Microsoft Word doc

Transcription

1 재조합아데노부속바이러스를이용 한유전자형질도입율향상 연세대학교대학원 의과학과 김성진

2 재조합아데노부속바이러스를이용 한유전자형질도입율향상 연세대학교대학원 의과학과 김성진

3 재조합아데노부속바이러스를이용한유전자형질도입율향상 지도교수장진우 이논문을석사학위논문으로제출함 2003 년 12 월일 연세대학교대학원 의과학과 김성진

4 김성진의석사학위논문을인준함 심사의원장진우인 심사의원김주항인 심사의원이희란인 연세대학교대학원 2003 년 12 월일

5 차례 그림및표차례 iii 국문요약 I. 서론 4 II. 재료및방법 chemicals 세포배양 raav 의생산및농축 Calcium phosphate transfection X-gal 염색법과유전자형질도입율의결정 MTT assay RT-PCR 15 III. 결과 아데노바이러스의 co-infection에의한 raav의 형질전환증가 chemicals이암세포주에미치는 세포독성측정 raav 벡터에의한유전자전달효율 chemical 조합에따른 rave의유전자형질 도입율의비교 28 IV. 고찰 32 i

6 V. 결론 37 참고문헌 34 영문요약 44 ii

7 그림차례 Fig 1. Schematic representation of paav vector 8 Fig 2. A model for the role of cell surface HSPG and FGFR1 in mediating AAV binding and entry into the host cell 9 Fig 3. Constuction scheme of a recombinant adenoassociated virus 14 Fig 4. Transduction efficiency to various human cancer cells by raav encoding Lack 18 Fig 5. Cytotoxicity by sodium butyrate and trichostatin A, histone deacetylase inhibitors 20 Fig 6. Cytotoxicity by aphidicolin and hydroxyurea, DNA synthesis inhibitors 21 iii

8 Fig 7. Cytotoxicity by etopocide and camptothecin, topoisomerase inhibitors 22 Fig 8. Cytotoxicity by MG-132 and tyrphostin-1, proteosome inhibitor and EGFR inhibitor, respectively 23 Fig 9. RT-PCR analysis of α V integrin RNA in control and trichostatin A treated cells 29 Fig 10. Effect of combination of each chemical on the transduction frequencies of raav vector 30 표차례 Table 1. Effect of various chemical additives on transduction efficiency in various human cancer cell lines 26 iv

9 국문요약 재조합아데노부속바이러스를이용한유전자형질도입율향상 재조합아데노부속바이러스유전자전달체 (recombinant adeno-assicated virus; raav) 는세포또는조직에전달한유전자의발현을장기적으로유도한다. 또한신경및근육세포와조직에대한우수한유전자전달효과와면역반응의최소화등의장점을가지고있다. 그러나 raav 의형질전환율은아직도유전자발현에따른효능을기대하기에는아직미흡한점이많이있다. 따라서본연구는이러한 raav 의낮은유전자형질도입율을개선하기위하여각종화학물 (chemical) 을첨가함으로써유전자발현율의증대를유도하고자하였다. 각종인체암세포주를대상으로 raav 수용체 (receptor) 발현을증가시키는 trichostatin A, DNA 합성억제제인 aphidicolin 과 hydroxyurea, topoisomerase 저해제인 etoposide 와 camptothecin, proteosome 저해제인 MG- 132, 그리고 epidermal growth factor receptor (EGFP) 억제제인 tyrphostin- 1 을적용하여유전자전달효율성의증대유무를검증하였다. LacZ 를표지유전자로하고 x-gal 염색법을시행하여분석한결과, 본연구에사용한 raav 에의한유전자전달효율은약 0.02% 정도로매우낮았다. 하지만 hydroxyurea 를전처리한후의효율은자궁암세포주 Hela, 직장암 1

10 세포주 HCT 116 에서각각 25 배, 5 배, 간암세포주 SK-Hep1 에서는 MG-132 처리시 8.5 배형질전환효율을보였다. 각각의 chemical 을동시처리 (chemical combination) 하였을때 Hela 와 MCF-7 에서 combined effect 를관찰할수있었다. Hela 의경우 camptothecin (1.5 배 ) 과 MG-132 (8.5 배 ) 를동시에처리하였을때 12 배까지유전자감염효율이증가함을확인하였다. 또한동일한세포주에 hydroxyurea (1.3 배 ) 와 tyrphostin-1 (3 배 ) 를동시처리한경우 8 배까지각 chemical combination 효과를확인할수있었다. 또한 MCF-7 에서도 hydroxyurea (8 배 ) 와 tyrphostin-1 (3 배 ) 을공동처리하였을때 12 배까지유전자전달효율이상승함을알수있었다. 하지만, HCT 116 과 SK-Hep 1 의경우에는화학물의동시처리에따른유전자전달효율성증대를관찰할수없었다. 마지막으로, 상기화학물들은고농도에서처리시세포에손상을줄수도있으나본연구에사용된농도에서는동시처리의경우에도세포에손상을주지않음을 MTT assay 로확인하였다. 따라서본연구결과로 raav 에의한유전자전달효율은대상인체암세포주의종류에따라또한처리한 chemical 의종류와작용기작의특성에 따라반응도에차이가있음을확인하였다. 하지만 raav 의유전자형질 도입율은각종화합물의첨가특히서로다른성질을가진화합물의동시 처리에의하여상당부분개선되어질수있음을관찰하였다. 이러한 chemical 에의한 raav 유전자전달효율증대효과가인체종양세포주뿐 2

11 아니라신경세포주등에서도유도될수있다면, raav 의취약점을크게 보완해주는것으로그유용성이매우클것으로기대된다. 핵심되는말 : 재조합아데노부속바이러스 (raav), 유전자형질도입율, camptothecin, MG-132, hydroxyurea, tyrphostin-1, combined effect. 3

12 재조합아데노부속바이러스를이용한유전자형질도입율향상 < 지도교수장진우 > 연세대학교대학원의과학과 김성진 I. 서론현대의과학연구분야의하나로국내외적으로많은연구가진행되고있는유전자치료는유전자의이상으로발생하는선천적유전병을유전자수준에서치료하려는신기술로개발되기시작하였다 1. 이후암, 퇴행성뇌질환, 및감염성질환과같은다양한인체질환의경우에도적절한치료유전자의도입으로치료효과를볼수있다는가능성이속속밝혀지면서그적용 범위는계속증가하는추세이다 2,3. 이러한유전자치료가성공적으로 수행되기위해서는먼저몇가지선결해야할문제점들이있다. 그중하나는치료에필요한유전자를원하는세포안으로안전하게그리고효과적으로도입시켜그유전자를발현시키기위한유전자전달기술의확보이다. 이러한기술의핵심요소는유전자전달체이다. 유전자치료에사용되는유전자전달체는세포에유전자를전달하는도구가되는것으로써, 궁극적으로는 4

13 인체에적용될것임을고려할때그자체의독성이낮거나아예없어야하며, 유전자를선택적이고효과적으로원하는세포에전달할수있어야한다. 이러한유전자전달체는그구성물질의유래에따라크게바이러스성과비바이러스성으로나눌수있다. 비바이러스성유전자전달체는주로 양이온성지질또는고분자로이루어지며, 이들은음이온성인 DNA 와 이온결합에의해복합체를형성하여세포내로전달된다. 이는바이러스성전달체에비하여낮은독성, 비면역원성, 대량생산과취급의용이성등의장점을가지고있으나낮은유전자전달효율이라는큰단점을가지고있다. 바이러스성유전자전달체 4 는유래한바이러스의종류에따라재조합레트로바이러스 (recombinant retrovirus), 재조합아데노바이러스 (recombinant adenovirus), 재조합아데노부속바이러스 (recombinant adeno-associated virus; raav) 등이있다 5,6,7. 한편이들은각기나름대로의장단점을가지고있어대상질환또는대상세포등에따라달리이용되고있다. 이러한바이러스성벡터는비바이러스성벡터에비하여대체적으로유전자발현효율이월등히높다. 하지만잔류하고있는바이러스유래물질에의한독성및원치않는면역반응의유도등안전성이동시에문제점으로지적되고있다 8. 이들중 raav 는장기간의유전자발현을유도할수있고, 면역반응에따른부작용이거의일으키지않는장점을가지고있다 9. 이를근거로퇴행성뇌질환등의치료목적으로신경세포에유전자를전달하는유전자전달체로개발되기시작하였다 10. raav 는바이러스중에서도그크기가작은편으로, 5

14 비병원성인파보바이러스 (parvovirus) 군에속한다. 바이러스의게놈은 4.7 Kb 의단일가닥 DNA (single-stranded DNA ; ssdna) 로 mrna 와동일한유전자암호를가지는 positive 또는그반대인 negative strand 단일가닥이모두게놈기능을할수있다 11,12. 한편야생형 AAV 가숙주를감염한후효과적인바이러스의복제와바이러스생산을유도하기위해서는아데노바이러스가동시에감염되어야한다. 최근연구결과를살펴보면 AAV 의복제에필요한것은아데노바이러스의유전자중초기발현유전자들로, E1A, E1B, E4, 그리고 E2A 등이필요함을알수있었다 13,14,15. 현재유전자전달체로개발되어있는 raav 벡터체계를살펴보면, raav vector 로는대부분 AAV 중 AAV2 를변형한형태로게놈의양쪽말단의 TR (Terminal repeat) 을제외한 rep genes 과 cap genes 을모두제거한형태가사용되고있다 (Fig.1). 제거된 rep genes 과 cap genes 은 raav 생산시추가로보충된다 (Fig.2) 16,17,18. 현재개발되어있는 raav 벡터의유전자전달효능은세포에따라다르다. 이는일차적으로바이러스가표적세포를인식하고세포내로삽입되는반드시필요한세포표면의 receptor 와 coreceptor 의분포특성과밀접한관계가있다. 바이러스의감염은현재 two-step process 가널리이해되고있다. raav 의 primary receptor (coxsackievirus adenovirus receptor and heparan sulfate proteoglycan) 를통한직접침투와 adenovirus 나 HSV 같은 helper 6

15 virus 에의해결정되는 co-receptor (α v integrin) 에의한감염이그것이다 (Fig.2) 19,20,21. 그러므로 raav 를유전자전달을위한벡터로사용하고자할때, raav 의 receptor 나 co-receptor 의발현여부는유전자전달의효능을증가시킬수있는요소중의하나가될수있다. 한편세포내로삽입된 raav 벡터를통한유전자발현을위해서는핵내로전달되어야만한다 22. raav 는 ssdna 를 genome 으로가지고있기때문에유전자발현을위해서는전사 (transcription) 시활성이있는형태인이중가닥 DNA (double-stranded DNA ; dsdna) 로의전환이일어나야만한다 15,23. 이러한 raav 벡터의유전자전달효율을증대시키기위한시도들이행해지고있다. 그중에서, 화학제에의해 AAV 의형질전환이증가된다는 사실이많이보고되고있는중이다. Trichostatin A 는 raav 의 coreceptor 인 α v integrin 의발현을증가시킨다고알려져있다. Etoposide (type II topoisomerase 저해제 ), camptothecin (type I topoisomerase 저해제 ), Aphidicolin (DNA polymerase 저해제 ), 그리고 ribonucleotide reductase 를저해함으로써 DNA systhesis 를억제하는 hydroxyurea 의처리는 DNA repair 에관여하는 DNA polymerase 의발현을순간적으로증가시켜 raav 의형질전환율을개선시킨다고알려져있다. 이는 raav genome 의 ssdna 를 ds DNA 로의전환을촉진시키기때문에보여지는현상인것같다 15,23. 7

16 CMV promoter Lac ITR REP CAP ITR ITR CMV promoter Lac Z ITR Fig.1. Schematic representation of paav vector. This vector was designed to express an inserted gene under the control of cytomegarovirus(cmv) promoter. 그리고 EGFR (Epidermal growth factor receptor) 에의해 ssdbp (singlestranded D-Sequence-binding protein) 이인산화되어결과적으로활성화되면, 이 ssbp 는 AAV 의 single-stranded D-sequence 에결합하여 ssdna 의 dsdna 로의전환을억제한다 30,31,32. Tyrphostin-1 은 EGFR 을저해함으로써, IB3 세포에서 AAV 의형질전환을증가시킬수있다고알려져있다. 이러한사실등을바탕으로본연구에서는세포수준에서보다효율적인 AAV 의유전자전달효율성을증대시키기위한방안을개발하고자하였다. 8

17 Fig. 2. A model for the role of cell surface heparan sulfate proteoglycan (HSPG) and fibroblast growth factor receptor 1 (FGFR1) in mediating AAV binding and entry into the host cell. Co-expression of HSPG and FGFR1 is required for successful binding of AAV followed by viral entry into a susceptible cell (a). Both of which are perturbed by the ligand, β-fgf, which also requires the HSPG-FGFR1 interaction (b). (Nat Med 1999;5:71-77). 즉상기 chemical 들이 AAV 에의한유전자전달에필요한각각의단계 (1) AAV 의 receptor 를통한감염, (2) 감염된 AAV 의발현을위한핵까지의 trafficking, (3) ssdna 의 dsdna 로의전환에관여한다는사실에근거하여, 각종인체암세포주에서이러한각각의 chemical 의전처리에따른 AAV 유전자전달효율성변화를 β-galactosidase (LacZ) 를표지유전자로하여규명하고자한다. 또한 chemical 처리가세포에어떤독성을유도하는지를검증하고유전자전달효율성은증대시키나세포에독성은유도하지않는 9

18 적절한 chemical 처리조건을확보하여, 만약서로다른특성을가지는 chemical 의 combination 시유전자전달효율성을더욱증대시킬수있는가능성이있는지를검증하고자하였다. 즉다양한성질을가진 chemical 을적절히조합을하였을때, 두개혹은 3 개의 chemical combination 을통한좀더강력한 AAV 의유전자형질도입율향상방안을제시하고자하였다. 10

19 II. 재료및방법 1. chemicals 실험에사용된모든 chemical 은 Sigma 에서구입하였다. Hydroxyurea (1 M) 는 phosphate-buffeded saline (PBS), 그리고 trichostatin A (5 mm), etoposide (10 mm), camptothecin (10 mm), aphidicholin (5 ug/ml), MG-132 (20 mm), Tyrphostin-1 (50 mm) 는 dimethyl sulfoxide (DMSO) 에각각의농도로농축액을만들어서저장하였고, 실험시배지용액으로 희석하여사용하였다. Trichostatin A (5 mm) 은 48 시간동안 처리하였다. Hydroxyurea (4 mm), etoposide (10 um), camptothecin (0.1 um), 그리고 aphidicolin (5 ug/ml) 은 16 시간처리하였다. MG-132 (20 um) 과 tyrphostin-1 (250 mm) 3 시간처리하였다. chemical 처리후, 각각의 well 은 DMEM 배지로세척한후, 형질전환효율을측정하기위해바이러스를감염시켰다. 2. 세포배양본실험에사용된 SK-Hep1 (ATCC HTB-52) 은간암세포주이며, U251 은뇌암세포주이다. HCT116 (ATCC CCL-247) 은결장암세포주이며, MCF-7 (ATCC HTB-22) 은유방암세포주이고, HeLa (ATCC CCL-2) 은자궁경부암세포주이다. 293T (ATCC CRL-11268) 세포는 SV40 large T 항원으로형질전환된 293 세포이다. 모든세포주는 10 % 우태아혈청 (GIBCO BRL, 11

20 Grand island, NY, USA) 과 2 mm L-glutamine, 100 IU/ml penicillin 과 50ug/ml streptomycin 이포함된 Dulbecco s modified Eagle s medium (Gibco BRL, Grand island, NY, USA) 으로배양액으로항생제 penicillin/streptomycin (GIBCO BRL, Grand island, NY, USA) 을첨가하여 5 % CO 2 의존재하에 37 항온배양기에서배양하였다. 3. raav 생산및농축 293T 세포를 10 개의 15 cm 배양접시에 이되도록분주하였다. raav-lacz (Stratagene, Lajolla, CA,USA) 을생산하기위하여 3 plasmid system (Stratagene, Lajolla, CA,USA) 을사용하였다. 그제품에서제공하는 paav-lacz 벡터, prep-cap 벡터, phelper 를 1:1:1 의비율로 calcium phosphate transfection 방법으로 10 X 15 cm 플레이트에 transfection 시켰다. 2 일후세포와배양액을회수하였다. 3 번의얼림과녹임을반복한뒤 DNase I (10 ug/ml) 를 37 에서 30 분간처리한후, 원심분리 (3,700g, 4, 20min) 하였다. 상층액을분리한후 1/3 volume 의 saturated (NH 4 ) 2 SO 4 를첨가하였다. 4 에서 10 분간방치한후원심분리 (5,000g, 4, 20min) 하였다. 상층액을분리한후 2/3 volume 의 saturated (NH 4 ) 2 SO 4 를첨가하였다. 4 에서 20 분간방치한후 원심분리 (10,000g, 4, 20min) 하였다. 침전된 Pellet 을 PBS (ph 7.5) 로잘녹인후 5ml ultracentrifuge tube 로옮긴후, VTI 90 rotor 12

21 (Beckman, Palo Alto, CA, USA) 에서 71,000 rpm 으로 16 에서 3 시간 동안초원심분리하였다 16, Calcium phosphate transfection Calcium phosphate transfection 은 ProFection Mammalian Transfection systems (Promega, Obispo, CA, USA) 에따라시행하였다. 3 ug DNA 를 25 ul 의 2.5 M CaCl 2 가포함된증류수와섞어최종부피가 250 ul 가되게 하였다. CaCl 2 와섞인 DNA 용액을저어주면서 2 X HBS 용액 (HEPES buffered saline ; 50 mm HEPES, ph7.1, 280 mm NaCl, 1.5 mm Na 2 HPO 4 ) 250 ul 를한방울씩떨어뜨렸다. 혼합용액을 transfection 대상세포가깔려있는배양접시에천천히떨어뜨렸다. 16 시간후배지를제거한후, 새로운배지로바꾸어주었다. 5. X-gal 염색법과유전자형질도입율의결정 X-gal 염색을위해서세포들은고정액 (1% formaldehyde, 1% glutaraldehyde in dh 2 O) 에서 5 분간고정한후, 2 mm MgCl 2 가포함된 ferricyanide, 2 mm MgCl 2 in PBS) 으로 37 에서 4~16 시간동안 반응시켰다. raav 의유전자형질도입율은감염 48 시간후에 X-gal 염색으로결정하였다. 13

22 paav-rc paav-lacz phelper 293 T Fig.3 Construction scheme of a recombinant adeno-associated virus. paav-lacz, paav-rc, and phelper were co-transfected into 293T cells using calcium phosphate transfection. Recombinant AAV vectors were purified as described in material & methods 16,17,24. 14

23 유전자형질도입율은 100 배의해상도를가지현미경에서플레이트의크기와확대비율세포수를계산하여결정하였는데현미경상에서네곳이상의부위를무작위로정하여전체세포중염색된세포의비율을계산하였다. 6. MTT assay 96 well 플레이트에각각암세포를 1 X 10 4 세포 / 200 ul 가되게분주하였다. 다음날 sodium butyrate, trichostatin A 는 72 시간, hydroxyurea, etoposide, camptothecin, aphidicholin 는 20 시간. MG- 132, tyrphostin-1 는 2 시간씩암세포주에처리한후, 배지를제거하고 MTT(3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazoliumbromide, 5 mg/ml) 용액을 120 ul 씩첨가하여 37 항온기에반응시켰다. 4 시간후에 MTT 용액을제거하고 50 ul 의 DMSO 를첨가한후, 540 nm 에서흡광도를측정하여세포의상대적생존율을측정하였다. 7. RT-PCR α v integrin 을감지하기위한 RT-PCR 은다음과같은방법으로 진행되었다 27. total RNA 는 TRIzol (Invitrogen, Rockvile, MD,USA) 를 사용하여추출하였다. Genomic DNA 의오염을제거하기위하여, 전체 15

24 RNA(1 ug) 에 RQ1 RNase-free Dnase (Promega, Obispo, CA, USA) 를 1 시간동안 37 항온수조에서반응시켰다. 역전사반응은 Moloney murine leukemia virus reverse transcriptase (Invitrogen, Rockvile, MD, USA) 와 Oigo(dT) 15 primer (Pomega, Obispo, CA, USA) 를가지고 수행되었다. 역전사반응의 1 ul 를취하여 α v integrin 와 GAPDH 프라이머를사용하여 PCR 을시행하였다 : α v integrin 5 (sense), TAAAGGCAGATGGCAAAGGAGT 과 α v integrin 3 (antisense), CAGTGGAATGGAAACGATGAGC. GAPDH 5 (sense)-cct TCA TTG ACC TCA ACT AC- 3, GAPDH 3 (antisense), GGA AGG CCA TGC CAG TGA GC. PCR 반응은 95 에서 30 초, 55 에서 30 초, 72 에서 1 분간격으로 35 회실시하였다. PCR 생성물은 1% 아가로스젤에서분리하였고, ethidium bromide 염색하에서 UV 를조사하여관찰하였다. 16

25 III. 결과 1. 아데노바이러스의 co-infection 에의한 rave 의형질전환증가아데노바이러스는 raav 의형질전환에영향을준다고알려져있다 15. 아데노바이러스의초기유전자발현은재조합아데노부속바이러스의 replication - translational activation (E1A), mrna maturation (E1B and E4 ORF6), 그리고 translation enhancement (VA and E2A) - 이효율적으로일어날수있도록도움을준다. 본연구에서는아데노바이러스가 raav 벡터의유전자전달효율에영향을주는지를알아보기위하여뇌암 (U251), 결장암 (HCT116), 간암 (SK-Hep1), 그리고유방암 (MCF-7) 등의암세포주를이용하였다. raav 자체의감염능을알아보기위하여, raav-lacz 바이러스를각세포당 1000 개의바이러스 (1000 particles/cell) 를감염시켰다. 감염 2 일후에형질도입율을 X-gal 염색으로결정하였다. raav-lacz 바이러스 (1000 TU/cell) 의감염효율은극히일부분의세포만을감염 (0.02% 이하 ) 시켰다. 예상된바와같이, 아데노바이러스의 co-infecion 에의한 raav 의유전자전달효율은 10 배 ~100 배까지증가되었다 (Fig. 4, Table 1). 17

26 HCT 116 SK-Hep1 U 251 MCF-7 Mock raav lacz raav + Ad5 Rad-lacZ (MOI=5) Fig. 4. Transduction efficiency to various human cancer cells by raav encoding LacZ. Cells were seeded into 48-well plate. At 24 h later, the cells were infected with raav-lacz (1000 particles/cell) with/without Ad (MOI=5) for 2 h. Transduction efficiency was determined by X-gal staining at 48 h post-infection. (Magnification, 200X). 18

27 2. Chemicals 이암세포주에미치는세포독성측정 Chemical 처리에의한재조합아데노부속바이러스벡터의유전자전달 효율에관한연구를하기위하여뇌암 (U251), 자궁경부암 (Hela), 결장암 (HCT116), 간암 (SK-Hep1), 그리고유방암 (MCF-7) 등의암세포주를 이용하였다. 화학제로는 raav 의수용체발현을증가시키는 sodium butyrate, trichostatin 와, type II topoisomerase 저해제인 etoposide, type I topoisomerase 저해제인 camptothecin, DNA polymerase 저해제인 aphidicolin, 그리고 ribonucleotide reductase 를저해함으로써 DNA systhesis 를억제하는 hydroxyurea 와 MG-132, tyrphostin-1 등 raav 의유전자전달효율에관여한다고알려진것들을사용하였다. 우선, 세포에독성을미치지않는각화학제의적절농도를결정하기위하여각각의 chemical 을처리한후 48 시간만에 MTT assay 를시행하였다. Fig. 5 에서보면, NaB 의경우 3mM 의농도에서세포가생존율에거의영향을미치지않음을알수있고, 그농도로 raav 의유전자전달효율관련실험에이용하였다. TSA 의경우는 10 nm 의농도가적절함을알수있다 (Fig. 5). Aphidicolin, hydroxyurea, etoposide, 그리고 camptothecin 은각각 5 ug/ml, 4 mm, 10 um, 그리고 1 um 의농도까지세포가저항성이있음을알수있다 (Fig. 6, 7). 19

28 A Sodium Bytyrate (NaB) cell viability (% of mock-treated) U251 Hela MCF-7 SK-Hep1 HCT116 (mm) B Trichostatin (TSA) cell viability (% of mock-treated) (nm) U251 Hela MCF-7 SK-Hep1 HCT116 Fig. 5. Cytotoxicity by sodium butyrate and trichostatin A, histone deacetylase inhibitor. Cells were plated at a density of 1 x 10 3 /well in 96-well plates. Sodium butyrate (A) or trichostatin A (B) was respectively added, and the cells were allowed to grow for 48 h. The cell viability was measured by MTT assay. 20

29 A Aphidicolin Cell viability (% of mock-treated) U251 Hela MCF-7 SK-Hep1 HCT (ug/ml) B Hydroxy Urea Cell viability (% of mock-treated) U251 MCF-7 SK-Hep1 HCT (mm) Fig. 6. Cytotoxicity by aphidicolin and hydroxyurea, DNA synthesis inhibitors. Cells were plated at a density of 1 x 10 3 /well in 96-well plates. Aphidicolin (A) and hydroxyurea (B) was respectively added, and the cells were allowed to grow for 16 h. The cell viability was was measured by MTT assay. 21

30 A Camptothecin cell viability (% of mock-treated) (um) U251 Hela MCF-7 SK-Hep1 HCT116 B Cell viability (% of mock-treated) Aphidicolin (ug/ml) U251 Hela MCF-7 SK-Hep1 HCT116 Fig. 7. Cytotoxicity by etoposide and camptothecin, topoisomerase inhibitors. Cells were plated at a density of 1 x 10 3 /well in 96-well plates. Aphidicholin (A) and camptothecin (B) was respectively added, and the cells were allowed to grow for 16 h. The cell viability was measured by MTT assay. 22

31 A MG-132 Cell viability (% of mock-treated) (um) U251 Hela MCF-7 SK-Hep1 HCT116 B Tyrphostin-1 Cell viability (% of mock-treated) (mm) U251 Hela MCF-7 SK-Hep1 HCT116 Fig. 8. Cytotoxicity by MG-132 and tyrphostin-1, proteosome inhibitor and EGFR inhibitor, respectively. Cells were plated at a density of 1 x 10 3 /well in 96-well plates. MG-132 (A) and Tyrphostin-1 (B) was added, and the cells were allowed to grow for 2 h. The cell viability was measured by MTT assay. 23

32 또한 MG-132 은 20uM, tyrphostin-1 은 250mM 의농도가적당함을알수있다 (Fig. 8). SK-Hep1 의경우는 27mM turphostin-1 의농도부터세포가민감하게반응함을알수있다. 대체로 SK-Hep1 와 Hela cells 는모든 chemicals 에민감하게반응하는편이었다. Hela cells 에 hydroxyurea 를처리한경우는실험결과가일관적이지않아서생략하였다. 3. raav 벡터에의한유전자전달효율 raav 자체의감염능을알아보기위하여, raav-lacz 바이러스를각 세포당 1000 개의바이러스 (1000 particles/cell) 를감염시켰다. 감염 2 일후에형질도입율을 X-gal 염색으로결정하였다. raav-lacz 바이러스 (1000 TU/cell) 의감염효율은극히일부분의세포만을감염 (0.02% 이하 ) 시켰다. 다음으로는 chemicals 의처리에의해 raav 에의한유전자전달효율이증가되는지를알아보고자하였다. Etoposide (type II topoisomerase inhibitor), camptothecin (type I topoisomerase inhibitor), aphidicolin (DNA polymerase inhibitor), 그리고 ribonucleotide reductase 를저해함으로써 DNA systhesis 를억제하는 hydroxyurea 의처리는 DNA repair 에관여하는 DNA polymerase 의발현을순간적으로증가시켜 raav 의형질전환율을개선시킬수있다고알려져있다. 이는증가된 DNA polymerase 가 ss AAV genome 을 ds DNA 로의전환을촉진시키기때문에보여지는현상인것같다. 24

33 이런화학제가각각의세포에서효과를보이는지알아보기위하여각각의시약을처리한후, 그형질전환효과를비교해보았다. 각 chemical 의효과는사용된세포에따라다른결과를보였다 (Table 1). HCT 116 cells 에서는 hydroxyurea (5.2 배 ), trichostatin A (3.7 배 ) 의처리시높은유전자전달효율을보여주었다. SK-Hep1 에서는 MG-132 (8.5 배 ) 의처리시비교적유전자전달효율이높았고, MCF-7 의경우에는 aphidicolin (1.6 배 ), Hela cells 의경우에는 hydroxyurea (25 배 ) 의처리가유전자전달효율을높여주었다. 이러한결과는세포내에존재하는각기다른환경에따라, 각각의 chemical 반응이달라질수있음을반영한다. 또한, 같은농도의 chemical 을각각의세포에처리를하였을때, 세포가받는 cytotoxicity 도각각달랐다. Peptide aldehyde MG-132 는 proteasome 의강한 inhibitor 이다. raav 의감염은세포내에존재하는 proteasome 에의하여제거되어질수있다. 따라서자연상태에서 raav 에의한유전자전달효율은 proteasome activity 에의해제한적일수있다. 본실험에서는 MG-132 를처리하였을때, SK-Hep1 cells 의경우에는 MG-132 (8.5 배 ) 처리시효율이증가되었다 (Table 1). 그러나다른세포에처리하였을때는그효과가미비하였거나, 세포에많은손상을주었다. 25

34 Table 1. Effect of various chemical additives on transduction efficiency in various human cancer cell lines SK-Hep1 HCT 116 MCF-7 Hela AAV only TSA Aphi HU Etopo Campto MG-132 AAV + Ad Each of the cells was seeded onto a 48-well plate and treated with each chemical. After optimal treatment of each chemical, the respective chemical-containing medium was replaced with normal medium, and the cells were infected with 1000 particles per cell of raav-lacz for 2hr. Transduction efficiency was determined by X-gal staining at 48hr post- infection. The values represent the relative fold-increase of transduction efficiency campared to that by raav itself. 26

35 EGFR (Epidermal growth factor receptor) 에의해 ssdbp (singlestranded D-Sequence-binding protein) 이인산화그리고활성화되면, 이 ssdbp 는 raav 의 single-stranded D-sequence(ssDS) 에결합하여 ssdna 가 dsdna 로전환되는것을억제한다. Tyrphostin-1 은 EGFR 을저해함으로써, IB3 세포에서 raav 의형질전환을증가시킬수있다고알려져있다. Tyrphostin-1 이본연구에서도 raav 의형질전환을유도하는지를알아보았다. 그결과는 table 1 에서보듯이 Hela cells 와 MCF-7 cells 에서는 3 배정도증가시켰다. HCT116 과 SK-Hep1 세포에는그효과가미비하였다. raav 의유전자전달효율은 ssdna genome 이 dsdna genome 으로의전환효율에따라달라진다고알려져있다. 아데노바이러스는 raav 의복제를 위한 helper 바이러스로써알려져있다. 아데노바이러스 genome 에서 발현되는초기유전자인 E1A, E1B, E4, 그리고 E2A 의해 raav 의 ss DNA genome 이 dsdna 로전환이촉진됨으로써형질전환이증가된다고있다. 이러한사실이본연구에서도적용되는지를확인하기위해야생형아데노바이러스와 raav 를동시에감염시켜보았다. HCT 116 의경우는 100 배, Hela 와 SK-Hep1 세포의경우는 40 배, MCF-7 의경우 50 배까지형질전환효율을증가시켰다 (Fig. 4, Table 1). U251 세포의경우에는 chemical 에의한효과가거의보이지않았고, 또한세포에많은손상을주어서결과를생략하였다. 27

36 Histone deacetylase inhibitor 인 trichostatin A 는 raav 의 coreceptor 인 α v integrin 의발현을증가시킨다고알려져있다. 본연구에서는 raav 의 co-receptor 의발현양의증가가 raav 에의한형질전환효과를유도할수있는지를알아보기로하였다. Trichostatin A 처리에의해 α v integrin receptor 의발현이증가되었는지를알아보기위해, RT-PCR 을통해 mrna level 을측정하였다. 그결과, 각각의세포는어느정도 α v integrin receptor 를발현시키고있었고, trichostatin A 처리에의하여 α v integrin receptor 의발현양이증가됨을확인할수 있었다 (Fig. 9). 증가된 co-receptor 에의해 raav 의형질전환이 증가되는지를알아보기위하여, 동일한조건으로 TSA 를처리한후에, X- gal staining 을통해형질전환효율을비교해보았다. 그러나 raav 자체를 infection 한경우와비교하여 trichostatin A 처리에의한형질 전환효과는모든세포에서거의변화가없었다 (Table 1). 4. chemical 조합에따른 raav 의유전자형질도입율의비교 앞의결과에서보듯이, 각각의 chemical 은세포에따라그효과가 다르기때문에, 각단계 (1) raav 의 receptor 를통한감염, (2) 감염된 raav 의발현을위한핵까지의 trafficking, (3) ssdna 의 dsdna 로의 28

37 α v integrin GAPDH Fig. 9. RT-PCR analysis α V integrin of RNA in control and trichostatintreated cells. Cells were incubated with trichostatin A. Total RNA was isolated and RT-PCR was performed as described in materials and methods using GAPDH as an internal control. 1. Mock- treated control nm trichostatin treated nm trichostatin treated. 전환에관여하는각각의 chemical 의조합을통한결과는어떻게되는지를알아보고자하였다. Hela cells 에서 chemical combination 에의한효과는분명하게나타났다 (Fig. 10). Hela cells 에 camptothecin 와 MG-132 를을처리하였을때 raav-lacz 자체의감염보다형질도입율이각각 1.3 배, 9 배정도증가하는것으로나타났다. 각각의 chemical 을 combination 시켰을때는약 12 배로추가적인효과가나타났다. 29

38 A relative transduction efficiency drug Hela AAV only camp camp + MG-132 camp + tyr MG132 tyrphostin-1 HU HU + tyr B relative transduction efficiency MCF-7 1 drug AAV TSA Camptothecin HU HU+Tyr Tyr Fig. 10. Effect of combination of each chemial on the transduction frequencies of AAV vector. Cells were seeded into a 48-well plate and treated with each chemical as described in materials and methods. After optimal treatment of each chemical, the respective chemical-containing medium was replaced with normal medium, and the cells were infected with 1000 particles per cell of raav-lacz for 2 h. Transduction efficiency was determined by X-gal staining 2 days after infection. The values represent the relative fold-increase of transduction efficiency campared to that by raav itself. 30

39 Camptothecin (1.3 배 ) 과 tyrphostin-1 (3 배 ) 을 combination 시켰을때에도 9 배정도로 synergistic effect 가관찰되었다. Hydroxyurea (1.3 배 ) 와 tyrphostin-1 (3 배 ) 를처리하였을때에도 6 배정도로그효과가증가되었다 (Fig.10,A). MCF-7 cells 에서도마찬가지로 chemical combination 에의한형질도입율의증가가관찰되었다. Hydroxyurea 와 tyrphositin-1 을처리하였을때 raav-lacz 자체의감염보다형질도입율이각각 8 배, 3 배정도로증가되었다. 두 chemical combination 시에는 12 배정도로 additive effects 를관찰할수있었다 (Fig. 10). 다른세포에서도같은실험을하였었지만, 그효과가미비하여결과를생략하였다. 31

40 IV. 고찰 본연구에서는 raav 의유전자전달효율을증가시킨다고알려져있는 각각의화학적첨가제를서로조합함으로써여러가지암세포주에대한 raav 의유전자형질도입율을개선하고자하였다. 그결과 Hela cells 에서는 camptothecin 과 MG-132, camptothecin 과 tyrphostin- 1, 그리고 hydroxyurea 와 tyrphostin-1 의조합이현저하게 raav 에의한유전자형질도입율을증가시킨다는것을알수있었다 (Fig. 10A). MCF- 7 에서도 hydroxyurea 와 tyrphostin-1 의조합이 AAV 의유전자형질도입율을올릴수있다는가능성을보여주었다 (Fig. 10B). raav 의효과적인유전자전달을위해서는다음과같은사항들이고려되어야한다. 첫째, 바이러스가세포내로 uptake 되기위해서는자신의 receptor 와결합을하여야한다. Heparan sulfate proteoglycan 는 raav 의 receptor 로써잘알려져있고, fibroblast growth factor receptor 와 α v integrin 는 coreceptor 로알려져있다 27,28. 이러한 receptor 들이부족하거나세포막에서그것의 location 이 raav 의결합이용이하지않을때는유전자전달효율이떨어진다. 이러한바이러스의초기단계에관여하는 receptor 의발현을증가시키기위하여, trichostatin 의처리가 raav 의 coreceptor 인 α v integrin 발현을증가시키는지또한그발현 32

41 증가가 raav 의감염능을증가시키는지를알아보았다. RT-PCR 결과에의하면, TSA 를 30nM, 90nM 로증가시켰을때 α v integrin receptor 발현이증가함을알수있었다 (Fig. 10). 하지만 HCT 116, Hela, SK-Hep1, 그리고 MCF-7 모두에서 TSA 의단독처리는 raav 의유전자형질전환을거의유도하지못하였다. 이는아마도 TSA 에의해 raav 의 coreceptor 의발현증가가이루어졌지만, receptor 가세포막으로제대로 trafficking 이되지않아서 raav 가결합할기회가늘어나지않았기때문이거나, raav 가 α v integrin co-receptor 에의해충분한감염이이루어졌지만, 핵내로이동된 raav 의 ssdna genome 이유전자발현형태인 dsdna 로전환되는과정이원할하지않기때문에그효율이미미했을수도있다. Qing et al. 에의하면 coreceptor 의증가는 raav 의 receptor 결합을증가시킨다는보고는있지만 21 (Fig. 2), 이역시 co-receptor 자체만의효과는미비하였다. 둘째, 다양한 chemicals 이 raav 의형질전환을유도한다. DNA 에손상을주는 UV light 나 gamma irradiation 을주었을때 double-stranded vector DNA 의축적이증가된다는보고가있었다. 이러한결과는외부자극에의해 DNA 손상되었을때, 그것을극복하기위해세포내에일시적으로 DNA 중합효소발현이증가하게되고, 그증가된 DNA 중합효소가 raav 의 ssdna genome 을 dsdna genome 으로바꾸는데기여하는것으로보인다. 본연구에서는 hydroxyurea 를처리하였을때유사한결과를얻을수있었다. Hydroxyurea 는세포에활성산소 (Reactive oxygen intermediates,roi) 의 33

42 발생을증가시킴으로써세포내의 DNA 에손상을일으킨다고알려졌다 25,26. 이런 DNA 손상을극복하기위해 DNA repair 에관여하는 DNA 중합효소의발현이증가되고, 그증가가 raav 의유전자형질전환을증가시키는것으로보인다. 본실험에서 hydroxyurea 를처리하였을때, MCF-7 과 HCT 116 에서는 raav 의유전자전달효율이증가됨을알수있었다. 그러나, Hela 와 SK-Hep 1 에서는그효과가거의관찰되지않았다 (Table 1). Topoisomerase 저해제인 camptothecin 과 etoposide 의경우에도각각의 처리되는세포에따라그효과가다르게나타났다. Camptothecin 의 경우에는 HCT 116 에서약 10 배까지효율을증가시켰고, etopocide 의 경우에는 SK-Hep 1 에서약 5 배정도까지효율을증가시켰다. 이는각각의 chemical 이세포에따라다른효과를준다는것을알수있다. 그리고 Proteasome 활성억제는 raav 벡터를핵내로좀더효율적으로이동시킴으로써그벡터의형질전환효율을증가시킬수있다. 그러나, proteosome 억제제인 MG-132 를가지고여러번의시도를했지만세포에너무많은손상을일으켜서그효과를확인하지는못했다. 다만, Hela 에서는세포가많은손상을받았지만 ( 약 30% 손상 ) 9 배까지효율이증가되었다. MG-132 에의한 raav 형질전환을좀더연구하기위하여, 앞으로 MG-132 의농도와처리시간을변화시킴으로써좀더효율적이고, 세포에안전한조건을찾으려고시도중이다. 또한 EGFR 은 ssdbp 를인산화시키고, 인산화된 ssdbp 는 raav 의 terminal repeat (TR) 에있는 D 34

43 sequence 와결합하여 dsdna 로의전환을억제한다. EGFR 억제제인 tyrphostin-1 을처리하면 EGFR 의 downstream 신호전이를억제함으로써, ssdbp 를억제하게되고, raav 의 ssdna genome 을 dsdna 로전환이용이하게할수있다. 하지만, 이 chemical 도세포에약간의손상을주는것으로보인다. Hela 와 MCF-7 에서 3 배정도미비한효율증가가관찰되었다 (Table 1). 이런미비한효과는 chemical combination 에의하여더욱증가시킬수있었다. Hela cells 에 camptothecin 와 MG-132 를을처리하였을때 raav-lacz 자체의감염보다형질도입율이각각 1.3 배, 9 배정도증가하는것으로나타났다. 각각의 chemical 을 combination 시켰을때는약 12 배로추가적인효과가나타났다. Camptothecin (1.3 배 ) 과 tyrphostin-1 (3 배 ) 을 combination 시켰을때에도 9 배정도로 synergistic effect 가관찰되었다. Hydroxyurea (1.3 배 ) 와 tyrphostin-1 (3 배 ) 를처리하였을때에도 6 배정도로그효과가증가되었다 (Fig. 11,A). MCF-7 에서도마찬가지로 chemical combination 에의한형질도입율의증가가관찰되었다. Hydroxyurea 와 tyrphositin-1 을처리하였을때 raav-lacz 자체의감염보다형질도입율이각각 8 배, 3 배정도로증가되었다. 두 chemical combination 시에는 12 배정도로 additive effects 를관찰할수있었다 (Fig. 10). 하지만, tyrphostin-1 은 EGFR 뿐아니라세포내스트레스반응 (stress response) 에도영향을주는것같다. 이시약의처리에의해많은세포가손상을받았다. 그러므로처리가능한적절한시약농도를결정하고, 35

44 raav 의유전자형질효율을증가시킬수있는조건을찾는일이시급한 과제라고할수있다. 또한각각의 chemical 이작용하는기전과그것에 반응하는세포들에관한좀더많은연구가선행되어져야할것이다. 36

45 IV. 결론 본연구는재조합아데노부속바이러스의낮은유전자형질도입율을개선하기위하여각종화학물의첨가에따른유전자형질도입율을향상시킬수있는방안들을찾고자계획되었다. 재조합아데노부속바이러스에의한유전자전달효율이 Hela, SK-Hep1, MCF-7 등의각종인체암세포주를대상으로하였을때약 0.02% 정도로매우낮았지만, hydroxyurea, camptothecin, tyrphostin-1, MG-132 등과같은 chemical 을처리하였을때그형질전환효율이크게증대됨을확인할수있었다. 또한이러한 chemicals 을동시처리 (chemical combination) 하였을때에는 Hela 와 MCF-7 에서 additive effect 를관찰할수있었다. 또한이러한조건에서바이러스및화학물의처리에따른부작용은발견되지않았다. 따라서본연구결과는재조합아데노부속바이러스의 유전자전달효율이 인체암세포주의종류와 chemical 에따라차이가 있을수있지만, 성질이다른화학물의단독처리, 특히화학물의동시 첨가에의하여개선되어질수있음을보여주었다. 이는향후재조합아데노부속바이러스를이용한유전자전달의 유용성에또다른가능성을제시한다. 37

46 참고문헌 1. Blaese RM, Culver KW, Miller AD, Carter CS, Fleisher T, Clerici M et al. T lymphocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years. Science 1995;270: Ma HI, Lin SZ, Chiang YH, Li J, Chen SL, Tsao YP et al. Inratumoral gene therapy of malignant brain tumor in a rat model with angiostatin delivered by adeno-associated viral(aav) vector. Gene therapy 2002;9: Luo J, Kaplitt MG, Fitzsimons HL, Zuzga DS, Liu Y, Oshinsky ML et al. Subthalamic GAD gene therapy in a parkinson s disease rat model. Science 2002;298: Wu N, Ataai MM. Production of viral vectors for gene therapy applications. Cur Opin Biotechnol 2000;11: Boris-Lawrie K, Temin HM. The retroviral vector-replication cycle and safety considerations for retrovirus-mediated gene therapy. Ann NY Acad Sci 1994;716: Benihoud K, Yeh P, Perricaudet M. Adenovirus vectors for gene delivery. Cur Opin Biotechnol 1999;10: KR Clark, X Liu, JP Mcgrath, and PR Johnson. Highly purified recombinant adeno-associated virus vectors are biologically active 38

47 and free of detectable helper and wild-type viruses. Human Gene Ther 1999;10: J Bennett. Immune response following intraocular delivery of recombinant viral vectors. Gene ther 2003;10: X Xiao, J Li, TJ McCown, and RJ Samulski. Gene transfer by adenoassociated virus vectors into the central nervous system. Exp Neurol 1997;144: Alexander, DW Russell, and AD Miller. Effects of gamma irradiation on the transduction of dividing and nondividing cells in brain and muscle of rats by adeno-associated virus vectors. Hum gene ther 1996;7: NS Templeton, DD Lasic. Gene therapy : therapeutic mechanisms and strategies. Basel(NY) : Marcel Dekker,Inc ; Srivastava A, EW Lusby, and KI Berns. Nucleotide sequence and organization of the adeno-associated virus 2 genome. J Virol 1983;45: Richardson WD and Westphal H. Requirement for either early region 1a or early region 1b adenovirus gene products in the helper effect for adeno-associated virus. J Virol 1984;51:

48 14. West MH, Trempe JP, Tratschin JD, and Carter BJ. Gene expression in adeno-associated virus vectors:the effects of chimeric mrna structure, helper virus, and adenovirus VA1 RNA. Virology 1987;160: Ferrari FK, Samulski T, Shenk T, and Samulski RJ. Secon-strand systhesis is a rate-limiting step for efficient transduction by recombinant adeno-associated virus vectors. J Virol 1996;70: Hermens W, Brake OT, Dijkhuizen PA, Sonnemans M, Grimm D, Kleinschmidt JA, and Verhaagen J. Purification of recombinant adenoassociated virus by iodixanol gradient ultracentrifugation allows rapid and reproducible preparation of vector stocks for gene transfer in the nervous system. Hum Gene Ther 1999;10: Ried MU, Girod A, Leike K, Buning H, and Hallek M. Adenoassociated virus capsids displaying immunoglobulin-binding domains permit antibody-mediated vector retargeting to specific cell surface receptors. J Virol 2002;76: Salvetti AS, Oreve S, Chadeuf G, Favre D, Cherel Y, Champion- Arnaud P et al. Factors influencing recombinant adeno-associated virus production. Hum Gene Ther 1998;9:

49 19. Summerford, C, and RJ Samulski Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. J Virol 1998;72: Summerford C, Bartlett JS, and Samulski RJ. α v integrin:a coreceptor for adeno-associated virus type 2 infection. Nat Med 1999;5: Qing K, Kah C, Hansen J, Zhou S, Dwarki V, and Srivastava A. Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat Med 1999;5: Douar A, Poulard K, Stockholm D, and Danos O. Intracellular trafficking of adeno-associated virus vectors:routing to the late endosomal compartment and proteasome degradation. J Virol 2001;75: Fisher KJ, Gao G, Weitzman MD, Dematteo R, Burda JF, and Wilson JM. Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand systhesis. J virol 1996;70: Clark KR, Voulgaropoulou F, and Johnson PR. A stable cell line carrying adenovirus-inducible rep and cap genes allows for infectivity titration of adeno-associated virus vectors. Gene ther 1996;3:

50 25. Devary Y, Rosette C, DiDonato JA, and Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal. Science 1993;261: Sanlioglu S and Engelhardt. Cellular redox state alters recombinant adeno-associated virus transduction through tyrosine phosphatase pathways. Gene ther 1999;6: Kitazono M, Goldsmith ME, Aikou T, Bates S, and Fojo T. Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR Cancer research 2001;61: Kitazono M, Rao VK, Robey R, Aikou T, Bates S, Fojo T, and Goldsmith ME. Histone deacetylase inhibitor FR enhances adenovirus infection of hematopoietic cells. Blood 2002;99: Russell DW, Alexander IE, and Miller AD. DNA systhesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proc Nat Acad Sci,USA 1995;92: Hansen J, Qing K, Kwon H, Mah C, and Srivastava A. Impaired intracellular trafficking of adeno-associated virus type 2 vectors limits efficient transduction of murine fibroblasts. J Virol 2000;74:

51 31. Qing K, Hansen J, Weigel-kelley KA, Tan M, Zhou S, and Strivastava A. Adeno-associated virus type 2-mediated gene transfer:role of cellular FKBP52 protein in transgene expression. J Virol 2001;75: Smith AD, Collaco RF, and Trempe JP. Enhancement of recombinant adeno-associated virus type 2-mediated transgene expression in a lung epithelial cell line by inhibition of the epidermal growth factor receptor. J Virol 2003;77:

52 Abstract Enhancement of gene expression by recombinant adeno-associated virus by various chemical treatments Sung Jin Kim Department of Medical Science The Graduate School, Yonsei University (Directed by Professor Jin Woo Chang) Recombinant adeno-associated virus (raav) has been recently drawn an attention as a gene delivery system with the advantage of long-term and efficient gene expression in various cell types, especially neuronal and muscle cells. However, transduction efficiency by raav is still low, which may explain its limited application, even in neuronal cells in vitro. To overcome this drawback of raav system, I have tried to enhance the transduction efficacy using many different kinds of chemicals which can have an effect on DNA synthesis, cell cycle or raav receptor expression. To elucidate the enhanced transduction efficacy, I investigated the 44

53 enhanced transduction efficacy of raav expression by treatment or combination of seven chemicals (Trichostatin A as an inducer of raav receptor expression, Aphidicolin and Hydroxyurea as a DNA damaging agent, Etopocide and Camptothecin as a DNA synthesis blocker, MG-132 as a proteosome inhibitor, and Tyrphostin-1 as a EGFR inhibitor) in five different human cancer cell lines (cervical Hela, colon HCT 116, breast MCF-7, hepatocellular carcinoma SK-Hep 1, and glioma U 251). Hydorxyurea increased the transduction efficiency by 25- or 5-fold in Hela or HCT 116 cells, respectively. MG-132 increased the transduction efficiency by 8.5-fold in SK-Hep 1 cells. Co-treatment of MG-132 and camptothecin enhanced the transduction efficiency by 12-fold in Hela cells. The combined treatment of hydroxyurea and tyrphostin-1 also enhanced the transduction efficiency by 12-fold in Hela cells. Finally, MTT assay data consistently showed that cytotoxicity was not observed in any concentrations of each chemical used in this study. In conclusion, the transduction efficiency of raav mediated transgene expression could be significantly enhanced in human cancer cells by chemical combinations. This may be of wide application to other cells, such as primary neuronal cells, neural progenitor cells 45

54 as an optimized gene delivery condition with highly improved transduction efficiency. Key Words : recombinant adeno-associated virus(raav), transduction efficiency, chemical combination, camptothecin, hydroxyurea, tyrphostin-1, MG