대구외지 2005;31: MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 서제덕 명훈 * 강나라** 정필훈

Size: px

Start display at page:

Download "대구외지 2005;31: MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 서제덕 명훈 * 강나라** 정필훈"

아인 변
3 years ago
Views:

1 MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 서제덕 명훈 * 강나라** 정필훈* 서울대학교보라매병원치과구강악안면외과, * 서울대학교치과대학구강악안면외과학교실, ** 이화여자대학교의과대학구강악안면외과 Abstract (J. Kor. Oral Maxillofac. Surg. 2005;31: ) THE EFFECTS OF INSULIN-LIKE GROWTH FACTOR I (IGF-I) ON EXPRESSION OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) MRNA IN MG-63 OSTEOBLASTLIKE CELLS Je-Duck Suh, Hoon Myung*, Nara Kang**, Pill-Hoon Choung* Department of Oral and Maxillofacial Surgery, Seoul National University Boramae Hospital *Department of Oral and Maxillofacial Surgery, Seoul National University, College of Dentistry **Department of Oral and Maxillofacial Surgery, Ewha Womans University, College of Medicine Purpose: To determine the role of Insulin-like Growth Factor-I (IGF-I) in the regulation of Vascular Endothelial Growth Factor (VEGF) expression in MG-63 cells and then to find the mechanism b which this regulation occurs. Materials and methods: MG-63 cells were grown to confluence in 60-mm dishes. To determine the effects of IGF-I on expression of VEGF mrna according to time and concentration, the cells were treated with 10 nm IGF-I, following isolation of total RNA and Northern blot analysis after 1, 2, 4, 8, 12, 24 hours and after 2 hours of treatment with 0.5, 2, 10, 25, 50 nm IGF-I respectively, isolation of total RNA and Northern blot analysis were followed. To determine the mechanism of action of IGF-I, inhibitors such as hydroxyurea (76.1 μg / ml ), actinomycin D (2.5 μg / ml ), cycloheximide (10 μg / ml ) were added 1 hour after treatment of 10 nm IGF-I. Results: 1. the expression of VEGF mrna was increased with treatment of IGF-I. 2. The expression of VEGF mrna was increased according to time- and concentration dependent manner of IGF-I. 3. The effect of IGF-I was decreased by hydroxyuera, actinomycin D, but not by cycloheximide. Conclusion: IGF-I regulate the expression of VEGF mrna in the level of DNA synthesis and transcription. These results could suggest that IGF-I plays an important role in angiogenesis in the process of new bone formation and remodeling. Key words: Osteogenesis, Angiogenesis, Vascular endothelial growth factor, Insulin-like growth factor I, MG-63 cell line Ⅰ. 서론 신혈관생성은혈관발육과태아에서의분화, 창상치유, 기관재생등의다양한생물학적과정에매우중요한요소이다 1). 이런신혈관생성은정교하게조절되고계획된, 자체적으로조절기전을가진과정이며이러한조절기전은혈관생성자극요소와억제요소간의균형활동의결과이다 1). 실제적으로는존재하지않는것처럼보이며, 전체기관증식시에나타나 정필훈 서울종로구연건동 28 서울대학교치과대학구강악안면외과학교실 Pill-Hoon Choung Department of OMFS, College of Dentistry, Seoul National University, Yeon-gun dong 28, Jongno-Gu, Seoul, , Korea Tel: Fax: choungph@snu.ac.kr 는모든혈관 endothelial cells 의 0.1 % 미만밖에는되지않는다 1-4). 그러나류마티스성관절염, 건선, retrolental fibroplasias, 당뇨병성망막병변, 혈관종, 장기이식의거부반응, 종양성장및전이과정등의많은병적상태는지속적인혈관생성에의해유도되며, 10% 이상의 vascular endothelial cell 들이활발하게증식한다 1-4). 성장, 회복, 그리고재형성등의골과관련된전체반응들은새로운혈관의형성을필요로한다. 새로운골이형성되는부위에서는조골세포및골세포전구체등이혈관의 endothelial cell 주변에위치하게되며이러한사실로혈관재생과골형성은서로연관을가짐을유추할수있다 2-5). 연골내에서골이형성되는것을관찰하였을때, 성장판의골단종말부 (metaphyseal end) 로모세혈관이자라들어가는현상은연골이광화된골로대치되는데매우중요하다 6,7). 골절의치유과정에서조골세포에의한골화과정은가골내로의모세혈관투과와공간적으로 363

2 서로연관된다 6,8). 다양한성장인자들은혈관재생과관련이있으며이러한성장인자들로는 tumor necrosis factor (TNF), transforming growth factor-β(tgf-beta), basic fibroblast growth factor (bfgf) 등이거론된다 1). 기존에존재하던모세혈관들로부터새로운혈관이생성되는과정은 angiogenic factor, 세포외기질, 그리고 protease 등의서로복합적으로작용하여이루어진다. 혈관재생과관련한요소들중에서가장중요한매개체중의하나가 Vascular Endothelial Growth Factor(VEGF) 이며이는 Vascular Permeability Factor(VPF) 또는 Vasculotropin 이라고도불린다. 대표적인기능으로는혈관의투과성을증가시키며, endothelial cell 증식을유도한다. VEGF 는 Platelet-derived Growth Factor(PDGF) 와동질성을공유하는 glycoprotein 이며생체내에서모세혈관형성을자극하는가장중요한혈관형성요소로알려져있다 2,6). 또한 endothelial cell 에대해제한적으로유사분열 (mitogenic) 을촉진하며화학주성을가진다 9). 최소한 4 가지의 VEGF- VEGF121,165,189,206- 가존재하지만단일유전자로부터형성되어선택적인절편화 (alternative splicing) 에의해서로다른형태가형성된다 1,10). 그러나이중 VEGF 165 가가장중요한생물학적활동력을가지며생체내에서가장많은부분을차지한다. VEFG 121 도정상또는병적상황에서발현되지만 VEGF 165 에비해 10~100 배정도약한생물학적특성을갖는다 1). VEGF 는 2 개의 tyrosine kinase receptors-flk-1(kdr), Flt-1- 와결합하여작용한다 11-13). 이러한수용체들은주로 endothelial cell 에제한적으로발현한다 5). 그러나, VEGF 는많은세포로부터분비되며다양한성장인자들과 cytokine 에의하여분비가조절된다. 또한 VEGF 는조골세포에서의 alkaline phosphatase 활동을유도하며 parathyroid hormone 에대한조골세포의반응성을강화시키는것으로보고되었다 5). 조골세포는 VEGF 수용체에대해가장높은친화성을보이며이는조골세포내에기능적인 VEGF 수용체들이다수존재함을알려준다 5). 골반응에대한모세혈관의본질적인역할과 VEGF 가골세포에서매우조절되는양태로생산된다는점을고려하였을때 VEGF 와같은혈관생성인자들이골의성장과수복에매우중요한역할을하는것으로생각된다 6). 예를들어 endogeneous VEGF 의기능을차단하면골생성과흡수가차단된다 14). Insulin-like Growth Factor-I (IGF-I) 은 insulin, insulin-like growth factor-ii, relaxin 등과동질성을공유하며인슐린자체에대한세포적인반응등을공유한다 1,15). IGF-I 은대다수의조직에서생산되나 growth hormone 에의해합성이유도되어주로간세포에서분비가이루어진다 1-3,6,7). IGF-I 은간엽조직의성장에중요한매개체이며혈장과조직액에 insulin-like growth factor binding protein(igfbp) 등과함께 nanomolar 농도로존재한다 15). 이러한결합단백질은몇가지의복잡한기전을통하여 IGF 의작용을조절하게된다. Insulin 수용체와유사한 membrane bound tyrosine kinase 인제 1 형 IGF 수용체와 IGF 의결합으로유사분열이시작된다 15). 또한많은형태의세포에서 VEGF 를포함한서로다른유전자의발현을유도한다 1). IGF 는순환하는혈액내에서와세 포외공간에서 IGFBP-I 에서 - VI 까지의 IGF 결합단백질과결합하는것으로알려져있다 16). IGF 는골에서가장풍부한성장인자들중하나이며 IGF 조절기전은골형성과재형성에중요하다. 또한 human osteoblast-like cell 과조골세포등에서 DNA, alkaline phosphatase 그리고 type I collagen 등의합성을유도하는것으로알려져있다 15). IGF 의발현및조절기전은세포의생리학적인상태에따라매우다를수있으며또한골세포의성장발육조절에매우중요한작용을한다 15). 골에대한 IGF 의뚜렷한이화작용과골성장, 수복, 재형성에있어서모세혈관형성등을통하여본저자등은 IGF-I 이조골세포에서의 VEGF 발현을증가시킬수있을것이라고유추할수있었다. 그리하여저자등은조골세포와유사한기능을갖는것으로알려진 MG-63 세포주를이용하여 VEGF 발현에대한 IGF-I 의역할등을알아보고자하였으며어떠한기전을통하여작용하는지에대하여알아보고자한다. 1. 세포배양 Ⅱ. 재료및방법 MG-63 세포주를 95% 의공기와 5% 의이산화탄소로이루어진습기화된대기중에서 37 에서 10% 의우태아혈청 (fetal bovine serum) (Gibco, grand island, NY, USA) 과 1% 항생제 (100 unit/ml 페니실린, 스트렙토마이신 ) 을혼합한 Dulbecco s Modified Eagle s Medium(Gibco, grand island, NY, USA) 에서배양하였고 60-mm 조직배양접시에서배양하였다. 2. RNA 분리및 northern blot analysis 제조사의설명에따라 TRI-REAGENT (Molecular Research Center, Cincinnati, OH, USA) 를이용하여 60-mm 조직배양접시에서자라밀생에도달한세포들로부터 total cellular RNA 를추출하였다. 세포들을모은후 1.0 ml 의 TRI-REAGENT 에반복적인피펫팅으로분해시키고, 세포의핵내단백질복합체 (nucleoprotein complex) 의완전한분해를위해실온에서약 5 분간보관하였다. 그리고, 1.0 ml 의 TRI-REAGENT 당 0.2 ml 의 chloroform 과 15 초간강하게흔들어혼합하였다. 이후실온에서약 10 분간보관하고 4 의온도, 12,000 g 의조건으로 25 분간원심분리하였다. 이러한원심분리를거치면 3 층으로구별된다. 이중 RNA 는최상층인 aqueous phase 에존재하므로이층을 fresh tube 로옮긴후 0.5 ml 의 isopropanol 로처리하면침전물이형성된다. 얼음에서약 10 분간보관하고 12,000 g 로 8 분동안원심분리하였다. 원심분리후상청액은제거하고, 남은 RNA pellet 은 1.0 ml 의 75% ethanol 로세척한후다시 5 분간원심분리하였고다시에탄올로세척하였다. 이러한일련의세척과정을거친 RNA 를 DEPC(diethylpyrocarconate) - treated H2O 에용해시켰다. 발생가능한 DNA 오염을제거하기위하여 RNase-free DNase I 364

3 MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 Table 1. The condition of PCR and sequences of each primer VEGF(all isoform) G3PDH Forward: 5 - Reverse 5 - primer CCTGGTGGACATCTTCCAGGAGTACC GAAGCTCATCTCTCCTATGTGCTGGC Forward: 5 - Reverse: 5 - ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA PCR product size(bp) annealing temperature/time 60 /30sec 60 /30sec number of cycle 35 cycle 35 cycle (Amersham Pharmacia Biotech, 도시, IL, USA) 으로 total RNA 를처리하였다. 정량화를위해 260 nm 에서 Ultraspec 2000 UV/Visible Spectrometer (Pharmacia Biotech, Piscataway, NJ, USA) 를이용하였다. 20μg 의 RNA 표본을 MOPS 완충액하에서 formaldehyde agarose gel electrophoresis 로용해시켰고, intactness 를검증하였다. 전기영동이후에 12 시간동안 capillary transfer 를이용하여 gel 로부터나일론막 (Nytran, Keene, NH, USA) 으로흡착하였고 UV irradiation (200 mj/cm 2 ) 으로 cross-link 시켰다. 이 Blots 들은 random priming method 에의해인지되는적절한 probe 에 12 시간동안 55 에서하이브리드화하였고 cdna 는 DIG-dUTP 를이용, labelling 하였다. Label 된 cdna probe 는 DIG-detection kit(boehringer Mannheim, Mannheim, Germany) 를이용하여관찰하였다. Northern blot 은이후각시편당유사한양의 RNA 가적절히 loading 및 transfer 되었는지를확인하기위하여 G3PDH 를이용, reprobing 을시행하였다. 3. IGF-I 처리의시간과농도에따른 VEGF mrna 발현에대한연구 우선 MG-63 세포주에서 IGF-I 이 VEGF mrna 발현을변화시키는지에대한실험을시행하였다. 우선대조군으로설정된밀생을이룬해당세포주에서안정수준의 VEGF mrna 를 RT-PCR 을이용, 측정하였다. 196 bp 의크기를갖는 PCR 생산물이 urea-containing polyacrylamide gel 상에확인되었다. (Table 1, Fig. 1) 해당세포주를 10 nm 의 IGF-I 으로미리설정된시간 - 1,2,4,8,12,24 시간 - 동안처리한후전체 RNA 를분리, 그발현을 northern blot analysis 를통해분석하였다. IGF-I 농도에따른 VEGF mrna 발현변화를확인하기위하여 2 시간동안서로다른농도 -0.5, 2.0, 10.0, 25.0, 50.0 nm- 로처리한후분석을시행하였다. 4. VEGF 발현에대한 IGF-I 기전에대한연구 세포분열단계, RNA 합성단계, 새로운단백질합성등의여러단계에대한차단을통하여그관여하는기전을알아보기위하여 hydroxyurea (76.1 μg / ml ), actinomycin D (2.5 μg / ml ), 그리고 281 bp 234 bp 190 bp M Fig. 1. mrna expression of VEGF in RT-PCR. mrna expressions of VEGF are shown at the expected location(196 bp) in the gel. (M: size marker) cycloheximide (10.0 μg / ml ) 등을 IGF-I 으로처리, 1 시간후에밀생을이루고있는세포주에가하였다. 그리고전체 RNA 를 24 시간후에분리하여분석을시행하였다. Ⅲ. 결과 1. IGF-I 처리의시간과농도에따른 VEGF mrna 발현에대한연구 VEGF mrna 의발현정도는처리된 mrna 의농도와시간에따라변화하는양상을보였다. 즉, IGF-I 으로처리된시간및농도를증가시킬수록 VEGF mrna 의발현정도는증가하는것으로나타났다. IGF-I 으로처리한군은그렇지않은군에비해약 3.5 배정도많은 VEGF mrna 발현을보였다. 그리고 VEGF mrna 의발현은 IGF-I 으로 24 시간동안처리한군에서최대발현을나타냈다. IGF-I 에의한 VEGF mrna 발현은처리시간에따라증가하는것으로나타났다. (Fig. 2) VEGF mrna 의발현은처리된 IGF-I 의농도에따라달라지는데실험된세포주에서는 VEGF mrna 의최대발현은사용된최대농도로처리하였을때나타나는것으로나타났다. (50nM) (Fig. 3) 365

VEGF mrna G3PDH mrna c 1 hr 2 hrs 4 hrs 8 hrs 12 hrs 24 hrs Fig. 2. Time course of IGF-I action on the abundance of VEGF mrna in MG-63 osteoblast-like cells.

VEGF mrna c 0.5nM 2 nm 10 nm 25 nm 50 nm G3PDH mrna Fig. 3. Concentration dependence of IGF-I on the abundance of VEGF mrna in MG-63 osteoblast-like cells.

5 G3PDH mrna Fig. 4. The effects of different inhibitors on expression of VEGF mrna. 1: none, 2: IGF-I only, 3: IGF-I Hydroxyurea, 4: IGF-I Actinomycin D, 5: IGF-I Cycloheximide 2.

4 VEGF mrna G3PDH mrna c 1 hr 2 hrs 4 hrs 8 hrs 12 hrs 24 hrs Fig. 2. Time course of IGF-I action on the abundance of VEGF mrna in MG-63 osteoblast-like cells. The cells were treated for the indicated times - 1, 2, 4, 8, 12 and 24 hours with 10 nm IGF-I, the total RNA were isolated, an expression of VEGF was determined by Northern blot analysis. VEGF mrna c 0.5nM 2 nm 10 nm 25 nm 50 nm G3PDH mrna Fig. 3. Concentration dependence of IGF-I on the abundance of VEGF mrna in MG-63 osteoblast-like cells. The cells were treated with different concentration of IGF-I, which was 0.5, 2.0, 10.0, 25.0 and 50.0 nm, for 2 hours. VEGF mrna G3PDH mrna Fig. 4. The effects of different inhibitors on expression of VEGF mrna. 1: none, 2: IGF-I only, 3: IGF-I Hydroxyurea, 4: IGF-I Actinomycin D, 5: IGF-I Cycloheximide 2. VEGF 발현에대한 IGF-I 기전에대한연구 해당세포주에서 IGF-I 에의해유도된 VEGF mrna 의발현에관련된기전을알아보기위하여서로다른단계에작용하는억제제 (inhibitor) 의효과를확인하였다. DNA 합성과정을차단하는 hydroxyurea 로세포주를처리하였을때 VEGF mrna 발현에대한 IGF-I 의발현자극효과가차단되었다. 또한 actinomycin D 에의한 transcription 차단은아무 것도처리하지않은세포주에서 VEGF transcription 을감소시켰으며 IGF-I 에의한 VEGF mrna 의발현이거의완전히차단되는결과를나타내었다. IGF-I 의 VEGF mrna 에대한효과가새로이합성된단백질에의한것인지를확인하기위하여 cycloheximide 로처리하였다. 이때 cycloheximide 는아무것도처리하지않은대조군세포주에서는 VEGF mrna 발현을증가시켰으나 IGF-I 의효과에대해서는거의영향을미치지않았던것으로나타났다. (Fig. 4) 366

5 MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 Ⅳ. 고찰 아직까지그기전이어떠한방식으로서로연결되어있는가에대해서는정확히알려지지않았으나골에서유래된국소인자 (local factors) 들은혈관형성을자극할수있을것이며그반대로혈관내피세포에서분비된인자들이골형성을자극할수있을것이다 6). 인간의조골세포와탯줄정맥혈관세포를같이배양하여실행한연구에의하면조골세포에서유래된 VEGF 는주변 endothelial cell 들의증식을촉진하였다 18). Endothelial cell 들은골의분화와성장에영향을미칠수있는 cytokine 과성장인자들을발현한다 17). 조골세포및파골세포와매우밀접한관계에있는 endothelial cell 들은매우다양한 cytokine 이나성장인자들 -fibroblast growth factor, interleukin-i, -6, colony-stimulating factors, prostaglandin, endothelin-1, nitric oxide, oxygen radicals 등 6,19,20) 과같은성장인자들을생산한다. 골내에존재하는혈관들은오랫동안골의재형성과성장에중요한본질적요소로인식되어왔다. 그러나혈관세포와골간의정확한분자적인관계는여전히알려져있지않다 6). 다양한성장인자들 -tumor necrosis factor, transforming growth factor-β, basic fibroblast growth factor 등 - 이혈관형성과관련이있음이알려져있다 1). 그러나, 이러한인자들은직접적으로혈관형성에관여하는것이아니라간접적으로작용하는것으로추측된다. 그러므로비록다양한요소들이잠재적으로혈관형성을유도하는것으로알려져있을지라도이중 VEGF 가가장분열을촉진할수있고운동성을유도하는분자이다 7). VEGF 는특별히 endothelial cell 에만선택적으로그기능을수행하며, VEGF 형질이상실된경우 embryo 의생존에치명적이라는결과로인해인간태생발육에있어서매우중요한역할을함을보고하는연구결과가점점늘어나고있다 17,21,22). VEGF 는순환하는거대분자들 (circulating macromolecule) 에대해투과도가증가하도록하는 venule 들을만들어내는 tumor 에의해분비되는단백질로처음알려졌고 23,24) endothelial mitogen 으로써 pituitary follicular cell 로부터분리되었다 25). VEGF 는다양한혈관생성환경하에서매우중요한역할을수행한다. 즉, 순환기계 (circulating system), embryonic development 시의기관들의형성과창상치유, 당뇨성신혈관화등의다양한과정에매우중요한역할을수행하며, 신혈관형성이라는과정은또한종적골성장에매우중요한성장판에서의 endochondral ossification 26), tumor 의성장과파생 9) 등의과정에중요한역할을수행한다. 다양한자극들 - 저산소성상태 28), phorbol esters 29), camp analogue 29), 중금속이온들 ( 카드뮴, 코발트, 니켈등 ) 30), interleukin -1 31), -6 32), transforming growth factor-β 33), platelet-derived growth factor-β 34), IGF 35), H2O2, Ultraviolet B light irradiation 36) - 로세포들을처리함으로써 VEGF mrna 는발현된다. 본연구에서실험대상으로이용된 MG-63 세포주에서세포들을 IGF-I 으로처리시 VEGF mrna 가약 3.5 배정도증가되어발현되었고, 이는처리된시간과처리한농도에따라발현이조절될수있었다. 생리적농도의 IGF-I 은인간 SaOS-2 osteoblast-like cell, murine osteoblast-like cell, non-malignant untransformed osteoblast-like cells-mouse preosteoblast-like cell line(ks483) 등에서 VEGF mrna 과 VEGF protein 의발현을증가시키는것으로보고되었다 6). 또한, VEGF 및그수용체의발현과생산은해당세포의분화상태에따라다르다. VEGF-A 의발현은분화과정의진행에따라서증가되며이러한발현, 생산과정은세포의분화단계를조절하는인자들에의해조절될수있으며외부에서가해진 exogeneous VEGF-A 를가하는경우조골세포의분화도가증가하게된다. 인슐린과 IGF-I 에의한 VEGF 발현유도는다양한신호전달과정에의해일어난다. 인슐린의신호전달과정은 phosphatidylinositol 3-kinase/protein kinase B 를포함하며, IGF-I 의신호전달과정은 MEK/mitogen-activated protein kinase 를포함한다 1). VEGF 발현을유도하는자극의기전은매우다른요인에의해매우다른기전을통한다. VEGF mrna 발현의증가는세포복제와 new transcription 에따라달라질수있음이추측되고있다. 그러나새롭게합성된단백질은 VEGF mrna 의증가에큰영향을미치지않는듯하다. IGF-I 의역할은 actinomycin D 가 VEGF mrna 에대한 IGF-I 의자극을차단하는것으로보이기때문에 VEGF 유전자, 또는 VEGF 전사과정을조절하는다른유전자등이전사되는과정에서조절된다. 그러나이러한인자들이 VEGF promoter 또는공통된조절전사요인들에대한공통된활성요소들을어떠한방식으로공유하는지에대해서는아직알려져있지않다. 새로운단백질의합성은 fetal rat calvarial cells 에대한 IGF-I 의 VEGF mrna 발현자극에반드시필수적인요소는아닌것으로나타났다. 그러나 cycloheximide 는 prostaglandin E2 에의한 VEGF mrna 의증가를강화한다 35). 골에서 IGF-I 은 autocrine 또는 paracrine 의방식으로 preosteoblast 의증식을촉진하며분열과정과는무관하게분화된조골세포에의한골기질의형성을증진한다 3). 본연구의결과들로 MG-63 osteoblast-like cell 등은 VEGF 를발현한다는것과이러한 VEGF 의발현은 IGF-I 에의해증가된다는점을알수있었다. 이러한결과를통해재형성및재생과정에있어서혈관들과조골세포간의상호관계에대한한모델을추론할수있었다. 흡수과정중의골기질로부터분비되거나부갑상선호르몬또는성장인자등의 systemic hormone 에대한반응으로조골세포로부터분비되는 IGF-I 은 autocrine 또는 paracrine 의방식으로조골세포를자극하여 VEGF 발현을증진시킨다. 이렇게증가된 VEGF 의발현을통하여모세혈관들의형성이유도되고이로인해골의성장, 재생, 재형성등이진행된다. 이러한결과들을통하여골형성을증가시키는인자들은부분적으로조골세포에의한 VEGF 생산을증가시키며그로인해혈관형성을증가시킨다. 본저자등은골형성은생체내에서부분적으로 VEGF 와같은 endothelial growth factor 등을통해혈관형성을조절함으로써골형성등도조절할수있을것이라는가능성을확인하였다. 367

6 Ⅴ. 결론 본연구를통하여 MG-63 조골세포유사세포주에서 VEGF mrna 의발현은 IGF-I 의처리에의하여증가되며 IGF-I 에의한조절양상은시간과사용된농도에따라그발현이조절된다. IGF-I 에의한 VEGF mrna 발현양상은 hydroxyurea 와 actinomycin D 의추가처치에의하여발현이감소하지만 cycloheximide 에의하여는발현양상이영향을받지않으므로 IGF-I 에의한 VEGF mrna 의발현은 DNA 합성과전사단계에작용하여그영향을나타낸다는결론을도출해낼수있었으며이로인하여 IGF-I 은신생골의형성및재형성과정에중요한신혈관생성과정에있어서매우중요한역할을함을알수있었다. 참고문헌 1. Miel C, Rochford JJ, Filippa N,Giorgetti-Peraldi S, Van Obberghen E: Insulin and insulin-like growth factor-i induce vascular endothelial growth factor mrna expression via different signaling pathways. J Biol Chem 2000;275: Yeh LCC, Lee JC: Osteogenic Protein - 1 increases gene expression of vascular endothelial growth factor in primary cultures of fetal rat calvaria cells. Mol Cell Endocrinol 1999;153: Trueta J: The role of the vessels in osteogenesis. J Bone Joint Surg 1963; 45B: Decker B, Bartels H, Decker S: Relationships between endothelial cells, periocytes, and osteoblasts during bone formation in the sheep femur following implantation of tricalciumphosphate ceramic. Anat Rec 1995;242: Deckers MM, Karperien M, Van der Bent C, Yamashita T, Papapoulos SE, Lowik CW: Expression of vascular endothelial growth factors and their receptors during osteoblast differentiation. Endocrinol 2000; 141: Goad DL, Rubin J, Wang H, Tashjian AH Jr, Patterson C: Enhanced expression of vascular endothelial growth factor in human SaOS-2 osteoblast-like cells and murine osteoblasts induced by Insulin-like growth factor I. Endocrinol 1996;137: Brighton CT: Structure and function of the growth plate. Clin Orthop Rel Res 1978;136: Brighton CT, Hunt RM: Early histological and ultrasrtuctural changes in medullary fracture callus. J Bone Joint Surg 1991;73-A: Bermont L, Lamielle F, Fauconnet S, Esumi H, Weisz A, Adessi GL: Regulation of vascular endothelial growth factor expression by insulin-9 like growth factor-i in endometrial adenocarcinoma cells. Int J Cancer 2000;85: Houck KA, Ferrara N, Winer J, Cachianes G, Li B, Leung DW: The vascular endothelial growth factor family: Identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol 1991;5: De Vries C, Escobedo JA, Ueno H, Houck K, Ferrara N, Williams LT: The fins-like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 1992;255: Quinn TP, Peters KG, De Vries C, Ferrara N, Williams LT: Fetal liver kinase 1 is a receptor for vascular endothelial growth factor and is selectively expressed in vascular endothelium. Proc Natl Acad Sci 1993;90: Ferrara N, Davis-Smith T: The biology of vascular endothelial growth factor. Endocr Rev 1997;18: Gerber HP, Vu TH, Ryan AM, Kowalski J, Werb Z, Ferrara N: VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat Med 1999;5: Hodgson DR: Free-ligand accelerated dissociation of insulin-like growth factor 1 (IGF-1) from the type I IGF receptor is reduced by insulin-like growth factor binding protein 3.Regulatory Peptides 2000;90: Yeh LCC, Adamo ML, Kitten AM, Olson MS, Lee JC: Osteogenic Protein-1-mediated IGF gene expression in primary cultures of rat osteoblastic cells. Endocrinol 1996;137: Garcia-Ramirez M, Toran N, Andaluz P, Carrascosa A, Audi L: Vascular endothelial growth factor is expressed in human fetal growth cartilage. J Bone Miner Res Mar 2000;15: Wang DS, Miura M, Demura H, Sato K: Anabolic effects of 1, 25- Dihydroxyvitamin D3 on Osteoblasts are enhanced by vascular endothelial growth factor produced by osteoblasts and by growth factors produced by endothelial cells. Endocrinol 1997;138: Zaldi M, Alam ASMT, Bax BE, Shanker VS, Bax CMR, Gill JS, Pazianas M, Huang CLH, Sahinoglu T, Moonga BS, Stevens CR, Blake DR: Role of the endothelial cell in osteoblast control: new perspectives. Bone 1993;14: Collin-Osdoby P: Role of vascular endothelial cells in bone biology. J Cell Biochem 1994;55: Shifren JL, Doldi N, Ferrara N, Mesiano S, Jaffe R: In the human fetus, vascular endothelial growth factor is expressed in epithelial cells and myocytes, but not vascular endothelium: Implication for mode and action. J Clin Endocrinol Metab 1994;79: Carmeliet P, Ferreira V, Breier G, Pollefeyt S. Kieckens L, Gerstsenstein M, Fahrig M, Vandenhoeck A: Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 1996;380: Dvorak HF, Orenstein NS, Calvalgo AC, Churchill WH, Dvorak AM, Galli SJ, Feder J, Bitzer AM, Rypysc J, Giovinco P: Induction of a fibrin-gel 10 investment. An early event in line 10 hepatocarcinoma growth mediated by tumor-secreted products. J Immunol 1979;122: Dvorak HF, Dvorak AM, Manseau EJ, Wiberg L, Churchill WH: Fibrin gel investment associated with line 1 and line 10 solid tumor growth, angiogenesis, and fibroplasias in guinea pigs. Role of cellular immunity, myofibroblast, microvascular damage, and infarction in line 1 tumor regression. J Natl Cancer Inst 1979;62: Ferrara N, Leung DW, Cachianes G, Winer J, Henzel WJ: Purification and cloning of vascular endothelial growth factor secreted by pituitary folliculosatellite cells. Methods Enzymol 1991;146: Ando S, Nojima K, Majima H, Ishihara H, Suzuki M, Furusawa Y, Yamaguchi H, Koike S, Ando K, Yamauchi M, Kuriyama T: Evidence for mrna expression of vascular endothelial growth factor by X-ray irradiation in a lung squamous carcinoma cell line. Cancer Lett 1998;23;132: Sugishita Y, Takahashi T, Shimizu T, Yao A, Kinugawa K, Sugishita K, Harada K, Matsui H, Nagai R: Expression of genes encoding vascular endothelial growth factor and its Flk-1 receptor in the chick embryonic heart. J Mol Cell Cardiol 2000;32: Schweiki D, Itin A, Soffer D, Keshet E: Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 1992;359: Claffey KP, Wilkinson WO, Spiegelman BM: Vascular endothelial growth factor. J Biol Chem 1992;267: Eyssen-Hernandez R, Ladoux A, Frelin C: Differential regulation of cardiac heme oxygenase-1 and vascular endothelial growth factor mrna expression by hemin, heavy metals heat shock and anoxia. FEBS Lett 1996;382: Li J, Perrella MA, Tsai JC, Yet SF, Hsieh CM, Yosizumi M, Patterson C, Endege WO, Zhou F, Lee ME: Induction of vascular endothelial growth factor gene expression by interleukin-1??in rat aortic smooth muscle cells. J Biol Chem 1995;270: Cohen T, Nahari D, Cerem LW, Neufeld G, Levi BZ: Interleukin-6 induces the expression of vascular endothelial growth factor. J Biol Chem 1996;271: Pertovaara L, Kaipainen A, Mustonen T, Orpana A, Ferrara N, Saksela O, Alitalo K: Vascular endothelial growth factor is induced in 368

7 MG-63 세포주에서 Vascular Endothelial Growth Factor (VEGF) mrna 발현에대한 Insulin-like Growth Factor I (IGF-I) 의효과에대한연구 response to transforming growth factor-βin fibroblastic and epithelial cells. J Biol Chem 1994;269: Finkenzeller G, Marme D, Weich HA, Hug H: Platelet-derived growth factor-induced transcription of the vascular endothelial growth factor gene is mediated by protein kinase C. Cancer Res. 1992; 52: Warren RS, Yuan H, Matli MR, Ferrara N, Donner DB: Induction of vascular endothelial growth factor by insulin-like growth factor1 in colorectal carcinoma. J Biol Chem 1996; 271: Brauchle M, Funk JO, Kind P, Werner S: Ultraviolet B and H2O2 are potent inducers of vascular endothelial growth factor expression in cultured 11 keratinocytes. J Biol Chem 1996;271: Ando S, Nojima K, Majima H, Ishihara H, Suzuki M, Furusawa Y, Yamaguchi H, Koike S, Ando K, Yamauchi M, Kuriyama T: Evidence for mrna expression of vascular endothelial growth factor by X-ray irradiation in a lung squamous carcinoma cell line Cancer Lett 1998;23;132:

α α α α α

α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를