DBPIA-NURIMEDIA
|
|
- 성언 환
- 6 years ago
- Views:
Transcription
1 Korean Society for Biotechnology and Bioengineering Journal 32(1): 9-15 (2017) ISSN / eissn Research Paper HaCaT 세포주에서캐모마일 (Matricaria chamomilla) 추출물의항병원성및항염효과에관한연구 임은경 1, 김근태 1, 김보민 1, 김은지 1, 김상용 2, 한남규 3, 하재순 3, 김영민 1 * Study of Anti-microbial Activities and Anti-inflammatory Effects of Chamomile (Matricaria chamomilla) Extracts in HaCaT cells Eun Gyeong Lim 1, Guen Tae Kim 1, Bo Min Kim 1, Eun Ji Kim 1, Sang-Yong Kim 2, Nam Kyu Han 3, Jae Sun Ha 3, and Young Min Kim 1 * Received: 2 January 2017 / Revised: 31 January 2017 / Accepted: 2 February The Korean Society for Biotechnology and Bioengineering Abstract: Chamomile (Matricaria chamomilla), a member of the Asteraceae family, is a well-known for medicinal plant and can be found in India and Europe. Chamomile is an effective sedative and various medical effects. But, the effects of acne treatment by chamomile were not investigated. Therefore, we assessed the anti-oxidant effects, anti-microbial activity and anti-inflammatory effects by chamomile extracts in HaCaT keratinocyte cells. Anti-oxidant effects of chamomile extracts were investigated by DPPH assay. Also, results of MTT assay was demonstrated that chamomile extracts did not have a cytotoxic effect in HaCaT cells. To assess the antimicrobial activity, we determined formation of inhibition zone of Propionibacterium acnes by extracts from chamomile. Tumor necrosis factor-α (TNF-α) induces production of inflammatory cytokines such as interleukin-1β (IL-1β), IL-6 and IL- 8 and expression of COX-2. Chamomile extracts could inhibit 1 한남대학교생명나노과학대학생명시스템과학과 1 Department of Biological Sciences and Biotechnology, College of Life Science and Nano Technology, Hannam University, Daejeon 34054, Korea Tel: , Fax : kym@hnu.kr 2 신안산대학교식품생명과학과 2 Department of Food Science & Bio Technology, Shinansan University, Ansan, Korea 3 닥터하스킨주식회사 3 Dr. HASKIN Co., Ltd., Korea TNF-α-induced mrna expression levels of IL-1β, IL-6, IL-8 and COX-2 gene. These results demonstrated the possibility of chamomile for prevention and treatment of skin inflammatory diseases such as acne. Keywords: Chamomile, Anti-microbial activity, Anti-inflammatory effects, P.acnes, HaCaT cells 1. INTRODUCTION 여드름은피지선주변에서발생하는만성염증질환으로면포, 구진, 농포, 낭종, 결절등의다양한병변을동반하며, 잘못된관리시흉터등의후유증을남긴다 [1]. 여드름의발생에는복합적인요인이작용하는것으로알려져있으며, 일반적으로피지선에서의과도한피지분비, 호르몬불균형, 유전, 비정상적인모낭내각화현상및 Propionibacterium acnes 의증식에의한염증반응등에의하여발생한다 [2]. 여드름은주로사춘기청소년층에서관찰되지만최근육식위주의식습관변화와환경호르몬등에의하여 25 세이상의청년층에서나타나는성인여드름이증가하는추세다 [3]. 일반적인여드름치료법은국소요법과전신요법으로나뉘며국소요법으로는 erythromycin, clindamycin 을포함한국소항생제와벤조일과산화물 (Benzoyl peroxide), tretinoin, adapalene 등의국소레티노이드제와레이저치료, 압출등의방법이있으며, 전신요법으로는호르몬제 ( 경구피임제, spironolactone) 등이있다 [1,3]. 하지만이러한방법들은피부자극이심하고항생
2 10 Korean Society for Biotechnology and Bioengineering Journal 32(1): 9-15 (2017) 제및스테로이드제에대한내성및부작용등의문제점이발생하기때문에최근에는피부에자극이적고안전한천연추출물유래여드름치료물질개발에대한관심이높아지는추세이다 [3]. 실제로최근소비자들의소비추세가자연지향적이고환경친화적으로변해감에따라화장품에들어가는유효성분도화학물질보다는식물유래의천연물을선호하고있으며, 천연물의유용성을기반으로하여여러가지형태로화장품에배합되어사용되고있다 [4,5]. 캐모마일 (Matricaria chamomilla) 은인도와유럽이원산지인국화과다년생식물로황색의꽃이피는다이어즈캐모마일과백색의꽃이피는로만캐모마일로나뉜다 [6]. 캐모마일은피부살균효과가있어서유럽에서는미용을위한목욕제로쓰이며, 감기예방, 불면증해소등의효과가알려져있기때문에주로차로음용되어왔다 [6]. 캐모마일의꽃에는 terpenes, flavonoids, coumarin, calicacid 등의성분이함유되어있으며, 꽃을증류추출하여얻은에션셜오일은푸른빛을띠고 α-bisabolol, chamazulene, bisabolol oxide 등의성분이포함되어있어염증을가라앉히는데효과적이다 [6-8]. 또한캐모마일은진정작용, 항당뇨효과, 항관절염효과등의다양한약물효능이있는것으로보고되었다 [9-11]. 하지만아직까지여드름과같은특정피부염증질환에대한캐모마일의과학적효능에대한연구는미미한실정이다. 따라서본연구에서는캐모마일추출물의항산화효과와여드름유발균인 P.acnes 균에대한항균효과, 피부각질형성세포에서의항염증효과를확인함으로써여드름개선화장료로서캐모마일의가능성을확인하고자하였다. 2. MATERIALS AND METHOD 2.1. 실험재료및기기실험에사용된 1,1-Diphenyl-2-picrylhydrazyl radical (DPPH) 와 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2h-tetrazolium bromide (MTT) 는 Sigma-Aldrich Co. (St. Louis, MO, USA) 에서구입하였으며에탄올, 클로로폼, 이소프로판올등의시약은시판특급시약을사용하였다. 시료의흡광도는 ELISA microplate reader (Model 680, Bio-Rad Laboratories, Inc., Tokyo, Japan) 를사용하여측정하였다 캐모마일추출물제조본실험에서사용된캐모마일은경상남도진주시에위치한허브줌농원에서구입하였으며, 캐모마일꽃 1 Kg 에증류수 8 L 를가하여 2 h 동안증류추출하였다. 이러한방법을통하여얻어진추출물의상층부분에생성된캐모마일오일과하단부분의캐모마일플로럴워터는분리하여빛을차단한상 태에서상온보관하였다. 실험에사용된캐모마일워터는 1 g/ml 의농도로보관하였고, 캐모마일오일은 30 mg/ml 의농도로캐모마일플로럴워터에희석하여보관한후실험에사용하였다 균주와세포주배양 HaCaT 세포는 Dr. Fusenig (German Cancer Research Center, DKFZ, Heidelberg, Germany) 로부터분양받았으며, Fibroblast 세포는 American Type Culture Collection (ATCC, Rockville, MD, USA) 에서분양받아사용하였다. 세포는 10% FBS 와 1% antibiotics 가포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA) 를사용하여 5% CO 2, 37 o C 조건하에서배양하였다. 매 48 h 마다 Trypsin-EDTA (Hyclcone, Laboratories Inc., Logan, UT, USA) 를이용하여세포를부유상태로만든다음세포를 cells/ml 로분주하고계대배양하였다. 여드름유발균주인 Propionibacterium acnes (P. acnes KCTC 3314) 는한국생명공학연구원생물자원센터에서분양받아사용하였으며, Reinforced Clostridial Agar (MB-R1096, MBcell, Korea) 를사용하여매 72 h 마다 37 o C, anaerobic 조건하에서배양하였다 (Table 1) DPPH assay 캐모마일워터및오일의항산화효능은 DPPH 법을통하여확인하였다. 시료로사용된캐모마일워터는 1 mg/ml, 캐모마일오일은 15, 30, 60 μg/ml의농도가되도록 94.9% 에탄올에희석하여사용하였다. 94.9% 에탄올에용해시킨 0.2 mm DPPH 용액 1 ml과시료 1 ml을혼합하고빛을차단하여 30 min 동안반응시킨후 microplate reader를이용하여 517 nm 의파장에서흡광도를측정하였다. blank로는시료대신증류수를첨가하였고, Vitamin C를농도별로제조하여사전실험을진행한후에적정농도를양성대조군으로사용하였다. 자유라디칼소거능력은아래식을이용하여계산하였다. DPPH free radical scavenging rate (%) A blank A exp = 100 A blank 2.5. 세포생존율측정세포생존율은 MTT assay 법을통하여측정하였다. 12 well plate 에 HaCaT 세포와 fibroblast 세포를각각 cells/ml 로분주하고 24 h 동안안정화시킨후최종농도가캐모마일워터는 1 mg/ml, 오일은 30 μg/ml 의농도가되도록처리하여 24, 48 h 동안 5% CO 2, 37 o C 조건하에서배양하였다. 염증반응유도군에서는 TNF-α 를 1 h 전처리하였다. 배양이끝난후 5 mg/ml 3-(4,5-dimethyl-2 thiazolyl)-2,5-diphnyl-2h-tetra- Table 1. Culture condition of microorganisms for antimicrobial activity test Strains Media Temp ( o C) Propionibacterium acnes KCTC 3314 Reinforced Clostridial agar 37
3 HaCaT 세포주에서캐모마일 (Matricaria chamomilla) 추출물의항병원성및항염효과에관한연구 11 zolium bromide (MTT, Sigma-Aldrich Co.) solution 을각 well 당 20 μl 씩첨가하여 1 h 동안 CO 2 incubator 에서반응시켰다. MTT solution 이포함된 media 를제거하고 PBS washing 후 PBS 를완전히제거하였다. 각 well 당 DMSO 150 μl 을첨가하여생성된 formazan 을모두녹인다음 96 well plate 에 100 μl 씩옮긴후 ELISA microplate reader (Bio-Rad model 680, Bio-Red Laboratories Inc., Tokyo, Japan) 로 595 nm 에서흡광도를측정하였다. 측정은모두 3 번이상하였으며, 이에따른평균값과표준오차는 Microsoft Excel program 을사용하여분석하였다 생육환저해환시험 (Clear Zone Test) 여드름유발균에대한캐모마일워터및오일의항균활성측정은 clear zone test 를통해실시되었다. 여드름유발균인 P. acnes 를액체배지에접종하여 37 o C 에서 18 시간씩 2 회계대배양하여활성화시킨후실험에사용하였다. P.acnes 균을 1 백금이취하여평판배지에도말한후시료 25 μl 을완전히흡수시킨직경 6 mm 의멸균 paper disc 를올려놓고 37 o C, anaerobic 조건하에서 24 시간동안배양하였다. 배양후 disc 주위에생성된생육저해환 (clear zone) 크기 (mm) 를측정하여각시료의항균력을측정하였다. 음성대조군으로는아무것도처리하지않은 paper disc 와증류수를동량흡수시킨 paper disc 를사용하였으며, 양성대조군으로는항생제인 Gentamycin(10 μg/ml) 을동량흡수시킨 paper disc 를사용하였다 Total RNA 추출및 cdna 합성 6 well plate 에 HaCaT 세포를각각 cells/ml 로분주하고 24 h 동안안정화시킨후최종농도가캐모마일워터는 1 mg/ ml, 오일은 30 μg/ml 의농도가되도록처리하여 24, 48 h 동안 5% CO 2, 37 o C 조건하에서배양하였다. 염증반응유도군에서는 TNF-α 를 1 h 전처리하였다. 배양후 media 를모두제거한뒤 PBS 로 1 회 washing 후 RiboEX Total RNA Isolation Solution (GeneAll Biotechnology, Seoul, Republic of Korea) 을가하여세포를용해한후클로로폼, 이소프로판올, 70% 에탄올을각각첨가하는과정을통하여 total RNA 를추출하였다. cdna 합성은 DiaStar TM RT kit (SolGent, Seoul, Korea) 를이용하여진행하였다. total RNA 1 μl 와 oligo(dt)20 primer 9 μl 를혼합한뒤 65 o C 에서 5 min 동안반응시킨후 ice 에넣어반응을중단하였다. 상기과정을통하여 oligo(dt) primer 가붙은 mrna 에 8 mm DTT 1 μl, RNase (200 U/μL) 1 μl, 10 mm 의 dntp 가포함된 5X RT reaction buffer 4 μl, DEPC- DW 를첨가한후 40 o C 에서 1 h, 95 o C 에서 5 min 동안반응시킴으로써 cdna 를합성하였다 역전사중합효소연쇄반응 (Reverse Transcription Polymerase Chain Reaction, RT-PCR) PCR은 DNA polymerase와 buffer, dntp, tracking dye가포함된 2X Taq PCR Smart mix 1 (SolGent, Seoul, Korea) 를이용하여실시하였다. PCR 증폭은 95 o C에서 10 min 동안 pre-denaturation 하고, denaturation은 95 o C에서 30 sec, annealing은 60 o C에서 30 sec, extension은 72 o C에서 30 sec의조건으로 35 cycles 반응시켰으며 72 o C에서 10 min 동안안정화시켰다. IL-1β, IL-6, IL-8, COX-2, actin의 specific primer sequences는 Table 2와같다 통계처리통계프로그램인 SPSS 22.0 을사용하였고실험설계에대한분산분석은일원배치분산분석 (One-way ANOVA) 과독립표본 t-test (independent sample t-test) 를실시하여검정하였다. 각자료는 3 번이상의반복된실험을통하여얻어진결과로검정하였고 p<0.05 인경우통계적으로유의한것으로판정하였다. 3. RESULT AND DISCUSSION 3.1. 캐모마일추출물의항산화효과캐모마일워터및오일의항산화효과를측정하기위하여 DPPH assay 를실시하였다. DPPH 법은시료의환원력을측정하는실험방법으로시료가 DPPH 의자유라디칼에전자를공여함으로써발생하는자유라디칼소거능력을측정한다 [12]. 캐모마일워터및오일의항산화효과를측정한결과, 캐모마일워터는 13.3%, 캐모마일오일은 15 μg/ml 의농도에서 11.74%, 30 μg/ml 의농도에서 22.75%, 60 μg/ml 에서 Table 2. Specific primer sequences for the amplification of target gene Gene Primer sequence (5'-3') Amplification size (bp) Annealing temperature ( o C) IL-1β For: GGAGAATGACCTGAGCACCT Rev: GGAGGTGGAGAGCTTTCAGT IL-6 For: AGTCCTGATCCAGTTCCTGC Rev: AAGCTGCGCAGAATGAGATG IL-8 For: TGAGCATCTACGGTTTGCTG Rev: TGCTTGTCTGGAACAACTGC COX-2 For: TGAGCATCTACGGTTTGCTG Rev: TGCTTGTCTGGAACAACTGC Actin For: GGACTTCGAGCAAGAGATGG Rev: AGCACTGTGTTGGCGTACAG
4 12 Korean Society for Biotechnology and Bioengineering Journal 32(1): 9-15 (2017) 비교적높은항산화효과를지닌것으로볼수있다. 선행연구에의하면캐모마일에탄올추출물의항산화효과는 75.4% 로라벤더, 페퍼민트와같은기타허브류보다높은것으로보고된바있으며, 이러한결과는본실험의항산화효과보다높은수치이지만이는추출용매및방법에의한차이인것으로생각된다 [13]. Fig. 1. Free radical scavenging ability of chamomile extracts. Antioxidative effects were measured by DPPH assay. The statistical analysis of the data was carried out by use of a one-way ANOVA (p< 0.05, each experiment, n=3) % 의자유라디칼소거능이관찰되어항산화효과가있음을확인하였다 (Fig. 1). 이는양성대조군인 vitamin c 의항산화효과가 37.23% 인것과비교했을때, 캐모마일오일이 3.2. 캐모마일추출물의세포독성검사피부표피층을구성하는피부각질형성세포 (HaCaT) 는피부의보호막역할을하는각질을형성하며다양한자극에반응하여여러사이토카인 (cytokine) 을분비함으로써염증반응및면역반응에관여한다 [14,15]. 피부각질형성세포가자극을받으면 tumor necrosis factor-α (TNF-α) 를분비하여다른사이토카인의분비를촉진함으로써염증을유도하는것으로알려져있다 [15]. 따라서본연구에서는피부를구성하고있는피부각질형성세포 (HaCaT) 및섬유아세포 (fibroblast) 에대한캐모마일추출물의세포독성여부를확인하기위하여 MTT assay 를실시하였다. 또한 TNF-α 로여드름성염증반응을유도한후 MTT assay 를실시함으로써여드름성염증유발피부에서캐모마일추출물의세포독성여부를확인하고자하였다. 캐모마일워터및오일을 24 h 및 48 h 동안처리한 Fig. 2. Cytotoxic Effects of Chamomile extract in HaCaT cells. Cell viability was measured by MTT assay. (a and c) Cells were treated with chamomile water (C.W) and oil (C.O) for 24 h and 48 h. (b and d) Cells were pre-treated with 10 ng/ml TNF-α for 1 h followed by treatment with chamomile water and oil for 24 h and 48 h. The statistical analysis of the data was carried out by use of a t-test. N.S. is not significant (each experiment, n=3).
5 HaCaT 세포주에서캐모마일 (Matricaria chamomilla) 추출물의항병원성및항염효과에관한연구 13 Table 3. Antimicrobial activities of chamomile extracts Diameter of Clear Zone (mm) Strains None D.W Gentamycin Chamomile Water Chamomile Oil P. acnes KCTC3314 ND a) ND 28.0±1.0 b) ND 10±0.0 b) a) ND, not detected, b) Inhibition Zone, The results are expressed as mean±sd of triplicates 후에세포생존율을측정한결과, Fig. 2 에나타난바와같이염증을유발한 24 h 처리군의경우, TNF-α 처리시세포생존율이 90.9%, 캐모마일워터처리군에서 96.8%, 캐모마일오일처리군에서 98% 로나타났으나통계적으로유의하지않았다 (Not Significant). 또한, 염증을유발한 48 h 처리군에서도 TNF-α 처리시세포생존율이 86.6% 로감소하는것으로나타났으나통계적으로유의한결과는아니었으며, 캐모마일워터처리군에서 96%, 캐모마일오일처리군에서 100.9% 로세포생존율이다시증가하는것을확인하였다. 따라서본실험을통하여캐모마일추출물이피부각질형성세포및섬유아세포에독성이없는것을확인하였다 캐모마일추출물의항균효과과각질화및과다한피지분비와같은다양한요인에의하여모공이막히면혐기성세균으로알려진 P.acnes 의모공내증식이활발하게진행된다. P.acnes 는지질분해요소인 lipase 를분비함으로써피지의주성분인 triglyceride 를분해하여 free fatty acid 를생성하는것으로알려져있으며, 생성된 free fatty acid 는모낭벽의상피세포를자극하여과각질화및피지분비를더욱더악화시켜염증을유발한다 [16]. 따라서본연구에서는여드름유발균인 P.acnes 균에캐모마일워터및오일을처리하여캐모마일의항균력을측정하고자하였다. 그결과 Table 3 과같이, 음성대조군인아무것도처리하지않은군과증류수를처리한군에서는 P.acnes 균에대한항균효과가나타나지않았으며, 양성대조군인 Gentamycin 처리군에서는 28.0±1.0 mm 의생육저해환이형성되었다. 또한캐모마일워터처리군에서는생육저해환이형성되지않았으나캐모마일오일처리군에서 10±0.0 mm 의생육저해환이형성되었다. 선행연구에의하면 P.acnes 균에캐모마일에센셜오일을처리하였을때약 8 mm 정도의생육저해환이형성되었다고보고되었으며, 이는본실험의결과와비슷하였다 [17]. 이와같은캐모마일오일의항균력은캐모마일추출물에함유되어있는지용성화합물인 α-bisabolol 및 cyclic ethers 등에의한것으로사료되며 [18], 이에대한추가적인연구는향후연구과제로여겨진다 캐모마일추출물의염증관련유전자발현저해효과 P.acnes 균에의해피부각질형성세포가자극을받으면 TNFα, interleukin-1β (IL-1β), interleukin-6 (IL-6) 및 interleukin-8 (IL-8) 과같은다양한염증성사이토카인이세포외부로분비되어여드름성염증반응이유도된다 [15,19,20]. 염증반응을조절하는주요유전자인 cyclooxygenase-2 (COX-2) 는성장인자 (growth factor), 사이토카인등에의하여발현이유도되 며, 염증반응매개물질인 PGE2 와 NO 의생성에관여함으로써마름버짐, 홍반성낭창과같은염증성피부질환을일으키는것으로알려져있다 [21]. TNF-α 는많은염증반응에관련된중요인자로알려져있으며, 정상적인상태의세포에서는생성되지않으나세포가염증유발인자에의하여자극을받으면분비되는것으로알려져있다 [22]. 또한 IL-1β 는염증초기반응에관여하고있어염증의발생및진행과정에중요한역할을하며, IL-8 은백혈구의탈과립반응을유도함으로써히스타민과같은염증유발인자가분비되도록한다. 분비된염증유발인자는염증부위에부종및통증과같은염증반응을촉진시킨다 [15,22]. 선행연구에의하면피부각질형성세포에 TNF-α 로염증을유도한뒤봉독을처리하였을때, 증가했던 IL-1β 와 IL-8 의분비및발현량이감소한다고보고되었다 [15]. 또한모링가뿌리또는잎추출물을처리하였을때 TNF-α 에의하여유도된 IL-6 의 mrna 발현이농도의존적으로감소한다고보고되었다 [21]. 따라서본연구에서는피부각질형성세포에 TNF-α 를처리하여여드름성염증반응을유도한뒤, 캐모마일추출물을처리하여캐모마일의항염증효과를확인하고자하였다. 그결과, Fig. 3 과같이 TNF-α 의처리에따라 IL-1β, IL-6, IL-8 및 COX-2 유전자의발현이아무것도처리하지않은군과비교하였을때, 각각 1.8, 1.2, 2.0, 1.4 배수증가하였으며, 캐모마일워터처리군에서각각 1.3, 0.3, 1.1, 1.0 배수, 캐모마일오일처리군에서각각 1.1, 0.1, 1.6, 0.4 배수로 TNF-α 단독처리군보다발현량이유의하게감소하였다. 선행연구에의하면캐모마일의항염증효과는페놀성화합물에의한것으로알려져있으며, apigenin, quercetin, patuletin, luteolin 중에서도 luteolin 에의한항염증효과가뛰어난것으로보고되었다 [9]. 결과적으로본실험을통하여캐모마일추출물의항염증효과를확인하였으며, 이와같은효과는 IL-1β, IL-6, IL-8 및 COX-2 과같은염증관련유전자의발현을억제함으로써나타난것임을확인하였다. 또한이러한캐모마일추출물의항염증효과는추출물에함유되어있는 luteolin 과같은페놀성화합물성분에의한것으로예상된다. 4. CONCLUSION 최근화장품시장이확대됨에따라여드름의예방및증상개선을위하여항균및항염효능이있고피부에자극이덜한천연물유래화장료개발에대한연구가많이이루어지고있다 [20]. 따라서본연구에서는캐모마일추출물의항산화효과와세포독성, 항균및항염효과를확인하여천연물유래
6 14 Korean Society for Biotechnology and Bioengineering Journal 32(1): 9-15 (2017) Fig. 3. Effects of chamomile extracts on IL-1β, IL-6, IL-8 and COX-2 mrna expression levels in HaCaT cells. Cells were pre-treated with 10 ng/ml TNF-α for 1 h followed by treatment with chamomile water (C.W) and oil (C.O) for 24 h. The statistical analysis of the data was carried out by use of a t-test. **p<0.01 and ***p<0.001 compared to control. ###p<0.001 was compared to 10 ng/ml TNF-α treated group. N. S.; not significant (each experiment, n=3). 화장료로서캐모마일의가능성에대하여알아보고자하였다. 그결과, 캐모마일워터및오일추출물에서각각 13.3%, 22.75% 의항산화효과가확인되었으며, 캐모마일워터보다캐모마일오일처리군에서더높은항산화효과를확인하였다. 또한 MTT assay 를통하여캐모마일추출물의세포독성검사를실시한결과, 캐모마일추출물처리에따른세포독성은나타나지않았다. 여드름유발균으로알려진 P.acnes 에캐모마일을처리하여항균효과를확인한결과, 캐모마일워터처리군에서는생육저해환이관찰되지않았으며캐모마일오일처리군에서 10±0.0 mm 의생육저해환이형성되었다. 또한 TNF-α 로여드름성염증반응을유도한뒤, 염증관련유전자들의발현변화를통하여캐모마일추출물의항염효과를확인한결과, IL-1β, IL-6, IL-8 및 COX-2 유전자의발현이감소하는것을확인하였다. 결론적으로캐모마일추출물의항산화, 항균및항염효과를확인하였으며, 캐모마일워터보다는캐모마일오일이더뛰어난항여드름효과를지닌것을확인하였다. 따라서, 캐모마일이피부세포에독성이없고항균및항염작용을하는것으로보아여드름증상개선을위한화장료로서이용될가능성이높다고사료된다.
7 HaCaT 세포주에서캐모마일 (Matricaria chamomilla) 추출물의항병원성및항염효과에관한연구 15 Acknowledgements 본연구는 2015 년산학연협력기술개발사업 ( 기업부설연구소신규설치, 과제번호 C ) 에의해수행되었음. REFERANCES 1. Lee, W. G., B. H. Kim, S. W. Jeon, K. S. Kim, H. J. Nam, and Y. B. Kim (2011) The Latest Trends of Treatment for Acne Vulgaris in PubMed. J. Korean Orient. Med. Ophthalmol. Otolaryngol. Dermatol. 24: Jin, B. W., J. H. Ahn, and C. J. Ma (2011) Antibacterial Activity of Some Medicinal Plants against Propionibacterium acnes. Kor. J. Pharmacogn. 42: Yoon, H. J. and D. I. Kim (2015) Review on the Acne Related Articles Published in Korean Medical Journals-Focusing on Experimental Studies Published after J. Korean Obstet. Gynecol. 28: An, B. J., J. T. Lee, C. E. Lee, J. H. Son, J. Y. Lee, and T. S. Park (2005) A Study on the Development of Cosmeceutical Ingredient, Rhododendron mucronulatum, and the Application of Rheology Properties. J. Korean Soc. Appl. Biol. Chem. 48: Eom, J. N. and J. D. Kim (2004) An empirical study on the oriental herbal cosmetics purchase behaviors in women in the Metropolitan area. J. Soc. Cosmet. Scientists Korea. 30: Cho, Y. J., S. J. Yoon, J. H. Kim, and S. S. Chun (2005) Biological Activity of Chamomile (Matricaria chamomilla L.) Extracts. J. Korean Soc. Food Sci. Nutr. 34: Lee, S. H., K. J. Min, K. O. Lee, J. S. Sin, Y. C. Kim (2008) Effect of German Chamomile Oil Application to Atopic Dermatitis Mice on the Change of Serum IgE Level. J. Kor. Soc. Cosm. 14: Srivastava, J. K., E. Shankar, and S. Gupta (2011) Chamomile: A herbal medicine of the past with bright future. Mol. Med. Report. 3: Kim, J. H., S. Y. Kim, Y. N. Hong, Y. S. Kim, and Y. M. Han (2014) Effect of Chamomile Flower Extract on Septic Arthritis due to Candida albicans. Yakhak Hoeji. 58: Abebe, W. (2002) Herbal medication: potential for adverse interactions with analgesic drugs. J. Clin. Pharm. Ther. 27: Weidner, C., S. J. Wowro, M. Rousseau, A. Freiwald, V. Kodelja, H. Abdel-Aziz, O. Kelber, and S. Sauer (2013) Antidiabetic effects of chamomile flowers extract in obese mice through transcriptional stimulation of nutrient sensors of the peroxisome proliferator-activated receptor (PPAR) family. PLoS One. 8: e Ha, J. H., Y. J. Jeong, J. S. Seong, K. M. Kim, A. Y. Kim, M. M. Fu, J. Y. Suh, N. H. Lee, J. Park, and S. N. Park (2015) Antioxidant and Antibacterial Activities of Glycyrrhiza uralensis Fisher (Jecheon, Korea) Extracts Obtained by various Extract Conditions. J. Soc. Cosmet. Sci. Korea. 41: Choi, I. Y., Y. J. Song, and W. H. Lee (2010) DPPH radical scavenging effect and antimicrobial activities of some herbal extracts. Kor. J. Hort. Sci. Technol. 28: Beissert, S., I. Cavazzana, F. Mascia, P. Meroni, S. Pastore, G. Tessari, and G. Girolomoni (2006) Mechanisms of immune-mediated skin diseases: An overview. Clin. Exp. Rheumatol. 24: S Lee, W. R., K. H. Kim, H. J. An, J. Y. Kim, S. M. Han, K. G. Lee, and K. K. Park (2014) The effects of bee venom on tumor necrosis factor (TNF)-α induced inflammatory human HaCaT keratinocytes. Kor. J. Pharmacogn. 45: Sohn, H. Y., Y. S. Kim, E. J. Kum, Y. S. Kwon, and K. H. Son (2006) Screening of anti-acne activity of natural products against Propionibacterium acnes. Kor. J. Microbiol. Biotechnol. 34: Zu, Y. G., H. M. Yu, L. Liang, Y. J. Fu, T. Efferth, X. Liu, and N. Wu (2010) Activities of ten essential oils towards Propionibacterium acnes and PC-3, A-549 and MCF-7 cancer cells. Molecules. 15: Singh, O., Z. Khanam, N. Misra, and M. K. Srivastava (2011) Chamomile (Matricaria chamomilla L.): An overview. Pharmacogn Rev. 5: Taylor, M., M. Gonzalez, and R. Porter (2011) Pathways to inflammation: acne pathophysiology. Eur. J. Dermatol. 21: Choi, J. Y., S. Y. Song, and H. H. Lee (2015) Antibacterial and antiinflammatory activity of corni fructus ethanol extract in Propionibacterium acnes. Kor. J. Aesthet. Cosmetol. 13: Lee, H. J. and Y. C. Chang (2012) Suppression of TNF-α-induced inflammation by extract from different parts of moringa in HaCaT cells. J. Life Sci. 22: Bordon, Y. (2010) Cytokines: Cytokines reach out. Nat. Rev. Immunol. 10:
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 311-318 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.311 ISSN 1225-7117 / eissn 2288-8268 Research Paper HaCaT 세포주에서나복근즙 (Juice of
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationμ
μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 335-341 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.335 ISSN 1225-7117 / eissn 2288-8268 Research Paper 염증성사이토카인의발현억제를통한홍해삼추출물의항염증효과및아토피개선효과
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information슬라이드 1
Anti-aging Peptide Anti-wrinkle peptide Whitening peptide Anti-hair loss & hair growing peptide BF-Dynorphin Elastin essential peptide Cyclitol Anagen BF-Enkephalin Elastin anti-wrinkle peptide ElaX-MV
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information2014_........pdf
1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials
More information27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
More information大学4年生の正社員内定要因に関する実証分析
190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의
K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information103.fm
Lab. Anim. Res. 2010: 26(1), 15-20 Investigations of Samwhang-sasimtang Extracts on Biological Activities In Vitro and Vivo In-Chul Lee 1, Bae-Hwan Kim 2 * and Mee-Kyung Kim 1 * 1 Senior Industry Cluster
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a
조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information..................
ptical & Mechanical Characteristics of Lining Papers Oby the Artificial Heat Ageing Treatment 1 1 This study was carried out to investigate the effect of artificial accelerated ageing treatment on the
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information