19(3)-05.fm

Transcription

1 ª Ÿ (Korean J. Medicinal Crop Sci.) 19(3) : (2011) 짚신나물물추출물의항산화활성및미백효과에관한연구 ½kx*Á½ *Á *Á½k *, **Á½ **Á w***á *, ** * w œw, ** w p y x l, ***y y t» Antioxidant and Whitening Effects of Agrimonia pilosa Ledeb Water Extract Tae Hyuk Kim*, Jeong Mi Kim*, Jong Mi Baek*, Tae Woo Kim* **, Dae Jung Kim**,, Jeong Hae Park*** and Myeon Choe*, ** *Department of Bio-Health Technology, and **Well-being Bioproducts RIC Center, Kangwon National University, Chuncheon , Korea. ***Hwajin Cosmetic R&D Center, Seoul , Korea. ABSTRACTG: This study was performed to assess the antioxidant activities and whitening effects of Agrimonia pilosa Ledeb on melanin synthesis. The whitening effects of Agrimonia pilosa Ledeb water extracts were examined by in vitro mushroom tyrosinase assay and B16BL6 melanoma cells. We assessed inhibitory effect of Agrimonia pilosa Ledeb water extract on expression of melanogenic enzyme proteins including tyrosinase, tyrosinase-related protein 1G (TRP-1) and tyrosinaserelated protein 2G (TRP-2) in B16BL6 cells. Inhibitory effect of Agrimonia pilosa Ledeb onto free radical generation was determined by measuring DPPH and hydroxyl radical scavenging activitie. Our results indicated that Agrimonia pilosa Ledeb water extract effectively inhibited free radical generation. In DPPH and hydroxy radical scavenging activity, Agrimonia pilosa Ledeb water extract had a potent anti-oxidant activity in a dose-dependent manner. They significantly inhibited tyrosinase activity in vitro and in B16BL6 melanoma cells. Also, Agrimonia pilosa Ledeb suppressed the expression of tyrosinase in B16BL6 melanoma cells. These results show that Agrimonia pilosa Ledeb inhibited melanin production on the melanogenesis. The underlying mechanism of Agrimonia pilosa Ledeb on whitening activity may be due to the inhibition of tyrosinase activity. We suggest that Agrimonia pilosa Ledeb may be useful as new natural active ingredients for antioxidant and whitening cosmetics. Key Words : Whitening, Melanin, Tyrosinase, Tyrosinase-Related Protein œw y w s³ ƒ š y z ù w ƒ w š w w» y t ³ ƒ y š, y w w š (Cho, 2007). t» t ù t w y t inner beautyƒ y t ¾ y t š (You et al., 2009). Inner beauty y t t w ƒ» w š, t y t w ƒw œ y w š (Ryu et al., 1997). v w»». w y ƒ š y v s j s s w. w v y ƒ, e ƒw w v s w melanin ƒ. w y w w y y ww v s y wš (Shin, 2001) z y w melanin ƒ w e (Ra et al., 1997). Melanin sw tvd melanocyte w. w w z tyrosinase polyphenol oxidase w w z Corresponding author: (Phone) ( ) mchyuk2@hanmail.net Received 2011 February 16 / 1st Revised 2011 April 26 / 2nd Revised 2011 May 25 / 3rd Revised 2011 June 13 / Accepted 2011 June

2 ½kxÁ½ Á Á½k Á½ Á wá s tyrosine L-3,4-dihydroxyphenylalanine (DOPA) ywš z y w dopaquinone y k. dopaquinone w dopachrome y tyrosinase-related protein-2 (TRP-2, DOPA chrome tautomerase) w 5,6-dihydroxyindole-2-carboxylic acid (DHICA) y. DHICA tyrosinase-related protein-2 (TRP-1, DHICA oxidase) w indole-5,6- quinone-2-carboxylic acid (IQCA) y w (Boissy et al., 1998). v tyrosinase, TRP-1, TRP-2 y w sƒ š ù ü y ƒ û. ù (Agrimonia pilosa Ledeb) w û e s, ù», û, û wš (Jang et al., 2008). j š l ¼ k Õ ù ù, 6-7 v (Kim, 2010).,, y,, w,» w, l w³, wšx x (Kim et al., 2006). ù l, t,, š Vitamin K, k,, luteolin-7-β-glucoside, apigenin-7-β- 0-glucoside, r, agrimoniin, agrimonolide p agrimoniin w z ƒ ù (Yang et al., 2005) z w w. ù ƒ š w y mw y p melanin w w t w TRPs me tyrosinase, TRP-1, TRP-2 y d w» ƒ ƒ. 1. ù x w ù w w þ w w. (2008) w z 10.7 ƒw 60æ 24 w z w. þw» (EYELA SB-1000, Japan) w š,» (IlShin FD 8508, Korea) w w % w 70æ þ w w w w. 2. DPPH e DPPH e Blois (1958) ƒ 2,2-diphenyl-1-picryl-hydrazyl (DPPH) e w y d w. ù k M DPPH w 1:3 yww 37æ 30 ew z 532 Ÿ d w. DPPH e w ƒ Ÿ w (1- Ÿ / Ÿ ) 100 w w (Braca et al., 2001). 3. Hydroxy e Hydroxy e y (2008) w d w. ù w z ƒ 100, 100 mm sodium phosphate (ph 7.4) 250, 1 mm EDTA 100, 36 mm deoxyribose 100, 1 mm FeCl 3 6H 2 O 100, 1 mm L-ascorbic acid 100, 10 mm H 2 O 2 100, 150 ƒw 38æ water bath 1 ew z 1% thiobarbituric acid 1, 10% trichloroacetic acid 1 ƒw 100æ 10 ò z 532 Ÿ d w, (1- Ÿ / Ÿ ) 100 w w. 4. s s Mouse B16BL6 melanoma s w s w w. B16BL6 s 10% fetal bovine serum (FBS) 1% w ƒ ƒ minimum essential medium (MEM) 37æ 5% CO 2 w. 5. s óù s (2005) w 3- [4,5-dimethylthiazole-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT) y w d w. Mouse melanoma B16BL6 s 96-well plates cells/ 100 w 24 w z FBS w ƒ ƒ ù ƒ w z s w 24 w. 24 z DMEM 10 1 w w MTT (5 / ) ƒw š 4 w MTT y k z d w. 30 w z DMSO 100 w 1 yww z 570 Ÿ d w. 178

3 ù w y y z 6. Mushroom tyrosinase y Melanin w w w z tyrosinase y mushroom tyrosinase z w» L-DOPA L-dopaquinone Ÿ d w. x 0.1 M phosphate buffer (ph 6.8) 0.2, 5 mm L-DOPA solution 0.2 w ù 0.5 yw tyrosinase (250 U/ ) 0.1 ƒw 35æ 2 k 475 Ÿ d w z (1- Ÿ / Ÿ ) 100 w y w (Prota, 1990). 7. Mouse B16BL6 melanoma tyrosinase y ù w B-16 melanoma w z d w. s 24-well plates cells/ w 24 w š, FBS w ƒ ƒ ù ƒ w 24 w. w w phosphate-buffer saline (PBS, ph 6.8) w š, 1% Triton X-100 w PBS wells ƒw cell scraper wells s g 1.5 p 70æ þ k z w g, 3 w s q w. 10,000 g 10 w z d tyrosinase y d w z d w w. Bio-Rad protein kit w, tyrosinase y d 10 mm L-DOPA M PBS (ph 6.8) 500, tyrosinase z ( s l d ) 300 ƒw z 35æ 1 w 475 Ÿ d w. 8. Total RNA cdna w B-16 mouse melanoma s 6-well plates cells/ w 24 w z ù w 24 w. ù w w z QIAzol lysis buffer ƒ wells 500 w s lysis w z 70æ w. chloroform 200 w 15 z 12,000 g 15 w d isopropanol 500 p. 12,000 g 10 w d w z 100% ethanol 0.1% diethyl pyrocarbonate (DEPC) 75 : 25 75% ethanol ƒ p 1 w 12,000 g 5 w d w g. Nuclease free water 40 w z RNA 5 0.1% DEPC 955 ƒw Table 1. PCR primer sequences. Gene Primer Sequence Tyrosinase TRP-1 TRP-2 GAPDH Forward Reverse Forward Reverse Forward Reverse Forward Reverse Primers are shown 5 3. GGCCAGCTTTCAGGCAGAGGT TGGTGCTTCATGGGCAAAATC GCTGCAGGAGCCTTCTTTCTC AAGACGCTGCACTGCTGGTCT GGATGACCGTGAGCAATGGCC CGGTTGTGACCAATGGGTGCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 260 Ÿ d w š total RNA w. Oligo (dt) 15 primer (500 / ) 1, dntp mix (10 mm) 1, w RNA 2 RNase free water 11 š 65æ 5 k z 5 first-stand 4, nuclease free water 1, DTT (100 mm) 2, SuperScript III reverse transcriptase 1 9 ƒ PCR tube w z 42æ 50, 70æ 15 g cdna w w. x w primer sequence Table RT-PCR Tyrosinase mrna x d w» w w RT- PCR w. PCR tube Go Tag Green Master 10, forward primer (15 µm) reverse primer (15 µm) ƒ ƒ 0.5, nuclease free water 8, w w first-stand cdna 1 ƒw z PCR ww. Tyrosinase PCR 94æ 4 (1 cycle), 94æ 30, 62æ 30 š 72æ 30 (21 cycles), 72æ 5 (1 cycle) š, GAPDH PCR 94æ 4 (1 cycle), 94æ 30, 55æ 30, 72æ 30 (21 cycles), 72æ 5 (1 cycle). PCR 0.002% ethidium bromideƒ ƒw 1.2% agarose gel 100 V 30» w z Ÿ x. SigmaGel (Jandel Scientific) v p w w. 10. m x m GraphPad InStat (GraphPad InStat Version 3.00, 2003) m package w s³ ± t r t w š, s ³ m Tukey-Kramer multiple comparisons test w w. 179

4 ½kxÁ½ Á Á½k Á½ Á wá Fig. 2. Effect of Agrimonia pilosa Ledeb water extract on hydroxy radical scavenging activity. SHC : Agrimonia pilosa Ledeb water extract. Results were expressed as % control and data were mean±sd. Significant differences were compared with control at ** p < 0.01 vs. Fig. 1. Effect of Agrimonia pilosa Ledeb water extract on DPPH radical scavenging activity. SHC : Agrimonia pilosa Ledeb water extract. Results were expressed as % control and data were mean±sd.g Significant differences were compared with control at * p < 0.05 vs. control, *** p< vs. control. š 1. DPPH e ù DPPH e y d w Fig. 1. ù 50, 100, 250, 500, 1000 ppm w DPPH e y ƒ, 500 ppm 1000 ppm ƒƒ 85.6, 85.4% ƒ DPPH e. (2008) 7 w DPPH e y v w ascorbic acid w DPPH e y ùkü ù 1,000 ppm y 50% w DPPH e š š w x w ù y w DPPH e ùkü. 2. Hydroxyl e Hydroxyl radical y e yw ƒ j, y wš DNA ù w š, 2+ y ù y ƒ Fe ù 2+ Cu w ƒ w free radical. Fig. 2 ù hydroxy e y 50, 100, 250, 500, 1000 ppm w 34% š p 1000 ppm 42.5% ƒ y. ½ (2006) w k hydroxy e 6000 ppm ƒƒ 71.4% 83.98% ùkûš ½ w 74.39% 59.20% ùkù š šw x ù w hydroxy radical ùk ü. 3. s ù mouse melanoma B16BL6 s e w» w w wš w z MTT s w. Fig. 3 B16BL6 s w ù 100, 250, 500, 1000, 3000 ppm w 100 ppm l 1,000 ppm ¾ 87% B16BL6 s w, 250 ppm w 100% ùkü. wr ù 3,000 ppm 66.3% s û ùkü. ù tyrosinase y TRP-1, TRP-2 mrna x w x 100, 250, 500, 1000 ppm ww. 4. Mushroom tyrosinase y w w w z tyrosinase y tyrosinase z w» L- DOPA L-dopaquinone Ÿ d w. In vitro tyrosinase z d, Fig. 4 ù 100, 250, 500 ppm 180

5 ù w y y z Fig. 3. Effect of Agrimonia pilosa Ledeb water extract on the viability of B16BL6 cells. SHC: Agrimonia pilosa Ledeb water extract. The cells were cultured in the presence of various concentrations of samples for 72 h. Results were expressed as % control and data were mean±sd. Significant differences were compared with control at * p < 0.05 vs. control, *** p < vs. control. Fig. 4. Effect of Agrimonia pilosa Ledeb water extract on mushroom tyrosinase activity in vitro. SHC : Agrimonia pilosa Ledeb water extract. To test their direct effect on tyrosinase, human tyrosinase activity was measured in a cell free system. 100~1000 ppm of samples were added to each well. Results are the averages of triplicate experiments±sd. Significant differences were compared with control at ** p < 0.01 vs. control, *** p < vs. control. ƒƒ 93.4%, 93.4%, 93.0%, j. ù 1,000 ppm 80.4% ƒ y. w tyrosinase z y w q. 5. B16BL6 melanoma w tyrosinase y ù B16BL6 mouse melanoma sü tyrosinase y w z d w Fig. 5. ù ƒ (100, 250, 500, 1000 ppm) w ƒƒ 99.72%, 91.73%, 84.57%, 78.51% w sü tyrosinase y z ùkü. Fig. 5. Effect of Agrimonia pilosa Ledeb water extract on tyrosinase activity in B16BL6 cells. SHC: Agrimonia pilosa Ledeb water extract. Results are expressed as mean±sd. Significant differences were compared with control at * p < 0.05 vs. control, *** p < vs. control. (2005) p 0.5% 78.1% ùkþ š šw š, (2008) x p p z p û IC 50 š šw, w upstream w tyrosinase y w w downstream w w B16BL6 melanoma w z w» š šw. v tyrosine w y w melanin w», y w v yƒ (Chang et al., 2007). w w z ƒ tyrosinase, tyrosinase z w w. ù tyrosinase y k v e w» y t ƒ w. 6. Tyrosinase, TRP-1, TRP-2 mrna x e w ù w e w sƒw y tyrosinase, TRP-1, TRP-2 x e w sƒw. ù 100, 250, 500, 1,000 ppm tyrosinase x w w, 1,000 ppm x w (Fig. 6). ù ù TRP-1 TRP-2 mrna x w. Zhang (2009) g tyrosinase x w TRP-1 TYP-2 x yƒ š w w. ù tyrosinase mrna x w eù melnin 181

6 ½kxÁ½ Á Á½k Á½ Á wá Fig. 6. Effect of Agrimonia pilosa Ledeb water extract on tyrosinase, TRP-1, TRP-2 mrna expression in B16BL6 cells. SHC; Agrimonia pilosa Ledeb water extract. Cells were incubated with medium containing 0, 100, 250, 500 and 1000 ppm SHC for 24 hr. The tyrosinase, TRP-1, TRP-2 mrna levels in each sample was normalized to the quantity of GAPDH. The fold induction of tyrosinase mrna in treated cells was calculated as ratio of the corresponding mean value of the control cells. Results are expressed as mean±sd. Significant differences were compared with control at *** p < vs. control. w w TRP-1 TRP-2 x w. k» x w, melanosome w, α-melanocyte y (α-msh) ¼w, N- glycosylation melanogenesis» ww z ùkü w š (Seiberg et al., 2000; Motogawa, 2000; Negroiu et al., 1999). w t w v tyrosinase, TRP-1 x w TRP-2 N-glycosylation mw z ùkü š w š (Park et al., 2009), endothelin-1 mrna k k š šw (Park et al., 2008). wr (2007) z tyrosinase y w mw w w,» w x w tyrosinase, TRP-1, protein kinase A, microphthalmia transcription factor (MITF) x w extracellular regulated kinase (ERK) AKT x ƒw w ƒ ù š w. ù x w 182

7 ù w y y z tyrosinase z y cell free system j j w ù sü z y gš w tyrosinase x w w ùkû.» k z w microphthalmia transcription factor (MITF), protein kinase A, α-msh x w ƒ ƒ w w. ( ) y y t, w Nutraceutical Bio Brain Korea 21 p y x l ww. LITERATURE CITED Blois MS. (1958). Antioxidant determinations by the use of a stable free radical. Nature. 26: Boissy RE, Sakai C, Zhao H, Kobayashi T and Hearing VJ. (1998). Human tyrosinase related protein-1(trp-1) does not function as a DHICA oxidase activity in contrast to murine TRP-1. Experimental Dermatology. 7: Braca A, De Tommasi N, Di Bari L, Pizza C, Politi M and Morelli I. (2001). Antioxidant principles form Bauhinia terapotensis. Journal of Nature Products. 64: Chang MS, Kim HM, Yang WM, Kim DR, Park EH, Ko EB, Choi MJ, Kim HY, Oh JH, Shim KJ, Yoon JW and Park SK. (2007). Inhibitory effects of Nelumbo nucifera on tyrosinase activity and melanogenesis in clone M-3 melanocyte cells. Korea Journal of Herbology. 22: Cho WG. (2007). Comparision of drug delivery using hairless and pig skin. Journal of Korea Oil Chemists' Society. 24: Choe M, Kim DJ, Lee HJ, You JK, Seo DJ, Lee JH and Chung MJ. (2008). A study on the glucose-regulating enzymes and antioxidant activities of water extracts from medicinal herbs. Journal of Korean Society Food Science Nutrition. 37: Chung MJ, Sung NJ, Park CS, Kweon DK, Mantovani A, Moon TW, Lee SJ and Park KH. (2008). Antioxidative and hypocholesterolemic activities of water-soluble puerarin glycosides in HepG2 cells and in C57BL/6J mice. European Journal of Pharmaceutical Science. 578: Chung MJ, Walker PA, Brown RW and Hogstr C. (2005). Zinc-mediated gene expression offers protection against H 2 O 2 - induced cytotoxicity. Toxicology and Applied Pharmacology. 205: Jang SH, Yu EA, Han KS, Shin SC, Kim HK and Lee SG. (2008). Changes in total polyphenol contents and DPPH radical scavenging activity of Agrimonia pilosa according to harvest time and various part. Korean Journal of Medicinal Crop Science. 16: Kim BM, Jun JY, Park YB and Jeong IH. (2006). Antioxidative activity of methanolic extracts from seaweeds. Journal of Korean Society Food Science Nutrition. 35: Kim HJ, Lim HW, Kim BH, Kim HS, Choi SW and Yoon CS. (2006). Studies on the anti-acne effect of Agrimonia pilosa Ledeb. Journal of Society of Cosmetic Scientists of Korea. 32:53-58 Kim YM. (2010). The inhibitory effect of Agrimonia pilosa Ledeb extract on allergic reaction. Korean Journal of Medicinal Crop Science. 18: Motogawa T. (2000). Development of new skin whitening agents. Inhibition of α-msh induced melanogenesis by Sophorae radix extracts. Fragrance Journal. 9: Negroiu G, Branza-Nichita N, Petrescu AJ, Dwek RA and Petrescu SM. (1999). Protein specific N-glycosylation of tyrosinase and tyrosinase-related protein-1 in B16 mouse melanoma cells. Journal of Biochemical Society. 344: Oh HC, Lim KS, Hwang CY, Youn IH and Kim NK. (2007). A study on the melanin synthesis inhibition and whitening effect of Bombysis corpus. The Journal of Korean Oriental Medical Ophthalmology & Otolaryngology & Dermatology. 20:1-13. Park SH, Lee BY, Han CS, Kim JG, Kim KT, Kim KH and Kim YH. (2008). Whitening effect of Angelica keiskei Koidzumi extract by inhibition of endothelin-1 production and melanogenesis. Journal of Society Cosmetic Scientists Korea. 34: Park SH, Lee BY, Lee SH, Han CS, Kim JG, Kim KT, Kim KH and Kim YH. (2009). Whitening effect of dayflower (Commelina communis L.) extract by inhibition of N-linked glycosylation process and melanogenesis. Journal of Society Cosmetic Scientists Korea. 35: Prota G. (1990). Recent advances in the chemistry of melanogenesis in mammals. Journal of Investive Dermatology. 75: Ra KS, Suh HJ, Chung SH and Son JY. (1997). Antioxidant activity of solvent extract from onion skin. Korean Journal of Food Science Technology. 29: Ryu SH, Jeon YS, Kwon MJ, Moon JW, Lee YS and Moon GS. (1997). Effect of kimchi extracts to reactive oxygen species in skin cell cytotoxicity. Journal of Korean Society Food Science Nutrition. 26: Seiberg M, Paine C, Sharlow E, Andrade-Gordon P, Costanzo M, Eisinger M and Shapiro SS. (2000). The proteaseactivated receptor 2 regulates pigmentation via keratinocytemelanocyte interactions. Experimental Cell Research. 254: Shin JY. (2001). Screening of natural products that have activities against skin-aging. Korean Journal of Food Nutrition. 14: Yang H, Zheng S, Meijer L, Li SH, Leclerc S, Yu LL, Cheng JQ and Zhang SZ. (2005). Screening the active constituents of Chinese medicinal herbs as potent inhibitors of Cde25 tyrosine phosphatase, an activator of the mitosis-inducing p34cde2 Kinase. Journal of Zhejiang Univ. Science 6: Yoo YG, Joung MS, Choi JW and Kim JH. (2005). The study on the whitening effect of Ephedra sinica extract. Journal of Society Cosmetic Scientists Korea. 31: You JK, Chung MJ, Kim DJ, Seo DJ, Park JH, Kim TW and 183

8 ½kxÁ½ Á Á½k Á½ Á wá Choe M. (2009). Antioxidant and tyrosinase inhibitory effects of Paeonia suffruticosa water extract. Journal of Korean Society Food Science Nutrition. 38: Zhang R, Lee HJ, Yoon YG, Kim SM, Kim HS, Li SH and An SK. (2009). The melanin inhibition, anti-aging and antiinflammation effects of Portulaca oleracea extracts on cells. Korean Society for Biotechnology and Bioengineering Journal. 24: