Microsoft Word 학위논문_최종

Transcription

1 국내환자분리임균의항균제내성현황과분자역학적특성 연세대학교대학원 의과학과 김효진

2 국내환자분리임균의항균제 내성현황과분자역학적특성 지도교수이경원 이논문을석사학위논문으로제출함 2013년 12월연세대학교대학원의과학과김효진

3 김효진의석사학위논문을인준함 심사위원 인 심사위원 인 심사위원 인 연세대학교대학원 2013 년 12 월

4 감사의글 본논문을완성하기까지끊임없는관심과사랑으로지도해주신존경하는이경원교수님과이혁민교수님, 윤상선교수님께진심으로감사를드립니다. 그리고아낌없는조언으로격려해주신용동은교수님, 이양순선생님께감사의말씀을드립니다. 또한연구에전념할수있도록많은시간을할애하고, 실험을도와주신서영희선생님, 김완희선생님과같은공간에서함께실험하며지낸종소리선생님, 김인혜선생님, Roshan에게고마움을전합니다. 석사기간동안함께수업을들으며학교생활에적응할수있도록도움을주신전종수선생님께감사의말씀을전합니다. 항상곁에서힘이되어준가족에게감사의말을전하며마지막으로비슷한기간에석사를하며고민을나누기도하고학교생활에활력을준김미선, 김민애, 방수현그리고다른친구들에게도고마움을전합니다. 저자씀

5 < 차례 > 국문요약 1 I. 서론 3 II. 재료및방법 7 1. 균주수집및동정 7 2. 항균제감수성시험 7 가. 디스크확산법 7 나. 한천희석법 8 다. β-lactamase 생성시험 9 3. Cephalosporin제에대한내성기전규명 9 가. pena 유전자염기서열분석 9 나. mtrr, pona 및 pilq 유전자염기서열분석 내성균의분자역학적성상규명 1 1 가. N. gonorrhoeae multi-antigen sequence type (NG-MAST) 1 1 나. Multilocus sequence typing (MLST) 1 1 III. 결과 항균제감수성 1 3 가. 디스크확산법 1 3 나. 한천희석법 Cephalosporin 내성기전 1 8 가. pena 유전자염기서열 1 8

6 나. mtrr, pona 및 pilq 유전자분석 NG-MAST 2 4 IV. 고찰 2 7 V. 결론 3 1 참고문헌 3 2 영문요약 3 7

7 그림차례 그림 1. Distribution of minimum inhibitory concentrations (MICs) of ceftriaxone and cefixime among Neisseria gonorrhoeae isolates in 그림 2. Susceptibility rates for ceftriaxone and cefixime by CLSI, EUCAST and CDS 17 그림 3. Amino acid substitutions identified in PBP2 of the N. gonorrhoeae strains 19

8 표차례 표 1. Primers used for PCR amplification and sequencing 10 표 2. Oligonucleotide primers used in the N. gonorrhoeae MLST 12 표 3. Antimicrobial resistance rate of N. gonorrhoeae by Disk diffusion method 14 표 4. Antimicrobial resistance rate of N. gonorrhoeae by agar dilution method 16 표 5. Minimum inhibitory concentrations (MICs) distributions of cephalosporins for 77 N. gonorrhoeae isolates according to pena genotypes 20 표 6. Characteristics of cephalosporin decreased susceptibility for 48 N. gonorrhoeae isolates 22 표 7. NG-MAST summary of N. gonorrhoeae isolated from

9 < 국문요약 > 국내환자분리임균의항균제내성현황과분자역학적특성 근래다제내성임균의증가로 cephalosporin 항균제사용이증가하였고이로인해 cephalosporin 항균제에감수성이저하된균주들이보고되기시작하였다. Cephalosporin 항균제사용이증가한국내의환경을고려하면임균의 cephalosporin 내성에대한감시가필요할것으로생각된다. 본연구에서는전국주요지역에서 2011년부터 2012년까지특수직업여성및일반환자로부터배양한임균을수집하여총 151주의항균제감수성을디스크확산법과한천희석법으로시험하였다. Penicillin G, tetracycline 및 ciprofloxacin에내성인균주의비율은각각 34%, 51% 및 93% 로높았으나, azithromycin에내성균주의비율은 5% 로낮았고, spectinomicin에는모두감수성이었다. Cefixime 비감수성인 1주를제외하고, ceftriaxone 과 cefixime 에모두감수성이었다. 감수성시험균주중 cephalosporin계항균제에대하여감수성이저하된균주 48주와감수성균주 29주를대상으로 pena, mtrr, pona 및 pilq 유전자의염기서열을분석하였다. Penicillin binding protein 2 (PBP 2) 유전자인 pena 분석을통해 PBP 2 아미노산서열형 8가지를관찰하였다. 감수성균주의 pena type은 IV, V, XIII, XVI, XVII, XVIII형이보였고, 감수성저하균주의 pena type 은 V, X, XII, XIII, XVII, XVIII형이보였다. 그중 IV형과 XVI형은감수성균주에서만나타났다. XIII형이가장흔하였고, 이들대부분은 ceftriaxone 과 cefixime 또는 cefpodoxime의 MIC 값이높았다. 모자이크형 X형한 1

10 주는 cefixime (MIC 0.25 µg/ml), cefpodoxime (MIC 2 µg/ml) 로높았다. mtrr, pona 및 pilq 유전자의변이는감수성여하에관계없이관찰되었다. 국내에서분리된임균의 sequence type (ST) 은 porb 의차이에의해다양한 ST을보이나, tbpb는 tbpb21와 tbpb33이각각 49주와 39주로유전적연관성이있을것으로생각되었다 년에분리된균주중 tbpb21을가진균주의대부분이 cephalosporin에감수성이저하되었으며 tbpb110와 tbpb620을가진균주도 cephalosporin 감수성저하를보였다. 반면, tbpb33을가진균주는 cephalosporin에감수성이었다. 결론적으로국내에서분리된임균의대부분은 cephalosporin에대한감수성이었으나, 일부균주는감수성이저하된균주이었다. 모자이크형을가진한주가전세계적으로 cephalosporin 치료실패와관련있는 MLST ST1901을가지며, 일본에서발생한 ceftriaxone 고도내성임균과유사한 pena 모자이크형을가지므로, N. gonorrhoeae의 cephalosporin 내성출현을모니터링하기위한지속적인감시시스템이필요하다고판단된다. 핵심되는말 : 임균, pena, mtrr, pona, pilq, 모자이크형변이, tbpb, cephalosporin, 감수성저하 2

11 국내환자분리임균의항균제내성현황과분자역학적특성 < 지도교수이경원 > 연세대학교대학원의과학과 김효진 Ⅰ. 서론 임질은주요성매개감염 (sexually transmitted diseases, STDs) 으로, 세균에의한성매개감염질환중두번째로흔하다 1. 임균은대부분의남성에서요도염등의비뇨생식기감염을일으키며, 여성에서는무증상보균자로부터골반의염증성질환및불임등다양한감염과합병증을유발한다 1. 또한에이즈의원인인인간면역결핍바이러스 (human immunodeficiency virus, HIV) 감염가능성을높이고, 불임과같은심각한합병증을초래할수있다 1. 임균감염은사회경제적인변화에따라대부분의선진국에서감소하고있으나, 아직적지않은환자가발생하고있으며, 개발도상국에서는여전히많은환자가발생하고있다 1. 3

12 건강보험심사평가원자료에의하면국내의임균감염은 2012 년에 16,962 명의환자로부터 40,038 일의내원일수를보여, 여전히흔하였으며최근개방된성문화의등장으로인해그예방및관리의중요성은더욱부각되고있다. 특히 2004 년발표된성매매금지법으로성매개감염병에대한관리가어려운상황을고려하면, 국내에서도임균감염발생에대한주의가필요하다. 임질은세균및감염자의특수한상황에의해대부분이 1 차의료기관에서경험적으로치료된다. 적절한경험적치료를위해서는항균제내성현황에대한지속적이고효과적인감시가필요하다 1. 국내에서분리되는임균은과거임질치료에사용하였던 penicillin G 와 tetracycline 에거의내성이고 2-4, fluoroquinolone 역시높아진내성률 5-6 로사용이금지됨에따라, 근래에는 cephalosporin 항균제의사용이증가하였다 7. Cephalosporin 항균제중에서는 ceftriaxone 과 cefixime 등이주로사용되는데, 사용증가에따른항균제선택압력으로인해 cephaloscoporin 항균제에대한감수성이저하된균주들이전세계적으로보고되고있다 경구용 cephalosporin 인 cefixime 에대한내성은 2002 년에일본에서처음보고된이후로세계각국에서흔하게보고되고있으며, 임질치료의마지막보루로생각되던 ceftriaxone 에대한고도내성임균도 2011 년과 2012 년에 4

13 일본과유럽에서 4 주가보고되었다 임균의 cephalosporin 내성에관여하는유전자는 pena, mtrr, pona, porb1b, pilq 등이있다 Cephalosporin 항균제의작용대상인페니실린결합단백 (penicillin binding protein, PBP2) 를생성하는 pena 는모자이크구조나 501 번째아미노산인 adenine 변이가항균제내성과연관이있는것으로알려져 있으며, mtrr, pona, porb1b 및 pilq 유전자의변이도 cephalosporin 항균제내성에영향을주는것으로알려져있다. 심사평가원자료에의하면국내에서도임질감염치료를위한 cephalosporin 항균제의처방률이 2002년의 10% 에서 2010년에는 30% 로증가하였다. 따라서국내에서분리되는임균에서도이들약제에대한내성균의출현가능성이적지않으므로주요다제내성임균의확산을감시하고, 산발적으로발생할것이우려되는 cephalosporin 비감수성임균의역학적특성을분석함으로써, 내성세균발생시확산을조기에차단하는것이필요할것으로판단된다. 특히, ceftriaxone 내성임균이처음보고된일본은한국과지리학적으로매우가까울뿐만아니라인적교류가매우활발하다는점에서일본에발생한 ceftriaxone 내성임균이국내에유입될가능성또한적지않다. 본연구에서는국내에서최근분리된임균을대상으로 cephalosporin 항균제를포함한주요항균제에대한내성양상, 주요내성기전및분자역 5

14 학적성상을규명하여임균감염증의치료와내성균의확산을막기 위한대책수립에중요한자료를제공하고자한다. 6

15 Ⅱ. 재료및방법 1. 균주수집및동정 2011년 1월부터 2012년 12월까지전국각지역에위치한의료기관과특수직업여성밀집지역에위치한보건소에내원한환자로부터임균감염이의심되는균주또는검체를수집하였다. 검체는임균이죽지않도록 Transgrow 배지 (BBL, Becton-Dickinson, Cockeysville, MD, USA) 에넣어운반하였으며, modified Thayer-Martin 배지 (BBL) 에접종하여 35 에서 24시간배양하였다. 균종동정은그람염색, 전통적인생화학적검사와 Vitek System (biomerieux, Marcy 1'Etoile, France) 으로실시하였다. 동정된균주는 -70 이하의냉동고에보관하였다. 2. 항균제감수성시험가. 디스크확산법시험균주를증류수에현탁하여 McFarland제 0.5관탁도에맞춘후, 세균부유액을 GC agar base (BBL) 에 1% hemoglobin과 1% IsoVitaleX (BBL) 을첨가하여만든한천에접종하였다. Becton Dickinson (Cockeysville, MD, USA) 사의 penicillin G (10 U), ceftriaxone (5 µg, 30 µg), 7

16 cefixime (5 µg), cefpodoxime (10 µg), cefotaxime (30 µg), spectinomycin (100 µg), tetracycline (30 µg), azithromycin (15 µg), ciprofloxacin (5 µg) 및 nalidixic acid (30 µg) 디스크를놓은후 5% CO2 항온기에 35 에서, 24 시간배양후판독하였다. Penicillin G, ceftriaxone (30 µg), cefixime, cefpodoxime, cefotaxime, spectinomycin, tetracycline 및 ciprofloxacin은 Clinical and Laboratory Standards Institute (CLSI) 기준 14 에따라그리고 ceftriaxone (0.5 µg), azithromycin 및 nalidixic acid는 Australian criteria (CDS) 기준 15 에따라판독하였다. 나. 한천희석법동결보관균주를초콜릿한천에접종한후양초단지에넣어 35, 24시간배양한후, 증류수에현탁하여 10 4 CFU/mL으로희석하였다. GC agar base (BBL) 에 1% hemoglobin과 1% IsoVitaleX (BBL) 을첨가하고, 규정된희석액으로녹인항균제를넣어 2배수단계희석된농도가되도록평판을만들었다. 세균부유액을 Steers' replicator (Craft Machine Inc., Woodline, PA, USA) 로배지에접종하고 5% CO2 항온기에 35 에서 24 시간배양후판독하였다. Penicillin G, ceftriaxone, cefixime, cefpodoxime, spectinomycin, tetracycline 및 ciprofloxacin 감수성결과는 CLSI 기준 14 에따라해석하였고, azithromycin은 European Committee on Antimicrobial Susceptibility Testing (EUCAST) 기준 16 에따라해석하였다. Breakpoint가 8

17 결정되지않은 gentamicin은별도의해석을하지않고, MIC 50 과 MIC 90 만정리하였다. 정도관리를위해 N. gonorrhoeae ATCC 49226, Staphylococcus aureus ATCC 29213와 WHO 임균정도관리균주인 WHO A, WHO C, WHO G, WHO K, WHO L 및 WHO P 균주를같이시험하였다. 다. β-lactamase 생성시험 Chromogenic cephalosporin 법인 cefinase 디스크 (BBL) 로시험하여, 노란색이분홍색으로변하면양성으로판정하였다. 3. Cephalosporin제에대한내성기전규명가. pena 유전자염기서열분석균집락을멸균증류수에부유시킨후 10분간끓여서 2분간 13,000 rpm으로원심분리한상층액 1 µl를 template로사용하였다. 추출한 DNA는 PBP 2의 mosaicism을분석하기위해 pena 유전자전체를 3부분으로나누어각각의 primer set를사용하여 PCR을시행하였다 ( 표 1). PCR 산물은전기영동한후각 primer set에적합한크기의 PCR 산물을 QIA quick gel extraction kit (Qiagen, Hilden, Germany) 을사용하여추출한후염기서열을분석하였다 17. pena 서열은 penicillin와 cephalosporin 감수성균주인 N. gonorrhoeae LM306 (GeneBank accession 9

18 no. M32091) 와비교하였고 ( 그림 2), 유전형은 Ito 17 등과 Whiley 18 등이 이전에보고한분류에따랐다. 나. mtrr, pona 및 pilq 유전자염기서열분석 Cephalosporin 항균제의감수성에영향을미치는유전자다형성을규명하기위해각각의유전자에대한염기서열분석을시행하였다. Template로사용한 DNA는위와동일하였다. 추출한 DNA는각각의유전자의 promotor 부위와유전자부위를분석하기위해각각의 primer set를사용하여 PCR을시행하였다 ( 표 1). PCR 산물은전기영동한후각 primer set에적합한크기의 PCR 산물을 QIA quick gel extraction kit (Qiagen, Hilden, Germany) 을사용하여추출한후염기서열을분석하였다 17. 표 1. Primers used for PCR amplification and sequencing Primer Nucleotide sequence (5ʹ to 3ʹ) Nucleotide positions PenA-A1 CGGGCAATACCTTTATGGTGGAAC 8-31 PenA-B1 AACCTTCCTGACCTTTGCCGTC PenA-A2 AAAACGCCATTACCCGATGGG PenA-B2 TAATGCCGCGCACATCCAAAG PenA-A3 GCCGTAACCGATATGATCGA PenA-B3 CGTTGATACTCGGATTAAGACG mtrr-f GCCAATCAACAGGCATTCTTA mtrr-r GTTGGAACAACGCGTCAAAC

19 pona-f GAGAAAATGGGGGAGGACCG pona-r GGCTGCCGCATTGCCTGAAC pilq-f CGTTACGCCGAACATCACG pilq-r TGACCGAAACTGAACGGACTG 내성균의분자역학적성상규명가. N. gonorrhoeae multi-antigen sequence type (NG-MAST) 유전자변이가심한단일유전자의염기서열분석을통해역학적관계를규명하였다. porb 유전자 (F-CAAGAAGACCTCGGCAA; R-CCGACAACCACTTGGT) 와 tbpb 유전자 (F-CGTTGTCGGCAGCGC GAAAAC; R-TTCATCGGTGCGCCGCCTTG) 를 PCR로증폭하고, 증폭한산물을전기영동한후, QIA quick gel extraction kit (Qiagen, Hilden, Germany) 을이용하여 DNA를추출하였다. Bioneer (Daejeon, Korea) 에의뢰하여염기서열을분석한후에, 나. Multilocus sequence typing (MLST) 임균의세포내대사에관여하는 7개의주요유전자 (Housekeeping gene) 를대상으로염기서열분석을시행하였다. 인터넷을통하여 MLST database ( 에자료를입력하여분석하였다 ( 표 2)

20 표 2. Oligonucleotide primers used in the N. gonorrhoeae MLST Primer Nucleotide sequence (5ʹ to 3ʹ) Function abcz-p1 AATCGTTTATGTACCGCAGG Amplification and sequencing abcz-s2 GAGAACGAGCCGGGATAGGA Amplification and sequencing adk-p1 ATGGCAGTTTGTGCAGTTGG Amplification adk-p2 GATTTAAACAGCGATTGCCC Amplification adk-s1 AGGCTGGCACGCCCTTGG Sequencing adk-s2 CAATACTTCGGCTTTCACGG Sequencing aroe-p1 ACGCATTTGCGCCGACATC Amplification and sequencing aroe-p2 ATCAGGGCTTTTTTCAGGTT Amplification aroe-s2 ATGATGTTGCCGTACACATA Sequencing fumc-p1 CACCGAACACGACACGATGG Amplification fumc-p2 ACGACCAGTTCGTCAAACTC Amplification fumc-s1 TCCGGCTTGCCGTTTGTCAG Sequencing fumc-s2 TTGTAGGCGGTTTTGGCGAC Sequencing gdh-p1 ATCAATACCGCTGTGGCGCGT Amplification gdh-p2 GGTTTTCATCTGCGTATAGAG Amplification and sequencing gdh-s3 CCTTGGCAAAGAAAGCCTGC Sequencing pdhc-p1 GGTTTCCAACGTATCGGCGAC Amplification pdhc-p2 ATCGGCTTTGATGCCGTATTT Amplification and sequencing pdhc-s1 TATACTACATCACCCTGATG Sequencing pgm-s1 CGGCGATGCCGACCGCTTGG Amplification and sequencing pgm-s2 GGTGATGATTTCGGTTGCGCC Amplification and sequencing 12

21 Ⅲ. 결과 1. 항균제감수성가. 디스크확산법 2011년 1월에서 2012년 12월까지수집한임균은총 151주이며, Penicillin, tetracycline 및 ciprofloxacin에감수성인균주의비율은 0-4% 이고내성균주의비율은 57%, 90% 및 93% 이었다. Penicillinase 생성임균 (Penicillinase-producing N. gonorrhoeae, PPNG) 는 10주 (7%) 가, tetracycline 고도내성임균 (Tetracycline-resistant N. gonorrhoeae, TRNG) 는 36주 (24%) 가분리되었다. Spectinomycin과 azithromycin에대해서는모든균주가감수성이었다. Cephalosporin 항균제인 ceftriaxone (0.5 µg/30 µg), cefixime, cefpodoxime 및 cefotaxime에비감수성인균주비율은각각 53%/ 24%, 26%, 57% 및 25% 이었다 ( 표 3). 13

22 표 3. Antimicrobial resistance rate of N. gonorrhoeae by Disk diffusion method Antimicrobial agents (potency) % of isolates with (N = 151) Susceptible Intermediate NS Resistant Penicillin G (10 U) Ceftriaxone (0.5 µg) * Ceftriaxone (30 µg) Cefixime (5 µg) Cefpodoxime (10 µg) Cefotaxime (30 µg) Spectinomycin (100 µg) Tetracycline (30 µg) Ciprofloxacin (5 µg) Nalidixic Acid (30 µg) * Azithromycin (15 µg) * * Australian criteria (CDS) were applied. Not susceptible PPNG, 7% (10/151) TRNG, 24% (36/151) 14

23 나. 한천희석법 (Agar dilution method) 한천희석법은 penicillin G, ceftriaxone, cefixime, cefpodoxime, spectinomycin, gentamicin, tetracyclin, ciprofloxacin 및 azithromycin에대해시행하였다 ( 표 4). Penicillin G, tetracycline 및 ciprofloxacin에감수성인균주의비율은 0-5% 이었으며, 내성인균주의비율은각각 34%, 51% 및 93% 로높았다. Cefixime 비감수성인 1주 (MIC 0.5 µg/ml) 를제외하고, 모두 ceftriaxone 과 cefixime 에감수성이었으며, MIC 90 은각각 0.12 µg/ml 및 0.25 µg/ml이었다. Cefpodoxime 감수성균주의비율은 91% 로 cefixime 및 ceftriaxone 보다낮았다. Ceftriaxone과 cefixime에감수성이저하된균주 (MIC 0.12 µg/ml) 비율은각각 25% 및 28% 이었다 ( 그림 1). 해석기준에따른 ceftriaxone 및 cefixime 감수성균주의비율은각각 100% 및 99% (CLSI), 97% 및 88% (EUCAST), 57% 및 56% (CDS) 이었다 ( 그림 2). Spectinomycin에는모든균주가감수성이었으며, gentamicin의 MIC 50 과 MIC 90 은모두 8 µg/ml 였다. EUCAST 기준으로판독한결과 azithromycin 감수성인균주는 54% 이었으며, 5% 는내성이었다. 15

24 표 4. Antimicrobial resistance rate of N. gonorrhoeae by agar dilution method Antimicrobial agents MIC(µg/mL) % of isolates with (N = 151) Range 50% 90% S I R Penicillin G Ceftriaxone Cefixime Cefpodoxime Spectinomycin Gentamicin NA NA NA Tetracycline Ciprofloxacin Azithromycin * Abbreviation: S, susceptible; I, intermediate; R, resistant; NA, not applicable * EUCAST breakpoints were applied. Not susceptible 16

25 그림 1. Distribution of minimum inhibitory concentrations (MICs) of ceftriaxone and cefixime among Neisseria gonorrhoeae isolates in 그림 2. Susceptibility rates for ceftriaxone and cefixime by CLSI, EUCAST and CDS 17

26 2. Cephalosporin 내성기전가. pena 유전자염기서열 Cephalosporin 에비감수성이거나감수성이저하된 48 균주와감수성인 29 균주를대상으로 pena 염기서열을분석하였다. 모두 9 개의 pena 유전형이관찰되었으며, XIII 형이 45 주 (60%) 로가장많았다. 다음으로는 V형이 11 주 (13%), XVIII 형이 9주 (12%) 순이었고, 1 주에서는모자이크형인 X 형이관찰되었으며, 2 개의새로운유전형이발견되었다. 새롭게발견된 2 개의새로운유전형중한개는 X형의 번째모자이크형아미노산변이를가지고있는것으로보이며, 다른한개는 503 번아미노산을제외한나머지변이부위가 XIII 형과동일한유형이었다 ( 그림 3). XIII 형에속하는대부분의균주가 ceftriaxone, cefixime 또는 cefpodoxime 의 MIC 가높았으며, 2011 년도에분리된 cefixime 비감수성 1 주와 cefpodoxime 비감수성 12 주중 11 주가 XIII 형에속했다 ( 표 5). 모자이크형인 X 형을가진균주는 ceftriaxone 과 cefixime 및 cefpodoxime MIC 가각각 0.06 µg/ml 과 0.25 µg/ml 및 2 µg/ml 이었다. 반면에 IV, V 및 XVI 형균주는대부분 cefixime 과 ceftriaxone 의 MIC 가낮았다. 가장흔한 XIII 형균주의경우원주를제외한모든 지역에분포하였으며, 분리지역에따른 pena 형의차이는보이지 않았다. 18

27 그림 3. Amino acid substitutions identified in PBP 2 of the N. gonorrhoeae strains 19

28 표 5. Minimum inhibitory concentrations (MICs) distributions of cephalosporins for 77 N. gonorrhoeae isolates according to pena genotypes Amb pena type Number of isolates with MIC (μg/ml) of IV V X 1 CRO XII 1 XIII XVI 1 XVII 1 1 XVIII IV 7 1 V X 1 CFX XII 1 XIII XVI 1 XVII 1 1 XVIII IV V X 1 CPD XII 1 XIII XVI 1 XVII 1 1 XVIII Abbreviation: Amb, antimicrobial agent; CRO, ceftriaxone; CFX, cefixime; CPD, cefpodoxime Bold: Number of non-susceptible isolates 20

29 나. mtrr, pona 및 pilq 유전자분석 Ceftriaxone 또는 cefixime 에 대해 비감수성이거나 감수성이 저하된 48 주중에서, 오염으로관찰이불가능한 2 주를제외하고 46 주에대해 mtrr, pona 및 pilq 염기서열분석을시행하였다. 비감수성 1 균주를제외하고모두 mtrr promoter 위치에서하나의 염기쌍소실을보였으며, 4 균주에서 mtrr ORF 내아미노산치환 (Ala39Thr) 을 가지고 있었다. 염기쌍 소실을 보이지 않은 1 균주에서는 아미노산 치환 (Ala39Asp) 이 다르게 나타났다. pena 유전형에서 V 형을보인 1 균주에서는 mtrr promoter 위치에한개의 염기삽입을보였다. PonA 의경우 1 균주를제외하고모든균주에서 Leu421Pro 의아미노산치환을보였다. PilQ 유전자에서는대부분의 균주에서변이가관찰되지않았지만 4 균주에서 1 개의아미노산 치환 (Asn27Ser) 을보였다 ( 표 6). Cephalosporin 감수성인 29 균주에서도감수성저하균주와유사한 유전자돌연변이가관찰되었다 (data not shown). 유전형을검사한모든 감수성 균주의 mtrr promoter 부위에서 하나의 염기쌍 소실을 보였으며, 5 균주에서는 mtrr ORF 내아미노산치환 (Ala39Thr) 을 가지고 있었다. PonA 의 경우 1 균주를 제외하고 모든 균주에서 Leu421Pro 의아미노산치환을보였으며. PilQ 의경우 3 개 균주에서아미노산치환 (Asn27Ser) 을보였다. 21

30 표 6. Characteristics of cephalosphorin decreased susceptibility for 48 N. gonorrhoeae isolates PenA NG-MAST MIC (µg/ml) Mutations Region type ST tbpb porb CRO CFX CPD mtrr * pona pilq V GY A40D L421P N648S V SE Deletion A, Ins T L421P WT X IN Deletion A L421P WT XII SE Deletion A L421P WT XIII DJ Deletion A L421P WT XIII DJ Deletion A L421P WT XIII DJ Deletion A L421P WT XIII JB Deletion A L421P WT XIII IN Deletion A L421P N648S E666K XIII IN Deletion A L421P WT XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII JB Deletion A L421P WT XIII JB Deletion A L421P WT XIII JB Deletion A L421P WT XIII DJ Deletion A L421P WT XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII SE Deletion A L421P WT XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII SE Deletion A L421P WT XIII JB Deletion A L421P WT XIII IN Deletion A L421P WT XIII JB Deletion A L421P WT XIII IN Deletion A L421P WT XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII SE Deletion A L421P WT XIII JB Deletion A L421P N648S XIII SE Deletion A L421P WT XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII DJ Deletion A L421P WT XIII IN Deletion A L421P WT XIII SE NA NA NA XIII SE Deletion A L421P WT XIII IN Deletion A L421P WT XIII WJ Deletion A WT WT XIII NA 21 NA IN Deletion A L421P WT XVIII SE Deletion A, A39T L421P WT XVIII GY Deletion A, A39T L421P WT XVIII IN Deletion A L421P WT XVIII SE Deletion A, A39T L421P WT XVIII IN Deletion A, A39T L421P WT NEW IN Deletion A L421P N648S NEW GY Deletion A L421P WT NA IN NA NA NA Abbreviation: NA, not applicable; SE, Seoul; IN, Incheon; GY, Gyeonggi; WJ, Wonju; DJ, Daejeon; JB, Junbuk 22

31 * Nucleotide (A) deletion within the 13bp inverted repeat located between the -10 and -35 sequences of the mtrr promoter. New sequence types found in this study. 23

32 3. NG-MAST 151 주의 N. gonorrhoeae에서 96개의다양한 sequence type (ST) 이나왔으며, 그중 56개 ST은본연구에서새롭게발견되어 NG-MAST 데이터베이스에등록하였다. ST6734가 11개균주에서발견되어가장흔한 ST이었고, 다음으로 ST7690 (10 균주 ) 와 ST7548 (7 균주 ) 로흔하였다. porb 유전자는매우다양한유형을보였지만 tbpb 유전자는 tbpb21와 tbpb33이각각 32% 와 26% 로대부분을차지했다. 24

33 표 7. NG-MAST summary of N. gonorrhoeae isolated from NG-MAST No. Range of MIC (µg/ml) tbpb ST porb Isolates Penicillin G Ceftriaxone Cefixime Cefpodoxime etc , , , etc etc etc etc etc , , etc etc Other *

34 Abbreviation: NA, not applicable * New tbpb type identified in this study: tbpb1398, tbpb1399, tbpb1484 (N = 2), tbpb1485, tbpb1611, tbpb1612, tbpb1613, tbpb1614, tbpb1315, tbpb1616 sequence types belong to one isolate 26

35 Ⅳ. 고찰 국내의임균감염은아직도흔하며대부분다제내성임균이므로국민건강에큰위협이되고있다. 임균은과거대부분의항균제에감수성이었으나 penicillin G 내성을시작으로 tetracycline 및 quinolone에내성을보이는균주가출현하고확산됨에따라지금은 cephalosporin 과 spectinomycin만이효과적인치료제로남아있다. 본연구에서도대부분의균주가 penicillin G, tetracycline 및 ciprofloxaicn에내성이었으며, 감수성인균주의비율은 0-5% 로매우낮았다. Penicillin G 고도내성의원인인 PPNG의비율은 2011년에 6%, 2012년에는 8% 로 2000년의 64% 에비해크게감소하였다 2. PPNG가감소한명확한이유는불분명하나비슷한현상이홍콩등에서도보고된바있다 20. 국내에서는 PPNG의비율이많이감소하였으나동남아등지에서는아직흔하며, 특히태국에서 TEM-135형을생성하는임균이최근보고되었다 21. 대부분의임균은제한된범위의 β-lactam 항균제를분해하는 TEM-1형 β-lactamase를생성하지만, TEM 유전자는변이를통해광범위한 β-lactam 항균제를분해하는 extended spectrum β-lactamase로진화할수있어이에대한주의가필요하다. 반대로 TRNG는 2004년까지국내에서 0-4% 의낮은분리율을보였으나, 년에는 23% 로증가하였다. 증가의원인은확실하지않지만한국과일본을제외한동남아국가에서는 TRNG가흔하므로근접국가로부터유입가능성이있으며추가연구가필요할것으로생각된다 년수집균주중 1주 (cefixime MIC = 0.5 µg/ml) 를제외하고모든균주가 cefixime과 ceftriaxone에감수성이었다. Cefixime 또는 ceftriaxone에감수성이저하된 (MIC 0.12 µg/ml) 균주는 48주로 32% 27

36 의비율을보였다. Ceftriaxone에대한감수성판독기준은 CLSI 0.25 μg/ml, EUCAST 0.12 μg/ml 및 CDS μg/ml으로모두다르며, 이에따라디스크확산법결과와 CLSI 기준에따라해석한한천희석법결과에차이가발생한것으로생각된다. Ceftriaxone 최소억제농도 0.03 µg/ml 및 μg/ml인임균에의한인두감염증치료에있어서 ceftriaxone 치료실패가보고된적이있다 22. 그러므로국내에서는대부분 CLSI 기준을적용하고있으나, 감염부위에따라감수성판독기준을적용하는데주의가필요하겠다. 또한캐나다에서는 cefixime 최소억제농도가기존의감수성범위인 0.12 μg/ml 이상인균주들의치료실패율이 25% 로매우높아 CLSI 기준으로감수성인균주중에서도치료실패가흔함을보고하였다 23. 임균의 cephalosporin 감수성저하또는내성에관여하는유전자는 pena, mtrr, pona, porb1b 및 pilq 등이알려져있다 PBP2를생성하는 pena 유전자가다른 Neisseria 균종으로부터유전자의일부를받아모자이크형구조를생성하거나 Ala501, Gly542, Pro551 부위의아미노산에변이를획득하면 cephalosporin 항균제에대한감수성이저하될수있다. 2004년에국내에서분리된 cefixime 비감수성균주는전형적인 X형모자이크형을보였으나, 2011년에분리된비감수성균주는비모자이크형인 XIII 형이었다. XIII 형은국내에서가장흔하게관찰되며, 본연구에서도 cephalosporin 감수성저하임균 (MIC 0.12 µg/ml) 중 XIII 형을가지고있는임균의비율은 75% 이었다. 따라서다른내성기전이 cefixime 내성에관여하고있을것으로생각되었다. 본연구에서 XIII 형외에도 VI, V, X, XII, XVI, XVII 및 XVIII형이관찰되었고, 그중 VI형과 XVI형은감수성균주에서만나타났다. X형은모자이크형으로 cefpodoxime 비감수성인 1균주 (MIC 1µg/mL) 에서관찰되었으며, ceftriaxone MIC 0.06 µg/ml 및 cefixime MIC 0.25 µg/ml로 CLSI 28

37 기준으로는모두감수성이었으나, EUCAST 기준으로는 cefixime 비감수성이었고, CDS 기준으로는 ceftriaxone과 cefixime에모두비감수성이었다. X 형은 NG-MAST 분석에서 ST1407, MLST 분석에서 ST1901로전세계적인 cefixime 치료실패와관련있는 clone에속하는것으로분석되었다 10-11,23. 또한모자이크 X형은일본에서처음분리된 ceftriaxone 고도내성균주 9 와유사한모자이크형으로일본은한국과지리학적으로매우가까울뿐만아니라인적교류가매우활발하다는점에서일본에발생한 ceftriaxone 내성임균이국내에유입되었을가능성이있다고보여진다. 나머지 12주의 cefpodoxime 비감수성균주는모두비모자이크형인 XIII형이었다. Cephalosporin 감수성은 pena 유전자의변이외에도여러유전자에의해영향을받을수있다. 특히, 능동적유출 (active efflux) 와관련이있는 mtrr 유전자는 promoter 또는 ORF 내변이나결손에의해항균제에대한내성을증가시킬수있다. 본연구의 cephalosporin 감수성저하균주에서 mtrr promoter 위치의 A-deletion과 T-insertion 그리고 ORF 내 39번아미노산돌연변이가보였다. A-deletion의경우 cephalosporin 감수성균주에서도흔하게나타났으며, 39번아미노산돌연변이또한관찰되었다. PBP1을생성하는 pona 유전자의 421번아미노산변이도 cephalosporin 감수성저하균주에서한주를제외하고모두관찰되었다. pona 유전자도 mtrr과마찬가지로 cephalosporin 감수성균주에서동일한변이가나타났다. PilQ는세포막에구멍을형성하는역할을하며, 이를통해항균제가세포질내로들어오게된다. 돌연변이로인하여 PilQ를통한항균제의투과가저하될경우, 내성이증가할수있다. pilq는 mtrr, pona와다르게 cephalosporin 감수성저하균주에서변이가드물게관찰되나, 감수성균주에서도감수성저하균주와같은변이가관찰되었다. Cephalosporin 감수성균주와감수성저하균주에서 mtrr, pona, pilq 29

38 돌연변이가유사하게관찰되므로 cephalosporin 내성의관계를설명하기어려웠다. pilq는한주에서이전에보고된 pilq gene Glu666Lys (pilq2) 변이 24 가발견되었으며 pona, mtrr 돌연변이또한가진다. PilQ2 균주의경우모자이크형 pena 돌연변이를가지기때문에 cefixime 감수성저하를보이는것으로생각된다. 최근들어미국에서는 cephalosporin 내성임균이출현되고확산됨에따라 cephalosporin 과 azithromycin 병합요법을사용하도록권장하고있다 년에국내에서분리된임균의 47% 가 azithromycin 에내성이었다. Azithromycin의내성기전은 ribosomal RNA 의돌연변이또는 methylation 과 ribisomal 단백의돌연변이가흔한것으로알려져있으며, 외국에서도아직 azithromycin 내성은흔하지않다 Azithromycin 내성균주의경우는 cephalosporin 항균제와의병합요법에의한상승효과가불분명하여이에대한추가연구가필요하다. 국내에서분리된임균의 NG-MAST ST은 96개로매우다양하였다. NG-MAST의 ST은 porb 유전자와 tbpb 유전자의대립유전자번호에의해결정된다. 국내에서분리된임균의 ST은 porb 의차이에의해다양한 ST을보이나, tbpb는 tbpb21 tbpb33이각각 49주와 39주로유전적연관성이있을것으로생각되었다. Cefixime과 ceftriaxone에감수성이저하된 48주또한 NG-MAST ST형이다양하여, NG-MAST ST와 cephalosporin제감수성간의직접적인상관관계는보이지않았다. 그러나, 년에분리된균주중, tbpb21을가진균주의대부분이 cephalosporin에감수성이저하되었으며, tbpb33을가진균주는감수성이높아, tbpb21과국내에서분리된임균의항균제내성간에연관성이있을것으로생각되었다. 30

39 Ⅴ. 결론 년에국내에서분리된임균은 penicillin G, tetracycline 및 quinolone에는대부분내성을보였지만, spectinomycin과 cephalosporin 에는감수성이었다. Cephalosporin 항균제에감수성이저하되었거나비감수성인균주는 48주로 32% 이었다. pena 유전형분석에서 cefixime 비감수성균주는 XIII 형이었으며, 이는국내에서가장흔한유전형으로감수성균주와비감수성균주를결정하는다른내성기전이관여하고있을것으로생각되었다. 모자이크형은 1 균주에서관찰되었으며, X형이었다. Cephalosporin 내성에관여하는것으로알려진기타유전자변이중에서, porb1b는 cephalosporin 감수성균주에서오히려흔하였으며, mtrr A-deletion과 pona 돌연변이는 cephalosporin 감수성여부에관계없이모든균주에서관찰되어감수성저하와의관계를설명하기어려웠다. 각각의유전자변이와 cephalosporin 내성간의관계에대해서는추가연구가필요할것으로생각된다. 분자역학적인분석에서는 NG-MAST tpb21과 cephalosporin 내성간에상관성을보였으며, 모자이크형을가진국내분리한주가전세계적으로 cephalosporin 치료실패와관련있는 MLST ST1901을가지며, 일본에서발생한 ceftriaxone 고도내성임균과유사한 pena 모자이크형을가지므로, N. gonorrhoeae의 cephalosporin 내성출현을모니터링하기위한지속적인감시시스템이필요하다고판단된다. 31

40 참고문헌 1. Centers for Disease Control and Prevention. Sexually transmitted diseases surveillance Lee H, Hong SG, Soe Y, Yong D, Jeong SH, Lee K, et al. Trends in antimicrobial resistance of Neisseria gonorrhoeae isolated from Korean patients from 2000 to Sex Trans Dis. 2011;38: Antimicrobial susceptibility of Neisseria gonorrhoeae isolated in Korea in Korean J Clin Microbiol. 2009;12:S Antimicrobial susceptibility of Neisseria gonorrhoeae isolated in Korea in Korean J Clin Microbiol. 2010;13:S Korea Center for Disease Control and Prevention. Management guidelines for sexually transmitted disease. December Korean Association of Urogenital Tract Infection and Inflammation. Korean guideline for sexually transmitted infections. October Yong D, Kim TS, Choi JR, Yum JH, Lee K, Chong Y et al. Epidemiological characteristics and molecular basis of fluoroquinolone-resistant Neisseria gonorrhoeae strains isolated in Korea and nearby countries. J Antimicrob Chemother. 2004;54: Ohnishi M, Saika T, Hoshina S, Iwasaku K, Nakayama S, Watanabe H, et al. Ceftriaxone-resistant Neisseria gonorrhoeae, Japan. Emerg Infect Dis. 2011;17:

41 9. Ohnishi M, Golparian D, Shimuta K, Saika T, Hoshina S, Iwasaku K, et al. Is Neisseria gonorrhoeae initiating a future era of untreatable gonorrhea?: detailed characterization of the first strain with high-level resistance to ceftriaxone. Antimicrob Agents Chemother. 2011;55: Unemo M, Golparian D, Nicholas R Ohnishi M, Gallay A, Sednaoui P. High-level cefixime- and ceftriaxone-resistant Neisseria gonorrhoeae in France: novel pena mosaic allele in a successful international clone causes treatment failure. Antimicrob Agents Chemother. 2012;56: Cámara, J, Serra J, Ayats J, Bastida T, Carnicer-Pont D, Andreu A, et al. Molecular characterization of two high-level ceftriaxone-resistant Neisseria gonorrhoeae isolates detected in Catalonia, Spain. J Antimicrob Chemother. 2012;67: Ameyama S, Onodera S, Takahata M, Minami S, Maki N, Endo K, et al. Mosaic-like structure of penicillin-binding protein 2 Gene (pena) in clinical isolates of Neisseria gonorrhoeae with reduced susceptibility to cefixime. Antimicrob Agents Chemother. 2002;46: Lindberg R, Fredlund H, Nicholas R, Unemo M. Neisseria gonorrhoeae isolates with reduced susceptibility to cefixime and ceftriaxone: association with genetic polymorphisms in pena, mtrr, porb1b, and pona. Antimicrob Agents Chemother. 2007;51: Clinical and Laboratory Standards Institute. Performance Standard for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement; 33

42 Approved Guideline. Document M100-S23. Wayne, PA; Clinical and Laboratory Standards Institute. 2013: S. M. Bell, J. N. Pham, I. W. Carter, J. K. Hanrahan. Antibiotic susceptibility testing by the CDS method. A manual for medical and veterinary laboratories Sixth Edition. The antibiotic reference laboratory;2011: EUCAST. The European Committee on Antimicrobial Susceptibility Testing - EUCAST Ito M, Deguchi T, Mizutani KS, Yasuda M, Yokoi S, Ito S et al. Emergence and spread of Neisseria gonorrhoeae clinical isolates harboring mosaic-like structure of penicillin-binding protein 2 in Central Japan. Antimicrob Agents Chemother. 2005;49: Whiley DM, Limnios EA, Ray S, Sloots TP, Tapsall JW. Diversity of pena alterations and subtypes in Neisseria gonorrhoeae strains from Sydney, Australia, that are less susceptible to ceftriaxone. Antimicrob Agents Chemother. 2007;51: Ameyama S, Onodera S, Takahata M, Minami S, Maki N, Endo K, et al. Mosaic-like structure of penicillin-binding protein 2 Gene (pena) in clinical isolates of Neisseria gonorrhoeae with reduced susceptibility to cefixime. Antimicrob Agents Chemother. 2002;46: Kam KM, Lo KK, Ho NK, Cheung MM. Rapid decline in penicillinase-producing Neisseria gonorrhoeae in Hong Kong associated with emerging 4-fluoloquinolone resistance. Genitourin Med. 1995;71:

43 21. Shu-ichi N, Chanwit T, Sasiprapa P, Ken S, Somporn S, Magnus U et al. Molecular analyses of TEM genes and their corresponding penicillinase-producing Neisseria gonorrhoeae isolates in Bangkok, Thailand. Antimicrob Agents Chemother. 2012;56: Tapsall J, Read P, Carmody C, Bourne C, Ray S, Limnios A, et al. Two cases of failed ceftriaxone treatment in pharyngeal gonorrhoea verified by molecular microbiological methods. J Med Microbiol. 2009;58: Allen VG, Mitterni L, Seah C, Rebbapragada A, Martin IE, Lee C, et al. Neisseria gonorrhoeae treatment failure and susceptibility to cefixime in Toronto, Canada. JAMA. 2013;309: Zhao S, Tobiason DM, Hu M, Seifert HS, Nicholas RA. The penc mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises from a mutation in the PilQ secretin that interferes with multimer stability. Mol Microbiol. 2005;57: Singh AE, Gratrix J, Read R, Lovgren M, Drews SJ, Romanowski B et al. Neisseria gonorrhoeae multiantigen sequence typing is beneficial in further characterizing gonococcal populations in Alberta, Canada. Sex Transm Dis. 2013;40: Shimuta K, Unemo M, Nakayama S, Morita-Ishihara T, Dorin M, Kawahata T et all. Antimicrobial resistance and molecular typing of Neisseria gonorrhoeae isolates in Kyoto and Osaka, Japan, 2010 to 2012: intensified surveillance after identification of the first strain (H041) with high-level 35

44 ceftriaxone resistance. Antimicrob Agents Chemother. 2013;57: Kirkcaldy RD, Zaidi A, Hook EW. Neisseria gonorrhoeae antimicrobial resistance among men who have sex with men and men who have sex exclusively with women: the Gonococcal Isolate Surveillance Project, Ann Intern Med. 2013;158:

45 Abstract Antimicrobial resistance and molecular epidemiologic characteristics of Neisseria gonorrhoeae isolated from Korea Hyo-Jin Kim Department of Medical science The Graduate School, Yonsei University (Directed by Professor Kyungwon Lee) The recent emergence and spread of multi-drug resistant N. gonorrhoeae make the use of cephalosporins more popular, and increased selective pressure may be a cause of decreased susceptibility to cephalosporins in N. gonorrhoeae. In Korea, the rate of patients who were treated with cephalosporins in gonococcal infections also increased from 10% in 2002 to 30% in 2010, and monitoring for cephalosporin resistance in N. gonorrhoeae may be needed. In this study, we evaluated the antimicrobial resistance and molecular epidemiology of N. gonorrhoeae recently isolated from Korea. A total of 151 N. gonorrhoeae were collected from clinical samples from sexually transmitted disease clinics and public health centers during Antimicrobial susceptibility was determined by CLSI agar dilution method. The rates of resistance to penicillin G, tetracycline and ciprofloxacin were 34%, 51% and 93%, respectively. However, resistance rate to azithromycin was as low as 5% and all 151 isolates were susceptible to spectinomycin. All isolates were susceptible to cefixime and ceftriaxone, except one of cefixime non-susceptible isolate. PenA, mtrr, pona and pilq genes were sequenced to determine the resistant mechanism of cephalosporin in 29 cephalosporin-susceptible N. gonorrhoeae isolates and 44 isolates of with decreased susceptibility to cephalosporin. A total 37

46 of eight pena genotypes were found, and most common genotype was type XIII, and one cefixime non-susceptible isolate also had it. Types IV and XVI were only noted in cefixime-susceptible isolates. Mutations of mtrr, pona, and pilq genes were found in both cephalosporin-susceptible and less-susceptible isolates, suggesting that mutations in these genes were not associated with cephalosporin resistance. N. gonorrhoeae multi-antigen sequence typing (NG-MAST) was performed to determine genetic relatedness. Although N. gonorrhoeae isolated from Korea had various sequence type (ST) due to difference in porb allele, tbpb showed genetic relatedness because of 49 and 39 isolates belonged to tbpb21 and tbpb33, respectively. Most isolates belonged to tbpb21, tbpb110 and tbpb620 showed decreased susceptibility to cephalosporins, but tbp33 showed cephalosporin susceptibility. In conclusion, most of isolates are susceptible to cephalosporins in Korea. However, the emergence of cefixime non-susceptible isolate with pena X mosaicism and the prevalence of isolates with the tbpb110 allele belonging to ST1407, which cause cefixime and ceftriaxone treatment failure in successful global clones of N. gonorrhoeae, call for a continuous nationwide antimicrobial surveillance program in order to monitor the emergence of cephalosporin resistance in N. gonorrhoeae Key words: Neisseria gonorrhoeae, pena, mtrr, pona, pilq, mosaic, tbpb, cephalosporin, reduced susceptibility 38