Microsoft PowerPoint - 김진수단장(IBS)자료
|
|
- 원용 설
- 7 years ago
- Views:
Transcription
1 CRISPR 유전자가위로세상을바꾼다 김진수서울대학교화학부기초과학연구원유전체교정연구단 1
2 유전적다양성 유전자의차이가개체의차이를대부분설명함 유전자에따라질병에대한감수성이달라짐 2
3 유전질환 : Genetic Disorders 혈우병, 겸상적혈구증등 10,000 종이있음 전체신생아의 1% 가유전질환자임 소아과진료의 40% 에해당 대부분완치불가능 돌연변이유전자를다음세대에물려줌 3
4 정상적혈구와낫모양적혈구 흑인 500 명중한명비율로발생하는빈혈증 단일염기변이로인해헤모글로빈아미노산한개가바뀜 낫모양적혈구형성, 기능상실 4
5 유전체교정 : Genome Editing 유전자가위를사용해세포내유전자 DNA를절단함 절단된 DNA가수선되는과정에서변이가발생함 유전질환, 암, 감염성질환의치료법으로개발되고있음 가축, 농작물, 어류, 곤충등에널리활용됨 5
6 유전자가위 : Programmable Nuclease CRISPR/Cas-derived RNA-guided endonuclease (RGEN)
7 Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99% ~90% Average mutation <10% ~20% ~20% rate Length of target site 20 to 36 bp 30 to 40 bp 23 bp Restriction in target site Guanine-rich Start with T and end with A End with GG (PAM) Design density One per ~100 bp One per every bp One per 8 bp Off-target effects High Low Variable Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + grna Kim H & Kim JS, Nat. Rev. Genet. (2014) 7
8 CRISPR RNA-Guided ENdonuclease 8
9 Thomson Reuters Hot Papers 9
10 Double-Strand Break Repair Gene-targeting efficiency is boosted drastically by DSBs. Kim H & Kim JS, Nat. Rev. Genet. (2014) DSBs also induce NHEJ, an error-prone DSB repair system. 10
11 What Is Genome Editing? Targeted gene knockout and knock-in Single base change, gene correction, gene addition, gene disruption, etc. Targeted chromosomal rearrangements: large deletion, inversion, translocation
12 CRISPR: Adaptive Immune System in Bacteria Clusters of Regularly Interspaced Palindromic Repeats CRISPR-Cas9: RNA-guided programmable nucleases 12
13 RNA-Guided ENdonuclease (RGEN) Cas9 Guide RNA GG GG
14 Plasmid-free Gene Knockout in Human Cells Purified Cas9 protein: Guide RNA : CCR5 Indels (%) : CAATCTATGACATCAATTATTATA-CATCGGAGCCCTGCCAAAAAATCAA WT CAATCTATGACATCAATTATTATAACATCGGAGCCCTGCCAAAAAATCAA +1 CAATCTATGACATCAATTATTAT GCCAAAAAATCAA -13 CAATCTATGACATC GGAGCCCTGCCAAAAAATCAA -14 CAATCTATGACAT GCCCTGCCAAAAAATCAA -18 CAATCTATGACATCAATTATTAT AAATCAA -19 CAATCTATGACATC CAAAAAATCAA -24 CAATCTATGACA AAATCAA -30 Purified Cas9 protein and in vitro transcribed sgrna are used. Mutation frequencies range from 1% to 98%.
15 Gene/cell therapy targeting CCR5 CCR5 is an essential co-receptor of HIV infection. CCR5 32 deletion leads to resistance to HIV infection. Homozygote CCR5 32 carriers are healthy (1% of Caucasian) 15
16 16
17 T cells from HIV+ patients are treated with a programmable nuclease. CCR5-inactive T cells are delivered back to patients 17
18 혈우병 : The Royal Disease Queen Victoria ( ) Queen Victoria and her royal family British Queen Victoria was a carrier of the hemophilia gene. Almost half of the severe form of hemophilia A is caused by DNA inversion. 18
19 F8 유전자 일반인 F8 유전 자 혈우병환자 유전자가위 F8 유전 자 F8 유전자 유전자복구 ( 치료 ) 19
20 (A) Chromosomal Flip-Flop in Human ips Cells Homolog 1 Inverted clones Reverted clones Pa WT #1 #2 #1 #2 #3 #3 Factor VIII WT Inv 1 Inv 2 Rev 1 Rev 2 Rev 3 Homolog 2 FOXA2 Inversion 1 Sox17 Inversion 2 GAPDH Prof. Dong Wook Kim at Yonsei Univ. A TALEN was used to create F8 gene-inverted clones and to revert them. 20
21 줄기세포와유전자교정 검출 환자체세포 세포역분화 환자유래분화만능줄기세포 유전병환자 유전자가위 이식 세포분화 유전자교정된줄기세포 분화된세포 21
22 Targeted gene knockout in mice Prof. Han-Woong Lee at Yonsei Univ. RNA transcripts encoding ZFNs/TALENs were injected into the embryos. 49 to 77% of F0 contained mutations.
23 Naturally-occurring MSTN KO animals Myostatin inhibits muscle differentiation and growth. Animals lacking myostatin have extensive muscles.
24 MSTN KO Pigs Created Using TALENs No naturally-occurring MSTN -/- pigs have been found. MSTN KO pigs may be exempted from GMO regulation. 24
25 Bananageddon and Banana Save Project Banana is infected by a fungus. Gros Michel is an old banana variety extinct in 1950 s. Cavendish banana will be extinct in 10~20 years. Genome editing can be used to make banana resistant to the fungus.
26 CRISPR Revolution Biomedical research Drug target discovery Gene and cell therapy Plant biotechnology Animal biotechnology 26
27 유전체교정기술과맞춤형아기 가타카 (1997): 미국 SF 영화 인간생식세포유전자교정 유전자강화된맞춤형아기 유전체교정기술개발로실현가능성대두 일부과학자들, 모라토리움요청 27
28 Center Genome for Engineering Genome Center Engineering Human Genome KO Stem Cell Group Animal Research Group Pig genome engineering Core Group Plant Research Group Plant genetics Plant biotechnology Cell Therapy Group Therapeutics 28
29 Acknowledgments Dr. Seokjoong Kim, ToolGen, Inc. Dr. Eunji Kim, ToolGen, Inc. Prof. Cheol-Hee Kim, Chungnam Nat. Univ. Prof. Dong Wook Kim, Yonsei Univ. Prof. Han-Woong Lee, Yonsei Univ. Prof. Narry Kim, Seoul National Unv. Prof. Xi Jun Yin, Yanbian Univ. Prof. Hyongbum Kim, Hanyang Univ. Prof. Emery Bresnick, Univ. of Wisconsin Prof. Jae Jung, Univ. of Southern California Home page:
01 08 01 유전자가위 기술 소개 및 활용 유전자가위 기술은 2011년과 2013년에 각각 권위 있는 학술지 Nature methods와 기초과학연구원, 유전체교정연구단 김은지, 김진수 Science에 의해 올해의 실험기법(Method of the Year), 올해
06 01 02 03 밀, 쌀, 옥수수 다음으로 많이 소비되는 식량은 바나나입니다. 다른 농산물과는 달리 식용바나나는 씨가 없어 꺾꽂이 방식으로 재배하고 있기 때문에 세계적으로 같은 품종의 바나나가 재배되어 소비되고 있습니다. 그러나 현재 전 세계 바나나 수출 비중의 약 96%를 차지하는 품종인 캐번디시(Cavendish) 품종이 치명적인 곰팡이균에 감염되어
More information미래의학 - 맞춤형의학 유전자가위
미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health
More informationsirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing( 게놈편집 ) 을이용하면특정유전자의기능을완전히 knock-
Cover title Subhead GeneArt CRISPR GeneArt Precision TALENs 게놈편집이펼치는과학원더랜드 만화로만나는게놈편집의원리 sirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing(
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationPowerPoint Presentation
유전자가위와우리의미래 송기원 연세대학교생화학과 CELL CYCLE & BIOPLASMA LAB 1 2018 년 11 월, 국제인류유전자편집회의 가타카 - Novel Brave New World in 1931 by Aldous Huxley - Movie in 1997 by Andrew Niccol 3 쥬라기공원 - novel in 1990 by Michael
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information융합WEEKTIP data_up
2016 DECEMBER vol.51 51 융합 유전자 편집기술 안주명 융합연구정책센터 발행일 2016. 12. 26. 발행처 융합정책연구센터 융합 2016 DECEMBER vol.51 유전자 편집기술 안주명 융합연구정책센터 선정 배경 생명공학기술은 미생물을 이용한 유전자 재조합(Recombination)을 통한 형질전환을 기반으로 발전해 왔다고 해도 과언이
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<313120C0AFC0FCC0DA5FBECBB0EDB8AEC1F2C0BB5FC0CCBFEBC7D15FB1E8C0BAC5C25FBCF6C1A42E687770>
한국지능시스템학회 논문지 2010, Vol. 20, No. 3, pp. 375-379 유전자 알고리즘을 이용한 강인한 Support vector machine 설계 Design of Robust Support Vector Machine Using Genetic Algorithm 이희성 홍성준 이병윤 김은태 * Heesung Lee, Sungjun Hong,
More informationInvitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit
Invitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit 이봐, 난 CRISPR 인데 나를 한번 단백질 형태로 세포에 넣어볼래? 교수님께서 게놈 편집이 어려운 ips
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More informationDBPIA-NURIMEDIA
논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate
More informationBreathing problems Pa t i e n t: I have been having some breathing problems lately. I always seem to be out of breath no matter what I am d o i n g. ( Nurse : How long have you been experiencing this problem?
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More information공급 에는 권역에 두개의 프라임 오피스가 준공 되었다. 청진구역 2,3지구에는 광화문 D타워가 준공되어 대림에서 약 50%를 사용하며 나머지 50%는 임대마케팅을 진행 중이다. 메트로타워는 GS건설의 사옥에서 매각 이후 2013년 4분기에 리모델링을 시작하여, 에 완공
Savills World Research 브리핑 서울 프라임 오피스 사진 :, Seoul 개요 여의도와 도심의 높은 공실률에도 불구하고 향후 공실 감소 기대와 낮은 이자율, 우량물건이 뒷받침되어 서울 오피스 시장은 국내외 투자자들의 지속적인 관심을 받고 있다. 신규공급으로 의 공실률은 증가하였고 GBD와 YBD의 공실률은 감소하였다. 공실률이 증가한 에서 임차인
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information歯MW-1000AP_Manual_Kor_HJS.PDF
Page 2 Page 3 Page 4 Page 5 Page 6 Page 7 Page 8 Page 9 Page 10 Page 11 Page 12 Page 13 Page 14 Page 15 Page 16 Page 17 Page 18 Page 19 Page 20 Page 21 Page 22 Page 23 Page 24 Page 25 Page 26 Page 27 Page
More information30이지은.hwp
VR의 가상광고에 나타난 그래픽영상 연구 -TV 스포츠 방송을 중심으로- A study of the graphic image that is presented in Virtual Advertising of VR(Virtual Reality) - Focused on TV Sports broadcasts - 이지은(Lee, ji eun) 조일산업(주) 디자인 실장
More informationFMX M JPG 15MB 320x240 30fps, 160Kbps 11MB View operation,, seek seek Random Access Average Read Sequential Read 12 FMX () 2
FMX FMX 20062 () wwwexellencom sales@exellencom () 1 FMX 1 11 5M JPG 15MB 320x240 30fps, 160Kbps 11MB View operation,, seek seek Random Access Average Read Sequential Read 12 FMX () 2 FMX FMX D E (one
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationMicrosoft PowerPoint - ch03ysk2012.ppt [호환 모드]
전자회로 Ch3 iode Models and Circuits 김영석 충북대학교전자정보대학 2012.3.1 Email: kimys@cbu.ac.kr k Ch3-1 Ch3 iode Models and Circuits 3.1 Ideal iode 3.2 PN Junction as a iode 3.4 Large Signal and Small-Signal Operation
More informationÀå¾Ö¿Í°í¿ë ³»Áö
Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>
Outline 2012. 1. 30 CS4HS 생물정보학 생물정보학및암정보의학 맟춤의학과생물정보학 김선 서울대학교컴퓨터공학부생물정보연구소생물정보학협동과정 유전체학, 후생유전체학을이용한암연구와맟춤의학 1 2 Central Dogma in Biology PART1. 생물정보학 http://en.wikipedia.org/wiki/central_dogma_of_molecular_biology
More informationhttp://www.kbc.go.kr/ Abstract Competition and Concentration in the Market for the Multichannel Video Programming G h e e - Young Noh ( P r o f e s s o, rschool of Communication,
More information[ReadyToCameral]RUF¹öÆÛ(CSTA02-29).hwp
RUF * (A Simple and Efficient Antialiasing Method with the RUF buffer) (, Byung-Uck Kim) (Yonsei Univ. Depth of Computer Science) (, Woo-Chan Park) (Yonsei Univ. Depth of Computer Science) (, Sung-Bong
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More information006- 5¿ùc03ÖÁ¾T300çÃâ
264 266 268 274 275 277 279 281 282 288 290 293 294 296 297 298 299 302 303 308 311 5 312 314 315 317 319 321 322 324 326 328 329 330 331 332 334 336 337 340 342 344 347 348 350 351 354 356 _ May 1 264
More information사용시 기본적인 주의사항 경고 : 전기 기구를 사용할 때는 다음의 기본적인 주의 사항을 반드시 유의하여야 합니다..제품을 사용하기 전에 반드시 사용법을 정독하십시오. 2.물과 가까운 곳, 욕실이나 부엌 그리고 수영장 같은 곳에서 제품을 사용하지 마십시오. 3.이 제품은
OPERATING INSTRUCTIONS OPERATING INSTRUCTIONS 사용자설명서 TourBus 0 & TourBus 5 사용시 기본적인 주의사항 경고 : 전기 기구를 사용할 때는 다음의 기본적인 주의 사항을 반드시 유의하여야 합니다..제품을 사용하기 전에 반드시 사용법을 정독하십시오. 2.물과 가까운 곳, 욕실이나 부엌 그리고 수영장 같은 곳에서
More informationGenome engineering 을통한지능형인공미생물개발. 울산과학기술대학교 이성국교수 최근몇년간미국의 CNN 1, 영국의 BBC 2 와국영방송 3 등여러권위있는미디어매체를통해합성생물학의잠재성이보도되었다. 현재가장뜨거운관심이모아지고있는분야인합성생물학은기존몇개의유전자를
Genome engineering 을통한지능형인공미생물개발. 울산과학기술대학교 이성국교수 최근몇년간미국의 CNN 1, 영국의 BBC 2 와국영방송 3 등여러권위있는미디어매체를통해합성생물학의잠재성이보도되었다. 현재가장뜨거운관심이모아지고있는분야인합성생물학은기존몇개의유전자를대상으로하는유전공학적실험방법이나기술들에국한된것이아닌, 특정유전체의전반적인이해를바탕으로한다.
More information4 5 6 7 8 9 10 11 12 13 14 15 조 희 영 선 생 님 고 맙 습 니 다 16 17 18 19 가정간호 장선미 간호사님 감사합니다 20 21 22 23 24 25 U l 26 27 p SEOUL MEDICAL CENTER NEWS 28 29 30 31 32 33 34 35 36 37 홍보실장이란 신동규 원고를 기다립니다
More informationBSC Discussion 1
Copyright 2006 by Human Consulting Group INC. All Rights Reserved. No Part of This Publication May Be Reproduced, Stored in a Retrieval System, or Transmitted in Any Form or by Any Means Electronic, Mechanical,
More information02이용배(239~253)ok
A study on the characteristic of land use in subcenter of Seoul. - Cases of Yeongdeungpo and Kangnam Ok Kyung Yuh* Yong-Bae Lee**,. 2010,,..,.,,,,.,,.,,.,,,, Abstract : This study analyzed the land use
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information........pdf 16..
Abstract Prospects of and Tasks Involving the Policy of Revitalization of Traditional Korean Performing Arts Yong-Shik, Lee National Center for Korean Traditional Performing Arts In the 21st century, the
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information»ï°¢½£ 46È£_¿Ï
서울여자대학교 총동창회 소식 제46호 대학이념 지(지적교육) 덕(도의실천교육) 술(기술교육) 교육목표 전문인의 양성 기독교 정신함양 실천인의 육성 발행인:김태련 발행처:서울여자대학교 총동창회 서울 노원구 공릉동 126번지 전화:970-5342, 974-2450 팩스:970-5348 Home Page : www.swu.ac.kr/cybera/m1.htm 동문은
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information<4D F736F F F696E74202D20332DB5B9BFACBAAFC0CC2DB0A8BCF6BAD0BFAD2DBFB0BBF6C3BCC0CCBBF3205BC8A3C8AF20B8F0B5E55D>
주제 3. 유전자돌연변이, 감수분열, 염색체이상 생명과학 10 장중간부분 생명과학 8 장뒷부분 유전체의 DNA 염기서열해독이끝난생물체와유전체크기, 유전자수 1 1. 돌연변이에의해유전정보가달라질수있다 돌연변이 (mutation) 란 DNA 의염기서열에변화가일어난것이다 돌연변이는 염색체상의넓은부위나 한개의뉴클레오티드에만생길수도있다 사람의경우, 생식세포 ( 정자,
More information5. .......hwp
X i D i ) 8 6 4 2 0-2 -4 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 12 8 4 0-4 -8 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 45 40 35 30 25 20 15 1987 19 90 1994 1998 2002 year ln W X 30
More informationÁ¶´öÈñ_0304_final.hwp
제조 중소기업의 고용창출 성과 및 과제 조덕희 양현봉 우리 경제에서 일자리 창출은 가장 중요한 정책과제입니다. 근래 들어 우리 사회에서 점차 심각성을 더해 가고 있는 청년 실업 문제에 대처하고, 사회적 소득 양극화 문제에 대응하기 위해서도 일자리 창 출은 무엇보다도 중요한 정책과제일 것입니다. 고용창출에서는 중소기업의 역할이 대기업보다 크다는 것이 일반적
More information03±èÀçÈÖ¾ÈÁ¤ÅÂ
x x x x Abstract The Advertising Effects of PPL in TV Dramas - Identificaiton by Implicit Memory-based Measures Kim, Jae - hwi(associate professor, Dept. of psychology, Chung-Ang University) Ahn,
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information공급 에는 3권역 내에 준공된 프라임 오피스가 없었다. 4분기에는 3개동의 프라임 오피스가 신규로 준공 될 예정이다.(사옥1개동, 임대용 오피스 2개동) 수요와 공실률 2014년 10월 한국은행이 발표한 자료에 따르면 한국의 2014년 경제성장률 예측치는 3.5%로 지
Savills World Research 브리핑 서울 프라임 오피스 사진 : Yeouido, Seoul 개요 삼성SDS가 지난 2분기 준공한 잠실 사옥 주변으로의 이전을 지속하고 증권업계의 임차면적 감소가 계속되어 GBD와 YBD 의 수요는 감소하였고 에서는 소폭의 수요 증가가 나타났다. 의 수요 회복에도 불구하고 GBD, YBD의 수요 감소로 서울프라임오피스의
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
More information27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationVol.259 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2018.01 Vol.259 C O N T E N T S 02 06 28 61 69 99 104 120 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2018.1 3 4 2018.1 1) 2) 6 2018.1 3) 4) 7 5) 6) 7) 8) 8 2018.1 9 10 2018.1 11 2003.08 2005.08
More information<B1B9BEC7BFF8B3EDB9AEC1FD5FC1A63234C1FD5FBFCF2E687770>
발 간 사 국악학 기초연구 활성화의 장을 마련하기 위한 국악원논문집 은 1989년 제1집을 시작으로 2004년 제16집까지 연1회 발간하였고, 잠시 중단되었던 학술지는 2008년 제17집부터 발간횟수를 연간 2회로 늘려 재발간하고 있습니다. 국악원논문집 은 공모를 통해 원고를 모집하고 편집회의를 통한 1차 심사, 분야별 전문가로 구성된 심사위원의 2차 심사를
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information시안
ULSAN NATIONAL INSTITUTE OF SCIENCE AND TECHNOLOGY GRADUATE SCHOOL OF TECHNOLOGY & INNOVATION MANAGEMENT 울산과학기술원 기술경영전문대학원 http://mot.unist.ac.kr 02 03 Global Study Mission CURRICULUM 2 Practicality Global
More information<32303132C7D0B3E2B5B520C0DABFACB0E8BFAD20B8F0C0C7C0FBBCBAB0EDBBE72020B9AEC1A62E687770>
언어이해력 1. 단어의 구조가 보기와 다른 것은? 4. 다음의 빈칸에 들어갈 적당한 말은? 선풍기 : 바람 = ( ) : ( ) 보리밥 은 재료+대상 의 의미 구조를 지 닌다. 따라서 보리로 만든 밥 이라는 뜻이 다. 1 발전소 : 전기 3 세탁기 : 옷 2 인쇄기 : 종이 4 자동차 : 기름 1 밀짚모자 2 유리창 3 꽃집 4 비단옷 2. 다음의 낱말 이어가기에서
More information歯채민병.PDF
Patient number Sex Age Animal contact 1 F 36 No 2 F 31 Cat scratch Result of biopsy/aspiration cytology of lymph nodes Chronic granulomatous inflammation with caseation necrosis, compatible with tuberculous
More information개정판 서문 Prologue 21세기 한국경제를 이끌어갈 후배들에게 드립니다 1부 인생의 목표로써 CEO라는 비전을 확고히 하자 2부 인생의 비전을 장기 전략으로 구체화하라 1장 미래 경영환경 이해하기 20p 4장 장기 실행 전략 수립하기 108p 1) 미래 환경분석이
휴넷 조영탁 대표가 제시하는 차세대 비즈니스 리더가 되는 길 개정판 글 _ 조영탁 21세기 국가경쟁력은 세계 최고 수준의 경영자가 얼마나 배출되느냐에 달려있다. 10년 후에는 우리나라에도 100억원의 연봉을 받는 CEO가 다수 등장할 것이다. 이들은 기업의 성공과 국가경쟁력을 이끌어가는 초엘리트 그룹을 형성 할 것이다. 그러나 아무나 100억 연봉 CEO 대열에
More information1030 ¿©¼º»ý¸í12³â»ç ¼öÁ¤
Contents 4 30 31 36 48 52 66 권두언 여성생명과학기술포럼 설립 12주년을 기념하며 이경림 회장 이화여자대학교 약학대학 창립되고 열 두 해가 되어 발전사를 준비하면서 그간 포럼의 역사 를 돌이켜 볼 때, 본인은 2013년도 제9대 회장으로서 남다른 감회 를 느끼게 됩니다. 어느덧 명실상부한 여성과학인 대표 단체로서 2001년 여성생명과학기술포럼(Women
More informationINDUS-8.HWP
i iii iv v vi vii viii ix x xi 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64
More informationCONTENTS.HWP
i ii iii iv v vi vii viii ix x xi - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 -
More information- i - - ii - - i - - ii - - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - - x - - xi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 -
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information이용석 박환용 - 베이비부머의 특성에 따른 주택유형 선택 변화 연구.hwp
住居環境 韓國住居環境學會誌 第 11 卷 1 號 ( 通卷第 20 號 ) pp. 159~172 투고 ( 접수 ) 일 : 2013.02.28. 게재확정일자 : 2013.04.04. The change of housing choice by characteristics of the Baby Boomers Lee, Yong-Seok Park, Hwan-Yong Abstract
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information¹Ìµå¹Ì3Â÷Àμâ
MIDME LOGISTICS Trusted Solutions for 02 CEO MESSAGE MIDME LOGISTICS CO., LTD. 01 Ceo Message We, MIDME LOGISTICS CO., LTD. has established to create aduance logistics service. Try to give confidence to
More informationStage 2 First Phonics
ORT Stage 2 First Phonics The Big Egg What could the big egg be? What are the characters doing? What do you think the story will be about? (큰 달걀은 무엇일까요? 등장인물들은 지금 무엇을 하고 있는 걸까요? 책은 어떤 내용일 것 같나요?) 대해 칭찬해
More information분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김
목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...4 3. 자본금 변동사항...7 4. 주식의 총수 등...9 5. 의결권 현황...10 6. 배당에 관한 사항 등...10 II. 사업의 내용...12 III. 재무에 관한 사항...30 IV. 감사인의 감사의견 등...34 V. 이사의
More informationNo BiolNdustry No. 107 (2016-8) 글로벌 CRISPR 시장현황및전망
No.107 2016-8 BiolNdustry No. 107 (2016-8) 글로벌 CRISPR 시장현황및전망 2016. 8 1 BioINdustry 글로벌 CRISPR 시장현황및전망 생명공학정책연구센터연구원김민정 / 책임연구원김무웅 본보고서의내용은 Occams Business Research & Consulting Pvt. Ltd 에서발간한 Global CRISPR
More informationChapter 11
Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,
More informationOP_Journalism
1 non-linear consumption 2 Whatever will change television will do so by re-defining the core product not just the tools we use to consume it. by Horace Dediu, Asymco 3 re-defining the core product not
More information06-구인회
29(2), 2009, 126-150 Health and Social Welfare Review,,,. (contributory benefit programs)...,..,., :, 2008). * :, (inhoeku@snu.ac.kr) 126 20. 1987 2 2007 642, 20 3. 1990 2008 563,210. 2008 429,850. 1995
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information보안과제 ( ), 일반과제 ( ) 과제번호 SB010 유전자적중및핵이식에의한레쉬 - 니한증후군질환모델복제돼지의생산 레쉬 - 니한증후군질환모델 HPRT1 유전자적중복제돼지의생산 비외과적수정란이식에의한복제돼지생산기술개발
보안과제 ( ), 일반과제 ( ) 과제번호 108080-03-3-SB010 유전자적중및핵이식에의한레쉬 - 니한증후군질환모델복제돼지의생산 레쉬 - 니한증후군질환모델 HPRT1 유전자적중복제돼지의생산 비외과적수정란이식에의한복제돼지생산기술개발 농림수산식품부장관귀하 이보고서를 유전자적중및핵이식에의한레쉬 - 니한증후군질환모델복제돼지의생 산 ( 세부과제 레쉬 - 니한증후군질환모델
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information248019_ALIS0052.hwp
Generation history for optimization eneration history of optimization 불평형질량 편심량 회전수 축외경 축내경 축길이 베어링간격위치 베어링강성 교배 대상이되는개체의수 집단의크기 돌연변이 대상이되는유전자수 집단내전체유전자수 와 와 Generation history
More informationMay 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr
May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the
More information김기남_ATDC2016_160620_[키노트].key
metatron Enterprise Big Data SKT Metatron/Big Data Big Data Big Data... metatron Ready to Enterprise Big Data Big Data Big Data Big Data?? Data Raw. CRM SCM MES TCO Data & Store & Processing Computational
More informationMicrosoft Word - retail_131122.doc
Analyst 유주연 (639-4584) juyeon.yu@meritz.co.kr RA 박지은 (639-451) jeeeun.park@meritz.co.kr 213.11.22 유통업 Overweight 1월 매출동향: 대형마트 -6.4%, 백화점 -2.2% Top Pick 하이마트 (7184) Buy, TP 15,원 현대홈쇼핑 (575) Buy, TP 21,원
More informationInterview OT&C 김은우 대표 를 제공하고 있습니다. 그것이 가능하려면 복잡한 시스템 이 필요한데요, 저희와 같은 회사들이 그 일을 담당하고 있습니다. Q 아마도 많은 업력이 있으실 것 같은데요. 독자들이 아~! 거기! 하고 쉽게 생각할 수 있도록 어떤 도서관
한 권의 책 그대에게 목숨을 걸만한 벗이 있는가? 지식과 지혜 KNOW EDGE & WISDOM 통찰력 INSIGHT 키우는 프리미엄 매거진 Book Zip 은 최신 해외 경영서를 핵심만 요약한 정보, 국내 신간 서적에 대한 간략한 핵심 정보, 글로벌 시대의 주요 트렌드와 미래 뉴스를 집약하여 제공하는 격주간 발행 지식 정보 매거진입니다. Book Zip을
More information