 - BCV로부터 viral RNA 추출이후, 아래 primer set으로 PCR 증폭을실시하였다 - BCV 28380F :5'-TCTTAGCTGTTGACTTTATTACCTGG-3' - BCV 29298R :5'-ACATAAACAGCAAAACCACTAGTATCGCC-3' - Amplicon length: 919bps - 증폭된 PCR product를 pgem-t easy vector에 TA cloning을실시하여삽입하였다
29 - 재구성된 plasmid 를 copies 으로 10-fold dilution 하여 real-time PCR 의 standard 로사용하였다. Real-time PCR amplification - 분변시료에서 viral RNA를분리해낸후 cdna로합성하였으며, 이를이용하여 Real-time PCR을실시한다. - primer와 probe의 sequence는다음과같다. - BCoV-F: 5'-CTGGAAGTTGGTGGAGTT-3' - BCoV-R: 5'-ATTATCGGCCTAACATACATC-3' - BCoV-pb : FAM-CCTTCATATCTATACACATCAAGTTGTT-BHQ1 - Real-time PCR thermal cycling conditionn은다음과같다. : 10min at 95 o C, and 45 cycles of 15s at 95 o C and 1min at 60 o C 나분변에서 RNA 를추출하여 real-time PCR 을이용하여분변에서 분비되는코로나바이러스양을측정함. (3). 송아지에세균성및바이러스성설사원인체동시인공감염후, 임상 증상및폐사율확인 ( 가 ) 실험동물및실험군분류 3개월령국내사육 holstein 송아지 6두를공시동물 (Figure 5) 로하여공격접종실험전설사에관련된임상증상과분변내정상세균총외병원성 E.coli 및 Salmonella가동정되지않음을확인하였다 (Figure 6). 또한 real-time PCR을통해 rotavirus 및 coronavirus 음성을확인하였다. 각각의공시동물은 3마리씩분류하여무처치대조군과 SoltoB 첨가군으로분류하였으며, 각군은격리되어상호감염을
30 예방하였다. 추가적으로 Salmonella의경우증균과정을통해장내 Salmonella 감염을 2차적으로확인하였고실험에사용된총 5마리의송아지는모두음성판정을받았다 (Figure 7). 증균을통해서 Salmonella가동정된송아지는설사관련증상이관찰되지않았고, 분변직접도말시 Salmonella가동정되지않았으므로실험을진행하였다. 본공격접종실험은전남대학교용봉캠퍼서동물실험윤리위원회의승인을얻어실시함 ( 승인번호 : CNU IACUC-YB ). ( 나 ) 실험군의사료급여 대조군 (3 두 ) 및 SoltoB 첨가군 (3 두 ) 는모두사료및음수에접근 이자유롭도록사육시설을설비하였으며, 대조군의경우항생제가포함 되지않은일반사료와수도수를 실험전 ( 全 ) 기간동안자유급여하였 으며, SoltoB 첨가군은 0.5% (w/w) SoltoB를첨가한사료와수도수를실험전 ( 全 ) 기간동안자유급여하였다. 대조군과 SoltoB 첨가군은각군의사료에 1주일간적응기간을거치고인공감염실험실시하였다. Figure 5. 실험군의분류. (A) 대조군 3 마리, (B) SoltoB 첨가군 3 마리
31 Figure 6. Normal flora in calves intestine before challenge. MacConkey agar used in this figure did not contain kanamycin. (A)-(C): control group; (D)-(F): SoltoB group. Figure 7. The morphology of Salmonella Typhimurium on XLD agar following enrichment of Salmonella. Black colony indicate Salmonella spp on XLD agar. There are no black colony on XLD agar. (A)-(C): control group; (D)-(F): SoltoB group
32 ( 다 ) 공격접종세균및바이러스 ( 세균동시공격접종 ) Bovine Rotavirus (1X10 8 pfu/ml): 100ml Bovine Coronavirus (1X10 8 pfu/ml): 50ml Salmonella typhimurium 09-2b (3x10 10 CFU/ml): 100ml Escherichia coli (5x10 10 CFU/ml): 100ml 우유에혼합하여경구투여 접종경로 : 4가지병원체동시구강접종 (Figure 8) Figure 8. 공시동물에대한경구투여. 투여물질은우유와혼합하여투여. ( 라 ) SoltoB의세균성설사방어효과확인 1 임상증상및생존율 (Figure 9, Figure 10) 대조군의송아지에서는공격접종 1일이후부터심한설사증상유발되었으며공격접종 1일이후부터폐사발생하였다 (2일째추가로 2두폐사 ). SoltoB 첨가군의송아지에서는대조군에비해가벼운설사가관찰되었으며 SoltoB 첨가군의송아지에서는대조군에비해완만한폐사율을보였다. SoltoB 첨가군의송아지중한마리는공격접종 8일째에시행한부검때까지생존하였다
33 Figure 9. After three day challenge, calf deaths was observed in contorl group. (A)-(D) Contorl No.2 and 3 Figure 10. Survival present situation of calves after challenge. Day of 0 indicates challenge day. SoltoB group shows high survival rate compared with control group
34 2 분변내공격접종균주변화인공감염직전 (0일째) 의분변에서확인된 E.coli의수는비슷하였으나인공감염후송아지분변내 E.coli 수는급속히증가하였다 (Figure 11). 감염직후증가정도는무처치군과 SoltoB 첨가군사이에서큰차이점이없어 SoltoB의초기감염예방효과는확인할수없었으며, 인공감염시킨후 3일째되는날에분변내 E.coli 수가가장높게나타났다, 이때의분변내 E.coli 수역시무처치군과 SoltoB 첨가군사이에서큰차이점을확인할수없었다. 인공감염이후 4일째되는날부터분변내 E.coli 수는감수하기시작하였으며, 부검을시행한 6일째까지생존한 SoltoB 첨가군3의개체에서는인공감염직후증가한균수만큼을회복하였다. Salmonella 인공감염을실시하기전송아지의단계희석한분변에서는 Salmonella 형상의집락이전혀관찰되지않았으나감염직후분변에서 Salmonella의수가급속히증가하였다 (Figure 12, Figure 13). 초기감염후증가정도는무처치군과 SoltoB 첨가군사이에서큰차이를관찰하기힘들었으며, 3~4일뒤에분변내 Salmonella의수가가장많이발견되었는데, 이때에도무처치군과 SoltoB 첨가군사이에서의차이는확인할수없었다. 부검시까지생존한 SoltoB 첨가군 3의경우 3일째부터분변내 Salmonella의수가감소하기시작하여부검시까지지속적으로분변내 Salmonella의수가감소하였다. E.coli와 Salmonella 인공감염실험에서분변내인공감염시킨균주의분리정도는대조군이모두공격접종후 2일째폐사하여두실험군사이에서큰차이점을확인할수없었다. SoltoB 첨가군의생존율이대조군에비해높음을확인할수는있었다. 대조군의폐사로분변내인공감염시킨균주의분리정도는초기감염때까지만비교가가능했으며, 초기감염및공격균주의분리정도는대조군과 SoltoB 첨가군사이에서큰차이점을보이지않았지만, 인공감염후방어하는능력은 SoltoB 첨가군이대조군에비해높음을확인할수있었다
35 Figure 11. The change of number of E. coli in experimentally infected calves. No difference is observed between control and SoltoB groups. There were not result of control group at D+4 and D+5, because of calf deaths. Figure 12. The change of number of Salmonella Typhimurium in experimentally infected calves. No difference is observed between control and SoltoB groups. There were not result of control group at D+4 and D+5, because of calf deaths
36 Figure 13. The white colonies are observed on MacConkey agar containg Kanamycin. The white colonies indicate Salmonelly typhimurium. Note that there was no white colony on MacConkey agar at D
37 (4) 송아지에세균성및바이러스성설사원인체동시인공감염후, 임상 증상및분변내인공감염원인체분리정도평가 ( 가 ) 실험동물및실험군분류 ( 고농도투여와같은조건 ) 3개월령국내사육 holstein 송아지 6두를공시동물로하여공격접종실험전설사에관련된임상증상과분변내정상세균총외병원성 E.coli 및 Salmonella가동정되지않음을확인하였다 (Figure 14). 또한 real-time PCR을통해 rotavirus 및 coronavirus 음성을확인하였다. 각각의공시동물은 3마리씩분류하여무처치대조군과 SoltoB 첨가군으로분류하였으며, 각군은격리되어상호감염을예방하였다. 추가적으로 Salmonella의경우증균과정을통해장내 Salmonella 감염을 2차적으로확인하였고실험에사용된총 6마리의송아지는모두음성판정을받았다 (Figure 15). ( 나 ) 실험군의사료급여 대조군 (3 두 ) 및 SoltoB 첨가군 (3 두 ) 는모두사료및음수에접근 이자유롭도록사육시설을설비하였으며, 대조군의경우항생제가포함 되지않은일반사료와수도수를 실험전 ( 全 ) 기간동안자유급여하였 으며, SoltoB 첨가군은 0.5% (w/w) SoltoB를첨가한사료와수도수를실험전 ( 全 ) 기간동안자유급여하였다. 대조군과 SoltoB 첨가군은각군의사료에 1주일간적응기간을거치고인공감염실험실시하였다. 본공격접종실험은전남대학교용봉캠퍼서동물실험윤리위원회의승인을얻어실시함 ( 승인번호 : CNU IACUC-YB )
38 Figure 14. Normal flora in calves intestine before challenge. MacConkey agar used in this figure contains kanamycin. (A)-(B): control group; (C)-(E): SoltoB group. Figure 15. The morphology of Salmonella Typhimurium on XLD agar following enrichment of Salmonella. Black colony indicate Salmonella spp on XLD agar. There are no black colony on XLD agar. (A)-(B): control group; (C)-(E): SoltoB group
39 ( 다 ) 공격접종세균및바이러스 ( 세균동시공격접종 ) Bovine Rotavirus (1X10 8 pfu/ml): 50ml Bovine Coronavirus (1X10 8 pfu/ml): 50ml Salmonella typhimurium 09-2b (8.8x10 8 CFU/ml): 100ml Escherichia coli (3x10 8 CFU/ml): 100ml 우유에혼합하여경구투여 접종경로 : 4가지병원체동시구강접종 (Figure 16) ( 라 ) SoltoB 의세균성설사원인체감염정도및청소율확인 1 임상증상및분변내수분함유량공격접종후모든실험군의송아지에서설사가유발되었으며, 설사의임상증상은다음과같이점수화하였다. - Normal : 1 / mild : 2 / moderate : 3 / Severe : 4 감염직후초기설사정도는 SoltoB군과대조군에서차이가없었으며 (Figure 17, Figure 18) SoltoB 첨가군의경우공격접종후유발된초기설사증상에서더이상증상이악화되지않고지속적으로임상증상이감소되는것을확인할수있었다. 반면대조군의경우공격접종후설사증상이유발되고나서 6 일째까지임상증상이호전되지않다가이후점차적으로호전되는양상을보였다. 공격접종후 12일이지난이후로는 SoltoB 첨가군과대조군모두설사증상을회복하였다. 이를통해 SoltoB 첨가군과대조군사이에서초기설사회복능력정도에서차이를확인할수있었다. 공격접종후두실험군에서분변내수분함유량차이는거의없었으며, (Figure 19) 대조군의설사증상이 6일째까지회복되지않음에따라분변내수분함유량은 SoltoB 첨가군에비해높게관찰되나이후회복됨에따라분변내수분함유량이빠르게감소함을확인할수있었다
40 Figure 16. Rear condition of calves before challenge and oral injection of diarrhea pathogens
41 Figure 17. Monitoring of clinical signs. (A)-(C): Caudal of calves looks dirty because of diarrhea. (D): watery diarrhea Figure 18. Clinical sign score. The SoltoB shows lower score than the control group. There are, however, no significant difference between control and SoltoB groups
42 Figure 19. Water content of feces. The percentage of water content could be indicator of degree of diarrhea. Note correlation with clinical sign score
43 2 분변내공격접종세균및바이러스의변화 ( 청소율, Figure 20) 공격접종한후분변내공격균주의분리정도를조사하여장내청소율을조사하였다. 장내청소율은공격접종전에분리되는 E. coli 의 CFU를기준 (100%) 로하여공격접종후각균주의분리정도를 % 로조사하였다. Salmonella 의경우공격접종전의분변에서분리되지않았으므로분변내에서분리된균수의 CFU를상용로그로변환하여그변화를확인하였다. E. coli 공격접종후 2일이경과한뒤채취한분변내에서공격접종전보다 SoltoB 첨가군의경우 15배, 대조군의경우 5배정도의장내 E. coli 가분리되었다. 대조군과비교시 SoltoB 첨가군의초기감염방어능을확인하기어려웠다. (Figure. 20 (A)) E. coli 의경우 SoltoB 첨가군에서는공격접종 2 일이후에가장많 은균수가분리되고이후지속적으로감소하는경향을확인하였다. 반 면대조군의경우초기감염정도는 SoltoB 첨가군에비해낮지만, 이후 지속적으로 분변내분리되는공격균주가증가하여 6 일째에가장많 은균수가분리되고이후감소하였다. E. coli 인공감염실험을통해 SoltoB가초기감염에대한방어는대조군과큰차이를보이지않으나이후설사유발 E. coli의증식을억제하여설사증상을호전시킴을알수있었다. 대조군의경우초기감염이후지속적으로병원균이증식하여공격접종후 6일째까지높은수의 E. coli가분리되었다. 대조군에서공격접종이후 6일째까지많은수의균이분리되는반면에 SoltoB 첨가군에서는 4일째부터정상적으로회복하였음을알수있다. Salmonella 인공감염실험에서 SoltoB 첨가군은대조군에비해낮은 균수로감염이되었으며, SoltoB 첨가군은공격접종 2 일째부터분변
44 내에서분리되는 Salmonella의수가감소하기시작하였으나, 대조군의경우공격접종 4일뒤부터균수가감소하기시작하였다. 또한공격접종후분리되는균수도 SoltoB의첨가군은대조군에비해낮음을알수있었다. Salmonella 인공감염된송아지는 SoltoB 첨가군과대조군에서모두 6일째되는날부터분변내에서균이분리되지않았다. Figure 20. (A) E. coli infection degree. (B) Change of number of isolated Salmonella Typhimurium in feces. The SoltoB group shows low AUC, compared with the control group
45 이틀간격으로전 ( 全 ) 개체의분변을채취하여 Real-time PCR 을통해 바이러스의분비정도를측정하였다. 바이러스분비정도의결과는 다음그래프와같다 (Figure 21). Figure 21. (A) Bovine Rotavirus 공격접종후바이러스분비정도, (B) Bovine Coronavirus 공격접종후바이러스분비정도
46 Bovine Rotavirus와 Bovine Coronavirus모두 SoltoB 급여군에서대조군에비해감소된경향을보여주었다. 특히 Bovine Coronavirus의경우, 공격접종 4일과 6일째에통계적으로유의성있게바이러스가감소되었다. 이러한결과들을보았을때, 송아지에서 Solto B의급여가 Bovine Rotavirus와 Bovine Coronavirus의제거에큰영향을미치는것으로사료된다. ( 마 ) 조직학적소견대조군의소화기관부검결과. 대조군송아지의부검후 H&E 염색을통해소화기관조직의변화를확인하였다. 대조군의소화기조직학적검사결과공격접종에의한융모의파괴및점막손상이관찰된다 (Figure 22). SoltoB 첨가군의소화기관부검결과. SoltoB 첨가군송아지의부검후 H&E 염색을통해소화기관조직의변화를확인하였다. 대조군의조직염색결과와달리 SoltoB 첨가군은소화기관장점막및융모의손상이관찰되지않는다. 특히맹장과대장에서두드러진방어효과를확인할수있었다 (Figure 23)
47 Control 군소장 Control 군맹장 Control 군대장 Figure 22. 대조군의소화기관부검결과. 대조군송아지의부검후 H&E 염 색을통해소화기관조직의변화를확인하였다. 대조군의소화기조직학적검 사결과공격접종에의한융모의파괴및점막손상이관찰된다
48 SoltoB 군소장 SoltoB 군맹장 SoltoB 군대장 Figure 23. SoltoB 첨가군의소화기관부검결과. SoltoB 첨가군송아지의부검후 H&E 염색을통해소화기관조직의변화를확인하였다. 대조군의조직염색결과와달리 SoltoB 첨가군은소화기관장점막및융모의손상이관찰되지않는다. 특히맹장과대장에서두드러진방어효과를확인할수있었다
49 제 2 절 2 차년도연구개발수행내용및결과 가. 설사유발세균에대한 SoltoB의흡착효과확인 (1) 송아지설사유발세균성병원체에대한 SoltoB의흡착력과성장억제력평가 ( 가 ) 균수측정을위한 O.D. 값과 Colony Forming Unit (CFU) 의상관관계설정설사유발세균에대한흡착력을평가하기앞서본연구수행시필수적인균수측정을위하여 colony forming unit (CFU) 와 600nm에서 O.D. 값을측정하여이들과의상관관계를분석하였다. 설사유발대표적인세균으로송아지설사분변에서분리동정된 Salmonella derby, S. Typhimurium 09-2b, S. Typhimurium 09-51, S. Typhimurium, E. coli 및 hemolytic E. coli 의병원균주를흡착력시험대상균주로선정하여각기의균주들의 CFU와 O.D. 값의상관관계를 Figure 29과같이확립하였다. 실험결과각각의균주는서로다른 CFU와 O.D. 값의상관관계를가지고있음을확인할수있었다. CFU의값은각기균주의배양액을 10진단계희석하여 Tryptic soy agar plate (TSA) 에희석액 50μl씩을접종하고균질도말후 16시간배양된뒤형성된 colony의수를새어희석배수를통해환산하였다 (Figure 24)
50 Figure 24. Correlation of Colony forming unit with O.D
51 ( 나 ) SoltoB 에의한균주의흡착력및성장억제력분석 각실험균주의균수를 CFU/ml 로통일하기위해 Blood agar plate(bap) 에선발균주를도말접종하여 37 C 5% CO 2 incubator에서 18시간배양후, 3 colonies/tsb 21ml로 TSB에접종하여 37 C 350rpm shaking incubator에서 18시간배양하였다. 이후 18시간배양된 TSB을기확립한 CFU와 O.D. 상관관계를이용하여각균주의 CFU를보정하였다. CFU 보정을위한사전실험을바탕으로본실험에서는같은조건으로배양된각균주가접종된 TSB를희석하여 CFU/ml, CFU/ml로 CFU를보정하고균주배양액 1ml 당시험물질로 SoltoB와 Kaolinite ( 양성대조군 ) 를 0.05g씩넣고각각흡착력과성장억제력을평가하였다. Solto B의균흡착력과성장억제력을평가하기위해각실험물질이접종된 TSB를 37 C, 350rpm shaking incubator에서 0시간, 2시간, 4시간, 6시간, 8시간, 10시간동안각각을반응시켰다. 각반응이끝난후 4 C, 1000rpm에서원심분리하여상층액을수거하고 1/10씩단계희석하였다. 단계희석된균주를 MacConkey (E.coli), XLD (Salmonella) 배지에 50μl씩도말하여 37 C, 5% CO 2 분압하에서 18시간배양한후 colony수를계산하였다. 균흡착력시험에서는대조군및 kaolinite 처치군과 SoltoB 처리에의한군간에유의적이차이가확인되지못하였다 (Figure 25). 하지만균성장억제력시험에서는 Salmonella derby, S. Typhimurium 09-2b 와 E. coli에서 SoltoB처리에의해서대조군에비해균성장이억제되는것을확인할수있었다. (Figure 26)
52 Figure 25. Adsorptive effect of SoltoB against bacterial diarrhea pathogens
53 Figure 26. Growth inhibiting effect of SoltoB against bacterial diarrhea pathogens
54 나. 송아지세균성및바이러스성호흡기질병에대한 SoltoB의방어효과 (1) 세균성병원체공격접종모델확립및공격균주검출기법확립 ( 가 ). 공격균주모델확립송아지호흡기세균성질병의주원인체로알려진 Mannheimia haemolytica serotype A1, Pasteurella multocida type A를공격균주로선발하였다. Mannheimia haemolytica serotype A1는건강한소의호흡기에서도분리되는상재균이나소의면역력이약해지거나다른질병에감염되어감수성이증가할경우호흡기감염을일으켜세균성폐렴을유발하는원인체로흔히수송열의원인체로알려진병원균이다. Pasteurella multocida type A 역시일부건강한소에서분리되며, Mannheimia haemolytica serotype A1과같이여러가지이유로면역력이약화되거나질병의저항성이감소되는환경, 또는급작스런환경변화로인한스트레스가유발될경우호흡기감염을일으킨다. ( 나 ) 공격균주검출기법확립각각공격균주의검출은 PCR을통해서검출하였다. 공격접종후 nasal swab을 1ml의 PBS에충분히부유하고부유된 PBS를샘플로공격균주를검출하였다. 부유된 PBS 샘플 200μl를채취하여 16,000 g, 3min 조건으로원심분리하여 pellet에서공격균주의 DNA를추출하였다. 원심분리된 pellet에 lysis buffer 500μl와 proteinase K (20mg/ml) 6μl를넣고 55, 30min incubation 한뒤, 16,000 g, 3min 조건으로원심분리하여상층액을채취한뒤, 이후상층액과동량의 [phenol : chlorophorm : isoamyl alcoho] 시약을넣어균질화한뒤다시 16,000 g, 3min 조건으로원심하여투명한상층액을채취한후 3M sodium acetate와 100% 에틸알코올로상층액의 DNA를농축시킨뒤이를 template로하여 PCR을수행하였다. 공격균주검출을위해사용된 PCR 의조건은 Table 7. Table 8와같다
55 Figure 27. Correlation of Colony forming unit (CFU) with O.D
56 Table 7. Multiplex PCR primer and condition for detecting Mannheimia haemolytica serotype A1. Lkt HP 16s F R F R F R Primer GCAGGAGGTGATTATTAAAGTGG CAGCAGTTATTGTCATACCTGAAC CGAGCAAGCACAATTACATTATGG CACCGTCAAATTCCTGTGGATAAC GCTAACTCCGTGCCAGCAG CGTGGACTACCAGGGTATCTAATC PCR condition for Mannheimia haemolytica serotype A1 Template 10 MgCl 2 free PCR buffer 10mM dntps 1 μl 2.5 μl 1 μl 10 pmol/ μl each primer (F) 1.5 μl 10 pmol/ μl each primer (R) 1.5 μl MgCl 2 25mM 3 μl 5U/ μl Taq 1 μl D.W 13.5 μl 95 15min 94 30s 60 30s 72 30s 72 10min Size 206 bp 90 bp ~304 bp 40 cycles Table 8. PCR primer and condition for detecting Pasteurella multocida type A. HyaD-Hya C F R Primer TGCCAAAATCGCAGTCAG TTGCCATCATTGTCAGTG PCR condition for Pasteurella multocida type A Size 1,044 bp Template 1μl 95 5min 10 PCR buffer 2.5μl 95 30s 10mM dntps 1μl pmol/ μl primer (F) 1μl 55 30s cycles 10 pmol/ μl primer (R) 1μl 72 30s 5U/ μl Taq 0.1μl D.W 18.4μl 72 5min
57 (2). 송아지의바이러스성호흡기원인체의검출기법확립 ( 가 ) Bovine herpesvirus 1 1 접종실험하기위한소허피스바이러스배양액확보가허피스바이러스배양은 MDBK cell에배양하여사용함. MDBK cell을 10% (v/v) FBS (Fetal Bovine Serum) 와 1% (v/v) antibiotics 가첨가되어있는 EMEM배지를이용하여 monolayer로배양하였음. Bovine Herpesvirus-1 (BHV-1) 를 0.1 MOI로 Monolayer confluent로성장한 MDBK cell에접종한다. 1시간동안 37 o C, 5% CO 2 의조건에서배양하며 10분간격으로 rocking을실시한다. 1% (v/v) antibiotics가함유된 alpha-mem배지를첨가하고 37 o C, 5% CO 2 의조건으로배양하여 virus를증식시킨다. 나바이러스농도를 1X 10 8 PFU/ml 이상되도록배양하여총 2L 의 배양액확보 2 Real-time PCR법확립가바이러스농도측정을위해서 Real-time PCR법을확립 Plasmid DNA standard 구성 - BRV로부터 viral RNA 추출이후, 아래 primer set으로 PCR 증폭을실시하였다 Rotavirus fwd: 5'-TGT GGA CCT AAA CCT CAC GGT-3' Rotavirus rev: 5'-GTA GTC GAG CAG ACC CGT GTC-3' - 증폭된 PCR product를 pgem-t easy vector에 TA cloning을실시
58 - 재구성된 plasmid 를 copies 으로 10-fold dilution 하여 real-time PCR 의 standard 로사용하였다. Real-time PCR amplification - 분변시료에서분리해낸 viral RNA를이용하여 Real-time PCR을실시한다. - primer와 probe의 sequence는다음과같다. - fwd: 5'-TGT GGA CCT AAA CCT CAC GGT-3' - rev: 5'-GTA GTC GAG CAG ACC CGT GTC-3' - probe: 5'-FAM-AGG ACC GCG AGT TCT TGC CGC-TAMRA-3' - Real-time PCR thermal cycling conditionn은다음과같다. : 2min at 50 o C, 10min at 95 o C, and 40 cycles of 15s at 95 o C and 1min at 60 o C 나비강 swab 과각조직에서 RNA 를추출하여 real-time PCR 을 이용하여분변에서분비되는바이러스양을측정함. (3) 공격접종실험군분리 공시동물 : 3개월령송아지 ( 국내사육한우 ), 6두 실험전특정질병조사 - 호흡기질병이관찰되지않음을확인 - 비강 swab 샘플을통해공격접종할병원체가동정되지않음을확인 - 무처치대조군, SoltoB 첨가군으로분류 각실험군의송아지는격리되어상호감염을차단
59 (3). 송아지에 세균성 및 바이러스성 호흡기 질병 원인체 동시 인공감 (가) 공격접종 실험군 분리 (Figure 28) 대조군 (3두) : 일반사료와 수도수를 실험 전(全)기간 동안 자유 급여 SoltoB 첨가군 (3두) : 0.5% (w/w) SoltoB를 첨가한 사료와 수도 수를 실험 전(全)기간 동안 자유급여 대조군과 SoltoB 첨가군은 각 군의 사료에 1주일간 적응 기간을 거 치고 인공 감염 실험 실시. 공격접종은 총 3일에 걸쳐 24시간 주기로 실시하였으며, 실제 야외 감염과 동일한 조건을 구현하기 위하여 비강에 병원체를 분무하는 형태로 공격접종이 이루어 졌다. 본 공격 접종 실험은 전남대학교 용봉캠퍼서 동물실험윤리위원회의 승인을 얻어 실시함 (승인번호: CNU IACUC-YB ). Figure 28. 입식 첫째날. 입식 후 계류를 시킴 (나) 공격접종 및 공격 접종 후 임상 증상 관찰 및 분석 1) 공격접종 후 임상 증상 관찰 및 분석 공격접종 이후 임상 증상은 24시간을 주기로 측정하였으며 기침 정도, 콧물 분비 정도, 호흡수, 체온을 Table 9을 기준으로 측정하여 각각 점 수화 하였다. 공격접종을 실시하기 전에 모든 송아지는 정상 체온을 유 지하고, 기침의 증상이 관찰되지 않았으며, 호흡수도 정상범위를 유지하
60 였다. 하지만공격접종이후전송아지에서체온이증가하고기침의횟 수가증가였으며, 호흡수가증가하는경향을나타내었다. SoltoB 투여군 은대조군에비해공격접종이후체온의증가가크지않았으며, 호흡수 역시대조군에비해낮게관찰되었다. 특히호흡수의경우 SoltoB 투 여군은대조군에비해낮게관찰되었으며, 공격접종을완료한지 2일이지난뒤에는거의정상범위를회복하여, 대조군이 4일이지난뒤부터정상범위를회복한것에비해빠르게회복하는경향을보여주었다 (Figure 29). Table 9. The clinical sign scoring criteria. Sign Description Score Temperature > 4 Degree of nasal discharge Absent 0 Mild 1 Moderate 2 Severe 3 Cough frequency degree Absent 0 Mild 1 Moderate 2 Respiratory rate < >
61 Figure 29. The changes of clinical signs before and after challenge. (a) rectal temperature, (b) nasal discharge score, (c) cough frequency rate (rate/min), (d) respiratory rate (rate/min). All experimentally infected calves showed increasing rectal temperature from D-0 to D+3 and SoltoB group showed lower rectal temperature than control group. The higher respiratory rate than SoltoB group is observed in control group from D-0 to D+5. ( 다 ) 공격접종후호흡기에서분리되는공격병원체및 total bacteria 측정공격접종후 48시간주기로송아지비강 swab 샘플을 1ml의멸균 PBS에부유시킨후 DNA를추출하여 PCR을통해서 Mannheimia haemolytica serotype A1 및 Pasteurella multocida type A를동정하였으며 swab 샘플이부유된 PBS를 10진단계희석한후희석된샘플을 Blood agar plate (BAP) 및 Chocolate agar plate에 50μl접종한
62 뒤균질도말하여형성된 CFU를 counting하여 total bacteria CFU를측정하였다. 공격접종이후 SoltoB 투여군의경우송아지 1두에서 Mannheimia haemolytica serotype A1 감염이확인되었으며, 반면대조군의경우 3두모든송아지에서 Mannheimia haemolytica serotype A1의감염이확인되었다. 이는면역증강효과를지닌 SoltoB의투여에따라 SoltoB 투여군의송아지가대조군의송아지에비해면역력이증가하여세균감염에저항성이유도된결과로보아진다. 반면 Pasteurella multocida type A의경우 3차에걸친공격접종후에도비강을통해서공격접종균이분리동정되지않았다. 공격접종이후송아지비강에서분리된 total bacteria 수는 SoltoB 투여군과대조군사이에큰차이는보아지않았으나 SoltoB 투여군의 AUC 값이 38.3 ± 0.7으로대조군 AUC 값인 41.3 ± 0.5에비해낮게관찰되었다 (Figure 30). Figure 30 Clearance of total bacteria in experimentally infected calves. Compared with the control group, the number of total bacteria isolated from nasal discharge in the SoltoB group seems to be similar, but higher AUC than in the SoltoB group is observed in the control group. The AUC of control and SoltoB groups was 41.3 ± 0.5 and 38.3 ± 0.7, respectively
63 ( 라 ) 공격접종이후호흡기조직에분리되는공격병원체측정공격접종이완료된뒤 12일후부검을통해기관지와폐를분리한뒤각각의기관에서분리되는 Mannheimia haemolytica serotype A1과 Pasteurella multocida type A를 real time PCR 및 PCR를통해분리동정, 정량화하였다. 부검을통해얻어진각각의조직 1g을 9ml의멸균 PBS에균질화하여, 이를샘플로하여 10진단계희석한뒤, 각각 1g에존재하는공격병원체의양을정량화하고병원체를동정하였다. Pasteurella multocida type A의경우 SoltoB 투여군및대조군의기관지및폐에서동정이되지않았으며, Mannheimia haemolytica serotype A1의경우대조군중한마리의송아지폐에서만동정되었다. 이는공격접종이후 12일이지나회복기에접어들었기때문으로보인다. 이러한결과는임상증상를점수화하였을때 SoltoB 투여군이대조군에비해더완화된임상증상을보였던것과일치하는결과이다. ( 마 ) 공격접종후호흡기에서분리되는 viral titer 측정공격접종후 48시간주기로송아지비강 swab이부유된 PBS에서 RNA를추출하여 real time PCR을통해 Bovine herpes virus-1 (BHV-1) 를분리동정하였으며, genome quantification을수행하였다. BHV-1의경우공격접종이후 4일째까지는대조군과 SoltoB 투여군간의차이가보이지않았으나공격접종 4일이후에는 SoltoB 투여군이대조군에비해낮은 genome quantity를보이면감소하였다 (Figure 31). ( 바 ) 공격접종이후호흡기조직에분리되는 viral titer 측정공격접종이완료된뒤 12일후부검을통해기관지와폐를분리한뒤각각의기관에서분리되는 BHV-1 genome를 real time PCR을통해분리동정, 정량화하였다. 부검을통해얻어진각각의조직 1g을 9ml의멸균 PBS에균질화하여, 이를샘플로하여 10진단계희석한뒤, 각각 1g
64 에존재하는공격병원체의양을정량화하고병원체를동정하였다. BHV-1의경우 SoltoB 투여군의폐에서대조군보다높은 genome quantity를보였으며, 기관지에서는대조군이 SoltoB 투여군보다높은 genome를보였다 (Figure 32). 이는 SoltoB 투여군의폐에대조군보다많은 virus의양이있음에도대조군보다더적은양의 virus를기관지로 shedding했기때문인것으로보인다. 선행된논문에서는 virus shedding 과관련하여임상증상이뚜렷이나타나고예후가불량할경우 virus shedding 양이증가함을제시하고있어 SoltoB 투여군이대조군보다도같은 virus 병원체에노출되고감염되었을때적은양의 virus를 shedding 하고임상증상도더완화되어나타냄을간접적으로제시한다. 이러한결과는임상증상를점수화하였을때 SoltoB 투여군이대조군에비해더완화된임상증상을보였던것과일치하는결과이다. Figure 31. Clearance of BHV-1 in experimentally infected calves. The load of BHV-1 genomes in nasal swab samples gradually decreases from D+4. The SoltoB group shows lower quantity than the control group
65 Figure 32. Quantity of BHV-1 genomes in trachea and lung at post-mortem. While SoltoB group shows higher quantity of BHV-1 genomes than control group in lung, a lower quantity than in the control group is observed in trachea of SoltoB group. ( 사 ) 공격접종이후부검소견공격접종으로폐렴이유발된각각의송아지의병변은주로 apical lobe 쪽에집중적으로관찰되었다 (Figure 33). Apical lobe에서명확하게병변이관찰되었으며이후 caudal쪽의폐로갈수록병변은완화되어관찰되었다. 각병변은주로폐 congestion을동반하며, 어두운자주빛에서연한갈색을띄었으며, 촉진시정상부위의폐보다 hepatization으로인해견고하게촉진되었다. SoltoB 투여군의폐의경우 apical lobe 에공격접종으로인한폐렴이유발되어병변이집중되어있었으며, 전체폐면적에서병변이차지하는비율이대조군에비해낮게관찰되었다 (Figure 33). SoltoB 투여군의경우전체폐의면적에서병변이차지하는비율은 10.2% ± 3.0 였으며, 대조군의경우 34.8% ± 4.6 로유의적인차이를보였다 (Figure 34) (p < 0.01)
66 Figure 33. (A), (B), and (C) Lesion of lung after challenge in the control group. (D), (E) and (F) Lesion of lung after challenge in the SoltoB group. The black circles indicate typical lung lesions by infection. The control group shows severer lesion than SoltoB group. Figure 34. Percentages of superficial lesion area in experimentally infected calves. The SoltoB group shows significantly lower percentages of lesion area than the control group (p < 0.01)
67 ( 아 ) 공격접종이후조직학적검사 1 조직학적검사부검을통해얻어진폐조직을 10% 중성포르말린용액에고정하여 H&E 염색을실시하여조직병리학적분석을수행하였다. 각각관찰된조직병리학적병변은 Table 10를기준으로점수화하여 SoltoB 투여군과대조군의병변의차이를분석하였다. Table 10의점수화는 0에서 6 점사이에이루어지며, 점수가높을수록강한병변을의미한다. SoltoB 투여군과대조군은모두조직병리학적으로공격접종에의해 type 2 pneumocyte hypertrophy 및 hyperlasia와 alveolar wall thickening 과 neutrophile filtration이관찰되었다. 반면 SoltoB 투여군의경우조직병리학적병변이대조군에비해완화되어관찰되었고, 기관지내 neutrophil filtration은대조군에비해현격히감소하여관찰되었다. 세균성폐렴의전형적인특징인 bronchopneumonia에서쉽게관찰되는기관지내 neutrophil filtration이 SoltoB 투여군에서낮게관찰된것은 SoltoB 투여로인해면역력이증가하여 virus 감염이후 2차적으로세균감염에대한저항성이증가하여공격접종에도불구하고세균성폐렴이완화되어나타났기때문인것으로보인다. Table 10를바탕으로평가된조직병리학적병변점수분석에서도 SoltoB 투여군은 2.06 ± 0.23 으로대조군의 4.55 ± 0.22에유의적인차이를보였다 (Figure 35). Table 10. The histopathological sign score criteria. Description Score normal 0 mild multifocal 1 mild diffuse 2 moderate multifocal 3 moderate diffuse 4 severe multifocal 5 severe diffuse
68 Figure 35. Histopathological features of lung tissue samples and microscopic lesion score in challenged calves. Severe neutrophils filtration and thickened alveolar septa are observed in lungs of the control group (arrows in a1 and a2) compared with the germanium biotite group (arrows in b1 and b2). Bronchiole also contains numerous neutrophils (arrowhead in a3) compared with the germanium biotite group (arrowhead in b3). The microscopic lesion scores were significantly different between the two groups (p < 0.01)
69 제 3 장목표달성도및관련분야에서의기여도 제 1 절연구개발목표의달성도 연차 목표연구개발수행내용 SoltoB 의면역증강효과를 규명 마우스비장세포배양법으로면역유도활성평가 국내송아지세균성설사원인체분석 달성도 (%) 100% 1 차 년 도 2 차 년 도 송아지에서세균성설사에 대한 SoltoB 의방어효과를 송아지인공감염을위한균주선발및감염모델확립 확인 E. coli, S. Typhimurium을송아지에인공감염시킨후임상증상의확인및분변내감염균주감소효과분석 송아지의바이러스성설사원인체의검출기법확립송아지에서바이러스성설 사에대한 soltob 의방어 효과를확인 Rota virus, Corona virus 를송아지에인공감염시킨후임상증상의확인및분변내인공감염바이러스분리정도평가 송아지설사유발세균성병원체에설사유발세균에대한대한 SoltoB의흡착력과성장억제력 SoltoB의흡착효과를확인평가 송아지호흡기성세균에 대한 SoltoB 의방어효과를 확인 송아지호흡기 IBR 바이 러스에대한 soltob 의방 어효과를확인 SoltoB 를급여한송아지에서세균성호흡기질병에대한항병력증가분석을위한인공감염실험 임상증상및호흡기에서분비되는세균의양측정 SoltoB 를급여한송아지에서바이러스성호흡기질병 (IBR) 에대한항병력증가분석을위한인공감염실험 임상증상및각장기에존재하는바이러스의양측정 100% 100% 100% 100% 100%
70 제 2 절관련분야에의기여도 항생제내성균에대한문제가제기되면서항생제사용의법적인규제가 이루어지고있으며이에따른대체물질에대한연구가진행되고있다. 이번연구에서 SoltoB 의세균의흡착력및면역력증강효과를규명하 였으며, 특히송아지호흡기및소화기질병예방효과를규명하는통합 적연구가수행되었다. 본시험결과를토대로최근필요시되고있는항생제대체제로써의가능성을가늠해볼수있었으며, 본연구에서사용된 Solto B의양축농가에서의이용을통해농가생산성향상및질병감염으로부터의예방에의한생산비절감효과가있을것으로사료된다
71 제 4 장연구개발성과및성과활용계획 제 1 절산업화계획 1. 사업추진전략가. OFF 라인전략 대형유통업체와독점공급조건으로 Solto B 판매 마케팅을통한양돈농가방문판매 사료제조업체와의협약을통한유통망확대 나. ON 라인전략 ( 주 ) 서봉바이오베스텍의웹홉페이지및블로그상에서의홍보 제 2 절추가연구, 타연구에활용계획 본연구에서는송아지에서실험이진행되었으나, 최근브랜드육의개발및생산이필수불가결한국내육우시장상황으로볼때비육우에서의연구를통해면역력과항병력뿐만아니라육질에서의효과까지실험을진행할필요가있다고사료된다. 또한, 송아지뿐만아니라산란계와육계에있어서도연구가진행될필요가있다고본다
72 제 5 장참고문헌 1. Abril, C., Engels, M., Liman, A., Hilbe, M., Albini, S., Franchini, M., Suter, M. and Ackermann, M Both viral and host factors contribute to neurovirulence of bovine herpesviruses 1 and 5 in interferon receptor-deficient mice. Journal of virology 78: Aikoh, T., Tomokuni, A., Matsukii, T., Hyodoh, F., Ueki, H., Otsuki, T. and Ueki, A Activation-induced cell death in human peripheral blood lymphocytes after stimulation with silicate in vitro. International journal of oncology 12: Alexander, T.W., Cook, S.R., Yanke, L.J., Booker, C.W., Morley, P.S., Read, R.R., Gow, S.P. and McAllister, T.A A multiplex polymerase chain reaction assay for the identification of Mannheimia haemolytica, Mannheimia glucosida and Mannheimia ruminalis. Veterinary microbiology 130: Angen, Ø, Thomsen, J., Larsen, L.E., Larsen, J., Kokotovic, B., Heegaard, P.M.H. and Enemark, J Respiratory disease in calves: Microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein response. Veterinary microbiology 137: Autio, T., Pohjanvirta, T., Holopainen, R., Rikula, U., Pentikainen, J., Huovilainen, A., Rusanen, H., Soveri, T., Sihvonen, L. and Pelkonen, S Etiology of respiratory disease in non-vaccinated, non-medicated calves in rearing herds. Vet Microbiol 119: Bosch, JC, Kaashoek, MJ, Kroese, AH and Van Oirschot, JT An attenuated bovine herpesvirus 1 marker vaccine induces a better protection than two inactivated marker
73 vaccines.veterinary microbiology 52: Cromwell, G.L Why and how antibiotics are used in swine production. Animal Biotechnology 13: Dowling, A., Hodgson, JC, Schock, A., Donachie, W., Eckersall, PD and McKendrick, IJ Experimental induction of pneumonic pasteurellosis in calves by intratracheal infection with Pasteurella multocida biotype A: 3.Researchin veterinary science 73: Fulton, R.W Bovine respiratory disease research ( ). Animal Health Research Reviews 10: Hanzlicek, G.A., White, B.J., Mosier, D., Renter, D.G. and Anderson, D.E Serial evaluation of physiologic, pathological, and behavioral changes related to disease progression of experimentally induced Mannheimia haemolytica pneumonia in postweaned calves.american journal of veterinary research 71: Hinkley, S., Hill, A.B. and Srikumaran, S Bovine herpesvirus-1 infection affects the peptide transport activity in bovine cells.virus research 53: Hodgson, J.C., Barclay, G.R., Hay, L.A., Moon, G.M. and Poxton, I.R Prophylactic use of human endotoxin core hyperimmune gammaglobulin to prevent endotoxaemia in colostrum deprived, gnotobiotic lambs challenged orally with Escherichia coli. FEMS Immunology & Medical Microbiology 11: Holian, A., Uthman, M.O., Goltsova, T., Brown, S.D. and Hamilton Jr, R.F Asbestos and silica-induced changes in human alveolar macrophage phenotype. Environmental Health Perspectives 105:
74 14. Irsik, M., Langemeier, M., Schroeder, T., Spire, M. and Roder, JD Estimating the effects of animal health on the performance of feedlot cattle. Bovine Practitioner 40: Jones, C. and Chowdhury, S A review of the biology of bovine herpesvirus type 1 (BHV-1), its role as a cofactor in the bovine respiratory disease complex and development of improved vaccines. Animal Health Research Reviews 8: Jung, B.G., Toan, N.T., Cho, S.J., Ko, J., Jung, Y.K. and Lee, B.J Dietary aluminosilicate supplement enhances immune activity in mice and reinforces clearance of porcine circovirus type 2 in experimentally infected pigs. Veterinary microbiology 143: Kaashoek, M.J., Moerman, A., Madi, J., Weerdmeester, K., Maris-Veldhuis, M., Rijsewijk, F.A.M. and van Oirschot, J.T An inactivated vaccine based on a glycoprotein E-negative strain of bovine herpesvirus 1 induces protective immunity and allows serological differentiation. Vaccine 13: Kaashoek, MJ, Moerman, A., Madic, J., Rijsewijk, FAM, Quak, J., Gielkens, ALJ and Van Oirschot, JT A conventionally attenuated glycoprotein E-negative strain of bovine herpesvirus type 1 is an efficacious and safe vaccine. Vaccine 12: Kamphues, J Antibiotic growth promoters for the view of animal nutrition.berliner und Munchenertierarztliche Wochenschrift 112: Lovato, L., Inman, M., Henderson, G., Doster, A. and Jones, C Infection of cattle with a bovine herpesvirus 1 strain
75 that contains a mutation in the latency-related gene leads to increased apoptosis in trigeminal ganglia during the transition from acute infection to latency. Journal of virology 77: Muhl, A. and Liebert, F Growth and parameters of microflora in intestinal and faecal samples of piglets due to application of a phytogenic feed additive. Journal of Animal Physiology and Animal Nutrition 91: Neu, H. C The crisis in antibiotic resistance. Science 257: Opriessnig, T., Thacker, EL, Yu, S., Fenaux, M., Meng, X.J. and Halbur, PG Experimental reproduction of postweaning multisystemic wasting syndrome in pigs by dual infection with Mycoplasma hyopneumoniae and porcine circovirus type 2.Veterinary Pathology Online 41: Rice, JA, Carrasco-Medina, L., Hodgins, DC and Shewen, PE Mannheimia haemolytica and bovine respiratory disease. Animal Health Research Reviews 8: Rodriguez-Fuentes, G., Barrios, MA, Iraizoz, A., Perdomo, I. and Cedre, B Enterex: Anti-diarrheic drug based on purified natural clinoptilolite. Zeolites 19: Sarker, MSK, Kim, GM and Yang, CJ Effect of green tea and biotite on performance, meat quality and organ development in ross broiler. Egypt Poultry Science Journal 30: sub Song, D., Moon, H.J., Jung, K., Yeom, M.J., Kim, H.K., Han, S.Y., An, D.J., Oh, J.S., Kim, J.M. and Park, B.K Association between nasal shedding and fever that influenza A (H3N2) induces in dogs.virology Journal 8: Suh, D.K. and Song, J.C Simultaneous detection of
76 Lawsonia intracellularis, Brachyspira hyodysenteriae and Salmonella spp. in swine intestinal specimens by multiplex polymerase chain reaction.journal of veterinary science 6: Ueki, A., Yamaguchi, M., Ueki, H., Watanabe, Y., Ohsawa, G., Kinugawa, K., Kawakami, Y. and Hyodoh, F Polyclonal human T-cell activation by silicate in vitro. Immunology 82: van den Bogaard, A.E. and Stobberingh, E.E Antibiotic usage in animals: impact on bacterial resistance and public health.drugs58: Vondruskova, H., Slamova, R., Trckova, M., Zraly, Z. and Pavlik, I Alternatives to antibiotic growth promoters in prevention of diarrhoea in weaned piglets: a review. Veterinarni Medicina 55: Yu, D.J., Na, J.C., Kim, T.H., Kim, S.H. and Lee, S.J Effect of Supplementation of Complex Probiotics on Performances, Physio-chemical Properties of Meat and Intestinal Microflora in Broiler.Journal of Animal Scienceand Technology 46:
77 주 의 1. 이보고서는농림수산식품부에서시행한농림기술개발사업의연구보고서입 니다. 2. 이보고서내용을발표할때에는반드시농림수산식품부에서시행한농림 기술개발사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개하여 서는아니됩니다
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 원외폐렴원인균조사및내성감시 시스템구축 주의 ( 주의내용기재 ) ( 글 14 point 고딕체 ) 제명 2 0 0 Microbiological Etiology of Community acquired pneumonia and Surveillance network of resistance 주관연구기관 : 울산대학교의과대학
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information발간등록번호
발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationhwp
최종연구보고서 - 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 -
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationContents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과
2017 년양돈질병세균 항생제내성검사결과 I Seul Oh ACE of Optipharm ois@optipharm.co.kr 043-249-7532 Contents I. 항생제내성 / 감수성기준및용어설명 II. III. 호흡기질병 5 종항생제내성검사결과 소화기질병 3 종항생제내성검사결과 2018-01-30 2 1. 항생제감수성 / 내성기준 2018-01-30
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information- 1 - - 2 - - 3 - 1 1 1. 연구목적 2. 연구필요성 - 4 - - 5 - - 6 - - 7 - 2-8 - 3 1. 브루셀라증 - 9 - (2006 5 12 ) ( ) (%) : (2007) (2007 112008 1 ) - 10 - 2. 큐열 9. (2009, ) (2007 112008 1 ) - 11 - 3. 장출혈성대장균감염증 - 12
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information발간등록번호 학술연구용역과제최종결과보고서 국민건강영양조사제기 차년도 영양조사질관리및전자조사표도입을위한사전조사실시 Quality Control and a Preliminary Study on Computer Assisted Personal Interview System for Nutrition Survey of KNHANES (2013) 주관연구기관 한국보건산업진흥원
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information: : : : : : : : : : : : - 1 -
: : : : : : : : : : : : - 1 - Ⅰ Ⅱ Ⅲ - 2 - Ⅳ - 3 - Ⅴ - 4 - - 5 - - 6 - - 7 - - 8 - 제 1 장 연구개발과제의개요 μm mm cm cm - 9 - - 1 - - 11 - - 12 - - 13 - - 14 - 제 2 장 국내외기술개발현황 - 15 - - 16 - - 17 - - 18 - - 19 -
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationÁ¶´öÈñ_0304_final.hwp
제조 중소기업의 고용창출 성과 및 과제 조덕희 양현봉 우리 경제에서 일자리 창출은 가장 중요한 정책과제입니다. 근래 들어 우리 사회에서 점차 심각성을 더해 가고 있는 청년 실업 문제에 대처하고, 사회적 소득 양극화 문제에 대응하기 위해서도 일자리 창 출은 무엇보다도 중요한 정책과제일 것입니다. 고용창출에서는 중소기업의 역할이 대기업보다 크다는 것이 일반적
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More informationºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information204135-2.hwp
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information발간등록번호 11-1541000-001187-01 농림수산사업성과평가 [ 식품유통재정사업 ] 연구기관 : 한국정책평가연구원 2011. 12 제출문 농림수산식품부장관귀하본보고서를 농림수산사업성과평가 의최종보고서로제출합니다. 2011. 12. 연구진 연구총괄박경귀 ( 한국정책평가연구원원장 ) 연구책임자윤인주 ( 한국정책평가연구원연구위원 ) 공동연구원송재옥 (
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information<5B D31322D31325DB0EDBAB4BFF8BCBA B9D9C0CCB7AFBDBA D BFA120B4EBC7D120C0CFB9DDBBE7C7D720C1B6BBE72E687770>
고병원성 PRRS 바이러스 (HP-PRRSV) 에대한일반사항 손진희수의사중앙백신연구소 지난 2006년중국에서발생하여양돈산업에심각한타격을입혔던고병원성 PRRS의발병사례를조사하여그심각성을이해하고해당바이러스의특성을파악하기위해자료조사를실시하였다. 또한본조사에이어 HP-PRRS의병원성에기여하는것으로알려진 nsp2 gene에대한추가조사및진단방법의수립등에대하여추가적인자료를통해논하고향후국내상황에대비할필요성여부를파악하고자한다.
More information2
02 1 1 22 36 38 46 5 1 54 61 65 77 81 2 _ 3 4 _ 5 6 _7 8 _ 9 1 0 _ 11 1 2 _ 13 1 4 _ 15 1 6 _ 17 1 8 _ 19 2 0 _ 21 2 2 www.kats.go.kr www.kats.go.kr _ 23 Scope of TC/223 Societal security International
More information주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 제 명 주 의 ( 주의내용기재 ) 2 0 1 1 ( 글 14 point 고딕체 ) 주관연구기관 질병관리본부 질병관리본부 주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다.
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information°Ç°�°úÁúº´6-13È£ÀÛ¾÷
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 13 www.cdc.go.kr 2013 3 29 6 13 ISSN: 2005-811X 10-years of Hepatitis B Perinatal Transmission Prevention
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationstep 1-1
Written by Dr. In Ku Kim-Marshall STEP BY STEP Korean 1 through 15 Action Verbs Table of Contents Unit 1 The Korean Alphabet, hangeul Unit 2 Korean Sentences with 15 Action Verbs Introduction Review Exercises
More informationWHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disabi
WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 2004. 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disability)..,,. (WHO) 2001 ICF. ICF,.,.,,. (disability)
More information