Microsoft Word doc
|
|
- 고은 동
- 3 years ago
- Views:
Transcription
1 국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 연세대학교대학원 의학과 이상국
2 국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 지도교수이경원 이논문을석사학위논문으로제출함 2008 년 12 월 연세대학교대학원 의학과 이상국
3 이상국의석사학위논문을인준함 심사위원 인 심사위원 인 심사위원 인 연세대학교대학원 2008 년 12 월
4 감사의글 본논문을완성하기까지끊임없는관심과사랑으로지도해주신존경하는이경원교수님과조상래교수님, 이혁민교수님께진심으로감사드립니다. 그리고바쁘신가운데도아낌없는조언으로격려해주신정석훈교수님, 용동은교수님께감사의말씀을드립니다. 또한연구에전념할수있도록많은시간을할애하고, 실험을도와주신서영희연구원과진단검사의학과미생물파트선생님들께감사드립니다. 저자씀
5 < 차례 > 국문요약 1 Ⅰ. 서론 4 II. 재료및방법 8 1. 시험대상균주 8 2. 항균제감수성시험 9 가. 한천희석법 9 나. β-lactamase 생성시험 9 3. pena 유전자분석 mtrr, pona, porb 및 pilq 유전자분석 Nucleotide sequence accession number 11 III. 결과 항균제감수성 PBP 2 아미노산서열 PBP 2 아미노산서열형과항균제감수성 mtrr, pona, porb 및 pilq 유전자다형성 19 IV. 고찰 22 V. 결론 27
6 참고문헌 29 영문요약 35
7 그림차례 Figure 1. Frequency of the PBP 2 patterns according to isolation sites 17 Figure 2. MICs of penicillin G, ceftriaxone, and cefixime for the N. gonorrhoeae clinical isolates with various patterns of PBP 2 alterations 18 표차례 Table 1. Primers used for PCR amplification and sequencing of the pena, mtrr, pona, porb and pilq genes 12
8 Table 2. PCR conditions for pena, mtrr, pona, porb and pilq gene amplication 13 Table 3. Proportion of N. gonorrhoeae isolates with decreased susceptibility to cephalosporins 14 Table 4. Amino acid substitutions identified in PBP 2 of the N. gonorrhoeae strains 16 Table 5. Polymorphisms of pena, mtrr, pona, porb and pilq 21
9 국문요약 국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 근래다제내성임균의증가로 cephalosporin 항균제사용이증가하였고이로인해 cephalosporin 항균제에감수성이저하된균주들이국외에서보고되기시작하였다. Cephalosporin 항균제사용이증가한국내의환경을고려하면임균의 cephalosporin 내성에대한감시가필요할것으로생각된다. 본연구에서는전국주요지역에서 2001년부터 2007년까지특수직업여성및일반환자로부터임균을수집하였고연도별도 20-50주씩임의로선택하여총 208주의항균제감수성을한천희석법으로시험하였다. 이중 cephalosporin계항균제에대하여감수성이저하된균주 46주 ( 실험군 ) 와감수성균주 2주 ( 대조군 ) 를대상으로 pena, mtrr, porb, pona 및 pilq 유전자의염기서열을분석하였다. 1
10 Penicillin binding protein 2 (PBP 2) 유전자인 pena 분석을통해 PBP 2 아미노산서열형 8가지를관찰하였고, 그중 PBP 2 XXⅣ형 (GenBank accession number FJ465093) 은이전보고들에서발견되지않은새로운형이었다. 대조군의경우 PBP 2 XⅣ형을가지고있었고, 실험군중 1 주에서만 PBP 2 모자이크 (X) 형이발견되었다. PBP 2 모자이크형을가진균에대한 cefixime MIC는 0.5 µg/ml로가장높았다. mtrr의경우대조군에서는불완전 MtrR단백이생성되었고실험군중 44주에서는 promoter 영역의변이가, 2주에서는 mtrr ORF 내의점변이 (Ala39Thr, Leu47Pro) 가관찰되었다. porb의경우대조군 1주를제외한모든균주가 101번, 102번위치에서아미노산치환을보였다. pona의경우대조군에서는돌연변이가발견되지않았고실험군중 44주에서 Leu421Pro의아미노산치환이관찰되었다. 그러나 pona의변이유무에따라 cephalosporin에대한감수성저하정도에차이는없었다. 한편 pilq의돌연변이는발견되지않았다. 본연구에서 pena 모자이크형변이를가진균주는 cephalosporin, 특히경구용제제 (cefixime) 에더높은내성을보였다. 그러나모자이크형이아닌 pena 변이를가진균주도 mtrr, porb 및 pona의유전자다형성을함께가질 2
11 경우주사제뿐만아니라경구용제제에대해서도비슷한 수준의감수성저하를나타내었다 핵심되는말 : 임균, pena, mtrr, porb, pona, pilq, 모자이크 형변이, cephalosporin, 감수성저하 3
12 국내에서분리되는임균의 cephalosporin 내성양상및 감수성저하기전규명 < 지도교수이경원 > 연세대학교대학원의학과 이상국 I. 서론 임균은그람음성쌍구균으로임질, 요도염, 골반염등다양한감염질환을일으키며불임, 자궁외임신등의합병증을유발할수있다. 질병관리본부의임균표본감시보고에따르면 ( 임균감염보고건수는 2001년 18,520건에서, 2004년 10,845 건, 2007년 3,115건으로감소하였으나아직도적지않은환자가발생하고있다. 2004년성매매금지법의제정이후로특수직업여성의국가적인관리가어려워졌다. 이로인해임균등의성병이음성적으로전파될 4
13 위험성이높아졌음을감안할때, 임균감염건수는실제보다낮게보고되었을가능성이많다. 임균관리에있어중요한점은새로운항균제내성균출현에대한지속적인감시와이에대한체계적인대책마련이라할수있다. 임균의전파를효율적으로통제할수있는방법중하나는진단즉시가장효과적인항균제를투여하여완치하는것이다. 과거임균은 penicillin G를포함한여러가지항균제에감수성으로치료에어려움이없었으나, 근래에는다제내성인임균이증가하여 문제가되고있다. 1 임균에서항균제내성균의출현과확산에는 여러요인들이관련된다. 많은경우내성균이출현하고성병의고위험군집단에전파되면서이들을통해지역사회에확산, 정착되는과정을갖는다. 또한치료에사용되는항균제를적절히선택하는것이중요한데이는선택작용에의해사용항균제에대한내성이증가할가능성이높기때문이다. 2 국내에서는 1979년 penicillinase 생성주 (penicillinaseproducing Neisseria gonorrhoeae, PPNG) 가분리된이후, 1990년대에급격히증가하여그비율은 년약 50% 에서 1999년약 84% 까지증가하였고이로인해 penicillin G는임균 감염의치료제로사용하기어렵게되었다. 3 Fluoroquinolone 은 대부분의임균에항균력이있고, 요에고농도로농축되며, 경구 5
14 투여가가능하다는장점이있어서, PPNG 의증가이후임균감염의 치료제로널리사용되었다. 그러나 1994 년 fluoroquinolone 에 감수성이저하된임균이최초로보고되었고, 4 근래에는이약제에 고도내성인임균까지도보고되었다 년에용등 9 이보고한 바에의하면국내에서분리되는임균의 fluoroquinolone 내성은 처음보고된 8 이후로급격히증가하여, 2000 년에수집된 190 주의 임균중 172주 (90%) 가 fluoroquinolone에중간혹은내성으로국내의 fluoroquinolone 내성이심각함을알수있었다. Fluoroquinolone 항균제에대한내성은국외에서도심각하여, 미국 Centers for Disease Control and Prevention (CDC) 는 2007년치료지침에서아시아및미국전지역에서발생한임균감염에대해 fluoroquinolone을사용하지말고, ceftriaxone 또는 cefixime을사용할것을권장하였다. 10 한편, ceftriaxone은제 3세대 cephalosporin 항균제이며대부분의임균이감수성이어서임균감염에효과적인약제이나주사제로만사용이가능하다는단점이있다. 1991년 Handsfield 등 11 은임균에감염된 333 명의환자를대상으로경구로 cefixime을투여받은군과근주로 ceftriaxone을투여받은환자군의치료효과를비교하여, cefixime이 ceftriaxone과동일한치료효과를갖고있고 ( 치료율 ; cefixime 400 mg, 96%; cefixime 6
15 800 mg, 98%; ceftriaxone, 98%), 주사제의불편함이없이 1회의경구투여로임균을치료할수있음을보고하였다. 그러나 cefixime 사용이증가됨에따라감수성이저하된임균이일본에서처음보고되었다. 12 Cefixime에대한감수성저하임균의경우 penicillin-binding protein (PBP) 2 유전자인 pena의염기서열에서감수성균주와많은차이를보였고, 오히려 transpeptidase 영역일부는다른 Neisseria spp. 의염기서열과는매우유사하였다. 이러한 pena 유전자의변이는다른 Neisseria 균종의 pena 일부가삽입된것으로, 모자이크형변이 (mosaicism) 로보고되었다 년 Ito 등 13 은 cefixime에감수성이저하된균주들을대상으로 pena의염기서열을분석하였고, PBP 2 아미노산서열에따라 10가지형을보고하였다. 이중 X형은모자이크형변이였고, 나머지 I IX형은모자이크형변이가아닌다른형의변이였다. I IX형은 mutation selection에의한것으로생각되며공통적으로 345번과 346번아미노산사이에 aspartic acid의삽입이있었고 transpeptidase 영역 C 말단아미노산잔기의변화양상이각각달랐다. 그후 Whiley 등 14 이 13가지형을추가적으로보고하여 23가지형 (I XXIII) 이보고되었다. 2006년 Tanaka 등 15 은 ceftriaxone에감수성이저하된균주에서 pena, mtrr, porb 및 pona 유전자의돌연변이를처음보고하였고, 이후 Lindberg 등 16 은 7
16 cephalosporin 감수성저하와 pena, mtrr, porb 및 pona 유전자다형성 (genetic polymorphism) 의연관성을보고하였다. 본연구에서는전국주요지역에서 2001년부터 2007년사이에특수직업여성및일반환자로부터임균을수집하고, 근래에사용이증가한 cephalosporin계항균제에대한내성양상및주요내성기전등을규명하여임균감염증환자의치료및내성균의확산을막기위한중요한자료를제공하고자하였다. II. 재료및방법 1. 시험대상균주 년에전국 10여개의의료기관과서울의과학연구소및녹십자검사센터에서분리된일반환자분리임균과, 전국 5개지역에위치한보건소에서분리된특수직업여성분리임균을수집하였다. 임균분리를위한선택배지는 modified Thayer-Martin 배지 (BBL, Becton-Dickinson, Cockeysville, MD, USA) 를사용하였고, 균종동정은전통적인방법과, 필요에따라서상품화된 kit를이용하였다. 동정된균주는 -70 이하의냉동고에보관하였고수집된 865주중연도별도 20-50주씩임의로선택하여총 208주에대해주요항균제감수성을시험하였다. 8
17 2. 항균제감수성시험 가. 한천희석법 (Agar dilution method) 동결보관균주를초콜릿한천에접종하여양초단지에서 35, 24-48시간배양한후, Mueller-Hinton broth에현탁하여 10 4 CFU/mL으로 희석하였다. GC agar base (BBL) 에 1% hemoglobin과 1% IsoVitaleX (BBL) 을 첨가하고, 규정된 희석액으로녹인항균제를넣어 2배수단계희석된농도가되도록 평판을만들었다. 항균제는 penicillin G (Sigma Chemical Co., St. Luis, MO, USA), cefixime ( 동아제약, 서울 ), ceftriaxone ( 한미약품, 서울 ) 을 사용하였다. 세균부유액을 Steers' replicator (Craft Machine Inc., Woodline, PA, USA) 를이용하여배지에접종하고 35, 5% CO 2 항온기에 24시간배양후세균의증식을관찰하였다. 세균의증식을완전히억제시킨최소한의농도를최소억제농도 (minimal inhibitory concentration, MIC) 로 정하였다. 결과의 정도관리를 위해서 N. gonorrhoeae ATCC 49226을 같이 시험하였다. 나. β-lactamase 생성시험 9
18 PPNG 가의심되는균주는 chromogenic cephalosporin 인 cefinase 디스크 (BBL) 로시험하여, 노란색이분홍색으로변하면 양성으로판정하였다. 3. pena 유전자분석 pena유전자는 cephalosporin에감수성이저하된균주 (ceftriaxone 또는 cefixime MIC 0.12 µg/ml 이상 ) 50주중소실된 4주를제외한 46주와 cephalosporin에높은감수성을보인대조군 2주에서분석되었다. 균집락을멸균증류수에부유시킨후 10분간끓여서 2분간 13,000 rpm으로원심분리한상층액 1 µl를 template로사용하였다. PBP 2의아미노산서열을분석하기위해서 pena 유전자전체를 3부분으로나누어각각의 primer set를사용하였다 (Table 1). 1U의 Taq DNA polymerase가들어있는 PreMix (Bioneer, 창원 ) 에상층액 1 µl, 20 pmol의 primer 각각 1 µl, 증류수 17 µl를첨가하여총 20 µl로 Master Cycler gradient 5331 (Eppendorf, Hamburg, Germany) 를사용하여 PCR을시행하였다 (Table 2). PCR 산물은전기영동한후각 primer set에적합한크기의 PCR 산물을 DNA extraction kit을사용하여추출한후염기서열을분석하였다
19 4. mtrr, pona, porb 및 pilq 유전자분석 Cephalosporin에감수성이저하된균주 46주와대조군 2주를대상으로 mtrr, pona, porb 및 pilq 유전자를분석하였다. 추출한 DNA는 mtrr, pona, porb 및 pilq 유전자의돌연변이분석을위해 PCR을시행한후염기서열을분석하였다 (Table 1, 2). 5. Nucleotide sequence accession number PBP 2 XXIV형을부호화하는 pena 유전자염기서열 (accession number FJ465093), 불완전 MtrR 단백을부호화하는 mtrr 유전자 염기서열 (FJ465094), 새로운 아미노산 치환 (Ala39Thr, Leu47Pro) 을갖는 MtrR 단백을부호화하는 mtrr 유전자염기서열 (FJ465095) 을 GenBank nucleotide sequence database에 등록하였다. 11
20 Table 1. Primers used for PCR amplification and sequencing of the pena, mtrr, pona, porb and pilq genes Primer Nucleotide sequence (5' to 3') Reference pena-a1 CGGGCAATACCTTTATGGTGGAAC 13 pena-b1 AACCTTCCTGACCTTTGCCGTC 13 pena-a2 AAAACGCCATTACCCGATGGG 13 pena-b2 TAATGCCGCGCACATCCAAAG 13 pena-a3 GCCGTAACCGATATGATCGA 13 pena-b3 CGTTGATACTCGGATTAAGACG 13 mtrr-f GCCAATCAACAGGCATTCTTA 32 mtrr-r GTTGGAACAACGCGTCAAAC 32 pona-f GAGAAAATGGGGGAGGACCG 32 pona-r GGCTGCCGCATTGCCTGAAC 32 porb-f CCGGCCTGCTTAAATTTCTTA 17 porb-r TATTAGAATTTGTGGCGCAG 17 pilq-f pilq-r CGTTACGCCGAACATCACG TGACCGAAACTGAACGGACTG GenBank No. AE GenBank No. AE
21 Table 2. PCR conditions for pena, mtrr, pona, porb and pilq gene amplication Target Pre-denaturation Denaturation Annealing Extension pena-a1 95, 2 min 95, 1 min 58, 1 min 72 1 min pena-a2 95, 2 min 95, 1 min 56, 1 min 72 1 min pena-a3 95, 2 min 95, 1 min 52, 1 min 72 1 min mtrr 94, 5 min 94, 30 s 50, 30 s s porb 94, 5 min 94, 30 s 46, 30 s 72 1 min pona 94, 5 min 94, 30 s 56, 30 s s pilq 94, 5 min 94, 30 s 52, 30 s s III. 결과 1. 항균제감수성임균 208주중 cefixime의 MIC가 0.12 µg/ml 이상으로감수성이저하된균주는 43주였고이중 MIC 0.5 µg/ml 이상의비감수성균주는 1주였다. Ceftriaxone에감수성이저하 (MIC 0.12 µg/ml 이상 ) 된균주는 30주였고비감수성 (MIC 0.5 µg/ml 이상 ) 균주는없었다. Cefixime 또는 ceftriaxone에감수성이저하된균주는 13
22 50주이었고, 두항균제에동시에감수성이저하된균주가많았다. 감수성이저하된균주의비율은분리연도에따라달라서 % 였다 (Table 3). β-lactamase를생성하는균주는모두 50주 (24%) 이었고 47주는 penicillin MIC가 16 µg/ml 이상의고도내성을보였다. Table 3. Proportion of N. gonorrhoeae isolates with decreased susceptibility to cephalosporins Year No. of isolates No. (%) of isolates with decreased susceptibility (8.3) (31.8) (8.3) (25.0) (14.3) (34.9) (29.6) Total (24.0) 1 Cefixime or ceftriaxone MIC 0.12 µg/ml. 14
23 2. PBP 2 아미노산서열본연구에서는 PBP 2 아미노산서열형 8가지가발견되었다 (Table 4). PBP 2 아미노산서열형은 Ito 등 13 과, Whiley 등 14 이이전에보고한분류에따랐다. XⅢ형이 28주에서발견되어가장많았고, Ⅳ형 9주, Ⅴ형 4주순이었다. XXIV형은본연구의 1주에서처음발견되었다. XXIV형은기존의 Ⅴ형와유사하였고, 551번째아미노산이 proline에서 serine으로치환된것이유일한차이였다. 모자이크형변이인 X형은 cefixime에비감수성인 1주에서발견되었다. Cephalosporin에감수성이높았던대조군 2주는 XⅣ형을가졌다. 분리지역에따른 PBP 2 형의차이는없었다 (Figure 1). 15
24 Table 4. Amino acid substitutions identified in PBP 2 of the N. gonorrhoeae strains Patterns No. of isolates 1 Insertion of a single aspartic acid codon between Arg345 and Asp Mosaic pattern. 345D PBP 2 amino acid substitution in Ins 1 501A 504F 510A 512N 516A 541H 542G 545G 549A 551P 552P 555K 556I 566I 574A IV 9 D L V G S V 4 D L V G S V NV X L V Y N S T V Q V V NV XII 2 D L V G S XIII 28 D V L V G S XIV 2 D L V G N XVII 1 D V L V G S V NV XXIV 1 D L V G S S V NV A, alanine; F, phenylalanine; N, asparagine; H, histidine; G, glycine; P, praline; K, lysine; I, isoleucine; D, aspartic acid; L, leucine; V, valine; S, serine; Y, tyrosine; T, threonine; Q, glutamate 16
25 Gwangju Daejeon Sungbuk Suwon Shinchon Wonju Inchon Others IV V X XII XIII XIV XVII XXIV Figure 1. Frequency of the PBP 2 patterns according to isolation sites. The pattern XⅢ was the most common. No relation was found between PBP 2 patterns and isolation sites. 17
26 Penicillin G µg/ml > No. isolates IV V X XII XIII XIV XVII XXIV Ceftriaxone Cefixime µg/ml µg/ml No. isolates No. isolates Figure 2. MICs of penicillin G, ceftriaxone, and cefixime for the N. gonorrhoeae clinical isolates with various patterns of PBP 2 alterations. 18
27 3. PBP 2 아미노산서열형과항균제감수성 PBP 2 형에따른 MIC의분포를 Figure 2에나타내었다. XⅣ형을가진대조군의경우다른형균주에비해 penicillin ( 0.5 µg/ml), cefixime ( µg/ml) 및 ceftriaxone ( µg/ml) 의 MIC가낮았다. X형의모자이크형을가진균주에대한 penicillin MIC (8 µg/ml) 의경우다른균주들에대한 MIC의값의중간정도이었다. 그러나 cefixime과 ceftriaxone의 MIC는 0.5 µg/ml와 0.25 µg/ml로다른형을가진가진균주들에비해높았다. 나머지 Ⅳ, Ⅴ, XⅡ, XⅢ, XⅦ 및 XXⅣ형을가진균주들에대한 penicillin, cefixime 및 ceftriaxone의 MIC 범위는서로비슷하게분포하여특정형과 MIC를연관시키기는어려웠다. 4. mtrr, pona, porb 및 pilq 유전자다형성유전자분석을시행한 48주중 44주에서 mtrr promoter의 - 10과 -35 염기서열사이에위치한 13-bp 역방향반복서열에서의하나의염기쌍 (A/T) 의소실을보였다 (Table 5). 나머지 4주중 2주에서는 mtrr ORF 내의아미노산치환 (Ala39Thr, Leu47Pro) 을보였다. 그리고나머지 2주는대조군으로 41개의아미노산으로이루어진불완전 MtrR 단백이생성되었다. PorB의경우 48주중대조군 1주를제외한 47주에서 101번째아미노산 Gly와 102번째아미노산 Ala의치환을발견할수있었다. 대다수인 42주는 Gly101Lys, Ala102Asp의아미노산치환을보였고, 2주는 Gly101Lys, Ala102Asn, 나머지 2주는 Gly101Asn, Ala102Asp, 그리고한주는 Gly101Lys, Ala102Gly의아미노산치환을보였다. PonA의경우 48주중대조군 2주를포함한 4주를제외하고는모두 19
28 Leu421Pro 의아미노산치환을보였다. 한편 pilq 의경우 돌연변이 17 가관찰되지않았다. 20
29 Table 5. Polymorphisms of pena, mtrr, pona, porb and pilq Isolates MIC (µg/ml) Polymorphisms in BL no. PEN Cefixime CRO pena pona mtrr porb pilq XIV WT truncated MtrR WT, WT WT XIV WT truncated MtrR G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT 4 + > XIII WT Deletion of A G101K, A102D WT XIII L421P A39T, L47P G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102N WT XII L421P A39T, L47P G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XXIV L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102N WT X L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102G WT XII L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT 30 + > IV L421P Deletion of A G101K, A102D WT V L421P Deletion of A G101K, A102D WT V L421P Deletion of A G101K, A102D WT V L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XVII L421P Deletion of A G101N, A102D WT IV L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT XIII L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT IV L421P Deletion of A G101N, A102D WT XIII WT Deletion of A G101K, A102D WT IV L421P Deletion of A G101K, A102D WT V L421P Deletion of A G101K, A102D WT PEN, penicillin; CRO, ceftriaxone; BL, β-lactamase; WT, wild type. Amino acid abbreviations: see Table 4. 21
30 IV. 고찰 Cephalosporin 에대한임균의감수성저하는 pena, mtrr, porb 및 pona 유전자다형성과연관되어있다는것이최근 보고되었다. 16 pena 유전자의변이는 2 가지형으로나타날수 있는데, 하나는모자이크형변이 (PBP 2 mosaicism) 이고, 다른하나는 345번과 346번아미노산사이에서 aspartic acid 삽입과함께 5개내외의아미노산잔기가치환된변이이다. 이중 pena 유전자의모자이크형변이가 cephalosporin, 특히경구용제제인 cefixime에대한감수성저하에중요하였다. Takahata 등 18 은유전자변환실험을통해, 모자이크형 pena를획득한균주에대한 ceftriaxone MIC는획득전에비해 4배증가한반면, cefixime MIC는 16배증가하였음을보고하였다. 그러나모자이크형 pena를획득한균주에대한 cefixime MIC가임상분리주에대한 MIC만큼현저히높은것은아니어서임상분리주에서관찰되는정도의감수성저하를나타내기위해서는추가적인유전자돌연변이가필요할것으로생각되었다. 18 Penicillin의염색체성내성에 pena, mtrr, porb 및 pona 유전자 다형성이관여한다는것은이미많이연구되었다. 19 pena 유전자에 변이가발생하면 PBP 2 의 penicillin 친화성이감소되어임균의 15, 20, 21 penicillin 내성이높아지게된다. pona 유전자변이로 PBP 1 의 421 번째아미노산이 proline 에서 leucine 으로치환되면 β- lactam 제의 acylation 율이낮아져내성이유발된다. 19 mtrr 유전자 변이로는 MtrCDE 유출펌프계의발현이증가되어소수성인 erythromycin, azithromycin 및 rifampicin 등에내성이 22
31 유발된다 Penicillin 에내성인임균에서는 mtrr ORF 내에 점변이또는 promoter 의 -10 과 -35 염기서열사이의 13 bp 역방향반복서열위치 (inverted repeat position) 에 1 개의염기쌍 (A/T) 결손이보고되었다. 19 porb 유전자의변이로 Gly101 과 Ala102 위치에서아미노산치환이발생하면 penicillin 과 tetracycline 등친수성항균제의외막투과감소로내성이유발된다. porb 유전자의변이로인한내성은 mtrr 에의한내성이있을때 추가적으로내성을증가시킨다 또한 pilq 돌연변이는 pena, mtrr 및 porb 돌연변이가이미획득된상태에서페니실린내성을 증가시킨다. 17, 19 PilQ 는세포막에구멍을형성하는역할을하며, 이를통해항균제가세포질내로들어오게된다. 돌연변이로인하여 PilQ 를통한항균제의투과가감소될경우, 내성이증가할수있다. 그러나 pilq 돌연변이는아직임상분리주에서관찰된적이없으며, 실험실균주에서자발적으로발생한돌연변이만이보고된 17, 19 상태이다. Ceftriaxone 내성에대한이들유전자다형성의영향은 2006 년 Tanaka 등 15 에의해처음보고되었다. Lindberg 등 16 은모자이크형 pena 유전자변이를가진균주들에대한 cefixime MIC 는 µg/ml 로다른 pena 유전자변이를가진균주들에대한 MIC ( µg/ml) 보다높았음을보고하였다. 본 연구에서는 1 주만이모자이크형 pena 유전자를가지고있었고, 이전연구들에서보고된 PBP 2 X 형과아미노산서열이 일치하였다. 13 모자이크형 pena 는 N. perflava, N. cinerea 등의 다른 Neisseria 균종의유전자서열을부분적으로가지고있었으며 다른종들간의유전자재조합에의한것으로생각되었다. 13 상기 23
32 균주에서는모자이크형 pena 외에 mtrr, porb 및 pona 유전자의돌연변이도함께발견되었다. 이균주에대한 cefixime MIC는 0.5 µg/ml로다른균주들과비교하여가장높은값을보였으며유일하게 cefixime에비감수성이었다. 한편, ceftriaxone에대한감수성저하의경우, 모자이크형 pena 변이를가진균주에대한 ceftriaxone MIC는 0.25 µg/ml로다른 pena 변이를가진균주들에대한 MIC ( µg/ml) 범위에포함되었다. 이것으로미루어모자이크형 pena 변이는 ceftriaxone보다는 cefixime에대한감수성저하에더중요한요소로생각된다. 최근 Whiley 등 31 의연구에서는모자이크형 pena 변이를가지고있지만 ceftriaxone MIC가 µg/ml 인균주가보고되었다. 이균주의경우모자이크형아미노산서열이기존에보고된 X형이아닌새로운 XXIII형이었지만 ceftriaxone에높은감수성을보인점이특이하였다. 또한본연구에서다른형태의 pena 변이와 mtrr, porb 및 pona 유전자돌연변이를가진 45주에대한 cefixime MIC는 µg/ml이었다. 이중 7주를제외한 38주에대한 cefixime MIC가 0.12 µg/ml-0.25 µg/ml로모자이크형변이를가진균주의 0.5 µg/ml 보다는낮았지만 Lindberg 등 16 이보고한모자이크형변이균주에대한 MIC 결과 ( µg/ml) 와비슷하였다. 따라서 pena 유전자의모자이크형변이뿐만아니라다른형태의 pena 유전자변이도다른여러관련유전자변이와동반될경우 cefixime에대한감수성저하를유도할수있을것으로생각되었다. 24
33 PBP 2 의아미노산서열형은이전연구들에서 23 가지가보고 13, 14 되었다. 본 연구에서는 8 가지의 PBP 2 가발견되었고, 그중 XXⅣ형은이전보고에서는발견되지않은새로운형이었다. Cephalosporin에감수성이높았던대조군의경우이전에보고된 XⅣ형을가지고있었고, 당시보고된균주에대한 ceftriaxone MIC는 µg/ml로본연구와동일하였다. 14 대조군 2주의경우 pona 유전자의돌연변이는발견되지않았으며, mtrr 유전자에서는 promoter 영역의변이가아닌 81번째염기 G의소실로인한미성숙 stop codon 발생으로 41개아미노산으로구성된불완전단백이형성되는변이가발견되었다. 그러나 MtrR의소실은 promoter 영역의변이보다항균제내성에 미치는영향이적다고보고되었다. 25 이것은 mtrr promoter 영역의 변이는 mtrr 과 mtrc 유전자의전사에모두영향을주기때문으로설명되었다. mtrr promoter와 mtrc promoter의위치는서로겹치는데변이로인해 mtrr promoter와 RNA polymerase의결합은감소하지만, 그와반대로 mtrc promoter와 RNA polymerase의결합은증가하여 mrtr의전사감소와동시에 독립적으로 mtrcde 의전사가증가할수있기때문이었다. 25 본 연구에서는 cephaloporin에감수성이높았던대조군에서만불완전 MtrR 단백이발견되었고감수성이저하된실험군들에서는 promoter 영역의변이가관찰되어이전연구결과를뒷받침하였다. 임균에서불완전 MtrR 단백을유발하는돌연변이는본연구에서처음보고되는것이다. 대조군에서공통적으로불완전 MtrR 단백이생성되는것으로미루어보았을때항균제감수성저하에관련된 MtrR 단백의역할은적을것으로생각되며, promoter 영역의 25
34 돌연변이에의한 mtrcde의전사조절이감수성저하의주요기전으로생각되었다. 하지만정확한 MtrR 단백의역할을규명하기위해서는더많은연구가필요할것으로생각된다. 대조군중 1주에서만 Gly101Lys, Ala102Asp 아미노산변이를일으키는 porb 유전자돌연변이가발견되었고, 이균주는다른대조균주보다 penicillin MIC (0.5 µg/ml vs µg/ml) 가조금높았다. Cephalosporin에감수성이저하된 46주중 44주에서 PonA단백의 Leu421Pro의아미노산치환을발견할수있었다. mtrr의경우 46주중 44주에서 mtrr promoter 영역의변이를발견할수있었고, 나머지 2주에서는 mtrr ORF 내의점변이가발견되었는데, 이전에보고된 Gly45Asp가아닌새로운 Ala39Thr, Leu47Pro 돌연변이가발견되었다. 24 porb 유전자분석에서는감수성저하를보인 46주모두가 101번, 102번아미노산의돌연변이를가지고있었다. 41주가 Gly101Lys, Ala102Asp의아미노산치환을, 2주가 Gly101Lys, Ala102Asn 치환을, 그리고한주는 Gly101Lys, Ala102Gly의치환을보였다. 그리고나머지 2주에서는이전에보고된적이없는새로운 Gly101Asn, Ala102Asp 아미노산치환이 발견되었다. 27 pena, mtrr 및 porb 유전자의돌연변이를모두 가지고있는균주들에서 pona 돌연변이의유무는 cephalosporin 의 감수성저하에영향을주지않았다. 한편 pilq 유전자돌연변이 (Gly666Lys) 는발견되지않았다. PilQ 는 pore 형성단백으로 작용할뿐만아니라 type IV pilus 의생합성에도관여한다. 17 Pili 는 임균의감염에서중요한역할을하기때문에 pilq 돌연변이가임상 균주에서발생하는것은어려울것으로보고되었다
35 Penicillin의고도내성에 pena, mtrr, porb 및 pona의유전자다형성이관여한다는것은이미잘알려져있다. Penicillin 내성과는달리 cephalosporin 내성에관련된대부분의연구들에서는여러관련유전자의다형성보다는모자이크형 pena 변이가주요연구대상이었다. 특히모자이크형 pena는경구용 cephalosporin의감수성저하에중요하게생각되었다. 본연구에서모자이크형 pena 돌연변이를가진균주는 cefixime에가장높은내성을나타내었다. 그러나모자이크형이아닌 pena 변이를가진균주들도 mtrr, porb 및 pona 유전자다형성을동반할경우주사제뿐만아니라경구용제제 (cefixime) 에대해서도비슷한수준의감수성저하를나타내었다. V. 결론 2000년대초반부터임균의 fluoroquinolone 내성으로인해 cephalosporin 항균제사용이증가한국내의환경을고려하여임균의 cephalosporin 항균제내성양상과감수성저하기전을규명하였다. Cephalosporin에감수성이높은균주는 pena, mtrr, porb, pona 및 pilq 유전자의돌연변이가없거나있더라도감수성이저하된균주와다른형태의돌연변이를보였다. Cefixime에비감수성인 1주에서만모자이크형 pena를발견할수있었고나머지감수성저하를보인균주들은다른형태의 pena 변이를가지고있었다. 모자이크형 pena 돌연변이를가진균주가 cefixime에가장높은내성을보였지만모자이크형이아닌 pena 변이를가진균주들도 27
36 mtrr, porb 및 pona 유전자다형성을동반할경우주사제뿐만아니라경구용제제 (cefixime) 에감수성저하를보일수있음을알수있었다. 각각의 pena, mtrr, porb 및 pona 유전자돌연변이가 cephalosporin 내성에어느정도기여를하는지는더연구가필요할것으로생각되었다. 28
37 참고문헌 1. Tapsall J. Antibiotic resistance in Neisseria gonorrhoeae is diminishing available treatment options for gonorrhea: some possible remedies. Expert Rev Anti Infect Ther 2006;4: Seong WK, Chung KT, Kill JY, Kim SH, Oh HB. Antimicrobial Resistance of Neisseria gonorrhoeae Isolated in Korea. Korean J Infect Dis 2001;33: 항균제내성소식. 1999년 1-12월에분리된세균의항균제감수성. 항균제내성소식지 2000;8: Birley H, McDonald P, Carey P, Fletcher J. High level ciprofloxacin resistance in Neisseria gonorrhoeae. Genitourin Med 1994;70: Trees DL, Sirivongrangson P, Schultz AJ, Buatiang A, Neal SW, Knapp JS, et al. Multiclonal increase in ciprofloxacinresistant Neisseria gonorrhoeae, Thailand, Sex Transm Dis 2002;29: Dan M, Poch F, Sheinberg B. High prevalence of high-level ciprofloxacin resistance in Neisseria gonorrhoeae in Tel Aviv, Israel: correlation with response to therapy. Antimicrob Agents Chemother 2002;46: Shultz TR, Tapsall JW, White PA. Correlation of in vitro susceptibilities to newer quinolones of naturally occurring quinolone-resistant Neisseria gonorrhoeae strains with 29
38 changes in GyrA and ParC. Antimicrob Agents Chemother 2001;45: Lee K, Chong Y, Erdenechemeg L, Soon Song K, Hun Shin K. Incidence, epidemiology and evolution of reduced susceptibility to ciprofloxacin in Neisseria gonorrhoeae in Korea. Clin Microbiol Infect 1998;4: Yong D, Kim TS, Choi JR, Yum JH, Lee K, Chong Y, et al. Epidemiological characteristics and molecular basis of fluoroquinolone-resistant Neisseria gonorrhoeae strains isolated in Korea and nearby countries. J Antimicrob Chemother 2004;54: Centers for Disease Control and Prevention. Update to CDC's sexually transmitted diseases treatment guidelines, 2006: fluoroquinolones no longer recommended for treatment of gonococcal infections. MMWR Morb Mortal Wkly Rep 2007;56: Handsfield HH, McCormack WM, Hook EW, 3rd, Douglas JM, Jr., Covino JM, Verdon MS, et al. A comparison of singledose cefixime with ceftriaxone as treatment for uncomplicated gonorrhea. The Gonorrhea Treatment Study Group. N Engl J Med 1991;325: Ameyama S, Onodera S, Takahata M, Minami S, Maki N, Endo K, et al. Mosaic-like structure of penicillin-binding protein 2 Gene (pena) in clinical isolates of Neisseria gonorrhoeae with reduced susceptibility to cefixime. 30
39 Antimicrob Agents Chemother 2002;46: Ito M, Deguchi T, Mizutani KS, Yasuda M, Yokoi S, Ito S, et al. Emergence and spread of Neisseria gonorrhoeae clinical isolates harboring mosaic-like structure of penicillin-binding protein 2 in Central Japan. Antimicrob Agents Chemother 2005;49: Whiley DM, Limnios EA, Ray S, Sloots TP, Tapsall JW. Diversity of pena alterations and subtypes in Neisseria gonorrhoeae strains from Sydney, Australia, that are less susceptible to ceftriaxone. Antimicrob Agents Chemother 2007;51: Tanaka M, Nakayama H, Huruya K, Konomi I, Irie S, Kanayama A, et al. Analysis of mutations within multiple genes associated with resistance in a clinical isolate of Neisseria gonorrhoeae with reduced ceftriaxone susceptibility that shows a multidrug-resistant phenotype. Int J Antimicrob Agents 2006;27: Lindberg R, Fredlund H, Nicholas R, Unemo M. Neisseria gonorrhoeae isolates with reduced susceptibility to cefixime and ceftriaxone: association with genetic polymorphisms in pena, mtrr, porb1b, and pona. Antimicrob Agents Chemother 2007;51: Zhao S, Tobiason DM, Hu M, Seifert HS, Nicholas RA. The penc mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises from a mutation in the PilQ 31
40 secretin that interferes with multimer stability. Mol Microbiol 2005;57: Takahata S, Senju N, Osaki Y, Yoshida T, Ida T. Amino acid substitutions in mosaic penicillin-binding protein 2 associated with reduced susceptibility to cefixime in clinical isolates of Neisseria gonorrhoeae. Antimicrob Agents Chemother 2006;50: Ropp PA, Hu M, Olesky M, Nicholas RA. Mutations in pona, the gene encoding penicillin-binding protein 1, and a novel locus, penc, are required for high-level chromosomally mediated penicillin resistance in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2002;46: Dowson CG, Jephcott AE, Gough KR, Spratt BG. Penicillinbinding protein 2 genes of non-beta-lactamase-producing, penicillin-resistant strains of Neisseria gonorrhoeae. Mol Microbiol 1989;3: Dougherty TJ. Genetic analysis and penicillin-binding protein alterations in Neisseria gonorrhoeae with chromosomally mediated resistance. Antimicrob Agents Chemother 1986;30: Mavroidi A, Tzouvelekis LS, Kyriakis KP, Avgerinou H, Daniilidou M, Tzelepi E. Multidrug-resistant strains of Neisseria gonorrhoeae in Greece. Antimicrob Agents Chemother 2001;45:
41 23. Lucas CE, Balthazar JT, Hagman KE, Shafer WM. The MtrR repressor binds the DNA sequence between the mtrr and mtrc genes of Neisseria gonorrhoeae. J Bacteriol 1997;179: Shafer WM, Balthazar JT, Hagman KE, Morse SA. Missense mutations that alter the DNA-binding domain of the MtrR protein occur frequently in rectal isolates of Neisseria gonorrhoeae that are resistant to faecal lipids. Microbiology 1995;141: Hagman KE, Shafer WM. Transcriptional control of the mtr efflux system of Neisseria gonorrhoeae. J Bacteriol 1995;177: Hagman KE, Pan W, Spratt BG, Balthazar JT, Judd RC, Shafer WM. Resistance of Neisseria gonorrhoeae to antimicrobial hydrophobic agents is modulated by the mtrrcde efflux system. Microbiology 1995;141: Liao M, Bell K, Gu WM, Yang Y, Eng NF, Fu W, et al. Clusters of circulating Neisseria gonorrhoeae strains and association with antimicrobial resistance in Shanghai. J Antimicrob Chemother 2008;61: Unemo M, Olcen P, Berglund T, Albert J, Fredlund H. Molecular epidemiology of Neisseria gonorrhoeae: sequence analysis of the porb gene confirms presence of two circulating strains. J Clin Microbiol 2002;40: Olesky M, Hobbs M, Nicholas RA. Identification and analysis 33
42 of amino acid mutations in porin IB that mediate intermediate-level resistance to penicillin and tetracycline in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2002;46: Gill MJ, Simjee S, Al-Hattawi K, Robertson BD, Easmon CS, Ison CA. Gonococcal resistance to beta-lactams and tetracycline involves mutation in loop 3 of the porin encoded at the penb locus. Antimicrob Agents Chemother 1998;42: Whiley DM, Limnios EA, Ray S, Sloots TP, Tapsall JW. Further questions regarding the role of mosaic pena sequences in conferring reduced susceptibility to ceftriaxone in Neisseria gonorrhoeae. Antimicrob Agents Chemother 2007;51: Ilina EN, Vereshchagin VA, Borovskaya AD, Malakhova MV, Sidorenko SV, Al-Khafaji NC, et al. Relation between genetic markers of drug resistance and susceptibility profile of clinical Neisseria gonorrhoeae strains. Antimicrob Agents Chemother 2008;52:
43 Abstract Prevalence and mechanism of reduced susceptibility to cephalosporin of Neisseria gonorrhoeae in Korea Sang-Guk Lee Department of Medicine The Graduate School, Yonsei University (Directed by Professor Kyungwon Lee) The options for the effective treatment of Neisseria gonorrhoeae infections have been significantly reduced over time by the emergence and spread of gonococci resistant to the penicillins, tetracyclines, and quinolone groups of antibiotics. Cephalosporin antibiotics are now the mainstay of treatment in many settings. Therefore, the surveillance of cephalosporin resistance is required. We undertook the primary isolation of N. gonorrhoeae from clinical samples from sexually transmitted disease clinics and public heath centers during Antimicrobial susceptibility was determined by agar dilution 35
44 method in randomly selected 208 isolates. Among these, 46 (22.1%) isolates with decreased susceptibility to cephalosporins and two highly susceptible isolates (controls) were tested for pena, mtrr, porb, pona, and pilq polymorphisms. In present study, eight patterns in amino acid sequence of penicillin binding protein 2 (PBP 2) were found, and one of them was new one (XXIV). We found mosaic PBP 2 in only one isolate, and this exhibited the increased cefixime MIC (0.5 µg/ml). In mtrr gene analysis, control isolates had incomplete MtrR protein. In contrast, the isolates with reduced susceptibility to cephalosporins had deletions in promoter region (44 isolates) or point mutations (Ala39Thr, Leu47Pro) within mtrr ORF (2 isolates). All isolates except one control isolate had two amino acid substitutions at 101 and 102 position of PorB. Control isolates had no mutation in pona gene. The isolates with reduced susceptibility had Leu421Pro in PonA except two isolates. However, cephalosporin susceptibility was not different between isolates with pona mutation and without the mutation if other genetic polymorphisms were same. In addition, pilq mutation was not detected in all isolates tested. In present study, the isolate with mosaic pena showed 36
45 the highest resistance to cephalosporins, especially to oral cefixime. However, the isolates with other type of pena mutation can exhibit reduced susceptibility to both oral and injectable cephalosporins when accompanied by mtrr, porb, pona polymorphisms Key words: Neisseria gonorrhoeae, pena, mtrr, porb, pona, pilq, mosaic, cephalosporin, reduced susceptibility 37
untitled
Review ISSN 1975-7425(Print) / ISSN: 2288-016X(Online) Korean J Urogenit Tract Infect Inflamm 2013;8(2):90-97 다제내성임균감염 백승, 임동훈 조선대학교의과대학비뇨기과학교실 Multidrug Resistance in Neisseria gonorrhoeae Seung Baik,
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More information12(2) fm
Journal of Dental Hygiene Science Vol. 12, No. 2, pp. 109~113 (2012) 임상에서분리한 Streptococcus pneumoniae 에서 Levofloxacin 내성유전자의비교연구 최재민 1 박선희 1 윤지아 1 한양금 2 이인수 1 1 한남대학교생명공학과, 2 대전보건대학교치위생 ( 학 ) 과 Comparative
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More informationuntitled
Review ISSN 1975-7425(Print) / ISSN: 2288-016X(Online) http://dx.doi.g/10.14777/kjutii.2015.10.1.12 Kean J Urogenit Tract Infect Inflamm 2015;10(1):12-18 다제내성시대의임균치료 채지윤, 오미미 고려대학교의과대학비뇨기과학교실 Treatment
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>
수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationhwp
최종연구보고서 - 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 -
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationuntitled
Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationEvaluation of Phoenix for AST of S. pneumoniae 213 mento, CA, USA) 이사용되고있다. 2000년에 Becton Dickinson에서포도알균, 장알균과그람음성세균의동정과항균제감수성검사를위한 Phoenix Automated
대한진단검사의학회지제 29 권제 3 호 2009 Korean J Lab Med 2009;29:212-7 DOI 10.3343/kjlm.2009.29.3.212 Original Article Clinical Microbiology 폐렴알균의항균제감수성검사를위한 Phoenix System 의평가 이교관 1 류남희 2 김성태 1 채석래 1 허희진 1 동국대학교일산병원진단검사의학과
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈
대한진단검사의학회지제 26 권제 6 호 2006 Korean J Lab Med 2006;26:412-7 원저 임상미생물학 vana 유전자를지닌 Vancomycin 내성장구균의 VanB 표현형발현기전 박일중 1 이위교 2 이혁민 3 용동은 4 이경원 4 김의종 5 정석훈 6 박연준 7 최태열 8 어영 9 신종희 10 이종욱 11 안지영 12 이성희 13 우건조
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 국문과제명 제 영문과제명 명 주 의 ( 주의내용기재 ) 2 0 주관연구기관 : ( 글 14 point 고딕체 ) 질병관리본부 질병관리본부 - 1 -
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 국문과제명 제 영문과제명 명 주 의 ( 주의내용기재 ) 2 0 주관연구기관 : ( 글 14 point 고딕체 ) 질병관리본부 질병관리본부 - 1 - 주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다.
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information, 41 ( ) * 1) ***.,. I.,..., ( ) ( ).,. ( ) *. ** 1
, 41 (2007 12 ) * 1) ***.,. I.,..., ( ) ( ).,. ( ) *. ** 1 2, 41,. 0..,,.,,.,,.....,,.., 3..,,... II. ( ).,.,. ( ).. : 1 1. 1. ( : 1,000, 4, 41 : 8%, : 3 ) 1,000. ( ) 12%. 1 1, 10 5,000 1 5,800. 1 903.926
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information건강과질병4-35호
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 4 No. 35 www.cdc.go.kr/phwr 년 9 월 2 일제 4 권 / 제 35 호 / ISSN:2005-811X 국내에서분리된임균의항균제감수성 Antimicrobial susceptibility
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationViridans Streptococci 균혈증 247 나이며, 이는류마티스성열, 승모판탈출, 선천성결손, 인공판막등으로인한심장판막손상이나결손이있는사람에서주로발생한다 [4]. 최근에는혈액종양이나고형암또는골수이식등의치료에사용된항암제에따른심각한호중구감소증, 구강점막의궤양등과
대한진단검사의학회지 : 제 23 권제 4 호 2003 Korean J Lab Med 2003; 23: 246-50 임상미생물학 Viridans Streptococci 균혈증의임상적의의 조은해 이남용 성균관대학교의과대학삼성서울병원진단검사의학교실 Clinical Significance of Viridans Streptococcal Bacteremia Eun Hae
More information... 수시연구 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 권혁구ㆍ서상범...
... 수시연구 2013-01.. 2010 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 2010... 권혁구ㆍ서상범... 서문 원장 김경철 목차 표목차 그림목차 xi 요약 xii xiii xiv xv xvi 1 제 1 장 서론 2 3 4 제 2 장 국가물류비산정방법 5 6 7 8 9 10 11 12 13
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationuntitled
210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information< BFF8C0FA2D B9E8C7F6C1D62E687770>
대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationhwp
심사위원 심사위원 심사위원 인 인 인 - i - - ii - - iii - - iv - - v - Ⅰ. 서 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - 항목 건강하지못하다 주관적구강상태 보통이다
More informationuntitled
The Korean Journal of Helicobacter and Upper Gastrointestinal Research Vol. 11, No. 1, 132, June 211 헬리코박터의항생제내성 Antibiotic Resistance in Helicobacter pylori Infection 중앙대학교의과대학내과학교실 Jae G. Kim, Beom Jin
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More information04±èºÎ¼º
Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대
저작자표시-비영리-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 이차적 저작물을 작성할 수 있습니다. 다음과 같은 조건을 따라야 합니다: 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More informationuntitled
Ann Clin Microbiol Vol. 17, No. 4, December, 2014 http://dx.doi.org/10.5145/acm.2014.17.4.110 pissn 2288-0585 eissn 2288-6850 The Evaluation of Recovery Rate of Neisseria gonorrhoeae in Two Bacterial Transport
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information음주측정을 위한 긴급강제채혈의 절차와 법리, A Study on the Urgent Compulsory Blood
음주측정을 위한 긴급강제채혈의 절차와 법리 A Study on the Urgent Compulsory Blood Collecting for Investigation of Driving while Intoxicated 양 동 철 * (Yang, Dong-Chul) < 차 례 > Ⅰ. 서론 Ⅱ. 체내신체검사와 긴급압수ㆍ수색ㆍ검증의 허용범위 Ⅲ. 긴급강제채혈의 허용범위와
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More information<3037C1D6BCBCC0CD2E687770>
대한임상검사학회지 : 38 권제 1 호, 38-44, 2006 포도구균의 Erythromycin 유도성 Clindamycin 내성검출을위한간편한디스크확산법의유용성 서울대학교병원진단검사의학과 1, 서울대학교의과대학검사의학교실 2 주세익 1 이현 1 임규상 1 김의종 1, 2 An Easy Method of Disk Diffusion Antibiotic Susceptibility
More informationuntitled
Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho
More informationVol.259 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2018.01 Vol.259 C O N T E N T S 02 06 28 61 69 99 104 120 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2018.1 3 4 2018.1 1) 2) 6 2018.1 3) 4) 7 5) 6) 7) 8) 8 2018.1 9 10 2018.1 11 2003.08 2005.08
More information12_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬
More information296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,
Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information<B4EBC7D1BFE4B7CEBBFDBDC4B1E2B0A8BFB0C7D0C8B8C1F620C1A637B1C720C1A632C8A32E687770>
대한요로생식기감염학회지: 제 7 권 제 2 호 2012년 10월 Korean J UTII Vol. 7, No. 2, October 2012 종 설 한국에서 세균성 성매개감염의 항생제 내성 역학 중앙대학교 의과대학 비뇨기과학교실 김정훈 장인호 [Abstract] Epidemiology of Antimicrobial-Resistance in Sexually Transmitted
More information