44-5(01) fm

Size: px
Start display at page:

Download "44-5(01) fm"

Transcription

1 KOREAN J. FOOD SCI. TECHNOL. Vol. 44, No. 5, pp. 503~525 (2012) 총 설 The Korean Society of Food Science and Technology 식품의원산지판별분석 최진영 1 방경환 2 한기영 노봉수 * 서울여자대학교식품공학과, 1 한북대학교식품영양학과, 2 농촌진흥청국립원예특작과학원인삼특작부 Discrimination Analysis of the Geographical Origin of Foods Jin-Young Choi 1, Kyong-Hwan Bang 2, Kee-Young Han, and Bong-Soo Noh* Department of Food Science and Technology, Seoul Women's University 1 Department of Food and Nutritional Sciences, Hanbuk University 2 Ginseng Research Division, National Institute of Horticultural and Herbal Science, Rural Development Administration Abstract Consumers are increasingly concerned about the origin of foods, so the geographical origin of foods has been a major topic of debate and extensive research. Various instrumental methods (e.g. high performance liquid chromatography (HPLC), gas chromatography (GC), capillary electrophoresis (CE), electronic nose, near-infrared spectroscopy (NIRS), nuclear magnetic resonance spectroscopy (NMR), DNA analysis, multi-isotope analysis) in conjunction with statistical analysis, were developed and applied in attempt to provide reliable answers to their geographical origin. This study reviews current developments in the application of various methods for a clear geographical origin of foods. The limitation of discrimination analysis for geographical origin was also discussed. Keywords: Foods, Geographical origin, Instrumental analysis, Statistical analysis, Discrimination 서 식품의원산지표기는자신이제조, 생산, 판매한제품의품질이우수하고독특한맛을가졌거나또는안전하다는것을소비자들에게믿게하기위하여이를마케팅의목적으로활용하는데에서시작하였다. 한지역의특산물에는그지역의기후나토양조건으로인한특성, 제조방법뿐만아니라문화나역사적으로의미있는사실이연관되어져있어전통성을가지게되는데, 이처럼지역의특산물이라고만알아왔던식품들이국가간의물량이확대교환되면서외국산농산물뿐만아니라가공제조품의원산지도경쟁시장에서각축을벌이고있다. 각나라마다제품에대한우수성을알리기위한전략의하나로원산지표시제를활발히활용하고있는실정이다. 원산지표기가특정제품을선택할수도있고거부할수도있는방법으로활용가능하기때문에원산지표기를정확하게하는것이매우중요한일이되었고, 식품에따라서여러국가의원료가혼합되어있는경우수입산이라고표시하고있으나보다구체적으로해당국가나지역을표시하여소비자의알권리를보호해줄수있는정확한원산지표시제를실시하기에이르렀다. 명확한원산지표시를한좋은품질의식품들에대한소비자들 *Corresponding author: Bong-Soo Noh, Department of Food Science and Technology, Seoul Women s University, Seoul , Korea Tel: Fax: Received July 23, 2012; revised September 11, 2012; accepted September 20, 2012 론 의관심이급격하게증가하고있다. 유럽연합에서는 PDO(Protected Designation of Origin, 원산지표시보호제 ), PGI(Protected Geographical Indication, 지리적표시보호제 ), TSG(Traditional Speciality Guaranteed, 전통특산품인증제 ) 와같은식품표시보호제에대한참여를장려하고있다. 이것은식품의원산지를판별하는적절한기술이매우많이필요하다는것을의미한다. 원산지간차이를유발하는요인들은 Fig. 1 과같이크게 5 가지로구분해서생각해볼수있다. 어떤품종을선택을하느냐에따라서달라질수있는데, 쌀의경우우리나라에서 200 여가지로생산되고있어서품종간에차이가많기때문에국내산쌀과수입산쌀간의원산지를판정하는데에어려움이많다. 기후조건에따라식물체가영양섭취를하는정도즉대사작용의차이에의해서도원료및제품의품질이다르게나타날수있다. 예를들어가뭄이든시기에생산된포도주와그렇지않은경우포도맛의급격한차이를가져와원산지판별에도큰영향을미친다. 토양또한중요한요인이되는데오랫동안농사를지어지력이약화되어각종영양소가공급되는정도가다를수있기때문이다. 이외에도재배조건이다르기때문에같은포도주라도어떤과수원에서수확하였느냐에따라다소차이가나며이러한차이가제품품질의차별화를가져오는요인이되기도한다. 재배조건뿐만아니라어떻게가공처리하는가의문제또한중요하다. 치즈생산의경우숙성시사용되는미생물의종류에따라각기독특한향기를갖는제품을생산할수있다. 이러한문제들이한가지요인에의해서만이루어지는것이아니라복합적으로작용하여이루어지기때문에분석에의해한가지성분만을대상으로하기보다는여러가지성분의복합적양상인패턴을바탕으로판별하기에이르렀고이런패턴을잘표현할수있는분석방 503

2 504 한국식품과학회지제 44 권제 5 호 (2012) Fig. 1. Five factors induced to the differences in the geographical origin of food products. 법등이활용되고있다. 국내유통중인식품원료중선정한식물성원료 16 종 139 품목에대한농약잔류량을분석한결과 19 품목에서농약이검출되었다. 인삼 ( 건삼, 수삼, 분말, 농축액 ) 은 6 품목에서 chlorpyrifos, quintozene, BHC(benzene hexachloride) 가, 홍삼의경우 1 품목에서 quintozene, BHC 가, 운지버섯은 3 품목에서 chlorpyrifos 가, 구기자는 3 품목에서 chlorpyrifos 와 α-endosulfan 이, 쑥 1 품목과오미자 2 품목에서검출된농약은 chlorpyrifos 이었고, 천궁은 3 품목에서 chlorpyrifos, aldrin, α-endosulfan tecnazene 이검출되었다 (1). 나라마다허용된농약과잔존량에차이가있어이를이용하여원산지를판별할수도있다. 중국에서는현재대한민국에서사용이금지된농약들을사용하고있어이들농약성분검출로쉽게판별이가능하기도하다. 원산지판별방법은최근관심을갖기시작한분야로기존의이화학적인성분분석에의한판별방법은분석소요시간과비용의손실이크고실험오류가발생하기쉬운단점이있어근래에는식품의원산지판별에근적외선분광분석법, 전자코등전처리과정없이분석이가능한다양한비파괴기술이도입되고있다 (2). 여기서는그동안원산지판별에활용되었던분석방법을토대로살펴보고, 식품별로원산지를판별한연구가어떻게진행되었는지그리고각분석기술들이무엇이문제였는지또한원산지를판별하는데한계점으로대두되는문제들에대하여살펴보고자한다. 분석방법 원산지판별에많이활용된분석기기로는 mass spectrometry를원리로한 isotope ratio mass spectrometry(irms), inductively coupled plasma mass spectrometry(icp-ms), gas chromatogrphy mass spectrometry(gc-ms) 등이있으며 spectroscopy 원리를토대로한 nuclear magnetic resonance(nmr), infrared spectrocopy (IR), 형광물질을분석하는 fluorescence spectroscopy 등이있으며, 무기염류및중금속을측정분석하는 atomic absorption spectroscopy(aas) 등이있다. 한편특정성분을분리하여분리된성분을토대로원산지를판별하는방법으로 high performance liquid chromatography(hplc), 미량의대사산물이나휘발성분을분석하여측정할수있는 gas chromatography(gc), 전기영동방법을이용하여분리하는 capillary electrophoresis(ce) 등이분리기술을바 Table 1. Overview of analytical techniques which can be used for determination of the geographical origin of food products Principle Specific forms of the technique Spectroscopy Low resolution NMR High resolution NMR Fourier transform IR (FTIR) Mid-infrared IR (MIR) Near-infrared IR (NIR) Front-face fluorescence spectroscopy Atomic absorption spectroscopy (AAS) Atomic emission spectroscopy (AES) Mass spectrometry 탕으로하고있다 (3). 이외에도센서기술을이용하여패턴분석을활용한전자코, polymerase chain reaction 을적용하여 DNA 구조를밝힘으로써식품의원료및제품의원산지를판별하는방법이있으며미네랄이나중금속의분포패턴을토대로판별할수있는 X-ray fluorescence(xrf) 방법이있다 (Table 1). 이들기기들은방법이간단하고분석시간이적게걸리며감응도가좋은장점등을가진방법들이있는반면에가격이높거나적용가능한시료가적은단점들이있어서 (Table 2) 원산지판별을하고자하는시료와각분석기기들의장단점을잘파악하고선택하는것이무엇보다도중요하다. 일반성분분석원산지에가장많이미치는요소는토양이며토양에따라원산지를판별하고자하면우선먼저금속성분의차이를살펴보아야한다. 금속성분이외에도항산화물질로대변할수있는총페놀함량이라든가 (4) 지방산의조성및분포상태라든가아미노산의함량패턴등이수입산과국내산을구별하는데에도움을제공하기도한다 (5). 꿀제품의원산지를판별하는데활용된방법으로단백질의패턴이다른것을활용할수있으며플라보노이드와같은특수성분의함량이나전기전도도와같은물리화학적요소를바탕으로꿀의원산지를판별할수가있다 (6). 이러한방법들은원산지판정에대한욕구가형성되기시작한초기에주로많이활용된방법이었으며전반적으로분석방법에소요되는시간이걸려신속하지가못하며시약이나전처리과정을요하고있어현장에서바로판정하는데에는한계를안고있다. 최근에는비파괴적인분석방법으로가능한전처리가생략된방법으로신속하게분석하는방법들이많이활용되고있으며특별한경우정밀분석을요하는경우별도의분석기기를활용하여산지별차이를파악하는데활용하고있다. GC/MS Continuous flow IRMS (CF-IRMS) Dual inlet IRMS (DI-IRMS) Gas chromatography mass spectrometry (GC-MS) Separation High performance liquid chromatography (HPLC) Gas chromatography (GC) Capillary electrophoresis (CE) Others Electronic nose Polymerase chain reaction (PCR) Sensory analysis GC/MS 등에의한기기분석방법은대체로휘발성향기성분에관여하는여러성분의종류와농도를밝힐수있도록물리적

3 식품의원산지판별분석 505 Table 2. Overview of several characteristics of the analytical techniques which can be used for determination of the geographical origin of food products Techniques Sensitivity Simplicity Time analysis Compounds Identification/profiling Spectroscopy NMR +/ +/ Various i+p IR +/ + + Various p Fluorescence Various p Atomic +/ +/ +/ Elements i+p MS IRMS + +/ +/ Various i+p ICP-MS + +/ + Elements i+p GC-MS + + +/ volatile i+p Separation HPLC +/ + +/ Various p GC + + +/ volatile p CE + +/ Various p Other Sensor technol. + + Volatile p PCR + +/ +/ DNA i+p Sensor analysis +/ +/ Various p The characteristics include the sensitivity and simplicity of the analytical tool, time of the analysis, instrumental costs, number of reported applications for determining the geographical origin, types of compounds which are analysed and possibility of identifying (i) and/or profiling (p) (including chemometrics) these compounds. Favourable (+), moderate (+/ ), unfavourable ( ). 으로의미있는절대값을재현성있게얻을수있고, 관능검사와는달리측정자의기분이나주위환경에영향을받지않는다. 다만얻어진 peak 의수나성분이많은경우판별상의어려움이따른다. 특히커피와같은경우 1,000 여개의 peak 를얻게되는경우도있는데가장영향력이큰성분들을대상으로다변량통계분석방법을활용하거나또는 VaporPrint TM 과같은소프트웨어를활용하면그판별이비교적용이하여비전문가들도쉽게판별을할수가있다. GC/MS 등에의한기기분석방법은향의종류와농도를구할수있고재현성이있으나, 고가의장비가요구되며, 사람이인식하는식품내에서의각성분들의상호작용에의한향특성을표현해낼수없을뿐아니라한성분의피크면적이크다고하여사람도그향을강하게느낄수있는것은아니라는단점이있어항상그타당성을관능검사를통해비교확인하여야하며높은상관관계가인정될때에만비로소사용가치가있다 (7-9). 사람의관능검사와 GC 를병행하는 GC 와연결된 olfactometry(gco) 방법 (10) 이개발되었는데, 이방법도 GC, GCO 모두복잡한전처리과정을거쳐야하므로많은시간과노동력이필요하고아울러숙련된작업자가요구되어중소기업형태의작업장이나공장에서는손쉽게사용하기가어려운문제점을안고있다. ICP-AES 유도결합플라즈마질량분석기 (inductively coupled plasma-mass spectrometry; ICP-MS) 에의한검정은시료가가지고있는극미량의무기원소성분함량을분석하여각원소별농도를데이타베이스화하여이를그룹별로통계처리하여판별식을작성하고이와비교하여검정시료의원산지를판별한다. 식품의원료가성장환경에따라특징적인무기원소들을함유하게되는데해당지역의지질학적특징을이용하여여러측정원소를분석하고이를이용하여판별할수있다. 특히여러가지원소를동시에분석할수있을뿐만아니라검출한계도낮고재현성이뛰어나며정밀 도가높아생산지역의차이에의한분석이용이하다. 문제가되었던점은원하는원소만정확히측정되는것이아니고원치않는동일한질량의다른분자이온도측정함으로써간섭을일으킬수있다는점이다. 그런가하면제품속의중금속함유량과더불어원산지를동시에알수도있는데고정밀극미량무기원소분석기인 ICP-AES(inductively coupled plasma-atomic emission spectroscopy) 를이용하면무기질성분과중금속함유량을측정할수있어원산지도동시에알수있다 (11). Capillary electrophoresis(ce) 외형적특성만으로는원산지파악이어려운곡류의품질이나품종판별을위하여주로전기영동, 크로마토그래피등을이용한분석에이용되어져왔다. 그러나이러한분석법은분석시간이나비용이많이드는단점이있다. 최근기존의분석방법보다속도와분리도가뛰어나고분석에필요한시료량을최소화할수있으며정량적인분석이가능한새로운분리법으로 CE 가적용되기시작하고있다. CE 는전기영동과같이기본적으로전기장에서의시차이동 (differential migration) 에따라분석이이루어지나 gel 이없는 free solution 상태에서분석하는것으로전하를띤이온이반대의전극으로이동하는전기적인이동과 capillary 내벽의표면전하로인해생기는액체의흐름에의해이동하는 electro-osmotic 이동에의해분리되는방법으로결과적으로전기력에따라분석하고자하는성분이이동하면서 concentration-sensitive detector 위치를지날때전기적인신호가생겨이를검출하는방법이다. 이방법은 SDS- 전기영동이나 HPLC 로분리가능한물질들에모두적용할수있으며전처리가까다로운시료도쉽게분석할수있어최근여러방면에서신속한분리법으로개발응용되고있다 (12,13). 하지만 CE 의데이터해석이쉽지않은점등의문제점이있다. 근적외선분광분석기 (Near-Infrared Spectroscopy: NIRS) 원산지규명은기존의 NIR 과 FT-IR 등분자구조등을이용하

4 506 한국식품과학회지제 44 권제 5 호 (2012) 여통계적으로처리하는방법을사용하여원산지규명을한다. 근적외선스펙트럼은중간적외선과가시광선사이에해당되며, nm 의영역이다. 근적외선스펙트럼은기본적으로분자진동운동에기인하며 C-H, N-H, O-H 등의작용기의분자이동에너지의결합 (combination) 과배음 (overtone band) 에의해나타난다. 스펙트럼이명확하지않고복잡한형태로나타나기때문에각피크에대한해석이어렵다. 최근에는컴퓨터의발전과더불어개발된계량화학 (chemometric) 을통해정량및정성분석에이용되는데 1960 년대초부터이를활용한분석방법으로농산물의원산지검사에주로이용되어왔다. NIR 의발전초기에는필터 (filter) 방식의기기가주류를이루었으며, 근대에는분산형 (dispersive) 방식의기기를사용하였다. 하지만필터방식의기기는파장의선택한계로인하여충분한데이터를확보하지못하는단점이있었다. 분산형 NIR 은단색광장치에들어있는 grating 의기계적인회전과슬릿의움직임으로인하여파장의정확성및분해능이떨어지고장비의낮은안정성으로시료의성상이복잡하거나정밀한분석을원하는경우에는사용이부적합한문제점이있다. 퓨리에변환근적외선분광분석기 (Fourier Transform Near- Infrared Spectrometer: FT-NIR) 는간섭계를사용하면이러한단점을해결하였으며, 여기서얻은신호를컴퓨터가퓨리에변환을함으로써스펙트럼을획득하는발전된방식을채택하였다. He- Ne 레이저를장착하여파장의위치를언제나정확하게조절함으로써기기의정확도와안정성을분산형에비해 배까지획기적으로개선하였다. FT 방식의이러한이점은기존의필터와분산형방식의 NIR 에서는접근이어려웠던, 복잡한구조를가지는물질과미량성분정량이가능하게되었다. NIR 에적용가능한시료의농도는고체의경우약 0.1% 이상, 액체의경우 500 ppm 이상이며유기수용액중의수분농도와같은경우기준분석법에따라다르지만일반적으로 50 ppm 의낮은농도도측정이가능하다. NIR 기술에서정확성은습식분석을기준으로하기때문에습식분석법보다정확하지는않지만정밀성은 10 배이상뛰어나다. NIR 은비파괴분석법으로화학약품을이용한전처리가필요없어시료의화학적조성변화가없으며분석시간은 1 분이내로빠른편이다. 여러성분을동시에분석하는것이가능하며고체, 분말, 액체등의모든상태의시료에대하여측정이가능하다. 기기운영유지비가저가라는장점을갖고있다. 그러나상대정량분석법이므로보정과검증에사용할시료의습식분석이반드시수행되어야하며사용되는시료는물론, 전체시료에대하여대표성을가지고있어야한다. 아울러전농도에걸쳐서골고루채취하는것이바람직하며예측모델을개발하기위해서는상당히많은시료에대한사전분석이필요하다. 검정대상품목별, 산지별로수집된표준시료에근적외선을조사하여시료에함유된유기성분에서발생되는흡광에너지값 (spectrum data) 을구해데이터베이스를작성한다음통계분석을이용하여원산지별판별검량식을작성하고검정대상시료의분석결과를원산지별검량식에대비하여원산지를판별한다 (13). 이를이용하면미지시료의다양한성분을매우짧은시간내에간단하게측정할수있으며, 액체시료를 NIR 을이용하여측정할경우가장큰문제는항상일정한온도로시료를측정해야재현성이있고신뢰성있는스펙트럼을획득할수있는단점을내포하고있다. NIRS 는종전의외형에대한육안판별방법과는달리농산물중의유기성분을분석하여원산지판별에응용하는방법 (14) 으로 시료를원형그대로하여비파괴적인분석이가능하나정확도를높이기위해서는빛의투과와분산을최소화하기위해미세한입자로분말화해야하는전처리과정이필요하다. 시료의입자크기및균일성정도에따라분석결과에큰영향을미치기때문에품목에따라동일한전처리과정이요구된다. DNA 분석 DNA 분석방법중에서동식물의종, 품종, 개체등의차이를관찰하기위해최초로적용된분자기법은제한효소단편다형성 (Restriction Fragment Length Polymorphism: RFLP) 으로써 (15), 이방법은실험대상 DNA에제한효소인지부위가있는지의여부에따라서절단되는단편의크기가차이가나는것을관찰하는것으로이기법을이용하여다양한유전자지도가작성된바있다. 하지만 RFLP는많은양의 template DNA가필요하고실험에오랜시간이소요되는등인력과경비가다른기법들에비해많이소요되는단점이있다. 한편특정 DNA를빠른시간내에증폭할수있는 PCR(Polymerase Chain Reaction) 기술이개발됨에따라 (16), 이를바탕으로 RAPD(Random Amplified Polymorphic DNA), AFLP(Amplified Fragment Length Polymorphism), SSR(Simple Sequence Repeats) 등의분석방법이개발되었으며, 특히특정염기서열을직접비교분석할수있는 sequencing 기술은게놈염기서열을해독하는장비인 DNA sequencer의지속적인개발과더불어최근눈부신성장을이루고있다. RAPD는 RELP나 sequencing과는달리유전자염기서열에대한사전정보가없는생물체에도사용할수있으며, 분석방법이간단하고실험에소요되는비용도저렴하기때문에현재까지도동식물의종의판별등다양한목적으로유용하게활용되고있다 (17). AFLP 기법은 RFLP 방법을변형한것으로 DNA를제한효소로처리한후특정 primer 를이용하여 PCR을수행하는방법으로 (18), 실험결과상대적으로많은수의 DNA 단편을확보할수있어유전적인다형성을관찰하기에는유리하나 PCR 산물확인시 silver staining을해야하는등실험방법이상대적으로어려운점이있다. 그리고 SCAR(sequence characterized amplified region) 기법은 RAPD나 AFLP로부터얻어진특정 DNA 단편을유전자클로닝하여염기서열을분석한다음 primer 를새롭게제작해 PCR을행한후유전양상을확인하는방법으로, 실험결과의재현성이높은장점을갖고있다 (19). 한편진핵생물의게놈에는반복적인 DNA 염기서열이존재한다고알려져있는데 (20), 이중초위성체 (Microsatellite: MS) 또는초위성체의다른이름인단순염기서열반복 (Simple Sequence Repeats: SSR) 은유전체전반에널리분포하는 2-6개의단순하게반복되는염기서열을대상으로 DNA 변이를분석할수있는방법이다 (21,22). SSR 마커를개발하기위해서는반복염기서열의클론확보, 염기서열분석및프라이머제작등초기개발비용이많이소요되는어려움이있지만, 유전자의위치마다많은대립유전자들 (alleles) 을가지고있고다형성지수 (Polymorphic Information Content: PIC) 를높아서유전적인차이를분석하는데이상적인공우성마커로알려져있다. DGES(degenerating gel electrophoresis scanning) 방법은 DNA 고유의 melting 속도의차이를이용하여전기영동시에나타나는 degenerating DNA밴드의숫자와이동위치이상을관찰하는방법인데 (23), 시험방법이다소어렵지만넓은범위의유전자를동시에검사할수있고특정유전자의다양성을일차적으로조사하는데효과적인결과를보이는것으로알려져있다. 또한 STS

5 식품의 원산지 판별분석 507 (sequence tagged site) 기법은 특정 클론들을 대상으로 염기서열 을 분석한 후 다양한 primer를 제작하여 단일염기서열의 다형성 (Single Nucleotide Polymorphism: SNP) 또는 염기서열의 삽입 또 는 결실(Insertion or Deletion: InDel)을 확인하는 방법으로 최근 동식물의 품종 판별 등의 목적에 많이 활용되고 있다(24). 전자코(electronic nose) 전자코에 의한 검정은 검정하고자 하는 시료가 가지고 있는 고 유의 향기 성분을 전처리를 행하지 않고 시료 그대로를 특수한 센서를 이용하여 각 시료별로 분석하고 이 때 얻어진 분석 데이 터를 통계분석하여 나타난 패턴을 활용하여 검정시료의 원산지 를 판별한다. 다른 분석방법은 특정성분의 분석을 위해 전처리 과정을 실시하고 있으나 전처리 과정 중에 미세하지만 휘발성분 의 손실이 예상되는바 이런 문제를 극복하고자 도입된 방법이 전 자코의 활용이다. 최근 유럽이나 북미 등지에서도 자국 농민들을 보호하는 차원 에서 이에 관련된 기술이나 관심도가 높아지고 있는 실정이다. 포도주나 치즈의 경우 자국 생산품, 지역 생산품임을 강조하기 위하여 품질관리 목적으로 전자코를 활용하기에 이르렀다. 이탈 리아 사람들이 즐겨먹는 살라미의 경우 각 지역 소시지 공장에 서 제조되는 것을 판별하기 위하여 metal oxide semiconductor (MOS)의 전자코를 사용하여 산지는 물론 미생물관리에도 사용 한 바 있다(25). 원산지 판별에 사용된 상업용 전자코는 초기에 MOS와 conducting polymer 센서로 구성된 센서 모듈이 이용되어 다변량 통 계 분석에 의하여 판별되는 1세대 전자코였으나 기존의 1세대 전 자코는 센서의 수나 종류에 따라서 측정할 수 있는 것에 한계가 있으며 MOS의 경우 습도에 영향을 받으며 1년에서 1년 반 정 도 이후에는 센서를 교체해야 하는데 이때 baseline이 차이가 발 생하여 이를 보정해 주어야 한다. 물론 소프트웨어가 이를 보정 하여 주기는 하나 번거로움이 뒤따른다. 뿐만 아니라 headspace 에 존재하는 휘발성분을 측정할 때 시료 중에 포함된 에탄올이 방해하므로 이 경우 purge, trap, 그리고 prevaporization 등의 과 정을 거쳐 에탄올을 제거하는 과정을 거치는데 이 경우 미세한 휘발성분마저도 손실되는 경우가 있어 알코올음료의 분석시에는 전처리 과정을 거쳐야 하는 불편이 따른다(26). 제1세대 전자코의 문제들을 해결하기 위하여 GC 혹은 MS가 접목된 제2세대 전자코들이 소개되었다. GC와 surface acoustic wave(saw) 센서를 바탕으로 한 z-nose의 경우 우선 머무름 시간 에 따라 시간적 차이를 두고 SAW센서와 반응을 하기 때문에 순 차적인 반응에 의하여 마치 수백 개의 센서를 사용한 것과 같은 효과를 가져 왔으며 이렇게 얻어진 휘발성분에 대한 크로마토그 램을 olfactory image를 통하여 Fig. 2와 같이 뚜렷하게 제시함으 로써 국내산과 수입산 농산물의 차이를 시각적으로 알기 쉽게 판 별하였다(27,28). 전자코의 경우는 신속하게 향기를 측정해내는 이점이 있으나 적절한 센서의 선택과 on-line 적용시, 측정하는 목적 향기 외에 외부의 향기가 유입되어 오차를 발생시킬 수 있 다는 단점이 있다. 이런 문제는 별도의 차단된 방에 분석기기를 설치하고 방내 습도, 온도, 신선한 공기 등을 조절하여 분석하면 문제는 극복될 수가 있다. 또 다른 형태로 MS를 바탕으로 한 전자코는 휘발 성분을 ion fragments로 분해하여 제시되는 mass spectrum중 차별성이 높은 30여개를 토대로 다변량통계 분석을 거쳐 패턴 분석에 의한 원 산지를 판별할 수가 있다. 이 경우 MOS나 conducting polymer 센서에서 야기되는 baseline의 차이 문제를 아르곤과 같이 비활 Fig. 2. Polar derivative patterns for the domestic (top) and the imported Cnidium officinale (bottom) using VaporPrintTM (27). Number means retention time (sec) of GC. 성물질을 기준으로 normalization을 함으로써 극복할 수가 있으며 자동 시료채취 방법을 통해 보다 많은 시료를 연속적으로 분석 할 수 있는 장점을 갖고 있다(29). 에탄올이 함유되어 있는 시료의 경우 기존의 전자코 분석에서 는 에탄올이 방해 요인으로 작용하는데 반하여 MS를 바탕으로 한 전자코에서는 분자량이 적은 에탄올의 ion fragments 통계 처 리시 변수로서 고려하지 않고 제거해 버림으로써 이로 인한 문 제를 해결할 수 있는 장점이 있다. 뿐만 아니라 시료가 매우 극 소량인 경우 inside needle extraction 방법을 사용하면 휘발성분을 injection syringe 내부에 흡착시켰다가 주입할 수가 있어 어떠한 손실 없이도 손쉽게 판별이 가능하며 액체, 고체, 분체 등 다양 한 시료에 대해서도 판별이 가능하다. Energy dispersive x-ray fluorescence spectrometer(edxrf) X-선 형광분석기(XRF)에 의한 검정은 고전압을 이용하여 강한 X-선을 발생시켜 시료에 조사하면, 형광현상에 의해 시료에 포함 된 무기원소별로 방출되는 고유의 형광 X-선을 검출하여 얻어진 원소의 종류와 양을 그룹별로 통계처리로 판별식을 작성하여 검 정시료의 원산지를 판별한다. EDXRF는 번거로운 산분해와 같은 전처리 과정이 필요 없어 간편하므로 전처리 과정에서 발생하는 오차가 적으며, 분석 비용 이 저렴하고, 분석 소요시간이 빠르고 여러 무기원소의 동시 분 석이 가능한 비파괴 분석법이다. 그러나 감응도는 ppm 수준이며 가벼운 원소는 분석이 어려운 단점을 가지고 있다(2). 이러한 단 점에도 불구하고 일반적으로 수입산과 국내산 농산물간에는 토 양의 차이, 관리방법, 기후 등에 따라 무기질 함량차이가 있다는 점에 착안하여 EDXRF를 이용하여 국산과 수입산 농산품 및 한

6 508 한국식품과학회지제 44 권제 5 호 (2012) 약재의다량무기질함량을분석하여원산지판별이가능하다. 신속하게분석을하는경우일단무기원소들의분포정도를비교하여판별할수있다. 이경우각각의무기원소의양을정량적으로분석하지않아도상대적인분포정도만으로도원산지를판별하는것이가능하기때문이다. 좀더정밀한무기원소분석이요구되는경우 ICP-MS 를이용할수도있다. 핵자기공명 (Nuclear magnetic resonance: NMR) 방법자기장내에서원자핵의자기모멘트에특정한외부의에너지가작용하여그에너지를흡수하고다른에너지준위로전이하는현상또는이를이용한분광법을말한다. 물질의특성분석에서의학분야까지널리이용되고있는핵자기공명방법은분자를연구하는과학적수단으로화학과고체물리분야에서널리사용되며, 시료에손상을주지않는분석방법으로서값비싼핵산이나 RNA, DNA, 단백질의특성을분석하는데사용된다. NMR 은시료의전처리가필요없는신속한비파괴검사방법으로시료를채취하여분석하기까지약 1 분의시간이소비될뿐다른처리가필요없기때문에 on-line 상에도입하여실용화하는데어려움이없다. 이탈리아남부지역과품종을달리한 durum wheat 의원산지를 NMR 분석으로비교해본결과 80% 정도의정확도를나타내었고 (30), 한국산, 중국산, 수단산참깨도각각 % 의원산지판별이가능하여 (31), NMR 방법이전처리없이빠르고정확하게원산지를판별할수있음을보여주었다. HPLC HPLC 는분리도가높고정확도와정밀도가 % 로높은편이다. 자료처리단계까지자동화가가능하지만기기및용매등운영비가고가이고실험방법에대하여오랜숙련도를필요로한다. 또한만족할만한검출기가없기때문에여러종류의검출기를각각의목적에맞게사용해야하는점과컬럼의선택도성분에따라각기바꾸어주어야한다는단점이있다. 또한분석하고자하는성분이외의다른물질을제거해야하므로전처리과정 이꼭필요하여시간과노력이많이요구된다는한계점을갖고있다. 원산지를검증하는데에는그렇게많이활용되고있지는않으나특정성분을확인하고자하는경우에드물게이용된다. 다중기기분석방법한가지기기분석만으로측정이어렵거나원산지를정확히판별하기위해여러가지기기를이용하여산지판별을하는다중기기분석방법이있는데실제로이용되는경우의예를들면 Table 3 과같다 (32). 어느시료의경우전자코의판별능력이높은경우도있고또어떤시료는 NIRS 가그분석능이뛰어난경우가있다. 그런경우두가지의기기를모두활용하면오차의범위를더욱줄일수가있다. 한가지분석기기로모든종류의시료를분석하는데다활용할수는없다. 각각의기기가갖고있는한계점을극복하여오차를최소화하기위해서는다른분석기기를활용하여해당기기가갖는한계점을극복하는것이바람직하다. 따라서 2-3 개의분석기기로같은시료에대한분석이이루어져야하는것이다. 그러한예로전자코와더불어 X-ray 형광분석광도계를이용하여길경의원산지판별을시도한결과 97.3% 의확률을보여주었는데단일기종에의한분석결과보다도훨씬더좋은결과를얻을수있었고 (33), GC 및 GC-TOF-MS 등으로꿀의휘발성분의패턴을분석하고원산지를판별하였다 (6). 현재국립농산물품질관리원에서는단일기종으로원산지판별이어려운품종에대해서는전자코이외에근적외선분광법이나, 형광분광법, 또는 capillary electrophoresis 등의 2-3 가지분석방법을함께활용하여보다높은판별확률로오차를최소화하고있다 (34). 식품및원료의원산지판별 쌀과곡류쌀의경우외관및일반적인물리화학적성질을분석하거나혹은쌀을가공하여밥상태에서조직감등을토대로비교분석할 Table 3. Summary of the relevant literature relating to the use of multi-isotope analysis of food commodities to the determine the geographical origin Food Parameters Instrumental and pattern analysis Reference number Meat Beef 18 O/ 16 O IRMS 35 Beef Se AAS 36 Beef 2 H/ 1 H`, 13 C/ 12 C, 15 N/ 14 N, 34 S/ 32 S IRMS PCA 37 Beef 2 H/ 1 H`, 13 C/ 12 C, 15 N/ 14 N IRMS ( 1 H, 2 H, 13 C NMR) DA 38 Lamb 13 C/ 12 C, 15 N/ 14 N, IRMS CDA 39 Dairy products Milk 13 C/ 12 C, 15 N/ 14 N, 18 O/ 16 O IRMS 40 Milk 18 O/ 16 O IRMS ( 1 H NMR) DA 41 Milk 18 O/ 16 O IRMS 42 Butter 13 C/ 12 C, 15 N/ 14 N, 18 O/ 16 O, 34 S/ 32 S, 87 Sr/ 86 Sr IRMS, TIMS DA 43 Butter 13 C/ 12 C, 15 N/ 14 N, 18 O/ 16 O, 34 S/ 32 S, 87 Sr/ 86 Sr IRMS, TIMS DA 44 Cheese 13 C/ 12 C, 15 N/ 14 N IRMS PCA, LDA 45 Cheese 2 H/ 1 H`, 13 C/ 12 C, 15 N/ 14 N, 34 S/ 32 S, 87 Sr/ 86 Sr, ME IRMS, Q-ICP-MS, TIMS, α-spectrometry ANOVA, PCA 46 Cheese 2 H/ 1 H`, 13 C/ 12 C, 15 N/ 14 N, 34 S/ 32 S IRMS, AAS (NIR, electronic nose) PCA 47 Cheese 87 Sr/ 86 Sr MC-ICP-MS, TIMS 48 Cheese 13 C/ 12 C, 15 N/ 14 N, 18 O/ 16 O, 34 S/ 32 S IRMS 49

7 식품의원산지판별분석 509 Table 3. Continued Food Parameters Instrumental and pattern analysis Reference number Beverage Coffee AAS, GF-AAS, EA, INAA 50 Coffee XRF PCA 51 Coffee 2 H/ 1 H`, 13 C/ 12 C, 15 N/ 14 N IRMS LDA, CART 52 Tea ICP-AES PCA, LDA, ANN 53 Tea ICP-AES, Q-ICP-MS PCA, LDA 54 Tea ICP-AES, Q-ICP-MS PCA, LDA 55 Orange juice 13 C/ 12 C IRMS 56 Orange juice ICP-AES, Q-ICP-MS PCA 57 Cereal crops Rice ICP-AES, Q-ICP-MS PCA, CA 58 Rice 11 B/ 10 B`, 87 Sr/ 86 Sr, Cd Q-ICP-MS, MC-ICP-MS 59 Rice 13 C/ 12 C, 18 O/ 16 O IRMS, Q-ICP-MS CDA 60 Rice 87 Sr/ 86 Sr MC-ICP-MS 61 Wheat 13 C/ 12 C, 15 N/ 14 N IRMS PCA 62, 63 Wheat 13 C/ 12 C, 15 N/ 14 N, ME Q-ICP-MS, IRMS CDA 64 Wine Wine 87 Sr/ 86 Sr TIMS 65 Wine 13 C/ 12 C, 18 O/ 16 O IRMS 66 Wine (D/H)1, (D/H)2 AAS, NMR ANOVA, PCA 67 Wine (D/H)1, (D/H)2 AAS, NMR PCA, CDA 68 Wine Q-ICP-MS CDA, PCA 69 Wine 87 Sr/ 86 Sr, 18 O/ 16 O IRMS, TIMS 70 Wine 13 C/ 12 C, 18 O/ 16 O IRMS, SNIF-NMR 71 Wine 87 Sr/ 86 Sr MC-ICP-MS 72 Wine 207 Pb/ 206 Pb` Q-CP-MS, TOF-ICP-MS 73 Wine 13 C/ 12 C, 18 O/ 16 O IRMS, SNIF-NMR PCA, ANN 74 Wine 87 Sr/ 86 Sr MC-ICP-MS 75 Wine 13 C/ 12 C, 18 O/ 16 O, (D/H)1, (D/H)2 IRMS, SNIF-NMR 76 Wine 13 C/ 12 C, 18 O/ 16 O, (D/H)1, (D/H)2 IRMS, SNIF-NMR 77 Wine ICP-AES, HPIC PCA, HCA, RDA 78 Wine 87 Sr/ 86 Sr Q-ICP-MS 79 Wine 2 H/ 1 H, 18 O/ 16 O, ME IRMS, ICP-MS CDA 80 Other commodities Honey Review 81 Potatoes ICP-AES PCA, CDA, ANN 82 Vegetable oils 18 O/ 16 O, 13 C/ 12 C IRMS 83 Vegetable oils 18 O/ 16 O, 13 C/ 12 C IRMS CA, PCA 84 2 H/ 1 H, The ratio of the isotope of hydrogen with atomic mass 2 to the isotope of hydrogen with atomic mass 1; 13 C/ 12 C, The ratio of the isotope of carbon with atomic mass 13 to the isotope of carbon with atomic mass 12; 15 N/ 14 N, The ratio of the isotope of nitrogen with atomic mass 15 to the isotope of nitrogen with atomic mass 14; 18 O/ 16 O, The ratio of the isotope of oxygen with atomic mass 18 to the isotope of oxygen with atomic mass 16; 34 S/ 32 S, The ratio of the isotope of sulfur with atomic mass 34 to the isotope of sulfur with atomic mass 32; 87 Sr/ 86 Sr The ratio of the isotope of strontium with atomic mass 87 to the isotope of strontium with atomic mass 86; ME, Multielement Analysis; ANOVA, Analysis of Variance; ANN, Artificial Neutral Network; CA, Cluster Analysis; CART, Classification and Regression Tree Analysis; CDA, Canonical Discriminant Analysis; HCA, Hierarchical Cluster Analysis; LDA, Linear Discriminant Analysis; PCA, Principal Component Analysis; ASS, Atomic Absorption Spectrometry; EA, Elemental Analysis (Dumas Combustion); GF, Graphite Furnace; HPLC, High Performance Liquid Chromatography; HPIC, High Performance Ion Chromatography; ICP-AES, Inductively Coupled Plasma-Atomic Emission Spectrometry, ICP-OES, Inductively Coupled Plasma-Optical Emission Spectrometry, INAA, Instrumental Neutron Activation Analysis; IRMS, Isotope Ratio Mass Spectrometry; MC-ICP-MS, Multiple Collector-Inductively Coupled Plasma-Mass Spectrometry; NMR, Nuclear Magnetic Resonance Spectrometry; Q-ICP-MS, Quadrapole-Inductively Coupled Plasma-Mass Spectrometry; RDA, Regulariged Discriminant Analysis, TIMS, Thermal Ionization Mass Spectrometry; TOF, Time-Of-Flight; SINF-NMR, Site-specific Natural Isotope Fractionation-Nuclear Magnetic Resonance; XRF, total reflection X-Ray Fluorescence analysis 수있다. 수입된찐쌀및중국에서시판되고있는브랜드쌀의품질, 아밀로그램및물리적특성등을분석하여국내산브랜드쌀과의미질을비교한결과완전미비율은 94.1% 였고, 중국브랜드쌀인소참도가 86.5% 로상대적으로낮았는데이것은싸라 기함량이 10.5% 로상당히높았기때문이었다. 특히중국산찐쌀에서는금이간쌀이 83% 로대부분을차지하였고, 싸라기함유율또한 12.5% 로나타나완전미는전혀찾아볼수없었다. 아밀로즈함량은국내산일품쌀과중국산갱관및소참도등에서

8 510 한국식품과학회지제 44 권제 5 호 (2012) % 정도였으나일차적으로쪄서말린가공된중국산찐쌀의경우 46.6% 로매우높게조사되었다 (85). 중국산브랜드갱관은수분함량이낮았으며, 중국산찐쌀은모든조사항목에서밥맛과관련하여밥맛을떨어뜨리는쪽으로수치가높게나타나식용으로사용하기에는부적절한정도로식미치가낮았다. 실제로일품벼로밥을지으면형체가뚜렷이보이지만중국찐쌀로밥을지었을경우쌀알의모양을유지하고있는밥을찾아보기가어려웠다. 뿐만아니라고체상태의시료를삼킬수있는상태로만드는성질로점탄성에탄성을곱하여구한저작성도일품벼가중국찐쌀에비해높았다. 이처럼중국산의경우보관, 저장상태가균일하지못하고저장기술이떨어져쉽게판정이이루어지나미국산의경우품질관리가잘이루어져정밀한분석을요구하고있다. 쌀은품종이다양하고보관에따른수분함량의차이가있으며, 수확시기상의차이와낟알크기상의문제로인하여원산지를판별하는데한계가있다. 이러한한계점을극복하기위한방법으로 Yasui 와 Shindoh(58) 는 ICP-AES 와 ICP-MS 를사용하여현미 34 종류의벼에서 27 개지역의차이를구별하였고, Kelly 등 (60) 은 IRMS 와 ICP-MS 을사용하여쌀에서 13 C, 18 O, 붕소, 홀뮴, 가돌리늄, 마그네슘, 루비듐, 셀레늄, 텅스텐의 9 개의요소를이용하여미국, 유럽, 인도및파키스탄지역원산지판별을하였다. 이처럼해당지역의토질성분의차이로인하여무기물의섭취정도가다른것을이용하여분석하는방법도있다. 일반적으로원산지간의차이가나는것은바로토양의무기성분들이중요한요소가되며이러한무기성분에대해서는 ICP-MS, XRF 등에의해이루어질수도있으나토양과비료등을구성하는요소인수소, 탄소, 질소, 산소와스트론튬, 납성분등이중요한요소가된다. 이들의비율, 특히동위원소의비율은바다로부터의거리, 고도, 위도, 습도등지역적특성을잘대변하여주는것으로알려져있어최근원산지판별을위해많이이용되고있다. Ariyama 등 (86) 은 87 Sr/ 86 Sr, 납의동위원소 ( 204 Pb, 206 Pb, 207 Pb, 208 Pb) 의비율을토대로보리와밀의원산지가호주산인것과다른국가로부터생산된것을판별하였고 Zhao 등 (87) 은밀의원산지를여러금속성분을분석하여다변량방법에의해판별하였다. 그러나이런방법을사용할때중요한것은방대한양의데이터베이스를사전에확보해야한다는점이다. 특히기후조건에따른차이를고려하였을때최소 3 년정도의시료에대한데이터를확보하고있어야올바른판별을내릴수있다. CE 를곡류품종판별에이용한 Bietz 와 Schmalzried 가글리아딘분석을통한밀의품종판별을시도한것을시작으로귀리와쌀, 옥수수, 보리및수수등에적용되어왔고우리나라에서는국내산쌀의품종판별및재배지역에따른차이식별을 CE 를이용하여수행한바있다 (12). NMR 의신호응답과분자구조간의관계는통계알고리즘이필요한데이러한방식을통해이탈리아남부지역과품종을달리한 durum wheat 의원산지를비교해본결과 80% 정도의정확도를보여주어 (30) 다른원산지판별분석방법에비하여다소정확도가떨어지는것으로나타났다. 그렇다고모든시료에대하여정확도가떨어지는것은아니며구성하고있는성분에따라다소차이가날수있는데특히 durum wheat 의경우정확도가낮게나타난것이다. 감자동위원소를이용하는방법은주로이산화탄소, 물, 암모니아, 이산화질소등으로부터얻어지는원소들의비율로예상을하는 데탄소는주로식물체로부터기인되고, 질소는땅으로부터, 산소는해당지역의물로부터유래가되므로이들의동위원소비율을예측해패턴으로관찰해보면대체로해당지역의농축산물의원산지를판별하는것이가능하다. 이탈리아지역의여러곳으로부터생산된감자의원산지를판별하고자동위원소를사용한결과 91.7% 의판별력을보였는데 (88) 이들동위원소와더불어휘발성분을다변량통계프로그램에활용하여분석한결과원산지판별을 100% 정확하게구분할수가있었다. 이처럼두가지방법을혼용하는경우정확도가매우개선이되는경우도있다. 콩황색콩과검은콩의원산지를판별하기위하여일반성분을분석한결과황색콩은조지방함량만이원산지별차이를나타내었고, 검은콩의경우에는수분과단백질함량이원산지별차이를보였다. 20 MHz pulsed NMR 을이용하여자기완화시간및고형지방함량을측정한결과황색콩은고형지방함량과 T-CPMG(spinlattice relaxation time-carr-purcell-meiboom-gill) 측정시원산지에따라유의적인차이를나타내었으며, 검은콩은 T-SR(spin-spin relaxation time-saturation recovery) 을제외한모든측정항목에서원산지별차이를나타내었다. 황색콩과검은콩의원산지판별분석시일반성분만으로정준판별분석을시행한결과 % 의정확도를나타내었으나, NMR 이자기완화시간및고형지방함량을이용한경우 100% 의정확성으로원산지를판별해낼수있었다 (89). 일반적인성분으로원산지를판별하기는쉽지않다. 그것은수많은성분을모두다비교를해보아야하기때문이다. 그러나특정성분의경우해당지역에서만검출되는경우가있는데콩의경우품종에따라서특정지역에서산출된것중이소플라본의특정성분만검출이되어이를토대로원산지를판별할수있으며 (90), 나아가열처리나다양한가공처리를거친식품이라할지라도이러한특정성분의검출을확인할수있다면가공식품의원산지를판별하는열쇠가될수있다. 율무 2000 년및 2001 년의국산및수입산율무총 240 점을 capillary electrophoresis(ce) 로분석한결과국산및수입산율무의판별율은 2000 년시료에서는국산이총 47 점중 39 점 ( 판별율약 83%), 수입산은총 48 점중 39 점 ( 판별율약 81%), 2001 년시료는국산총 74 점중 60 점 ( 판별율약 81%), 수입산은총 71 점중 59 점 ( 판별율약 83%) 이었으며전체적으로약 82% 의판별율을나타내었다 (12). 율무처럼수입하여보관중인원료와약재를판매하는경우가있다. 이런경우냉장고에서일정기간을거친것은상대적으로향기성분이차이가있기마련이다. 그러나율무의원산지판별을위하여 2000 년, 2001 년의국산및수입산율무를대상으로관찰한결과수입년도에따른큰차이를보이지않는시료도존재하는것을알수있다. 참깨참깨의원산지를판별하기위하여일반성분및 low field NMR 을이용하여 relaxation time 을측정하였다. 일반성분으로는한국산, 중국산및수단산간의 NMR 데이터중 T-CPMG(spin-lattice relaxation time-carr-purcell-meiboom-gill) 를제외한나머지측정항목인 T 1 -IR(inverse recovery), T 1 -SR(saturation recovery), T 1 -SE (spin echo), SFC(solid fat content) 는원산지별유의적인차이를보였다. 가장유의적인차이가높았던 SFC, IR, SR 을이용하여정준판별분석을시행한결과수단산은 100% 판별이가능하였

9 식품의원산지판별분석 511 Fig. 3. Result of discriminant analysis for geographical origin using second derivative NIR spectra data of the Korean ( ) Chinese ( ) and Japanese ( ) sesame seeds (91). 고, 한국산및중국산은각각 80, 90% 의정확성을나타내었으며, 위의 5 가지 NMR 측정항목을모두사용하여판별한결과한국산, 중국산, 수단산이각각 95, 90, 100% 의원산지판별이가능하였다 (31). 3 개국간의원산지판별에서먼저일본산참깨판별을수행한뒤, 한국산참깨와중국산참깨의판별식을이용하므로 3 개국간원산지가 100% 판별가능함을알수있었다. 일본산과한국산은거의겹쳐지지않았으나한국산과중국산에있어다소중첩되는것을볼수있다 (Fig. 3). 필터형근적외분석장치로도유사한정확도로참깨의원산지판별이가능함을알수있었다. 원산지가다른참깨가서로혼합된경우, 원산지를판별해야하므로당연하게정확도는낮아질수있으나판별율 100% 인검량식으로원산지를감정하여판별율이낮게나오면의당혼합된것으로의심해볼수있다 (91). 수입산의일부가혼합된정도를알아본연구들도있는데원산지가다른원료를일부만국내산원료와바꾸어혼합함으로써유사제품을만들어팔고있는실정이다. 일반적으로향이강한참깨제품의경우기름함량에따라, 또한수입년도에따라차이가날수있으며이런경우전자코등에의해미세한변화를구분하는것이가능하다. 전자코장치를이용하여한국산및중국산참깨로제조한참기름의판별여부를다변량분산분석과판별분석의통계기법을사용한결과 Table 4 와같이국산과중국산간의품종간의냄새차가뚜렷하게나타나품종간 flavor 판별능력이우수함을보여주었고, 재배지역간에도유의적차이가있으나종자간의차이보다그크기가상대적으로다소적은것으로해석되었다. 따라서한국품종이중국에서재배될경우에도한국품종의특성을유지하는경향이강한것으로추측되었고재배지보다는품종의영향이더강하게나타난다고본다면보다다양한시료에대한분석이뒷받침되어야한다 (92). 도토리국내산및중국산도토리가루의일반성분을분석한결과국내산도토리가루의조단백질이 6.85% 로가장많이함유되어있었으며도토리가루의지방산조성에대한결과는다소많은차이를보였다. 중국산도토리가루의경우국내산에비해모든아미노산의함량이매우낮은특징을나타내었고, 국내산도토리에가장많이함유되어있는글루타민산은총아미노산중약 15.58% 를차지하며, 중국산의경우 14.4% 로국내산보다적게함유되어있는것을알수있다. Proline 함량은국내산도토리가루가 Table 4. Volatile components of Korean and Chinese sesame oils Peck No. Volatile components Sesame oil (area %) 1 pyridine pyrazine + 1) 3 2-pentyl furan pentanol methyl pyrazine methyl thiazole ,4-dimethyl thiazole + 8 methyl pyridine - 9 2,5-dimethyl pyrazine ,6-dimethyl pyrazine ethyl pyrazine ,3-dimethyl pyrazine methyl ethyl pyrazine ethyl-5-methyl pyrazine trimethyl pyrazine ethyl-2,5-dimethyl pyrazine ethyl-3,5-dimethyl pyrazine (acetyloxy)-propanone acetic acid - 20 furfural ethenyl-5-methyl pyrazine (2-furanyl)-ethanone pyrole + 24 benzaldehyde + 25 furfuryl acetate pentyl pyridine methyl-2-furfural propionyl furan methoxy pyridine + 30 furfuryl propionate + 31 acetyl pyrazine dehydro-2(3h)-furanone furfuryl alcohol acetyl-6-methyl pyrazine acetyl-5-methyl pyrazine acetyl-4-methyl thiazole + 37 methyl nicotinate + 38 guaiacol acetyl pyrol + 40 phenol h-phrol-2-carboxaldehyde methyl-2-pyrol carboxaldehyde + 43 eugenol + 1) : 1.0% 2) : not detected 중국산도토리가루보다높게나타났는데, 이러한결과로볼때국내산도토리가루가중국산에비해탄력성이뛰어날뿐만아니라빵이나소면등의제품개발에도유익하다. 그리고총페놀함량은국내산도토리가루가 20 mg/g 으로높은함량을나타낸반면에, 중국산은 3mg/g 으로매우낮아국내산도토리의페놀성물질들이상대적으로항산화, 항균, 항암등의생리기능을더많이가지고있다 (5).

10 512 한국식품과학회지제 44 권제 5 호 (2012) 섯의원산지를판별한결과 139 개의국내산시료중 131 개는국내산으로판별하였고수입산 75 개중 74 개는수입산으로판별하여전체정확도는 95.8% 로나타났다 (29). 한편 NIRS 에의한원산지판별에서신선도의영향이고려되지못하여북한산시료가수입산으로판별하기에는모호하였으나 MS 를바탕으로한전자코로분석한경우그러한문제점들이나타나지않아수입산으로판정되어상대적으로높은정확도를보여주었다. 원산지판별에서예상되는수확시기에따른영향을알아보는실험에서국내산시료일부가보관상태에따른영향으로수입산으로판정되기도하였다. 실험실에서는시료가일정하게관리보관될수있으나현장에서는보관상태에따른향의변화로원산지판별의정확도를떨어뜨리는문제점이있을수있다. Fig. 4. A (top): The raw NIR spectra of domestic Tricholoma matsutake and the imported one. Domestic Tricholoma matsutake; ( ), the imported one; ( ). B (bottom): The first derivative NIR spectra of domestic Tricholoma matsutake and the imported one. Domestic Tricholoma matsutake; ( ), the imported one; ( ) (95). 송이버섯송이버섯의원산지판별은주로외관상특성으로구별하는주관적인방법에의해이루어지고있어사법처리및국제교역의원활화를위하여객관적인방법에의한판별이요청되고있다. 객관적인방법으로 GC-MS 를이용하여분석한결과국내산송이버섯성분을바탕으로주성분분석에의해가열처리전후과정에서송이버섯의등급화한연구결과를제시한바있고 (93), 이런접근방법과는달리산림속에있는다양한외생균근균혹은목재부식균들에대한계통분류적연구를바탕으로국내산송이의 18S rdna 의염기서열을밝힌바있어 (94) 수입산송이버섯과의차별가능성을모색하기도하였다. 그러나이러한방법들은여러단계의전처리과정을요구하고있으며신속한분석을요하는현장에서는사용상의한계가있어 Fig. 4 와같이 NIRS 을이용하기도한다. 259 개의국내산시료중 256 개는국내산으로판별하였고 (98.84%) 수입산 81 개중 60 개는수입산으로판별하였으나 (74.07%) 21 개의북한산은판별하기가모호하여잘못판정한것으로간주할때시료판별의전체정확도는 92.94% 로나타났다. Modified partial least square(mpls) 에따른분석의경우상관계수는 0.84, 검량선의표준오차는 15.10%, 예측표준오차는 18.30% 이었다 (95). 질량분석기를바탕으로한전자코시스템을이용하여송이버 꿀 XRF 와같은일반적인성분을분석시꿀의점도가높기때문에희석하여측정해야하는불편이뒤따르며벌들마다침속의단백질패턴차이를 SDS 전기영동을통해판별하는방법들이알려져있으나 (96) 꿀을어떤식물체로부터채취한것인지와더불어어느나라에서생산된것인지여부도확인하여야하는경우도있다. 이탈리아산 Robina 로부터 14 종, Rhododendron spp. 로부터 30 종, Citus spp. 로부터 20 종, 헝가리산 Robina 로부터 6 종등 70 종류의꿀을확보하여 3 개의 MOS 로구성된전자코로분석하여주성분분석을시행한결과, 제 1, 2 주성분값에의하여 4 그룹으로구분이뚜렷하게이루어졌으며이러한자료를인공신경망에반복학습시킨시스템을이용하여미지의 17 종류의꿀에대하여원산지및식물체의종 (spp.) 을 100% 정확히맞출수있다 (97). 한편 Lammertyn 등 (98) 은 6 개의다른품종으로부터채취한꿀들과사탕무와사탕수수로부터각각만든설탕용액을제조하여함께비교분석한결과 GC-SAW 를바탕으로한전자코에서얻어진크로마토그램과향기스펙트럼을이용하여주성분분석과정준판별분석을실시하여 94% 의확률로구분됨을보여준바있다. 이처럼높은확률로원산지및각각다른식물체로부터얻어진꿀제품을관리할수있게되었고현재유럽연합에서는 2003 년부터원산지를표시하게되어있어꿀제조품의산지진위여부를판단하는데활용되고있다. 꿀의경우일반성분이나점도또는화분을분석하거나화분속의단백질의패턴을보거나, 휘발성분, 무기질이나미량의원소를분석하여원산지를판별하기도하나 Stanimirova 등 (6) 은휘발성분의패턴인식기술을달리하여원산지를판별하고자하였다. 선형판별식분석, discriminant partial least squares, soft independent modeling of class analogy(simca), support vector machines 등을활용하여분석한결과감응도와선택성측면에서 SIMCA 를제외하고는모두꿀의지리적원산지를구별해내었으며그중에서도 support vector machines 방법이보다더잘구별하였다. 각기다른꽃에서채취한것과다른지역에서채취한아카시아꿀을분석하기위하여 rheometer 를사용하였고 (99) 아울러다양한패턴인식프로그램을적용하였는데주성분분석, 군집분석, 부분최소제곱법, support vector machine 을활용하여분석한결과 support vector machine 이가장효율적으로판별해주었다. 꿀은사실꽃과같이서로다른식물체로부터얻어진경우쉽게판별이되나같은식물체로부터얻은꿀의지역적특성을밝히는데에는여러가지방법들이동원되어야한다. 무기질과보편적인일반품질요소를토대로원산지를판별할수도있고 (100), 많은시료를신속하고경제적으로측정할수있는방법에하나로각광을받기시작한 TXRF(total reflection X-ray spectrometry)

11 식품의원산지판별분석 513 방법도있다 (101). 슬로베니아의비교적좁은지역에서생산된꿀을물리화학적요소와 TXRF 를이용하여원소들을분석하고탄소와질소의동위원소를분석한후통계방법을접목하여다양한꿀의원산지를판별하였는데꿀의종류에따라정확도에다소차이가있었다. Lime 꿀의경우 100%, 밤꿀은 94.6%, 아카시아꿀은 98.2% 의높은정확도를보여주었다 (102). 이처럼다양한분석방법들을활용하여얻어진데이터를함께통계처리에적용한다면보다정확도를높일수있다. 한편다른밀원에서기원한꿀의혼합여부를전자코를이용하여판별분석한바있는데사양꿀을첨가한양까지도예측이가능한방법으로미루어볼때 (103) 꿀의원산지판별에서도충분히활용이가능할것으로여겨진다. 이와같은방법은꿀과함께활용되는프로폴리스의경우도마찬가지로원산지판별이가능하다 (104). 한우전세계적으로소품종은백여종류가넘고있으며소품종간의유전적연관관계에관한국내외많은연구가혈액단백질이나 DNA 의구조차이를기초로해서이루어졌는데이들의품종구별은외형적차이인털색, 체형등의표현형에의존하는방법을사용하여왔다 (105). 하지만이런방법으로구별되는소품종이라할지라도쇠고기상태로가공처리되어변하게되면구별이불가능하게된다. 한편고기의검사와식품위생학적인측면에서주로고기단백질을전기영동법과면역법을이용하여종의특이적인단백질을검출함으로서축종을구별할수있는데이는단백질성분중에같은종내에는균일하지만종간에는서로다른사실을이용한것이다. 최근 DNA 염기배열이개발되어동물의발육시기나영양상태등의외부환경의변화에구애없이구조간의구별이 DNA 분석법으로도가능하게되었다. 한우와외국산쇠고기의수입개방화와생물다양성협약의발효로한국고유의유전차원인한우특성개발의중요성이그어느때보다높아지고있다. 한우의유전차원은다른재래가축들과비교해외래품종의오염없이잘보존되어왔으나, 한때외래우품종의정액이농가에보관된관계로일부한우에외래품종의유전적요소가섞이게되었다. 이렇게해서도입된유전형질중에는표현형으로나타나지않는특성에대해서는파악하기가불가능하며, 원하지않는유전인자의오염에대해서도방지할수있는대책이없다. 또한한우육과수입육사이에판매가격의큰차이로인해수입육및젖소육이한우육으로바꾸어판매할수가있기때문에한우육을판별하고자하는여러연구가시도되고있으며현재로는과학적으로판별할수있는증명방법이부족한실정이다. 축산물에서가장큰비중을차지하고있는한우육의경우수입육과의가격차가매우커서소비자에게원산지가명확하지않는수입육및국내산육우 ( 젖소비육우 ) 로바꾸어판매하는현상은심각한상황이며이에따라일부유통단계에서한우및젖소구분을위한유전자표지가제한적으로활용되고있으나 (106), 본질적으로원산지의이력정보를완벽하게제공하기에는현실적으로많은한계를가지고있다. 일반적으로국내외의경우쇠고기의원산지추적은광우병, 구제역등의악성질병의전파를사전에차단하거나사람으로의전이를원칙적으로차단하기위해매우중요하게추진되고있다. 유럽의경우원산지로부터개체식별이확인된소만이도축되거나이동될수있다. 또도축후에는생축에서확인된바코드번호가연계되어상품에부착됨으로써이로인해유통점에서도쇠고기의원산지가확인되는시스템을채택하고있다 (107). 그러나일본과한국등에서는외국산쇠고 Table 5. DNA amplification primers used for application of DNA test to individual traceability in Hanwoo (Korean cattle) (108) Primers Primer sequence Location on chromosome BM6438 TTGAGCACAGACACAGACTGG 1 ACTGAATGCCTCCTTTGTGC BMS711 AGCTTCTTATGGCAACACCTG 1 TGAAATCGCAGAGTTGTACATG MCM130 AAACTTTGTGCTGTTGGGTGTATC 1 CTCACCTCTGCCTTTCTATCTCTCT BMS4032 CGGACACAACTGAGCAACTC 1 AGATGGCCAACAAACACATG BMC4049 GATCAAGTTGCAACACACACAC 1 TCTCATTTCTCTCCCTGTGC BMS2263 AACCCAGTCAACCAGCAAAG 1 CACCCCAGCCATCACTTC URB014 CATTGGTAGGTGGGTTCTTTCC 1 GCAACCTAAGTGTCCATCAACAG BM1508 CAGGTGTACAGCAAACTGAATC 1 CGTCAAAACATTCGTTCAGG BMS1747 TCTAAGCTCCTTGAAGACAGGC 1 GGCTTTGTATTCCCCTCTCC ILSTS011 GCTTGCTACAGGAAAGTGC 14 CTAAAATGCAGAGCCCTACC TGGCCAAGACATATGCCATTCC 14 RMI80 GGAGTCTGGTGGGTTACAGTCC BL1009 TCTGTGTCAAAGTCCTGAGGG 14 CCTGGCATTCTGCAGTCC BL1029 CAAATCAGCCTCTCCTCTTCC 14 GTGCTTCCAGAGACAATAAAGG BM4305 CCAAGACATGAAAGCAATCTG 14 CTCTAGGTACATCCATGTTGCA BMS2055 ATGCTAAGTGAAGAACAAATCATTC 14 CTGGCAACTCTTCCTTAATACATT BM6425 AGTTGAACCTGGGTCTCCTG 14 TGCAATGGCAGTGAAAAAAG 기와국내산쇠고기의가격차이가매우높아도축후에원산지의정보가차단되는문제점을갖고있으며유럽등에서조차의도적이지않는경우에도소의개체식별체계 ( 귀표 ) 가틀리는경우가발생하여보다완벽한원산지정보를제공하고자유전자감식기법을통한원산지정보의진위여부확인을위한제도적추진을마련하고자하였다. 유전자표지방법은소의품종에따라매우다양하게발현되어개체확인정확도를높이기위해한우집단에서대상유전자표지의유전자형발현양상을 Table 5 처럼분석하여최적의표지유전자를설정하는것이필요하다. 따라서한우의원산지추적및개체식별검증시스템에서적절히사용할수있도록생체유전자감식기법에소요되는유전자표지 (marker) 로 6 개의유전자표지를설정하여개체확인을실시할경우 100% 에가까운정확도가나타난것으로추정되었다 (108). 여러소품종의 DNA 변이차이를 DNA 증폭을이용한 RAPD (random amplified polymorphic DNAs) 분석법으로조사하였는데임의의 primer 로증폭된 DNA 산물의전기영동양상은한우, 홀스타인, 헤어포드와앵거스품종모두에서재현성높게나타났다. 외래소품종간의밴드검출양상은거의동일하였으며한우

12 514 한국식품과학회지제 44 권제 5 호 (2012) 품종에서검출되는주된밴드들은외래소품종모두에서관찰되었지만외래소품종들에공통으로검출되는밴드들중에한우품종에서는관찰되지않는것이있어이밴드를외래소품종과한우의품종판별에 DNA 표시인자로이용가능하다 (109). 포유동물모색관련유전자의하나인 melancortin receptor 1 (MC1R) 유전자의 DNA marker 를이용하여한우를모색이다른국내 Holstein 종젖소와구별가능한기술을개발하여실제한우육판별에활용하고있다. MC1R, MGF(mast cell growth factor) 및 3 종류의모색유전자에대해 PCR-RFLP 기법을이용하여 DNA marker 를분석하고한우육및쇠고기품종판별에이용가능성을알아본결과한우및젖소그리고 3 품종의수입육우는특정제한효소의염기서열상의인지부위차이를가져와한우와홀슈타인젖소및앵거스육우품종간의 RFLP 양상에확실한차이가인정되었고한우품종에특이적인 MC1R 유전자의 RFLP marker 를이용한한우육판별이가능하였다 (109). Renou 등 (41) 은프랑스의 3 곳에서확보한쇠고기를분석하였는데일반적으로기름부위가균질하게분포되어있지않아시료채취상의문제가있음을극복하기위해비교적골고루분포되어있는조직내수분을이용하였는데수분에들어있는 18 O 의함량을 IRMS 로측정하였고지방함량은 1 H, 2 H, 13 C NMR 로측정하여지역에따라산소와수소그리고수소등의동위원소의차이를구별하였다. 우유나고기와같은경우전자코와 NIR 등을활용할수도있으나이와더불어기후와지역에따른탄소와질소의동위원소차이를 IRMS 와열이온질량분석기 (TIMS; thermal ion mass spectrometer) 를이용하여구별할수있다. 실제로바다에가까운지역에서생산되는쇠고기와산맥에근처에서자란쇠고기의물분자를보면물분자를구성하는산소가각기다른동위원소를많이포함하고있다는사실을이용하여분석을실시하는데, 바다쪽으로갈수록 16 O/ 18 O 의작아지고산악지역으로갈수록 16 O/ 18 O 의비율은커지는것으로나타난다. 일반적인분석방법이외에동위원소의비율을고려하여측정하게되면보다더확실히원산지를판별할수가있다. 또다른접근방법으로 Kim 등 (110) 은호주산, 미국산, 한우쇠고기간의휘발성분간의패턴차이를바탕으로원산지를판별하였는데휘발성분의분석을위해 GC-SAW 를바탕으로한전자코를사용하여활용가능성을제시하였다. 또한 MS 를바탕으로한전자코로도호주산, 뉴질랜드산, 국내산한우의판별을시도하였다 (111). 각나라별로사용된사료가달라특히뉴질랜드산은뚜렷하게구분이되었으나호주산일부와국내산일부는중첩되어완벽하게구별이되지못하였다. 이는국내산중에는호주산송아지를국내에서 6 개월간사육시킨것들도포함되어있어구별에어려움이뒤따르는것으로고찰되기도하였다. 유전자분석의경우도이런경우에는판별이제대로이루어지지못하는단점이있다. 원산지판별문제중가장관심을갖는것중에하나가소고기의원산지판별인데이는다른농축산물의경우대부분이수입산인지아니면국내산인지를판별하는데반하여구체적인국가를명시해야하는문제가다르다. 호주, 뉴질랜드, 미국, 대한민국등의소고기가과연어느나라에서생산되었는지를판단하기는쉽지않다. Jung 등 (112) 은 1 H NMR 를사용하여대사과정중에생성된 succinate 와아미노산들을 biomarker 로사용하여이를판별하고자하였다. 또, 소들이먹는사료성분에초점을두어이들사료의차이를알아보기위하여동위원소를이용하였는데 (113) 한가지동위원소를사용하는경우원산지로판별되는그룹이중첩이되어정확도가떨어지므로산소와탄소두가지의동위원소를사용하여정확도를높여원산지를판별하였다. 양고기동물조직내에축적된원소들에의해판별하고자 Sun 등 (114) 은양고기내 21 가지의원소를분석하여이를선형판별함수식에적용하여중국내에서각기다른지역으로부터도축된양고기의원산지를판별한결과 93.3% 의정확도를보여주었다. 그러나 21 개의원소를동시에분석을할수있다면큰문제는아니지만만일각각의전처리과정이다르다면이러한분석작업은번거로운작업이될수도있다. 닭고기닭다리근육의육색특성에서명도값은국내산과수입육간의차이를보이지않았으나적색도 a 값은국내산신선육이 6.99 로서수입냉동육 9.72 및국내산냉동 보다훨씬낮게나타났다. 황색도 b 값에서도국내산신선육이 으로낮았다. 수입닭고기는일반적으로냉동상태로수입및유통되기때문에장시간냉동에의해약간검붉은빛깔을띠며, 광택이없지만, 국내산닭고기는신선냉장상태로유통되기때문에육색이밝고광택이있어보인다. 특히, 수입닭고기중미국산다리부위는정육이아닌주로뼈가포함된닭다리형태로비닐에싸서종이박스로포장되어수입되는실정으로장기간냉동으로건조가될뿐만아니라, 냉동과정중, 뼈속에잔류하는혈액성분이남아있어일반적으로수입닭고기는검붉게보이는특성이있다. 이러한뼈와근육및가죽에의한색도의차이에따른특성으로국내산과수입산의외형상의차이가있는것으로나타났다 (115). 해산물최근양식기술의발달로많은양의양식넙치가공급되고있으며북한으로부터자연산넙치가수입되고있어한국산과북한산, 그리고양식산과자연산을구분할수있는방법이요구되고있다. 또한조기역시중국으로부터많은양이수입되고있기때문에원산지판별의중요성이높아지고있다. 이들은대개외형이매우유사하여형태적으로이들을구분하는것은어려운일이며, 따라서분자수준에서정확하게판정할수있는방법을개발하는것이중요하다. 넙치와조기의원산지를판별하기위한도구로 RAPD PCR 방법의가능성을확인하였는데넙치는한국의주문진자연산, 통영양식산그리고북한자연산을대상으로, 조기는한국산과중국산을대상으로관찰한결과넙치의 RAPD 패턴에서는일관성이있는진단용띠를찾기어려웠지만각원산지별로얻은 RAPD 패턴에서는가능성이있는진단용띠들을찾을수있었다. 조기의경우멸치를먹이로선택하는것과새우를선택하는것간에는품질차이가뚜렷한데이런요인까지고려하여판별하여야하므로매우어렵다 (116). 넙치는식용으로많이사용되므로양식산업이잘발달되어있고, 넙치의전체 mtdna 염기서열이 GenBank 에이미기록되어있으며넙치의계통발생학적연구가활발히진행되고있으므로원산지판별을효과적으로수행할수있다. 주문진근해의동해산넙치, 통영과거제의양식산넙치, 그리고북한해역의동해산넙치를이용하여넙치 ND-4 와 cytochrome b 유전자의다양성을관찰하기위하여 DGES(degenerating gel electrophoresis scanning) 와 DNA 염기서열검색을병행하여분석한결과, 각각의다른지역에서얻은넙치들은 ND-4-2 와 ND-4-3 영역에서특징적인 DNA 다양성이있었으나넙치의 cytochrome b 유전자에서는지역간의차이를보이는유전자변이가발견되지않았다. 넙치의지역별차이를구별하는원산지판별에는 DGES 와 DNA 염기서

13 식품의원산지판별분석 515 열검색방법이효과적이며, 넙치의유전자에서는개체간의변이가 ND-4-2 와 ND-4-3 영역에서구별되는유전자다양성이관찰되므로, 넙치의원산지판정을위한유전자검사에는 ND-4-2 와 ND-4-3 영역의검색이필요하다 (117). 국내산갑오징어및수입산갑오징어의수율, 일반성분, 중금속및무기질함량에있어큰차이가없는결과도있어서원산지판별에있어서일반성분에의한판단이어렵다는것을알수있다 (118). 소금천일염, 암염등수입소금의유입이급증하고있는데, 이들수입소금은국내산소금과그성분및기능성에차이가있으며, 이들차이는식품에영향을줄수있다. 특히새우젓과같이다량의식염이함유되는식품에서는더욱중요하다. 또한소금및새우젓은해수에함유된중금속이잔류될수있으며, 안정성을고려하여소금의무기질및중금속함량의차이를평가하는것이필요하다. 국내산소금과수입산소금의무기질및중금속함량의차이를보기위하여현재시판되고있는새우젓을산지별로구입하여무기질및중금속함량을분석한결과, 국산천일염과그것으로제조한새우젓은중국산에비해구리, 칼륨, 마그네슘의함량이많았으며, 중국산천일염과그것으로제조한새우젓은망간, 나트륨함량이높은것으로나타났다 (119). 또한국내산소금과수입산소금의무기질및중금속함량을측정한결과소금중의불용성분은국내산천일염이 %, 수입산천일염이 % 를나타났고, 국내산천일염의황산이온함량은 %, 수입산천일염은 % 를나타나국내산천일염에비해수입산천일염의수분함량이낮게나타난것과밀접한관계가있는것으로추측할수있다. 국내산천일염중수입산에비해상대적으로높게함유된무기질은칼륨과마그네슘이었고, 국내산과수입산에비슷한수준으로존재하는것은칼슘이었다. 망간은극미량검출되었고구리는수입산에서상대적으로높게검출되었으며, 게르마늄은국내산에서대체적으로높게나타났다. 그러나이러한결과로소금의원산지를판별하기는쉽지않다는것을알수있다 (120). 올리브유국내유통되는국산및수입산압착올리브유들을 GC/MS 를이용하거나이들의향기성분패턴을전자코로측정하고, 올리브유의총지방산및위치별지방산조성, 색도분석함량조사를한결과원산지별에따라다소증가혹은감소되는 peak 의차이를나타내어이들압착올리브유간에향성분으로인한구별이어려웠다 (4). 국내및수입 brand 보다는주로원산지에따라압착올리브유의비슷한향기패턴을보임을알수있었다. MOS 전자코를이용하여향기성분패턴을분석한결과, 올리브원유의원산지에따라각기다른향기패턴을보였고, 국내유통되는국산및수입산압착올리브유들을구분하기위하여페놀함량을조사한결과국내브랜드압착올리브유에서는수입브랜드압착올리브유보다총페놀함량이높게나타났다. 이것은페놀농도가올리브품종에기여하기때문으로보고있다. 이탈리아북부의 Garda 호수지역에서생산되는엑스트라버진올리브유의원산지와특징을판별하기위해서먼저화학적변수와센서의신호로분별하고다시전자혀센서로구분한후마지막으로전자코를이용하여분석하였다. 이러한데이터를인공신경망을이용하여분석한결과인공신경망과결합된전자코가엑스트라버진올리브유의원산지와특징을구별해주는가장신 속하고경제적이고기능적인방법으로제시하였다 (121). Angerosa 등 (84) 은 IRMS( 18 O-pyrolysis continuous flow) 을이용하여그리스, 이탈리아, 모로코, 스페인, 튀니지, 터어키의올리브에서 13 C, 18 O, 스테롤류, aliphatic 알코올을분리하여올리브유의원산지를판별하였다. 일반적으로특이한성분을함유하고있거나혹은아주흔하지않은귀한성분을함유하고있는시료라면원산지판별이매우쉽게이루어질수있다. 호박씨기름의경우동위원소를이용하여판별을하여보았으나뚜렷한차이를발견하기어려웠는데 (122), cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, prosium 등과같은휘귀금속성분을함유하고있는경우쉽게판별이가능하다. 그것은이러한희귀금속들의분포가매우제한된지역에서만발견이되기때문이다. 올리브유의경우도이러한희귀금속성분을지표로활용할수있다면보다쉽게구별이가능할것이다. 참기름경남도내에서유통중인국내산참기름과중국산참기름각각 30 건과콩기름및옥수수기름등의식용유지를첨가하여변조한참기름 12 건에대한지방산함량을 GC 로분석한결과국내산참기름은포화지방산인팔미틴산과스테아린산이중국산참기름보다적게함유되어있었고불포화지방산인리놀레산은반대로많이함유되었다 (123). 참기름의산지별확인과식용유지를첨가한변조참기름에대해서는각각의지방산함량에서특이성을보이고있으나일부지역에서구입한국내산과중국산참기름에서유사한결과치를보여앞으로국내에서유통되는참깨나참기름에대하여더많은연구가필요할것으로사료된다. Kim 등 (124) 의연구결과에서는국산참기름과외국산참기름이근적외분광법으로판별가능할것으로추정하였으나검량식을작성한뒤, 미지시료를사용한검정처리가따르지않았기때문에참기름의원산지판별실용성이불확실한상태로남아있다. 전자코를이용하여한국산및중국산참깨로제조한참기름의냄새차이판별여부를다변량분산분석과판별분석의통계기법을사용한결과국산과중국산간의품종간의냄새차가뚜렷하게나타나품종간 flavor 판별능력이우수함을보여주었고, 재배지간에도유의적차이가있으나종자간의차이보다그크기가상대적으로다소작은것으로해석되었다. 한국품종은중국에서재배될시에도한국품종의특성을유지하는경향이강한것으로추측되었고재배지보다는품종의영향이더강하게나타난다고보아더많고다양한시료에의한분석이뒷받침되어야한다 (92). 전자코를이용하여유통중인브랜드별참기름중원료가수입산으로표기된제품들에대하여제품들간의향구분을분석하고, 이들을사용한혼합참기름의판별을실시한결과시중에서유통중인 6 개사참기름의향기패턴이구분되었고이들 6 개시료를이용하여옥수수유를혼합하였을때어떠한원료참기름이사용되더라고 5% 옥수수유를함유한혼합참기름까지도구분됨을확인하여전자코를사용하여간편하고신속하게혼합참기름의판별을유용하게할수있음을확인하였다 (125). 참기름의경우참깨를어떤온도조건에서얼마동안볶은후착즙을하느냐에따라차이가있으며볶는과정에서원산지가다른참깨를혼합하는경우그판별이쉽지않다. 또다른기름을일부만혼합하여그차이가판별하기어려울정도로혼합한경우에도판별할수있는방법들이향후더연구검토되어야하는부분이기도하다.

14 516 한국식품과학회지제 44 권제 5 호 (2012) 한약재한약재는관능검사만으로정확한원산지를판단하기어렵고, 전문가가아닌일반인이육안으로원산지를정확히파악하기는더더욱어렵다. 그런연유로인하여의도적으로원산지를속여국산으로허위표시하여판매하기가쉽다. 수입한약재가국산한약재로불법유통됨을방지하고원산지나재배조건에따라발생하는성분차이를효율적으로구분할수있는과학적인원산지판별방법개발이필요하다 (2). 방풍, 시호, 천궁, 황기, 한약재국산과수입산 307 점을대상으로분석과정에서특별한전처리과정이필요없는간편하고신속한비파괴분석법을사용하여식물생장에필수원소인다량무기질인, 황, 칼륨, 칼슘의함량을 EDXRF(energy dispersive X-ray fluorescence) 로측정하고정준판별분석을실시한후원산지판별가능성을검토한결과이들한약재의국산과수입산간에높은판별정확도를나타내원산지판별이가능하였다 (2). 국내유통중인식품원료중선정한식물성원료 16 종 139 품목에대한농약잔류량을 ECD 로분석가능한농약 26 종, NPD 로분석가능한농약 10 종에대하여분석하여 19 품목에서농약이검출되었다 (1). 인삼 ( 건삼, 수삼, 분말, 농축액 ) 에서검출된농약은 chlorpyrifos, quintozene, BHC 였고홍삼에서검출된농약은 quintozene, BHC 였으며운지버섯에서는 chlorpyrifos 이검출되었고, 구기자에서검출된농약은 chlorpyrifos 와 a-endosulfan 이었다. 쑥에서도 chlorpyrifos 이검출되었고천궁에서는 chlorpyrifos, aldrin, a-endosulfan tecnazene 이검출되었다. Cho 등 (126) 은국내산구기자에서 chlorpyrifos, chlorothalonil 이검출되었으며, 국내산천궁에서는 pendimethalin 이검출되었다고보고한바있다. 또한국내산원료와수입원료의각각의품목에대한검출품목수와검출율을비교해보았을때, 수입생약 97 품목중 1 품목만이농약이검출되었고국내산생약에서는 154 품목중 8 품목에서잔류농약이검출되어국내산생약에서잔류농약검출율이높으며, 운지버섯과인삼, 홍삼및쑥에대한분석은아직미흡한실정이어서앞으로지속적인연구가필요하다. 이처럼각나라마다사용이승인된잔류농약성분을바탕으로원산지판별에활용되기도한다. 길초근길초근은 Valeriana officinalis 에는 valeric acid 가함유되어있고 Valeriana wallichii 에는 valeric acid 가함유되어있지않은특성을고려하여길초근의다른변종뿐만아니라이들의원산지까지구분하고나아가수확연도까지뚜렷하게구별할수있다. 그러나양쪽모두가 valepotriates 의농도가다른데이것은한약재를취급함에있어매우중요한약효성분으로치료효과가다른것이특징이기때문에다른두변종을구분해사용하여야하는과정에서전자코는보다신속하게그리고효율적으로이들두변종의차이까지구분할수있어길초근판별에적당한분석방법이다 (127). 길경길경에대한원산지식별을전자코및 X 선형광분석기로분석하여두기기로부터얻어진결과를종합하여통계처리하였을때단일기기로분석하였을때보다도훨씬정확도가높아 97.3% 의원산지판별을수행할수있었다 (33). 당귀당귀는우리나라당귀를참당귀, 중국에서는중국당귀, 일본에서는일당귀를정품으로사용하고있다. 당귀의품종과수집종의구분을위한유용한방법으로활용하고자 RAPD based primer 를 탐색한결과, OPC02 primer 는참당귀내에서내추대성과추대성 4 집단모든시료에서똑같은밴드패턴을보였던 primer 로써이 primer 를사용하여국내산참당귀를중국당귀, 일당귀와판별할수있었고, OPD11 과 OPD09 및 URP04 primer 는참당귀내에서내추대성과추대성을구분할수있었던 primer 들로써이들 primer 로도참당귀를중국당귀, 일당귀와판별할수있었다 (128). 한편, 아무런전처리과정없이질량분석기가연결된전자코를사용하여약효가있는 24 종의한국산당귀와약효가부족한 86 종의외국산당귀를측정하여주성분분석을한결과한국산은 100%, 외국산은 95.3% 의확률로판단하여 97% 의확률로길경의원산지를구별할수있었다 (129). GC-SAW 를바탕으로한전자코의경우우선머무름시간에따라시간적차이를두고 SAW 센서와반응을하기때문에순차적인반응에의하여마치수백개의센서를사용한것과같은효과를가져왔으며이렇게얻어진휘발성분에대한크로마토그램을 olfactory image 를통하여뚜렷하게제시함으로써국내산당귀와수입산당귀의차이를시각적으로알기쉽게판별하였다 (28). 천궁수입급증품목중하나인천궁을 CE 를이용하여원산지판별에적용가능성을검토한결과시중에유통되는국내산 (62 점 ) 과수입산 (51 점 ) 천궁을분석하여전체 peak 에대한구성비율이서로차이를나타내는 peak LW-1 과 peak LW-5( 용출시간약 11 분, 14 분 ) 를원산지판별에적용할수있는 peak 로도출하였다. 이 peak 를이용한국산및수입산천궁의원산지판별율은국산이약 65%( 총 62 점중 40 점을바르게판별 ), 수입산은약 63%( 총 51 점중 32 점을바르게판별 ) 로나타나판별비율은낮은편이었다 (130). SAW 센서가내장된 GC 로구축된시스템을이용하여휘발성성분을분석한결과사용된국내산과수입산천궁은별도의전처리과정없이분석되었고, 30 초이내에얻어진크로마토그램을 Vaporpint TM 이미지소프트웨어를사용하여패턴화하였으며패턴인식을통하여비교한결과, 수입과천궁과국내산천궁의패턴이뚜렷하게차이를나타냄으로서원산지를판별할수있었다 (27). 복령복령의경우 2001 년도국내산과수입산간에는구별이되지않았으나 2002 년도국내산의경우수입산과차이가뚜렷하게구분이되었다. 이것은 2001 년도산의경우보관중휘발성분이휘발되어전자코에의해감지될수있는휘발성분이거의없는상태일가능성이높은데비하여 2002 년산의경우, 수확한지얼마되지않아휘발성분을많이포함하고있는것으로수입산과의판별이용이한것으로보인다 (131). 그러나이와는달리생산한지 1-2 년이경과한대추의경우 83% 내의판별력과더불어커다란차이를보여주지는않았다 (132). 이처럼농산물이나임산물의경우시료에따라서차이가발생할수도있으므로이러한것을해결하는방법으로다른기기분석법과함께분석하는방법을겸용해이런문제에대비해야할것이다. 황기황기와재배지토양의무기물성분을자료로주성분분석과패턴인식분석법을토대로하여분석한결과산지별황기의상관관계와거리를바탕으로국내산황기의원산지규명이가능하였으며며중국산황기와의구분은훨씬더용이하였다 (11). ICP- AES 로살펴본재배지토양과황기속의원소량을비교분석해보

15 식품의원산지판별분석 517 면식물이토양에존재하는금속원소의농도에비례하여모두흡수하며성장하는것은아니라는것을알수있으며아연과같은경우다른금속원소의토양에존재하는농도에비해낮은함유량을보이나황기에서검출된양은상대적으로높다. 이는재배지에서채취한잡초뿌리에서는볼수없었던결과이므로아연에대해서황기가선택적으로흡수하는것으로사료되어진다. 황기는중국뿐만아니라한국에서도한약재로많이사용되는재료중의하나인데지역에따라성분함량의차이가커서약효에까지영향을미치기도한다. 이런황기시료에대하여원산지를판별하기위하여 IR 을사용하기도하였으나분석능을더욱높이기위하여 FTIR 을사용하였으며 (133), 용매를어떤종류를선택하느냐에따라서도정확도에많은영향을미친다. 이와더불어 FTIR 분석과더불어주성분분석에서얻어지는 Mahalanobis distance 를조합하였을때보다더정확도를높일수있다. 치즈유제품의원산지를판별을위해 Balling 과 Rossmann(44) 은 13 C/ 12 C, 15 N/ 14 N, 18 O/ 16 O, 34 S/ 32 S, 87 Sr/ 86 Sr 로우유에서기후와지역적인차이를, Renou 등 (41) 은우유에서 polyunsaturated(pufa), monounsaturated(mufa) 와 saturated fatty acids (SFA) 의조성을 IRMS 와 2 H, 18 O 을 NMR 로측정하여사료와지역적인차이를구별하였다. Manca 등 (45) 은치즈에서카제인의 13 C/ 12 C 와 15 N/ 14 N 동위원소를 isotope ratio mass spectrometry(irms) 로측정하고, 유리아미노산중의 His/Pro, Ile/Pro, Met/Pro, 그리고 Thr/Pro 의비율을 HPLC 로측정하여치즈의숙성시간과지역적인차이를구별하였고, Pillonel 등 (46) 은 IRMS, TIMS, AAS, ICP-MS and alpha-spectrometry 를이용하여유럽의 Allgu(D), Bretagne(F), Vorarlberg(A), Savoie(F), 스위스와핀란드의치즈원산지를판별하였다. 해당지역의가축들이마시는물의수소, 산소의동위원소비율과가축의털이나근육속의수분의동위원소비율이같을것이라고가정하면이를토대로미국내우유의산지를구별할수있으며 (134), 2 H, 18 O 의비율을토대로우유의원산지예측이가능하다. 이탈리아지역내에서 7 가지의치즈제품에대하여탄소, 질소, 산소, 황및스트론튬과 49 가지의무기질을토대로분석하고바륨, 칼슘, 칼륨, 마그네슘, 루비늄, 13 C casein, 15 N casein, 18 O glycerol 을토대로다변량분석을실행하여원산지를판별하였다 (135). 이처럼국가간의원산지가아니라어느특정지역에대한원산지를판별하는것으로이런방법은원산지표시보호제 (PDO) 와같은특별규정을수행하는데용이할것으로여겨진다. 과일식물체의경우위도가어떤곳이냐에따라일조량이달라지고광합성의정도가차이가나서안토시아닌과같은생리활성물질의농도가달라질수있는데이를이용하여 bilberries 의원산지를판별하기도하였다 (136). 허브및차류허브나차류의지리적원산국을판별하는것은매우어렵지만, 다수의연구가수행되어왔다. 홍차는 phenolic 화합물들의조성의차이와 flavanol glycoside 조성차이를기존의화학적분석법으로실시하여지리적원산지판별이가능하였고 (137) 인도, 중국및일본에서재배되는대표적인차품종의탄닌과카페인함량의변이가크다고하였다. 한국차와일본차의시료스펙트럼을 분석하여지리적원산국의정확한판별가능성을본결과한국산과일본산녹차제품을판별하기위하여 MPLS 분석법을이용한검량시의결정계수가 0.99 로나와극히양호한판별식임을알수있었다. 식품의지리적출처를판별하기위해서미량원소분석법, 동위원소분석법, 분광분석법등다양한분석이응용되었는데 NIRS 분광분석법은상대적으로분석이간편, 신속하고저렴한비용으로분석이가능하며, 특히진위성의확인이가능하므로녹차제품의원산지판별방법에적합하다. 질소함량의변이계수는중국산이 38.3% 로한국산보다매우높아찻잎수확시기가다양함을알수가있으며탄닌, 카페인함량도중국산이높았다. 면역기능성과관련있는카테친 (EGC, EC, EGCG) 함량의평균값은한국산이중국산에비하여높다. 한국산과중국산녹차제품의근적외선흡광치의차이가품종, 기후적인차이뿐만아니라제다방법등의차이에기인된것으로결국종합적인차이에기인됨으로서한국산녹차제품과중국산녹차제품의식별을용이하게할수가있다고생각된다. 한국산녹차제품의총질소, 중성섬유소, 총유리아미노산, 데아닌, 카테친및면역기능성등이중국산보다약간높았으며, 이들성분에대한중국산제품의성분변이가큰편으로제품의다양성을보여준다 (137). 중국에서도차의원산지를밝히기위한방법으로일반적인성분이나무기질등을분석하여판별을시도하기도하였으며, 혹은 FT-NIR, 전자혀와전자코등을이용하거나 CE 나 GC, HPLC 등을사용하여중국내의타지역간의원산지를판별하였다. Ye 등 (138) 은분석방법이외에도선형판별식분석과주성분분석, 군집분석등패턴인식을위한소프트웨어를활용하여원산지를판별할수있었다. 유럽의허브요법을대표하는캐모마일차와국내산국화차에속하는감국차를 GC 및 GC-MS 로분석, 동정하여비교한결과 Table 6 처럼캐모마일차는 cubebene(14.59%) 을포함한총 46 종류의화합물이, 국내산국화차는 santalol(6.25%) 등총 45 종류의화합물이동정되어비교할수있었다 (139). 말레이시아일대에서생산되는허브에일종인 Orthosiphon stamineus 의경우 GC-SAW 를바탕으로한전자코로얻어진크로마토그램을 olfactory image 를통하여 5 종의허브를구별할수있었는데, 그중두종류의패턴이유사하여이를다시주성분분석, 선형판별분석, 집락분석방법을통하여보다확실히원산지를구분할수있었다. 이처럼 olfactory image 와더불어다변량통계분석을함께실시한다면미세한차이로인한허브의원산지까지도구별할수가있다 (140). 상당히오랜역사를갖고있고가격이비싼샤프론은이란, 인도, 그리스, 모로코, 스페인, 이탈리아등지에서생산되고활용되고있는허브다. 각지역에서생산된샤프론의 16 개의핵심이되는품질요소를 UV-Vis, HPLC, GC 분석을통하여얻은후화학적성분을다변량통계를실시하였을때 60.7% 정도밖에는구별하지못하였으나 (141) 이데이터와동위원소 ( 수소, 탄소, 질소 ) 의비율분석을실시하여얻은결과를함께통계처리를하였더니 100% 에가까운판별을보여주었는데이처럼한가지방법보다는두가지이상의방법을실시하는것이보다효과적이다. 대부분의연구에서도마찬가지이지만단순하게한해생산된시료를가지고분석한결과를토대로모델화하기에는한계가있다고본다. 따라서생산이많은국가간의비교, 뿐만아니라몇년에걸쳐생산된시료를바탕으로기후조건에의한영향으로나타난생산년도에따른차이도구분해낼수있는지를파악하는연구가필요하다.

16 518 한국식품과학회지제 44 권제 5 호 (2012) 커피 Krivan 등 (50) 은 neutron activation analysis, 원자흡광광도기와일반성분분석등을이용하여그린커피에서 20 개의원소의농도를결정하여콜롬비아, 코스타리카, 쿠바, 엘살바도르, 멕시코, 니카라과, 파나마와파푸아뉴기니에서생산된그린커피의원산지를판별하였다. 원산지분류를위해브라질산, 인도네시아산, 에디오피아산, 예멘산커피생두를사용하여동일한커피볶음과동일한분쇄조건으로수행한후전자코로분석하여원산지를판별하였는데 (142), 커피의향기패턴을이미지화하여나타낼수있으므로원산지가다른커피간의차이를통계에대한지식이없는비숙련자도용이하게구분할수있다는장점을전자코분석이가지고있다. 주스북미, 남미, 아프리카, 유럽등지에서생산된약 150 여개의오렌지주스를동위원소분석을통해원산지를파악하기위해 2 H, 13 C, 15 N 과 87 Sr/ 86 Sr 를바탕으로분석한결과오렌지주스의수용성성분과불용성성분에서의 87 Sr/ 86 Sr 의차이를토대로원산지를파악할수있었다 (143). 매우광범위한지역에걸쳐생산된오렌지주스의특성이해당지역의기후나지질학적인특성에따라차이가있음을이용한방법이라고말할수있으며한가지방법보다는여러가지성분을동시에측정하는다중분석방법을함께병용하였을때보다신뢰할수있는결과를얻을수있다. 포도주포도나포도주의원산지판별을위해서 Horn 등 (65) 은 TIMS (thermal ionisation-mass spectrometry) 을이용하여 87 Sr/ 86 Sr 의비율로포도주의원산지를결정하였고, deuterium magnetic resonance spectroscopy 를이용하여에탄올의메틸기와메틸렌기의 2 H/ 1 H 비율을이용하여원산지를판별하였는데, 이러한기술은포도가발효시나오는발효액에서 SNIF-NMR 을이용하여 2 H/ 1 H 비율을이용한것이다 (144). 또한 Day 등 (68) 은프랑스의 165 개포도를이용하여 AAS 와 SNIF-NMR 를이용하여 Alsace, Burgundy, Beaujolais, Loire 계곡의포도주의원산지를판별하였고, Baxter 등 (69) 은 ICP-MS 를이용하여 48 개의원소의농도를 95% 까지정확히구별하여스페인과영국산의원산지를구별하였다. 한편아르헨티나지역의포도주원산지를판별하기위해서 K, Fe, Ca, Cr, Mg, Zn, Mn 등의무기물원소를이용하였을때 100% 구분을하였으나, Ca, Cr, K, Fe, Cu, Zn, Mg 을이용하여판별을하였을때는 92% 로다소떨어지는경향을보여주었다 (145). 이처럼어떤무기질원소를대상으로선택하느냐에따라원산지판별의정확도가달라질수도있으며원산지판별이토지성분에따라판별되는경향을보여주기도한다. 칠레의카사블랑카계곡의두지역에서생산되는포도의안토시아닌류의성분들과패턴인식기술을적용하여 Pinot Noir 포도주의산지를구분해낼수있었다 (146). 국가간의경계가아닌지역적인차이지만기후조건이차이가있기때문에나타날수있는제품의품질차이를엿볼수있는예이다. 포도의종류에따라, 국가에따라그리고과수원에따라각기다른플라보노이드를함유한포도들이생산되며이들이만들어내놓은포도주또한독특한특성을갖는데이는발효에관여하는곰팡이들의종류가각기다르기때문이다. 이로인해포도주를구성하는다양한페놀성분들이만들어지고이또한포도주품질에많은영향을미치기도한다. 뿐만아니라나무통에어떻게보관하고안정화시키느냐에따라갈릭탄닌이생성되기도한다. Fig. 5. Principal component analysis (PCA) plot of flavors from the all imported wines using the electronic nose (149). 그리고여러종류의유기산들이당류와만나에스테르화되는데이또한매우다양하게반응이일어나포도주의원산지나품질을보증하고자할때유리된형태의여러화합물을통해알수있다. 최근다양하게생성된페놀성분의분석을통해품종, 원산지, 유사여부등을판별하는연구가있는데 (147) 카테킨 / 에피카테킨, cis-/trans- 레스베라톨, cis-/trans-p-coumaric acid 를동시에분석할수있는 LC-MS/MS 를이용하여분석한후정준판별분석을통해원산지를구분하였다. 포도의품종뿐만아니라포도주의종류및원산지까지를구분할수있었다 (148). 또한전자코를이용하여포도주의향기를분석하고주성분분석을한결과, Fig. 5 처럼제 1 주성분값과제 2 주성분값의차이에따라각나라별로군을이루어서로다른위치를점하고있어포도주의각나라별향기패턴의차이가있음을알수있어미국, 프랑스, 칠레, 이탈리아, 호주산포도주를구별할수있었다 (149). 광천수광천수의경우화학적성질을결정하는요인들예를들면무기질, 탄산가스, 온도, 산화환원전위등의요소들을바탕으로원산지를판별하여왔으나분석방법못지않게중요한것이이를판정하는소프트웨어로서인공신경망을통해많은데이터를사전에학습시킨효과를이용하는경우 (150) 원산지판별이보다정확하게증명을할수있는것이다. 여러가지분석방법중에서가장신속하고간단한방법중에하나가 MS- 전자코에의한분석인데이경우어떤특정성분인지를동정하지않으며어떤전처리과정을거치지않기때문에빠르게선별할수있어널리활용되고있는방법이다. 물론얻어진데이터를이용하여다양한통계프로그램으로패턴인식을하여원산지를판별할수가있다 (151). 이방법에서는어떤특정성분에대하여얼마만큼함유되어있는지정량을하지않고도원산지판별이가능하다. 통계분석방법 향분석은일종의비교기술이라할수있기때문에적절한데이터처리방식이무엇보다중요하다. 데이터분석기술을선택할때에는데이터의유용성과요구하는데이터의종류에따라결정하는데일반적으로그래프분석 (graphical analysis) 과, 주성분분

17 식품의원산지판별분석 519 석 (principal component analysis), 판별분석 (discriminant analysis), 요인분석 (factor analysis) 등의다변량분석 (multivariate analysis), 그리고신경회로망분석 (neural network analysis) 의기술이많이이용되고있다 ( ). 그래프분석은데이터분석에서가장보편적인형태로써센서의저항값을나타내는방법이다. 센서의저항값이크면그만큼향기성분이나이취성분의양이많다는것을의미한다. 그러나센서가비특정센서인경우어느특정성분만을선택적으로측정하는것이아니라유서성분에대하여각기다른응답정도를보여주기때문에상대적인비교보다는패턴형식으로판별하는것이오히려바람직하다. 이런패턴형식의방법으로많이활용되는방법이다변량분석법이다. 다변량분석은시료사이의차이점과유사점을인식하는데유용하게쓰이는데이터처리기술이다 (9). 다변량분석중에서주성분분석은측정변량의데이터를보다작은수의상관관계가전혀없는새로운변량의데이터로전환하는통계처리방법으로새로운변량은측정변량의데이터가갖는정보를최대한수용한다. 즉주성분분석은변량을하나하나씩독립적으로파악하는것이아니라종합적으로파악하려는거시적방법이며많은변량의값을될수있는한정보의손실없이, 하나또는소수개의총괄적지표인주성분으로축소해서해석하려는통계학적기법인것이다 (155). 주성분분석으로오렌지향이나 (156), 생산지와생산년도가다른포도주 (157), 다른종류의맥주 (158), 산패정도가다른오렌지오일 (159) 을구별하는등식품의품질을평가하는데많이사용되어졌다. 관능검사와는달리좋은것과나쁜것으로구분하는것이아니라단순히차이가있는것을구별할뿐이다. 이때신선한공기를대조구로사용하면신선한것이나좋은품질의방향을파악할수있고반대편이이취가나거나품질의떨어지는쪽을말한다. 원산지판별의경우국내산과수입산으로구분하여판별을하게되므로좋고나쁘고를떠나얼마큼차별성이있는지를구분할수만있으면된다. 따라서대사조건이나기후, 토양, 농약사용등에따라각기다른휘발성분을내놓는시료간의차이를다변량통계분석에의해서판별하게되는것이며원산지판별등에가장많이활용되고있다. 신경회로망 (neural network) 은생물의뇌신경조직을수학적인모델로대체한것으로많은선형또는비선형신경모델들이병렬적으로연결되어있어서정보의처리속도가빠르며자기연상에의해학습 (learning) 이가능하다는장점을가졌다. 자기연상에의해신경회로망은데이터의변화에적응할수있으며입력과출력간의관계를매핑 (mapping) 을통해학습을수행한다 (160). 신경망은그것이경험하는환경에따라자신의내적상태를매우간단한규칙에의해변화시킴으로써스스로내적지식을만들어나간다. 일단학습이이루어진후, 신경망은자신이경험했던것들과는다른형태의입력에대해서도적당히반응할수있다. 즉, 경험을통해축적된내적지식을새로운형태의입력에까지일반화시켜적용할수있는것이다. 신경망의이러한일반화능력은입력에섞인잡음이나, 왜곡, 부분적인파손에도불구하고그것에대응할수있도록해준다. 일반화능력과반대로신경망은자신이경험한것들로부터공통적인특징들, 즉이상적인형태를추출해낼수있다. 예를들어원산지가 A 인시료의성분차이에따라각기변형된많은입력데이터들을학습한신경망은이러한변형된입력들로부터원산지가 A 라는이상적인형태를추출해낼수있다. 신경망은두개의정보를서로연관시키는능력을가지고있다. 신경망에어떤입력이주어지면, 신경망은그것과 연관된출력을내게된다. 신경망의이러한연관능력은부분적인입력에대해서도적절히동작하며, 적은입력자료로부터그것과연관된많은자료들을얻을수있게해준다. 신경망은자신에게주어진많은자료들로부터특징을찾아내어그것에따라자료를분류하는능력을가지고있다 (161). 신경망의구조는뇌의신경세포를단순화시켜수학적으로모델링한인공신경세포와그것들의연결로구성되어있다. 이러한신경세포들은신경망내에서는층을이루고있으며주변의신경세포들과연결되어있다. 인공신경세포란뇌의신경세포를모델링한것이며, 옆으로늘어선한무리의신경세포들의모임을층 (layer) 이라한다. 시스템의외부로부터입력을받아들이는층을입력층 (input layer), 시스템의외부로출력을내보내는층을출력층 (output layer), 입력층과출력층사이에있는층을은닉층 (hidden layer) 이라고한다. 같은층내의신경세포들은기능적으로같은작업을수행하며, 신경망의동시동작과병렬동작의기본단위가된다. 즉, 같은층내에있는인공신경세포들은동시에병렬적으로동작하게된다. 신경망의동작은입력혹은다른신경세포로부터전달된출력값은그것과연결된연결가중치가각각곱해져인공신경세포에전달된다. 이때, 연결가중치는시냅스와마찬가지로인공신경세포들간의정보전달정도를결정하는역할을하게된다. 즉, 연결가중치가큰경우, 그것을통해전달되는신호에는큰값이곱해지므로신호가커지고반대로연결가중치가작은경우그것을통해전달되는신호에는작은값이곱해지므로신호는작아진다. 연결가중치가곱해져전달된각각의값들은단순히서술적합산에의해합해진다. 이렇게연결가중치가곱해지고더해진값을가중합 (weighted sum) 이라고부른다. 신경세포는최종적으로이가중합에자신의특성을나타내는활성함수를취한값을다른인공신경세포들로출력하게된다. 이때, 인공신경세포의출력이 0 보다크면그인공신경세포는활성되었다고하며, 그때출력된값을활성값이라고한다. 이때, 우리가신경망에존재하는모든연결가중치의값을조절할수있다면, 신경망에서의정보전달과정을완벽하게제어할수있을것이다. 한편신경망스스로가외부로주어지는정보에대해어떤일정한규칙에의해자신의연결가중치를조절할수있다면, 신경망은주어지는정보에따라자신의정보처리상태를변경시켜갈수있을것이다. 이것이신경망의학습원리이며, 연결가중치를조절하는일정한규칙이바로신경망의학습규칙이다 (161). 학습된신경망을가지고실험을한경우는불순물을섞은올리브유를 GC/MS 로분석하여그데이터를인공지능망으로학습시킨다음불순물의농도를성공적으로구별하였으며 (162), 인공지능망을전자코의데이터로학습시켜서 12 개의가스시료를 100% 구별하거나 (163), 바나나의숙성정도 (164) 를분석하는등인공지능망을식품의품질을예상할때많이사용하고있다 (165,166). 얻어진전자코의데이터는처리방식에의해객관적인자료화가가능하며재현성이비교적우수하고일정기간이지난후에도이미분석한향분석자료를기준자료로활용할수있다는장점이있다 (167). 이러한원리를이용한다면축적된원산지판별데이타베이스를바탕으로하여원산지판별을더욱더정확하게할수있을것이다. 원산지판별의한계점 원산지판별에대한연구는그리오래되지는않았으나최근많은국가들의관심을갖는분야이기도하다. 그러나다양한방법들에효율적으로활용되고있음에도불구하고몇가지한계점을

18 520 한국식품과학회지제 44 권제 5 호 (2012) 내포하고있어원산지를판별할때특별히주의하지않으면안된다. 그러한요소로는다음과같은것들이있다. 현재소고기의경우국내에서키우는소의 DNA 를확보하여이를바탕으로원산지를판별하게되는데외국에서수입한어린소를 6 개월동안국내에서키운후에는국내산으로인정하는경우 DNA 검사를통한판별이혼동이된다. 뿐만아니라국산품종을외국국가에서재배하여들여오는경우가있다. 인삼, 고춧가루, 배추등국산품종을우리나라와기후나토양조건이유사한곳에서재배하여들여오는경우 DNA 분석뿐만아니라다른분석방법으로도쉽게판별하기가어렵다. 수입산으로판정이되는것과는달리구체적으로생산국을표기하도록요구하는경우예를들어벨기에산, 네델란드산, 프랑스산삼겹살인지를판별하는것은여간어려운일이아닐것이다. 일반적인수입농산물의경우는국내산인지수입산인지만을판별하나소고기나돼지고기등의경우특정국가까지를지칭하는경우가있는데이런경우해당국가까지맞추는것은여간힘든작업이아닐수없다. 이런판별이가능하게되기위해서수년간의데이터를축정하여야하는업무가선행되어야한다. 포도주나치즈의경우유럽에서는해당국가는물론과수원별로특징이되는 marker 또는패턴을이용하여판별방법을확립하여대응하고있을정도이다. 그것은자신의과수원이나지방에서생산된제품에대한자부심이강하고이를위조한제품들이많이유통되는것을방지하기위한노력의일환이기도하다. 한약재의경우수입한후바로유통되지않고 1-2 년보관후유통이이루어지는경우도있는데이런경우생산년도에따른문제까지도고려해야하는문제가야기될수도있다. 국내로수입된특용작물, 당근, 마늘 (168), 인삼 (169), 영지, 참깨 (170), 검정현미 (171), 작약 (172) 등에대하여국내에서생산되는농산물과의향기성분상의차이를바탕으로원산지를판별분석한결과, 대체적으로 83-97% 의판별을보였는데수입산농산물의원산지의기후나토양, 품종등에따라차이가예상되기도하나이보다는수확시기, 보관상태등이오히려보다큰영향을미치기도하였다. 보관상태를일정하게유지하는노력이필요하며보관상태에따른영향을파악할수있어야할것이며아울러수확시기에따른데이터도축적해좋아야할것이다. 국내산의경우도경상도, 전라도, 강원도등의산지에따라서도토양성분과기후에차이를보여국내산시료간에도많은차이를보여주고있으나수입산에비하면그차이는미미하여뚜렷하게국내산과수입산의판별이가능하기는하나북한산의경우는매우어려운문제이다. 특히휴전선과가까운지역의생산품들은그차이가매우적어서북한산을수입산으로판별하는것은결코쉬운일은아니다. 원산지문제와더불어유통질서를어지럽히는가짜식품혹은유사식품의경우국내산농산물의일부를수입산과혼합하여판매유통하는경우를말한다. 홍삼엑기스나버섯의일부를또는고춧가루의일부를수입산과혼합하여판매하는것을선별하기위해서는별도의판별방법이뒤따라야할것이다. 고추의경우부위별혼합이나혼합비율에따른차이를구별해낼수있는방법들이축적되어야할것이다. Son 등 (173) 은국내산참기름에들기름을첨가한비율에따라구별할수있었으며아울러인도산참기름에들기름을혼합한것과구분지어그첨가량을예측하기도하였다. Hong 등 (103) 은가격이비싼꿀에가격이싼사양꿀을첨가한비율과팜올레인유지에팜스테아린이첨가된비율을예측할수있는모델을제시한바있는데이런 know-how 가축적된다면이런문제들도충분 Fig. 6. Approach method for discrimination of geographical origin of foods. 히해결이가능하나수많은농산물에대해모두적용하여대비하기에는어려움이뒤따른다. 이런식품원료또는가공제조품의일부가원산지를속여유통하는것을찾아내기위해서는체계적인방법에따라접근하여해결해나가야할것이다. 물리적인방법이나화학적인분석방법을동원하여판별하되여러단계를거치면서하나씩확인하고또확인하여어느단계에해당하는가를파악하고그에해당한적절한분석방법을도입하여원산지유무, 나아가유사식품여부까지도판별할수있는프로토콜을적용하여해결해야할것이다. Fig. 6 은각단계별로적용할수있는방법들과과정을나타낸것이다. 물리적측정방법과화학적분석방법을사용하여한단계씩확인해나감으로써해결하는것이다. 원산지판별을수행하는업무부서에서는이러한프로토콜에바탕을두어체계적인분석방법을확립하여적용해나가야할것이다. 판별확률이 95% 를넘지못하면법적인효력을갖지못하므로 95% 이상의신뢰가가능한분석법의개발이요구되고있는실정이므로신뢰도를높일수있는다양한분석방법과다중분석을통하여이런문제를극복해나가야할것이다. 가공식품의경우참기름과같이원료가하나인경우큰문제가없으나, 포도주와치즈처럼발효과정을통해서독특한미생물을사용한다든가하면그특징을바탕으로구별해낼수는있을런지모르나일반적인가공식품의경우여러공정을거치면서성분의변화가일어나고또한원료들을여러국가로부터수입하여사용하는경우어느한특정국가의제품이라고말하기어려운문제가있다. 따라서가공식품에서의원산지판별이라는또다른어려운문제를어떻게해결해나아가야할것인가는향후더연구되어야할분야이기도하다. 맺음말 식품의원산지는토양이나기후, 일조량, 재배조건, 유통조건및가공조건에따라차이가발생할수있으며이러한차이는다

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï 실과056-094 2013.1.9 7:22 PM 페이지67 MDPREP_RipControl 2007 개정 5학년 검정 지도서 각론 알짜 정리 67 영양소 힘을 내는 일(탄수화물/지방/단백질) 몸의 조직 구성(지방/단백질/무기질/물) 몸의 기능 조절(단백질/무기질/비타민/물) 식품 구성 자전거의 식품과 영양소 식품군 곡류 탄수화물 우리가 활동하는데 필요한 힘을

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

- 2 -

- 2 - 작품번호 37 Solar material 로쓰일수있는검정색물질의재발견! 출품분야학생부출품부문화학 2009. 5. 13 시 군 학교 ( 소속 ) 학년 ( 직위 ) 성 명 성남시풍생중학교 2 김호기, 이희원 지도교사풍생중학교교사김경원 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - 석탄은주로탄소로구성되어있고, 수소와산소가들어있다. 이밖에질소

More information

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770>

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770> 고1 융합 과학 2011년도 1학기 중간고사 대비 다음 글을 읽고 물음에 답하시오. 1 빅뱅 우주론에서 수소와 헬륨 의 형성에 대한 설명으로 옳은 것을 보기에서 모두 고른 것은? 4 서술형 다음 그림은 수소와 헬륨의 동위 원 소의 을 모형으로 나타낸 것이. 우주에서 생성된 수소와 헬륨 의 질량비 는 약 3:1 이. (+)전하를 띠는 양성자와 전기적 중성인 중성자

More information

개최요강

개최요강 55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]

More information

(Microsoft PowerPoint - src.ppt [\300\320\261\342 \300\374\277\353] [\310\243\310\257 \270\360\265\345])

(Microsoft PowerPoint - src.ppt [\300\320\261\342 \300\374\277\353] [\310\243\310\257 \270\360\265\345]) LC/MS, LC/MS/MS 기초개론 LC LC/MS(Liquid Chromatography/Mass Spectrometry) 액상의분석물질을기화및이온화하여고진공관에서원하는질량 (m/z) 이나질량범위만검출하여정량 정성분석하는시스템 High vacuum PC/Software Ion source Mass Analyzer Detector ESI APCI APPI

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

조사보고서 완본(최종인쇄본).hwp

조사보고서  완본(최종인쇄본).hwp 뉴질랜드 농업투자환경조사보고서 ( 주 ) 제이앤드에이 Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ 2.3) Waipara Limestone Vineyard Estate 토양특성 [표 2-7] Waipara Limestone Vineyard Estate 부지 토양 특성 유효

More information

ìœ€íŁ´IP( _0219).xlsx

ìœ€íŁ´IP( _0219).xlsx 차단 IP 국적 공격유형 목적지포트 IPS 룰 180.97.215.45 중국 서비스취약점공격 TCP/5555 (0001)SYN Port Scan 222.186.42.248 중국 서비스취약점공격 TCP/80 (0001)SYN Port Scan 104.236.178.166 미국 웹해킹 TCP/80 (5010)HEAD / HTTP (Http server buffer

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

인도 웹해킹 TCP/80 apache_struts2_remote_exec-4(cve ) 인도 웹해킹 TCP/80 apache_struts2_remote_exec-4(cve ) 183.8

인도 웹해킹 TCP/80 apache_struts2_remote_exec-4(cve ) 인도 웹해킹 TCP/80 apache_struts2_remote_exec-4(cve ) 183.8 차단 IP 국적 공격유형 목적지포트 IPS 룰 222.119.190.175 한국 서비스취약점공격 TCP/110 #14713(POP3 Login Brute Force Attempt-2/3(count 30 seconds 10)) 52.233.160.51 네덜란드 웹해킹 TCP/80 Apache Struts Jakarta Multipart Parser Remote

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - 장비구성 : - 5 - - 6 - 치 - 7 - μ - 8 - - 9 - 고체흡착관의안정화방법및기기 (Tube conditioner) - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - 전기냉각저온농축장치 (TD) GC/FPD - 18 - GC/FID Headspace

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

rientation of Nuclear Spins in an Applied Magnetic Field 수소핵에외부자기장을걸어주면수소핵은전하를띠므로핵자기모멘트가유도 됨 Figure 13.1 : Spin states of 1 and 13 nuclei in t

rientation of Nuclear Spins in an Applied Magnetic Field 수소핵에외부자기장을걸어주면수소핵은전하를띠므로핵자기모멘트가유도 됨 Figure 13.1 : Spin states of 1 and 13 nuclei in t 47 hap 13 Nuclear Magnetic Resonance Spectroscopy 13.1 Nuclear spin states 13.2 rientation of nuclear spins in an applied magnetic field 13.3 Nuclear magnetic resonance 13.4 An NMR spectrometer 13.5 Equivalent

More information

기기분석 _ 기체크로마토그래피 (GC) 기체크로마토그래피 Gas Chromatography (GC) 1

기기분석 _ 기체크로마토그래피 (GC) 기체크로마토그래피 Gas Chromatography (GC) 1 기체크로마토그래피 Gas Chromatography (GC) 1 GC 의장점 빠른시간내에분석가능 높은분리능으로다성분분석가능 높은감도 MSD, AED와쉽게연결가능 높은정량재현성 적은시료주입량 ( 여러번주입가능 ) 2 기체크로마토그래프구성 운반기체 주입구 컬럼 검출기 데이터시스템 3 RESET 장치의구성도 Filters/Traps Data system H Regulators

More information

12.2 Molecular Spectroscopy ( 분자분광학 ) 분자에전자기복사선을쪼여주면분자가낮은에너지상태에서높은에너지상태로이동하게되며, 이때특정흡수진동수를이용하여분자의구조를알아낼수있다. Figure 12.1 : Absorption of energy in elec

12.2 Molecular Spectroscopy ( 분자분광학 ) 분자에전자기복사선을쪼여주면분자가낮은에너지상태에서높은에너지상태로이동하게되며, 이때특정흡수진동수를이용하여분자의구조를알아낼수있다. Figure 12.1 : Absorption of energy in elec 39 hap 12 Infrared Spectroscopy ( 적외선분광학 ) 12.1 Electromagnetic radiation 12.2 Molecular spectroscopy 12.3 Infrared spectroscopy 12.4 Interpreting infrared spectra 12.5 Solving infrared spectral problems

More information

국가별 한류현황_표지_세네카포함

국가별 한류현황_표지_세네카포함 지구촌 지구촌 Ⅰ 아시아대양주 Ⅱ 아메리카 지구촌 Ⅲ 유럽 Ⅳ 아프리카중동 지구촌 한류현황 개요 지구촌 지역별 한류 동호회 현황 Ⅰ. 아시아대양주 뉴질랜드 대만(타이뻬이) 라오스 말레이시아 몽골 미얀마 베트남 브루나이 싱가포르 아프가니스탄 인도 인도네시아 일본 중국 태국 파키스탄 피지 필리핀 호주 (1) 일반 현황 10 (2) 분야별 현황 11 12 (1)

More information

μ

μ μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62

More information

untitled

untitled Highquality news for professionals www.withbuyer.com 2 Highquality news for professionals Highquality news for professionals 3 4 Highquality news for professionals Highquality news for professionals 5

More information

Vector Differential: 벡터 미분 Yonghee Lee October 17, 벡터미분의 표기 스칼라미분 벡터미분(Vector diffrential) 또는 행렬미분(Matrix differential)은 벡터와 행렬의 미분식에 대 한 표

Vector Differential: 벡터 미분 Yonghee Lee October 17, 벡터미분의 표기 스칼라미분 벡터미분(Vector diffrential) 또는 행렬미분(Matrix differential)은 벡터와 행렬의 미분식에 대 한 표 Vector Differential: 벡터 미분 Yonhee Lee October 7, 08 벡터미분의 표기 스칼라미분 벡터미분(Vector diffrential) 또는 행렬미분(Matrix differential)은 벡터와 행렬의 미분식에 대 한 표기법을 정의하는 방법이다 보통 스칼라(scalar)에 대한 미분은 일분수 함수 f : < < 또는 다변수 함수(function

More information

36 Chap 20 : Conjugated Systems 20.1 Stability of Conjugated Dienes Diene : 2 개의 C=C 이중결합을가진화합물 C 1,4-Pentadiene 1,3-Pentadiene 1,2-Pentadiene (unconj

36 Chap 20 : Conjugated Systems 20.1 Stability of Conjugated Dienes Diene : 2 개의 C=C 이중결합을가진화합물 C 1,4-Pentadiene 1,3-Pentadiene 1,2-Pentadiene (unconj 36 Chap 20 : Conjugated Systems 20.1 Stability of Conjugated Dienes Diene : 2 개의 C=C 이중결합을가진화합물 C 1,4-Pentadiene 1,3-Pentadiene 1,2-Pentadiene (unconjugated diene) (conjugated diene) (cumulated diene)

More information

실험 5

실험 5 실험. OP Amp 의기초회로 Inverting Amplifier OP amp 를이용한아래와같은 inverting amplifier 회로를고려해본다. ( 그림 ) Inverting amplifier 위의회로에서 OP amp의 입력단자는 + 입력단자와동일한그라운드전압, 즉 0V를유지한다. 또한 OP amp 입력단자로흘러들어가는전류는 0 이므로, 저항에흐르는전류는다음과같다.

More information

8.2. 측정시스템 측정시스템의기본개념 통계적품질관리는모든것을품질데이터에근거하고있으므로정확한데이터의수집이중요 측정시스템이제품이나공정을정확히측정하여올바른데이터를산출할수있는것인지반드시평가 측정오차의성질 정확성, 정밀도, 안정성, 재현성

8.2. 측정시스템 측정시스템의기본개념 통계적품질관리는모든것을품질데이터에근거하고있으므로정확한데이터의수집이중요 측정시스템이제품이나공정을정확히측정하여올바른데이터를산출할수있는것인지반드시평가 측정오차의성질 정확성, 정밀도, 안정성, 재현성 8.2. 측정시스템 8.2.1 측정시스템의기본개념 통계적품질관리는모든것을품질데이터에근거하고있으므로정확한데이터의수집이중요 측정시스템이제품이나공정을정확히측정하여올바른데이터를산출할수있는것인지반드시평가 8.2.2 측정오차의성질 정확성, 정밀도, 안정성, 재현성 2 2 측정오차 (1) 정확성 (accuracy) 측정의정확성은어떤계측기로동일의제품을측정할때에얻어지는측정치의평균과이특성의참값과의차를말한다.

More information

최민지 / 세계무역기구과 / :16:24-2 -

최민지 / 세계무역기구과 / :16:24-2 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - 안식향산안식향산나트륨안식향산칼륨안식향산칼슘 파라옥시안식향산메틸파라옥시안식향산에틸 0.6 이하 ( 안식향산으로서, 파라옥시안식향산에틸또는파라옥시안식향산메틸과병용할때에는안식향산으로서사용량과파라옥시안식향산으로서사용량의합계가

More information

현대대학물리학 36(545~583p)

현대대학물리학 36(545~583p) 원자물리학 원서 38장 무엇을 배우는가 36.1 스펙트럼선 36.2 보어의 원자모형 보기문제 36.1 스펙트럼선 궤도각운동량의 양자화 36.3 보어 모형의 스펙트럼선 수소 전자의 파동함수 구형대칭 해 보기문제 36.2 수소 파동함수의 규격화 각운동량 36.4 완전해 다른 원자들 보기문제 36.3 헬륨 원자의 이온화에너지 36.5 엑스선 생성 레이저 유도방출과

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

CERIUM OXIDE Code CeO CeO 2-035A CeO 2-035B CeO REO % CeO 2 /REO % La 2 O 3 /REO %

CERIUM OXIDE Code CeO CeO 2-035A CeO 2-035B CeO REO % CeO 2 /REO % La 2 O 3 /REO % 희토류 SPEC CERIUM OXIDE Code CeO 2-040 CeO 2-035A CeO 2-035B CeO 2-025 REO % 99 99 98 97.5 CeO 2 /REO % 99.99 99.98 99.95 99.50 La 2 O 3 /REO % 0.004 0.01 0.03 0.1 0.01 (1) Pr 6 O 11 /REO % 0.003 0.004 0.015

More information

-. BSE ( 3 ) BSE. ㆍㆍ ( 5 ). ( 6 ) 3., ( : , Fax : , : 8 177, : 39660).. ( ). ( ),. (

-. BSE ( 3 ) BSE. ㆍㆍ ( 5 ). ( 6 ) 3., ( : , Fax : ,   : 8 177, : 39660).. ( ). ( ),. ( 2018-231 ( 2017-4, 2017.1.25.) 46. 2018 7 00 ( ) 1., ㆍ ㆍ. 2.. ( 2 ) - - 1 - -. BSE ( 3 ) BSE. ㆍㆍ ( 5 ). ( 6 ) 3., 2018 9 00 ( : 054-912-0423, Fax : 054-912-0431, E-mail : ilsu@korea.kr, : 8 177, : 39660)..

More information

Ⅰ. 석면 1 1) American Geological Institute, Glossary of geology, 2008, http://glossary.agiweb.org 2) US OSHA standard 29CFR1910.1001(b) 2 석면분석전문가양성교육교재 : 편광현미경을이용한고형시료중석면분석 1) Cornelis Klein, The Manual

More information

어린이기호식품1회제공량표시-결과보고서-줄임.hwp

어린이기호식품1회제공량표시-결과보고서-줄임.hwp 우리는소비자와함께행복한세상을만든다 어린이기호식품 1 회제공량표시조사보고서 2010. 11 식품미생물팀 차례 Ⅰ. 조사개요 1 1. 추진배경 1 2. 조사기간및조사내용 2 Ⅱ. 조사결과 2 1. 어린이기호식품 2 2. 가공식품의영양표시제도 4 3. 1회제공량표시 9 4. 영양성분앞면표시제 12 5. 신호등표시제 14 6. 고열량 저영양식품 16 7. 어린이기호식품품질인증

More information

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic

More information

국제 원자재 지수

국제 원자재 지수 국제원자재지수 구성품목리스트및가중치요약 자료요약및정리 : Korea PDS May. 2016 DOW JONES UBS Commodity Index (Bloomberg Commodity Index) -1- DOW JONES-UBS Commodity Index 아연, 2.53% 니켈, 2.36% 커피, 생돈, 2.06% 원면, 1.49% 2.29% 캔자스소맥,

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

MD-C-035-1(N-71-18)

MD-C-035-1(N-71-18) MD-C-035-1(N-71-18) KEPIC 적용사례 : MD-C-035-1(N-71-18) ( 승인일자 : 2010. 8. 31) 제목 : 용접으로제조되는 KEPIC-MNF 의 1, 2, 3 및 MC 등급기기지지물의추가재 료 (KEPIC-MN) 질의 : 품목이용접으로제작될경우, KEPIC-MDP의부록 IA, IB, IIA, IIB 및 VI에나열된것이외에추가로어떤재료가

More information

Y Z X Y Z X () () 1. 3

Y Z X Y Z X () () 1. 3 1. 3. 3 4. 2. 3 5. 1 6. 3 8. 3 Y Z X Y Z X 9. 7. () () 1. 3 11. 14. 3 12. 13. 15. D 3 D D 16. 3 19. 3 17. 18. 2. 1. 1 2 3 4 2. 3. 3 4. 3 5. 1 6. 8. UN 9. 3 7. 3 Y Z X Y Z X 1. 3 14. 3 11. 12. 3 13. 3 15.

More information

KAERIAR hwp

KAERIAR hwp - i - - ii - - iii - - iv - - v - - vi - Photograph of miniature SiC p-n and Schottky diode detector Photograph SiC chip mounted on a standard electrical package Photograph of SiC neutron detector with

More information

<4D F736F F F696E74202D2035BBF3C6F2C7FC5FBCF8BCF6B9B0C1FA2E BC8A3C8AF20B8F0B5E55D>

<4D F736F F F696E74202D2035BBF3C6F2C7FC5FBCF8BCF6B9B0C1FA2E BC8A3C8AF20B8F0B5E55D> 5. 상평형 : 순수물질 이광남 5. 상평형 : 순수물질 상전이 phase transition 서론 ~ 조성의변화없는상변화 5. 상평형 : 순수물질 전이열역학 5. 안정성조건 G ng ng n G G 자발적변화 G < 0 G > G or 물질은가장낮은몰Gibbs 에너지를갖는상 가장안정한상 으로변화하려는경향 5. 상평형 : 순수물질 3 5. 압력에따른Gibbs

More information

안전확인대상생활화학제품지정및안전 표시기준 제1조 ( 목적 ) 제2조 ( 정의 )

안전확인대상생활화학제품지정및안전 표시기준 제1조 ( 목적 ) 제2조 ( 정의 ) 안전확인대상생활화학제품지정및안전 표시기준 제1조 ( 목적 ) 제2조 ( 정의 ) - 1 - - 2 - 제3조 ( 안전확인대상생활화학제품지정 ) 제4조 ( 안전기준의설정 ) 제5조 ( 안전기준 ) 제6조 ( 표시기준 ) - 3 - - 4 - 제9조 ( 규제의재검토 ) 제 7 조 ( 안전기준확인제출자료 ) 제8조 ( 안전기준적용예외 ) 부칙 제1조 ( 시행일 )

More information

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월 지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 11 곡선과곡면 01 Spline 곡선 02 Spline 곡면 03 Subdivision 곡면 C n 연속성 C 0 연속성 C 1 연속성 2 C 2 연속성 01 Spline 곡선 1. Cardinal Spline Curve 2. Hermite Spline Curve 3. Bezier Spline Curve 4. Catmull-Rom Spline Curve 5.

More information

제 2 차 (2013~2015) 어린이식생활안전관리종합계획

제 2 차 (2013~2015) 어린이식생활안전관리종합계획 제 2 차 (2013~2015) 어린이식생활안전관리종합계획 2012. 9 목 차 추진배경 1 주요성과와반성 3 정책과여건 11 추진체계 16 세부추진과제 21 1. 어린이기호식품안전판매환경조성 23 1-1. 어린이식품안전보호구역지정및관리강화 26 1-2. 어린이기호식품판매환경개선 30 2. 어린이식생활안심확보를위한안전공급체계구축 39 2-1. 어린이단체급식의안전관리및품질개선

More information

<3235B0AD20BCF6BFADC0C720B1D8C7D120C2FC20B0C5C1FE20322E687770>

<3235B0AD20BCF6BFADC0C720B1D8C7D120C2FC20B0C5C1FE20322E687770> 25 강. 수열의극한참거짓 2 두수열 { }, {b n } 의극한에대한 < 보기 > 의설명중옳은것을모두고르면? Ⅰ. < b n 이고 lim = 이면 lim b n =이다. Ⅱ. 두수열 { }, {b n } 이수렴할때 < b n 이면 lim < lim b n 이다. Ⅲ. lim b n =0이면 lim =0또는 lim b n =0이다. Ⅰ 2Ⅱ 3Ⅲ 4Ⅰ,Ⅱ 5Ⅰ,Ⅲ

More information

2차 수사분석사례집_최종.hwp

2차 수사분석사례집_최종.hwp 1 발간사 최근국민소득의향상과 100세시대도래로인한수명의연장등으로건강에대한열망과관심이급증하고있습니다. 건강한삶을추구하기위하여식품이나건강기능식품등의소비가증가하고있으며, 이에따라건강기능식품시장이엄청나게활성화되고있습니다. 하지만부정 불법으로의약품성분이나그유사물질을식품이나건강기능식품등에혼입하거나의약품을불법제조 유통하는사례가빈발하여소비자가섭취시부작용과위해성에노출되어있는실정이며식

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

기업분석(Update)

기업분석(Update) 1.. Quantitative Analyst 이창환 91-73 ch.lee@ibks.com Sector Monitor: 업종별수익률 : Cyclical 업종이 Defensive 업종대비아웃퍼폼 이익모멘텀 : 1개월전대비 EPS 전망치변화율은업종전반적으로 (+) 를기록. ERR 역시전반적으로 (+) 를기록한가운데 와, 업종이두드러짐. 개월선행 EPS 전망치는,,

More information

(001~006)개념RPM3-2(부속)

(001~006)개념RPM3-2(부속) www.imth.tv - (~9)개념RPM-(본문).. : PM RPM - 대푯값 페이지 다민 PI LPI 알피엠 대푯값과산포도 유형 ⑴ 대푯값 자료 전체의 중심적인 경향이나 특징을 하나의 수로 나타낸 값 ⑵ 평균 (평균)= Ⅰ 통계 (변량)의 총합 (변량의 개수) 개념플러스 대푯값에는 평균, 중앙값, 최 빈값 등이 있다. ⑶ 중앙값 자료를 작은 값부터 크기순으로

More information

<B3EDB9AEC0DBBCBAB9FD2E687770>

<B3EDB9AEC0DBBCBAB9FD2E687770> (1) 주제 의식의 원칙 논문은 주제 의식이 잘 드러나야 한다. 주제 의식은 논문을 쓰는 사람의 의도나 글의 목적 과 밀접한 관련이 있다. (2) 협력의 원칙 독자는 필자를 이해하려고 마음먹은 사람이다. 따라서 필자는 독자가 이해할 수 있는 말이 나 표현을 사용하여 독자의 노력에 협력해야 한다는 것이다. (3) 논리적 엄격성의 원칙 감정이나 독단적인 선언이

More information

< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ]

< 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ] < 서식 5> 탐구보고서표지 제 25 회서울학생탐구발표대회보고서 출품번호 유글레나를이용한산소발생환경의탐구 2010. 09. 28. 소속청학교명학년성명 ( 팀명 ) 강서교육청서울백석중학교 3 임산해 [ 팀원이름 ] 목 차 Ⅰ. 탐구주제 02 Ⅱ. 탐구하게된동기 02 Ⅲ. 배경이론 02 1. 유글레나의특징가. ph 나. 온도 Ⅳ. 선행연구고찰 03 1. 산소결핍과인체에미치는영향

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

소성해석

소성해석 3 강유한요소법 3 강목차 3. 미분방정식의근사해법-Ritz법 3. 미분방정식의근사해법 가중오차법 3.3 유한요소법개념 3.4 편미분방정식의유한요소법 . CAD 전처리프로그램 (Preprocessor) DXF, STL 파일 입력데이타 유한요소솔버 (Finite Element Solver) 자연법칙지배방정식유한요소방정식파생변수의계산 질량보존법칙 연속방정식 뉴톤의운동법칙평형방정식대수방정식

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

- 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - 제 1 장연구개발과제의개요 - 17 - - 18 - - 19 - - 20 - - 21 - 제 2 장재료및방법 - 22 - - 23 - - 24 - - 25 - 시료번호 596 항목에따라해당점수위에표기해주십시오.

More information

[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종

[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종 [ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface

More information

이 장에서 사용되는 MATLAB 명령어들은 비교적 복잡하므로 MATLAB 창에서 명령어를 직접 입력하지 않고 확장자가 m 인 text 파일을 작성하여 실행을 한다

이 장에서 사용되는 MATLAB 명령어들은 비교적 복잡하므로 MATLAB 창에서 명령어를 직접 입력하지 않고 확장자가 m 인 text 파일을 작성하여 실행을 한다 이장에서사용되는 MATLAB 명령어들은비교적복잡하므로 MATLAB 창에서명령어를직접입력하지않고확장자가 m 인 text 파일을작성하여실행을한다. 즉, test.m 과같은 text 파일을만들어서 MATLAB 프로그램을작성한후실행을한다. 이와같이하면길고복잡한 MATLAB 프로그램을작성하여실행할수있고, 오류가발생하거나수정이필요한경우손쉽게수정하여실행할수있는장점이있으며,

More information

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

국가표본수기간 평균최초수익률 국가표본수기간 ( 단위 : 개, 년, %) 평균최초수익률 아르헨티나 20 1991-1994 4.4 요르단 53 1999-2008 149.0 오스트레일리아 1,562 1976-2011 21.8 한국 1,593 1980-2010 61.6 오스트리아 102 1971-2010 6.3 말레이시아 350 1980-2006 69.6 벨기에 114

More information

00....

00.... Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /

More information

온습도 판넬미터(JTH-05) 사양서V1.0

온습도 판넬미터(JTH-05)  사양서V1.0 온습도 조절기 Model:JTH-05 1. 제품 사양. [제품 구분] JTH-05A(입력 전원 AC), JTH-05D(입력 전원 DC) [전원 사양] JTH-05A 입력 전압 출력 전원 소비 전력 JTH-05D AC 90~240V DC 10~36V 12Vdc / Max.170mA Max.2W [본체 사이즈] ~ 온/습도 범위(본체): 사용 [0 ~ 50, 85%RH

More information

딥러닝 첫걸음

딥러닝 첫걸음 딥러닝첫걸음 4. 신경망과분류 (MultiClass) 다범주분류신경망 Categorization( 분류 ): 예측대상 = 범주 이진분류 : 예측대상범주가 2 가지인경우 출력층 node 1 개다층신경망분석 (3 장의내용 ) 다범주분류 : 예측대상범주가 3 가지이상인경우 출력층 node 2 개이상다층신경망분석 비용함수 : Softmax 함수사용 다범주분류신경망

More information

........01~11

........01~11 Highquality news for professionals www.withbuyer.com 2 Highquality news for professionals Highquality news for professionals 3 4 Highquality news for professionals Highquality news for professionals 5

More information

2017 년 1 학기 공학논문작성법 (3 강 ) 공학논문작성방법개요 좋은공학논문작성을위해서는무엇이필요한가? (1) 논리적이고정확하게글쓰기 (2강내용에연결 ) (2) Abstract 작성법의예

2017 년 1 학기 공학논문작성법 (3 강 ) 공학논문작성방법개요 좋은공학논문작성을위해서는무엇이필요한가? (1) 논리적이고정확하게글쓰기 (2강내용에연결 ) (2) Abstract 작성법의예 2017 년 1 학기 공학논문작성법 (3 강 ) 공학논문작성방법개요 좋은공학논문작성을위해서는무엇이필요한가? (1) 논리적이고정확하게글쓰기 (2강내용에연결 ) (2) Abstract 작성법의예 Homework #2 [2] 답의예 ( 학생 1): 소폭수정 다양한외부환경을효과적으로검지할수있는센서기술은검지변환, 신호처리및지능화기술등융합 적특성을갖고있음. 현재대부분실용화중심의연구가주류를이루고있으며,

More information

자연언어처리

자연언어처리 제 7 장파싱 파싱의개요 파싱 (Parsing) 입력문장의구조를분석하는과정 문법 (grammar) 언어에서허용되는문장의구조를정의하는체계 파싱기법 (parsing techniques) 문장의구조를문법에따라분석하는과정 차트파싱 (Chart Parsing) 2 문장의구조와트리 문장 : John ate the apple. Tree Representation List

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

- 2 -

- 2 - - 1 - - 2 - - - - 4 - - 5 - - 6 - - 7 - - 8 - 4) 민원담당공무원 대상 설문조사의 결과와 함의 국민신문고가 업무와 통합된 지식경영시스템으로 실제 운영되고 있는지, 국민신문 고의 효율 알 성 제고 등 성과향상에 기여한다고 평가할 수 있는지를 치 메 국민신문고를 접해본 중앙부처 및 지방자 였 조사를 시행하 였 해 진행하 월 다.

More information

1 2 자료조사 및 디자인 개인별 주제에 대한 발표 소재 선정 자료조사 및 디자인 조사한 자료에 대한 발표 작업지시서 작성 3 4 작업지시서 작성 작업지시서에 따른 일정 확인 작업지시서에 따른 공정 방법 확인 갑피 패턴 작성 복사본, 기본본, 작업본 만들기 5 재단 소

1 2 자료조사 및 디자인 개인별 주제에 대한 발표 소재 선정 자료조사 및 디자인 조사한 자료에 대한 발표 작업지시서 작성 3 4 작업지시서 작성 작업지시서에 따른 일정 확인 작업지시서에 따른 공정 방법 확인 갑피 패턴 작성 복사본, 기본본, 작업본 만들기 5 재단 소 2013학년도 2학기 교수코드 : 1997002 E-Mail : ygkim@osan.ac.kr 김영길 제화패션산업과 계열(학과) 전공명 이수구분 학 년 과목코드 과 목 명 수강반 학점 시수 제화패션산업과 공통전공 전필 2 1330040 Capstone Design 1 1 2 학습내용 Capstone Design에 사용되는 소재를 체계적으로 이해하여 발을 편하게

More information

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

歯140김광락.PDF

歯140김광락.PDF 2001 / Separation of Hydrogen Isotopes/Helium Using Gas Chromatography,,,, 150 196 C / He, H 2 D 2 Abstract In the hydrogen isotope facility and the fuel cycle of the fusion reactor, an effective means

More information

5부-11장(455~459)

5부-11장(455~459) 11 1) LMO를수입하기위해서는관계부처의승인 ( 신고포함 ) 절차가필요하며, 수출의경우에는지식경제부장관에게관련내용을통보해야한다. 이러한 LMO법에따라 2008년국내에수입된시험연구용 LMO는총 110건으로대부분시험용쥐였으며, 식품및사료용으로수입된옥수수의 77% 가, 콩의 53% 가 LMO였다. 한편우리나라의 LMO 수출은 8건이루어졌으며모두시험용쥐였다. 유전자변형생물체의국가간이동등에관한법률

More information

2015 년 3 월농축수산물수입가격지수 농산물과수산물을중심으로농축수산물수입가격은전년동월대비 하락 년 월농축수산물수입가격지수는 월 전년 동월대비는 하락 전월대비 하락 농산물 견과류를제외한전품목하락으로전년동월대비 하락 전월대비 하락 축산물 전년동월대비 상승 전월대비 하락

2015 년 3 월농축수산물수입가격지수 농산물과수산물을중심으로농축수산물수입가격은전년동월대비 하락 년 월농축수산물수입가격지수는 월 전년 동월대비는 하락 전월대비 하락 농산물 견과류를제외한전품목하락으로전년동월대비 하락 전월대비 하락 축산물 전년동월대비 상승 전월대비 하락 http://trass.kctdi.or.kr 자료문의무역통계2부통계연구과장박종문, 담당연구원 : 김덕현, 정영진전화번호 (02) 3416-5155~157 Fax (02) 540-7438 년 월농축수산물수입가격지수 년 월농축수산물수입가격지수는 농산물과수산물을중심으로농축수산물수입가격은전년동월대비 하락 전월대비 하락 2015 년 3 월농축수산물수입가격지수 농산물과수산물을중심으로농축수산물수입가격은전년동월대비

More information

<B1B9BEEE412E687770>

<B1B9BEEE412E687770> 21 학년도대학수학능력시험문제및정답 1. 3. 3 4. 2. 3 5. 1 6. 3 8. 3 Y Z X Y Z X 9. 7. () () 1. 3 11. 14. 3 12. 13. 15. D 3 D D 16. 3 19. 3 17. 18. 2. 1. 1 2 3 4 2. 3. 3 4. 3 5. 1 6. 8. UN 9. 3 7. 3 Y Z X Y Z X 1. 3 14.

More information

슬라이드 1

슬라이드 1 장연립방정식을 풀기위한반복법. 선형시스템 : Guss-Sedel. 비선형시스템 . 선형시스템 : Guss-Sedel (/0) 반복법은초기근을가정한후에더좋은근의값을추정하는체계적인절차를이용한다. G-S 방법은선형대수방정식을푸는반복법중에서 가장보편적으로사용되는방법이다. 개의방정식에서 인 ( 대각원소들이모두 0 이아닌 ) 경우를다루자. j j b j b j j j

More information

16-27( 통권 700 호 ) 아시아분업구조의변화와시사점 - 아세안, 생산기지로서의역할확대

16-27( 통권 700 호 ) 아시아분업구조의변화와시사점 - 아세안, 생산기지로서의역할확대 16-27( 통권 700 호 ) 2016.07.08 - 아세안, 생산기지로서의역할확대 본보고서에있는내용을인용또는전재하시기위해서는본연구원의허락을얻어야하며, 보고서내용에대한문의는아래와같이하여주시기바랍니다. 총괄 ( 경제연구실장 ) : 주원이사대우 (2072-6235, juwon@hri.co.kr) 경제연구실 / 동향분석팀 : : 조규림선임연구원 (2072-6240,

More information

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

KMC.xlsm

KMC.xlsm 제 7 장. /S 에필요한내용 1] IGBT 취급시주의사항 ) IGBT 취급시주의 1) 운반도중에는 Carbon Cross로 G-E를단락시킵니다. 2) 정전기가발생할수있으므로손으로 G-E 및주단자를만지지마십시요. 3) G-E 단자를개방시킨상태에서직류전원을인가하지마십시요. (IGBT 파손됨 ) 4) IGBT 조립시에는사용기기나인체를접지시키십시요. G2 E2 E1

More information

<C7D1B1B9C0CEC0C720B4EBC7A5BDC4B4DCBAB8B0EDBCAD2E687770>

<C7D1B1B9C0CEC0C720B4EBC7A5BDC4B4DCBAB8B0EDBCAD2E687770> (Mean group portion in gram) (weekly mean group frequency)/7days =average daily intake (g/day) :, 1998, 1999 ꀻ 9.4% 90.6% 해조류 어패류 7.9% 1.5% 1.2% 0.8% 28.0%

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

16<C624><D22C><ACFC><D0D0> <ACE0><B4F1><BB3C><B9AC><2160>_<BCF8><CC45>.pdf

16<C624><D22C><ACFC><D0D0> <ACE0><B4F1><BB3C><B9AC><2160>_<BCF8><CC45>.pdf I I 02 03 04 05 06 II 07 08 09 III 10 11 12 13 IV 14 15 16 17 18 a b c d 410 434 486 656 (nm) Structure 1 PLUS 1 1. 2. 2 (-) (+) (+)(-) 2 3. 3 S. T.E.P 1 S. T.E.P 2 ) 1 2 (m) 10-11 10-8 10-5 C 10-2 10

More information

한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과

한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium

More information

붙임2-1. 건강영향 항목의 평가 매뉴얼(협의기관용, '13.12).hwp

붙임2-1. 건강영향 항목의 평가 매뉴얼(협의기관용, '13.12).hwp 환경영향평가서내위생 공중보건항목작성을위한건강영향항목의평가매뉴얼 - 협의기관용 - 2013. 12 환경부환경보건정책관실 - i - - ii - - iii - - iv - - v - - vi - 제 1 장건강영향평가의개요 건강영향평가의정의건강영향평가제도의필요성건강영향평가의목적및기능건강영향평가의원칙건강결정요인 - 1 - - 2 - - 3 - 제 2 장건강영향평가제도의시행방안

More information

2 Journal of Disaster Prevention

2 Journal of Disaster Prevention VOL.13 No.4 2011 08 JOURNAL OF DISASTER PREVENTION CONTENTS XXXXXX XXXXXX 2 Journal of Disaster Prevention 3 XXXXXXXXXXXXXXX XXXXXXXXXXXXXX 4 Journal of Disaster Prevention 5 6 Journal of Disaster Prevention

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

전기 회로 과목의 성취기준 및 성취수준

전기 회로 과목의 성취기준 및 성취수준 ( 과 학 ) 과목의 성취기준 및 성취수준 1. 교과의 개요 (1) 성격 과학 에서는 물리, 화학, 생명과학, 지구과학의 기본 개념들이 적절하게 균형을 이루면서 자연스럽게 융합되도 록 구성한 학생들이 과학에 대한 흥미를 느끼고 자연을 통합적으로 이해하는 데 필요하다면 어려운 과학 개념 일지라도 적절한 수준에서 소개한 과학 을 통하여 학생들이 심화된 물리, 화학,

More information

Chap 6: Graphs

Chap 6: Graphs 그래프표현법 인접행렬 (Adjacency Matrix) 인접리스트 (Adjacency List) 인접다중리스트 (Adjacency Multilist) 6 장. 그래프 (Page ) 인접행렬 (Adjacency Matrix) n 개의 vertex 를갖는그래프 G 의인접행렬의구성 A[n][n] (u, v) E(G) 이면, A[u][v] = Otherwise, A[u][v]

More information

슬라이드 1

슬라이드 1 2019 년사용자교육안내서 The World Leader in Serving Science Enabling Our Customers to make the world Healthier, Cleaner and Safer 초대의글 안녕하십니까? 지난한해동안저희써모피셔사이언티픽코리아 ( 주 ) 에보내주신관심과성원에감사드립니다. 저희회사에서는 Thermo Scientific

More information

슬라이드 제목 없음

슬라이드 제목 없음 계량치 Gage R&R 1 Gage R&R 의변동 반복성 (Equipment Variation) : EV- 계측장비에의한변동 - 동일측정자가동일조건에서반복하여발생된측정값의범위로부터계산되므로 Gage의변동을평가하게됨. 재현성 (Operator / Appraiser Variation) : AV- 평가자에의한변동 - 서로다른측정자가동일조건에서측정한값의차이로부터 계산되므로측정자에의한변동을평가함.

More information

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (

농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명

More information

중점협력국 대상 국가협력전략 ( 9 개국 ) ᆞ 5 ᆞ 30 관계부처 합동

중점협력국 대상 국가협력전략 ( 9 개국 ) ᆞ 5 ᆞ 30 관계부처 합동 중점협력국대상국가협력전략 (9 개국 ) - 콜롬비아, 방글라데시, 아제르바이잔, 르완다, 볼리비아, 우간다, 우즈베키스탄, 인도네시아, 파라과이 - 2016. 5. 30. 관계부처합동 중점협력국 대상 국가협력전략 ( 9 개국 ) 2 0 1 6 ᆞ 5 ᆞ 30 관계부처 합동 총목차 1. 콜롬비아국가협력전략 1 2. 방글라데시국가협력전략 38 3. 아제르바이잔국가협력전략

More information

슬라이드 1

슬라이드 1 대한의료관련감염관리학회학술대회 2016년 5월 26일 ( 목 ) 15:40-17:40 서울아산병원동관 6층대강당서울성심병원김지형 기능, 가격, 모든것을종합 1 Excel 자료정리 2 SPSS 학교에서준다면설치 3 통계시작 : dbstat 4 Web-R : 표만들기, 메타분석 5 R SPSS www.cbgstat.com dbstat 직접 dbstat 길들이기

More information

82-01.fm

82-01.fm w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information

<B5DEC7A5C1F628BCB1BCFBB1E82D E6169>

<B5DEC7A5C1F628BCB1BCFBB1E82D E6169> UV VIS Spectrometer NIR Spectrometer Fiber Optic Temperture Converter 3 Channel On-line Absorbance Monitoring System Color Sensor Integrating Sphere Raman System Tunable light source LIBS Pyrometer UV

More information

장비명 GC/MS/MS (QQQ가스크로마토질량분석기) P-GC-MS ( 열분해가스크로마토질량분석기 ) FT-IR ( 적외선분광분석기 ) FT-Raman( laser 파장 :1064nm) ( 라만분광분석기 ) Dispersive-Raman ( laser 파장 :532,6

장비명 GC/MS/MS (QQQ가스크로마토질량분석기) P-GC-MS ( 열분해가스크로마토질량분석기 ) FT-IR ( 적외선분광분석기 ) FT-Raman( laser 파장 :1064nm) ( 라만분광분석기 ) Dispersive-Raman ( laser 파장 :532,6 유기분석실사용료안내 장비명 교내교외 1H (15분/ 시료당 ) 18,000 30,000 C / N / P (30분/ 시료당 ) 30,000 50,000 초과 30분당 5,000 10,000 Cryo-NMR 700MHz 13C Overnight (12시간) 155,000 258,000 2D 외 ( 기본 / 시료당 ) 60,000 100,000 ( 핵자기공명분광기

More information

OCW_C언어 기초

OCW_C언어 기초 초보프로그래머를위한 C 언어기초 4 장 : 연산자 2012 년 이은주 학습목표 수식의개념과연산자및피연산자에대한학습 C 의알아보기 연산자의우선순위와결합방향에대하여알아보기 2 목차 연산자의기본개념 수식 연산자와피연산자 산술연산자 / 증감연산자 관계연산자 / 논리연산자 비트연산자 / 대입연산자연산자의우선순위와결합방향 조건연산자 / 형변환연산자 연산자의우선순위 연산자의결합방향

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - μ μ - 13 - - 14 - - 15 - - 16 - - 17 - δ - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - A As S - 24 - - 25 - - 26 - - 27 - - 28 - μ

More information

의약품의_품목허가·신고_심사 체크리스트_및_세부_업무_매뉴얼.hwp

의약품의_품목허가·신고_심사 체크리스트_및_세부_업무_매뉴얼.hwp 의약품의품목허가 신고 체크리스트및세부업무매뉴얼 의약품심사부 목 차 1. 개요 1 2. 의약품제조판매 수입품목허가 신고절차 2 3. 의약품허가및신고대상의구분 3 4. 의약품허가및신고처리부서 4 5. 의약품허가 신고체크리스트 5 6. 의약품변경허가 신고체크리스트 21 7. 세부업무매뉴얼 ( 일부 ) 34 1 개요 < 법령 > 약사법 ( 법률제 12450 호, 14.3.18,

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

기업분석│현대자동차

기업분석│현대자동차 투자전략ㅣ Commodity 투자전략팀 2.3779.194 상품투자동향 [ 212/7/3 기준 ] 7/3 가격주간등락률 (%) 7/3 투기적포지션 전주대비 ( 계약 ) 연초대비 ( 계약 ) NYMEX 원유 ($/bbl.) 7.66 1.46 131,53 1,75-13,5 COMEX 전기동 ($/lb.) 3.53 6.69-13,21 3,626-9,626 COMEX

More information