01(JLS_140138).hwp
|
|
- 우민 봉
- 6 years ago
- Views:
Transcription
1 Journal of Life Science 2014 Vol. 24. No ~1045 ISSN (Print) ISSN (Online) DOI : hcg-induced Endoplasmic Reticulum Stress Leads to Activation of the IRE1/XBP1 Pathway in Mouse Leydig Tumor Cells (mltc-1) Sun-Ji Park 1, Tae-Shin Kim 2 and Dong-Seok Lee 1 * 1 School of Life Science and Biotechnology (BK 21 plus program), Kyungpook National University, Daegu , Korea 2 Department of Reproductive Medicine, University of California, San Diego, 9500 Gilman Drives, La Jolla, California 92093, USA Received July 17, 2014 /Revised August 11, 2014 /Accepted August 11, 2014 This study analyzed whether human chorionic gonadotropin (hcg) induces ER stress via the IRE/XBP1 pathway in mouse Leydig tumor (mltc-1) cells. In a previous study, we demonstrated that the unfolding protein response (UPR) plays an important role in the expression of steroidogenic enzymes by modulating the ATF6 pathway, as well as ER stress-mediated apoptosis in hcg-stimulated Leydig cells. Although UPR signaling has been reported to regulate the IRE1/XBP1 pathway, it is not known whether hcg-induced ER stress in Leydig cells can activate the pathway. To investigate the activation of the IRE1/XBP1 pathway in mltc-1 cells after hcg treatment, we performed a Western blot analysis to detect the phospho-ire1 protein and an RT-PCR analysis to validate splicing of XBP1 mrna. We used ER stress-activated indicator (ERAI) constructs for monitoring the activity of IRE1 and then analyzed by fluorescence microscopy and flow cytometry. The expression levels of the phospho-ire1 protein markedly increased in response to the hcg treatment. In the mltc-1 cells transfected with an F-XBP1-venus/F-XBP1 DBD-venus construct, the hcg treatment led to the appearance of green fluorescent cells and detectable fluorescence in the nucleus and cytosol, respectively. In addition, splicing of XBP1 mrna significantly increased after the hcg treatment. Taken together, these results indicate that hcg-induced ER stress leads to activation of the IRE1/XBP pathway in Leydig cells. Key words : ER stress, hcg (human chorionic gonadotropin), IRE1, leydig cells, XBP1 서 소포체 (endoplasmic reticulum, ER) 는단백질의합성과폴 딩 (folding), 조립 (assembly) 등의과정이일어나는중요한장 소이다. 하지만소포체내에과도한단백질합성과미성숙된 단백질의축적, 칼슘이온의항상성이상등으로인해소포체 기능에장애가발생하는데이를소포체스트레스 (ER stress) 라고한다 [3]. 세포는이스트레스에대항하여생존하기위한 방어기전으로 UPR (unfolding protein response) 경로를활성 화시킨다. UPR 경로는소포체막에존재하는세가지신호전달체계인 protein kinase RNA (PKR)-like ER kinase (PERK), inositol- requiring protein 1 (IRE1) 그리고 activating transcription factor 6 (ATF6) 에의해매개되어소포체의항상성을회복시킨다 [6]. PERK, IRE1, ATF6는스트레스가없는상태에 *Corresponding author *Tel : , Fax : * lee1@knu.ac.kr This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 론 서는소포체샤페론인 Grp78/Bip과결합하여비활성상태로존재하지만소포체스트레스가발생하게되면 Grp78/Bip과의결합으로부터분리되어져활성화된다 [14]. 먼저 PERK는이량체 (dimer) 형성후자가인산화 (autophosphorylation) 에의해활성화되고, 활성형의 PERK는 eukaryotic translation initiation factor 2α (eif2α) 를인산화시켜 mrna에서단백질로번역 (translation) 되는과정을감소시킨다 [16]. 두번째로 IRE1은 PERK와마찬가지로이량체형성후자가인산화되면 endonuclease로써작용하여 X-box binding protein 1 (XBP1) mrna를 splicing시켜활성형의 XBP1 단백질로의발현을유도하고, 이는전사인자로작용하여소포체스트레스관련유전자의 ER stress response element (ERSE) 부위에결합하여전사를증가시킨다 [6, 11]. 마지막으로 glucose-regulated protein (Grp78/ Bip) 에서분리된비활성형 ATF6 (p90) 는소포체에서골지체 (Golgi apparatus) 로운반된후절단되어활성형 ATF6 (p50) 로바뀌고핵속으로이동하여전사인자로작용하여샤페론의발현을유도한다 [11]. 이런 UPR signaling에대한연구는인슐린 (insulin) 을분비하는췌장의베타세포 [8], 콜라겐 (collagen) 을분비하는조골세포 [4] 와 gonadotropin을분비하는 gonadotrope 세포 [2] 등과같은특정단백질을생산하는분비세포에서많이이루어졌다. 정소의레이디히세포 (leydig cell) 는세정관간극에위치
2 1040 생명과학회지 2014, Vol. 24. No. 10 하며황체형성호르몬 (luteinizing hormone; LH) 의자극을받아남성호르몬인테스토스테론 (testosterone) 을생산하는또다른유형의분비세포이다. 레이디히세포는 LH의자극을받아테스토스테론합성을위해성호르몬합성효소들 (steroidogenic enzymes) 을지속적으로발현시켜야하므로 UPR signaling이레이디히세포에서중요한조절작용을할것으로생각된다. 이전연구를통하여마우스레이디히세포인 mltc-1 세포와 10주령수컷마우스에 LH 유사호르몬인사람융모성성선자극호르몬 (human chorionic gonadotropin; hcg) 을처리하였을때소포체스트레스가야기되어 UPR signaling이활성화되고특히활성형 ATF6 (p50) 에의해성호르몬합성효소의발현이직접적으로조절되는것을처음으로증명하였다 [9]. 또한이 hcg를고농도혹은장시간처리할경우소포체스트레스매개의세포자멸사가유도되는것을 in vivo와 in vitro level의레이디히세포에서모두확인하였다. 이연구를통하여레이디히세포역시다른분비세포와같이소포체스트레스가발생하여 UPR signaling의조절을받는다는것을확인할수있었다. 하지만아직레이디히세포에서 hcg처리에의해증가된세가지 UPR경로가각각어떤역할을하는지다밝혀지지않았으며각 UPR 관련유전자의세포내역할에대한연구가좀더필요한단계이다. 따라서본연구에서는 mltc-1세포에 hcg를다양한농도와시간으로처리하여 IRE1 유전자의활성여부및활성 IRE1 의 endonuclease 기능에의한 XBP1 mrna의 splicing 유도를확인하기위하여다양한실험방법을이용하여분석하였다. 이결과를통하여향후정소의레이디히세포에서 IRE1/XBP1유전자의역할을연구에적용및응용가능성을조사하고자하였다. 재료및방법시약본연구에서사용된 Human chorionic gonadotropin (hcg) 는 Intervet 社 (Chorulon, Milton Keynes, Buckinghamshire, UK) 으로부터, 8-Bromo-cAMP (8-Br-cAMP) 는 Sigma (St. Louis, MO, USA) 에서그리고 Tunicamycin (Tm) 은 Calbiochem (La. Jolla, Cal., USA) 에서각각구입하였다. 세포배양실험에사용한생쥐라이디히세포주인 mltc-1 세포는 ATCC (American Type Culture Collection, Manassas, VA, USA) 에서구입하였다. mltc-1 세포는 RPMI 1640배지에 10% FBS (fetal bovine serum, Hyclone, Thermo Scientific, Inc.) 와 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) 그리고 10mM Hepes를첨가한배지를사용하였으며 37, 5% CO 2 세포배양기에서배양하였다. Western blot hcg를농도별, 시간별로처리한후 PRO-PREP buffer (intron Biotechnology Inc.) 를넣어파쇄한후 13,000rpm으로 10분간원심분리하여단백질상층액을얻어사용하였다. 단백질을분리하기위하여 10% SDS- polyacrylamide gel을이용하여전기영동하였다. 그런다음분리된단백질은 nitrocellulose membrane (Pall Life sciences, NY, USA) 으로이동시키고 5% skim milk에 1시간동안 blocking 하였다. 이후 membrane을 anti-grp78/bip, anti-ire1 (Cell Signaling, MA, USA), anti-phospho-ire1 (Abcam, MA, USA), anti- β-actin (Santa Cruz Biotechnology, CA, USA) 각 1차 antibody로 4 에서 12시간배양한다. 1XTBST buffer로 washing 한후 antimouse/ rabbit IgG (Thermo, Scientific, MA, USA) 로각 2차 antibody로실온에서 1시간배양한다. 다시 1XTBST buffer로 washing 한후 ECL 용액 (abfrontier, Seoul, Korea) 으로감광시킨후암실에서 X-선필름에노출시킨후인화하였다. In vitro transient transfection mltc-1 세포에소포체스트레스-활성표지자 (ER stressactivated indicator, ERAI) 인 pcax-f-xbp1-venus 혹은 pcax- F-XBP1 DBD-venus 플라스미드 [10] 를 Effectene transfection reagent (Qiagen, Valenica, CA, USA) 를이용하여세포에도입하였다. 이후 48시간뒤에 FBS가들어있지않은 RPMI1640 배지에 12시간배양한다. 그런다음 5 IU hcg, 500 um camp 그리고 2 μg/ml Tm을 12시간처리한다. Flow cytometry 분석 pcax-f-xbp1-venus 혹은 pcax-f-xbp1 DBD-venus vector를도입한 mltc-1세포에 hcg, camp를처리하고난후 0.05% trypsine-edta (Invitrogen) 을이용하여세포를수확한다. 이후세포를 phosphate-buffered saline (PBS, ph7.4) 로두번 washing 하고 DMEM (-Phenol red) 에현탁시켰다. 세포현탁액을 green fluorescence 신호로 FACSCalibur (BD Biosciences, NJ, USA) 를이용하여분석하였다. 형광현미경을이용한세포관찰 pcax-f-xbp1-venus 혹은 pcax-f-xbp1 DBD-venus 플라스미드를도입한세포에소포체스트레스가유도되면녹색형광이핵혹은세포질에서발현된다. mltc-1세포에이플라스미드를각각도입한뒤 hcg, camp, Tm을처리하고형광현미경으로관찰하였다. 배지를제거하고 PBS로두번 washing 하고 methanol로고정한뒤 1 μg/ml Hoechst 33258로핵을염색시켰다. 염색 10분후에형광현미경 (Leica DMIL microscope, DFC420C digital camera) 을이용하여소포체스트레스가핵혹은세포질에서의발현여부를관찰하였다.
3 Journal of Life Science 2014, Vol. 24. No Total RNA 추출및 cdna 합성 5 IU hcg, 500 um camp 그리고 2 μg/ml Tm을시간별로처리한 mltc-1 cell에 PBS washing 2번후 1 ml의 Trizol solution(bio science Technology, korea) 을넣고 cell scrapper를이용하여 cell을수확하였다. 1.5 ml tube에옮겨서 ice에서 5분간반응시킨후수층과유기용매층으로분리시키기위해 200 μl chloroform을첨가하여 5분간반응시킨다. 12,000rpm에 15 분간원심분리한뒤, total RNA가들어있는상층액을 500 μl의 Isopropanol이들어있는새 tube에옮기고가볍게 inverting 하였다. 원심분리하여 total RNA pellet을 down 시킨후, 1 ml의 75% EtOH를이용하여 2차례 washing 한다음상온에서건조시켰다. 추출된 RNA는 50 μl의 RNase-free water인 DEPC에희석하였다. 추출한 1 μg의 total RNA와 Oligo-dT 그리고 AccuPower RT-PCR premix (Bioneer, korea) 을이용하여 cdna를합성한뒤 -20 에냉동보관하였다. RT-PCR 및 XBP1 mrna의 splicing 분석합성된 cdna를주형으로특정 primer (Table 1) 를첨가하여 AccuPower PCR premix (Bioneer) 를이용하여 PCR을수행하였다. PCR 조건은 95 에서 5분, 95 에서 30초, 55 에서 30초, 72 에서 30초, 72 에서 5분총 30 cycle 수행하였다. 대조군으로 GAPDH 유전자를사용하였다. XBP1 mrna의 splicing 분석하기위해서먼저 2X PCR Premix (Enzynomics, Seoul, Korea) 와 XBP-1 primer (Table 1) 를이용하여위의조건과동일하게 PCR을수행하였다. 이 PCR 산물에 Pst1 제한효소를첨가하여 37 에서 90분간반응시킨다. 그런다음 EtBr 이포함된 2% agarose gel에전기영동하여 UV상에서 band를확인하였다. 결과 hcg처리후 p-ire1 단백질발현량분석마우스레이디히세포에서 hcg처리에의해 p-ire1의발현패턴을확인하기위하여 mltc-l 세포에 hcg를농도별, 시간별로처리하여실험을진행하였다. 먼저주요한소포체스트레스표지자인 Grp78/Bip의단백질의발현패턴을확인한결과 hcg처리에의해 Grp78/Bip단백질의발현량이급격히증가하는것을통하여이전연구결과 [9] 와같이 mltc-l 세포에 hcg처리시소포체스트레스가증가하는것을확인하였다 (Fig. 1). hcg에의해유도된소포체스트레스가 IRE1경로를 활성화시키는지확인하기위하여 p-ire1와 Total IRE1의단백질발현량을 western blot을통하여확인하였다. Fig. 1A에서보듯이 hcg의농도가증가함에따라 p-ire1의발현이점점증가하였다 (p<0.001). 또한 5IU/ml의 hcg을시간별시처리하였을때, 3시간후부터 p-ire1이급격히증가하여 24시간까지꾸준히유지되었다 (Fig. 1B). 이결과를통하여마우스레이디히세포인 mltc-1세포에 hcg처리에의해유도되는소포체스트레스는 IRE1을인산화시키는것을단백질수준에서확인할수있었다. hcg와 camp 처리에의한 IRE의활성분석소포체스트레스에의해인산화된 IRE1읠활성화되어 endonuclease 활성을가지게된다. hcg처리에의해증가된 p- IRE1이활성화되어 endonuclease의기능을수행하는지확인하기위하여 IRE1의활성을분석할수있는소포체스트레스- 활성표지자 (ER stress-activated indicator, ERAI) 인 pcax-f- XBP1-venus 혹은 pcax-f-xbp1 DBD-venus vector 를 mltc- 1 세포에도입하여실험을진행하였다 [10]. 소포체스트레스환경에서이 vector에삽입되어있는 XBP1 유전자가 splicing 되면, splicing된 XBP1 mrna는 XBP1-venus fusion protein 으로번역되어녹색형광이발현되어세포내활성 IRE1을표지할수있다. pcax-f-xbp1-venus는활성 IRE1에의해 splicing 되어만들어진 XBP1-venus fusion protein이핵에위치하게되며, pcax-f-xbp1 DBD-venus 로부터만들어진 XBP1 DBD-venus fusion protein은세포질에위치하게된다 [5]. Figure 2에서 mltc-1 세포에각각 pcax-f-xbp1-venus, pcax-f-xbp1 DBD-venus을 transfection 한뒤 hcg와 hcg 자극에의한이차전달자인 camp를 12시간처리하여형광현미경으로관찰하였다. pcax-f-xbp1-venus vector가도입된세포에 hcg와 camp 처리시녹색형광을띄는세포들이 control에서보다많이증가되었으며 (Fig. 2A), 세포를확대해서관찰하니녹색형광이핵에서발현되는것을확인할수있었다 (Fig. 2B). pcax-f-xbp1 DBD-venus를도입한세포에서도역시 hcg와 camp 처리시녹색형광의세포들이많이발견되며, 녹색형광단백질 XBP1 DBD-venus fusion protein이세포질에서발현하는것을관찰할수있었다 (Fig. 2C and 2D). hcg와 camp 처리에의해증가되는녹색형광을띄는세포수는 positive control로써사용한소포체스트레스유도제인 Tunicamycin (Tm) 처리한경우와비슷한수준으로발견되는것을확인하였다. Table 1. Primer sequence for reverse-transcription PCR Gene Accession number Forword (5'-3') Reverse (5'-3') Grp78/Bip XBP1 GAPDH NM_ NM_ NM_ TGCAGCAGGACATCAAGTTC AAACAGAGTAGCAGCGCAGACTGC ACCACAGTCCATGCCATCAC CAGCTGCTGAGGCTCATTG TCCTTCTGGGTAGACCTCTGGGAG TCCACCACCCTGTTGCTGTA
4 1042 생명과학회지 2014, Vol. 24. No. 10 A B Fig. 1. hcg treatment cause ER stress and leads to IRE1 activation in mltc-1 cells. Western blot analysis of Grp78/Bip, phospho-ire1, total IRE1, β-actin protein in treated MLTC-1 cells with variant hcg concentrations. mltc-1 cells were incubated with dose dependent manner of hcg for 12 hr (A). mltc-1 cells were incubated with 5 IU/ml hcg for different incubation times (B). phospho-ire1 protein were quantified and normalized by total IRE1 for Western blot analysis. Data in bar graph are the means ± SEM of three independent measurements. A Cont 500μM camp 2μg/ml Tm B C Cont 500μM camp 2μg/ml Tm D Fig. 2. hcg and camp induce the activation of IRE1. Fluorescence (green) image in mltc-1 cells were transfected with indicator plasmids and treated with camp, hcg and Tm. mltc-1cells were transfected with pcax-f-xbp1-venus (A, B) and pcax-xbp1 DBD-venus (C,D) for 48 hr. After transfection, mltc-1 cells were pre-incuated with serum free medium for 12 hr, and then cells treated with camp (500 μm), hcg (5 IU/ml), and Tm (2 μg/ml) as positive control for 12 hr. Cells were fixed with methanol and stained with 1 μg/ml Hoechst for 10 min (B,D) And then, cells were visualized and analyzed under a fluorescence microscope. Scale bar, 200 μm.
5 Journal of Life Science 2014, Vol. 24. No 또한 pcax-f-xbp1-venus, pcax-f-xbp1 DBD-venus 를각각도입한세포에 hcg와 camp 처리하여증가하는녹색형광의강도를조사하고정량화하기위하여 Flow cytometry를이용하여분석하였다. Fig. 3에서확인할수있듯이 control에비하여 hcg와 camp 처리한세포에서형광강도가많이증가하였다. 세번의반복실험을통하여얻은평균값을통계처리하여그래프화한결과 control에비하여 hcg와 camp 처리하였을때유의적으로형광강도가증가하는것을확인할수있었다 (p<0.05). 이실험들을통하여 hcg와 2차전달자인 camp 모두 IRE1을활성화시키고, 활성화된 IRE1은 endonuclease 기능을수행하여도입된 pcax-f-xbp1-venus 와 pcax- F-XBP1 DBD-venus의 XBP1 mrna 영역을 splicing 시키는것을확인할수있었다. hcg 와 camp 처리에의한 XBP1 mrna의 splicing 분석 hcg와 camp 처리에의해활성화된 IRE1이세포내에서발현되는 XBP1 mrna의 splicing을유도하는지확인하기위하여 RT-PCR을수행하여분석하였다. XBP1 mrna는소포체스트레스에의해활성화된 IRE1에의해 26개의 nucleotide 가 splicing 된다. RT-PCR을통하여증폭한 unspliced XBP1 (uxbp1) 과 spliced XBP1 (sxbp1) 는 26개의 nucleotide 밖에차이가나지않아바로전기영동으로분리하여확인하기가어렵다. 따라서 splicing 되는 26개의 nucleotide 영역안에존재하는 Pst1 제한효소절단부위를이용하여 uxbp1와 sxbp1 를구별하였다 [1]. mltc-1 세포에 camp와 hcg를시간별로처리한뒤 sxbp1의발현량을확인하였다. camp 처리후 4시간부터 sxbp1의발현이증가하기시작하며 (p<0.01), 처리시간이길어질수록발현량이점점더증가하여 8시간에가장많이증가하였다 (p<0.001). hcg 역시처리후 3시간부터 sxbp1 발현이증가하며 (p<0.01), 6시간후부터급격히증가하는것을확인할수있다 (p<0.001). camp와 hcg 모두처리시간의존적으로 sxbp1의발현이점점증가하는경향을보이다가 12시간부터는조금씩감소하기시작한다. 하지만소포체스트레스유도물질인 Tm 처리한경우, 처리초반인 4시간때부터 sxbp1의발현이급격히증가하였다 (p<0.001). 이결과들을통하여 camp와 hcg 처리는 mltc-1 세포에소포체스트레스를유발하며 IRE1/XBP1 경로를활성화시키는것을확인할수있었다. 고찰마우스정소의레이디히세포인 mltc-1 세포에 hcg와 camp를처리하여 Grp78/Bip의발현증가를통하여소포체스트레스가유도되었음을확인하였고이에대한방어기작으로 UPR signaling 중활성 IRE1이증가하며 XBP1 mrna의 splicing이유도되는것을통하여 IRE1/XBP1 경로가활성화됨을확인할수있었다. 본연구에서는이 IRE1/XBP1 경로를분석하기위하여여러가지실험방법을사용하였다. 먼저소 A 500μM camp B 500μM camp Fig. 3. hcg and camp induce the ER stress- dependent splicing of XBP1. Quantification of green fluorescent cells by flow cytometry. After transfected mltc-1 cells with pcax-f-xbp1-venus (A) and pcax-xbp1 DBD-venus (B) were treated with camp (500 μm), hcg (5 IU/ml) for 12 hr, and then cells were analyzed with flow cytometry. The black and red lines indicate non-treated mock transfectants (pcax, control) and treatments in pcax-f-xbp1-venus and pcax-xbp1 DBD-venus, respectively. The mean fluorescence from three experiments is expressed per group of cells; intensities are expressed relative to the level in the each treatment cells. Asterisks indicate a statistically significant difference (p<0.05) between control (Cont) and treated cells using Student s t-test.
6 1044 생명과학회지 2014, Vol. 24. No. 10 A B C 2 μg/ml Tm Fig. 4. hcg and its Second messenger camp induces ER stress via IRE1/XBP1 pathway in mltc-1 cells. RT-PCR analysis of spliced XBP1 (sxbp1) and unspliced XBP1 (uxbp1) in 500 μm camp (A), 5 IU/ml hcg (B) and 2 ug/ml Tm (C) for indicated times. The sxbp-1 mrna were quantified and normalized by GAPDH for RT-PCR. Data in the bar graph represent mean ± S.E.M. of three independent measurements. **, p<0.01; ***, p<0.001, compared with control (0 hr). 포체스트레스에의해 Grp78/Bip과의결합에서해리된 IRE1 단백질이인산화되는데이를분석하기위하여 Western blot을수행하여 p-ire1/ IRE1의발현을확인하였다. 다음으로인산화된 IRE1은활성화되어 endonuclease 기능을하므로이를확인하기위하여 ERAI인 pcax-f-xbp1-venus, pcax-f-xbp1 DBD-venus vector를세포에도입하여형광현미경과 Flow cytometry를통하여분석하였다. 그리고소포체스트레스에의한세포내 XBP1 mrna의 splicing이유도되는지확인하기위하여 total RNA를추출하여 RT-PCR을수행한뒤 Pst1 제한효소를처리하여 unspliced XBP1과 spliced XBP1 분리하여발현량을조사하였다. 다음과같은실험방법들을이용하여 IRE1/XBP1 경로가활성화됨을판단할수있었으며, 본연구를통하여정립된실험방법을응용하여 mltc-1 세포내에서활성화된 IRE1과 XBP1의기능을규명하는데기여할것으로사료된다. 이전연구에서활성형 ATF6 (p50) 를세포에과발현시켰을때테스토스테론합성에필수적인성호르몬합성효소인 3β- hydroxysteroid dehydrogenase (3β-HSD) 의발현을감소시켰으나, 다른 UPR signaling의하위신호전달유전자인 sxbp1과 ATF4를과발현시켰을경우 3β-HSD의발현에영향을주지못하였다 [9]. 따라서 hcg 처리에의해활성화되는 sxbp1은성호르몬합성효소의발현에직접적으로관여하지않지만 ERSE 부위에결합하여소포체스트레스관련유전자의전사를증가시키고단백질의폴딩을도와주는샤페론기능을할것으로사료되며추가적인실험을통하여이가설을증명할예정이다 [7, 15]. 또한 IRE1이활성화되면 endonuclease domain과 serine-threonine kinase domain을가져 2가지기능을하게되는데, 본연구에서는활성 IRE1의 endonuclease기능에대하여만증명하였다. 활성 IRE1은 serine-threonine kinase로써역할을하여 pro-apoptotic 인자인 Jun N-terminal kinase (JNK) 를인산화시켜서소포체스트레스매개의세포자멸사를유도한다고알려져있다 [12, 13]. 우리도이전연구를통하여 5IU/ml의 hcg를처리뒤 12시간부터 p-jnk의단백질발현량이증가하며이것이소포체매개의세포자멸사를유도할것이라고보고하였다. hcg 처리에의해증가하는활성 IRE1의 endonuclease domain과 serine-threonine kinase domain이각각세포에작용하는시기에대하여아직연구가되지않았다. 따라서 hcg의처리시간및농도에따라활성 IRE의어떤 domain이활성화되는지본연구에서이용한실험방법들을이용하여이를분석할수있을것으로예상된다. 본논문을통하여향후정소의레이디히세포내에서 hcg 처리에의한 IRE과 XBP1 유전자의역할연구에적용및응용할수있는가능성을제시하였으며이결과는기초연구자료로써활용할수있을것으로사료된다. 감사의글 본연구는한국연구재단이공분야기초연구사업 (NRF- 2012R1A1A ) 및농림축산식품부생명산업기술개발사업 ( SB020) 그리고미래창조과학부한국생명공학연구원바이오인프라위탁과제 (KGM ) 의지원에의하여연구되었음. References 1. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbard, S. R., Harding, H. P., Clark, S. G. and Ron, D IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mrna. Nature 415, Do, M. H., Santos, S. J. and Lawson, M. A GNRH
7 Journal of Life Science 2014, Vol. 24. No induces the unfolded protein response in the LbetaT2 pituitary gonadotrope cell line. Mol Endocrinol 23, Fonseca, S. G., Gromada, J. and Urano, F Endoplasmic reticulum stress and pancreatic beta-cell death. Trends Endocrinol Metab 22, Hamamura, K. and Yokota, H Stress to endoplasmic reticulum of mouse osteoblasts induces apoptosis and transcriptional activation for bone remodeling. FEBS Lett 581, Iwawaki, T., Akai, R., Kohno, K. and Miura, M A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat Med 10, Lai, E., Teodoro, T. and Volchuk, A Endoplasmic reticulum stress: signaling the unfolded protein response. Physiology (Bethesda) 22, Lee, A. H., Iwakoshi, N. N. and Glimcher, L. H XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol 23, Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L. H. and Hotamisligil, G. S Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, Park, S. J., Kim, T. S., Park, C. K., Lee, S. H., Kim, J. M., Lee, K. S., Lee, I. K., Park, J. W., Lawson, M. A. and Lee, D. S hcg-in-duced endoplasmic reticulum stress triggers apoptosis and reduces steroidogenic enzyme expression through activating transcription factor 6 in Leydig cells of the testis. J Mol Endocrinol 50, Samali, A., Fitzgerald, U., Deegan, S. and Gupta, S Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int J Cell Biol 2010, Schroder, M. and Kaufman, R. J The mammalian unfolded protein response. Annu Rev Biochem 74, Szegezdi, E., Logue, S. E., Gorman, A. M. and Samali, A Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep 7, Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P. and Ron, D Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287, Wu, J. and Kaufman, R. J From acute ER stress to physiological roles of the Unfolded Protein Response. Cell Death Differ 13, Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. and Mori, K XBP1 mrna is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, Zhao, L. and Ackerman, S. L Endoplasmic reticulum stress in health and disease. Curr Opin Cell Biol 18, 초록 :mltc-1 세포에 hcg 처리에의해유도된소포체스트레스가 IRE1/XBP1 경로의활성화유발박선지 1 김태신 2 이동석 1 * ( 1 경북대학교자연과학대학생명과학부 (BK 21 plus 사업 ), 2 캘리포니아대학교생식의학부 ) 본연구의목적은마우스레이디히세포인 mltc-1 세포에사람융모성성선자극호르몬인 hcg를처리하여유도되는소포체스트레스가 IRE1/XBP1 경로를통하는지분석하는것이다. 이전연구에서 hcg처리에의해레이디히세포는소포체스트레스매개의세포자멸사가유도될뿐만아니라 ATF6경로를조절함으로써 UPR이성호르몬합성효소의발현에중요한역할을하는것을증명하였다. UPR 경로는또한 IRE1/XBP1 경로를통하여조절되는것이알려져있지만레이디히세포에서 hcg에의한소포체스트레스에의해 IRE1/XBP1 경로의활성화가유도되는지에대해서는거의알려져있지않다. mltc-1세포에서 hcg 처리후 IRE1/XBP1경로의활성을조사하기위하여, 인산화된 IRE1 단백질확인하기위한 western blot, XBP1 mrna splicing 확인하기위한 RT-PCR을수행하였다. 또한우리는 IRE의활성을관찰하기위하여소포체스트레스-활성표지자 (ERAI) construct를이용하고이를형광현미경과 flow cytometry를이용하여분석하였다. 결과적으로, hcg 처리에의해인산화된 IRE1 단백질의발현수준이두드러지게증가하였다. F-XBP1-venus/ F-XBP1 DBD-venus가도입된 mltc-1 세포에서, hcg 처리에의해녹색형광을띄는세포들이유도되었고각각핵 / 세포질에서발현하는것을확인할수있었다. 게다가 hcg 처리후에 XBP1 mrna의 splicing 또한상당히증가되는것을확인할수있었다. 이결과들을통하여종합해볼때레이디히세포에서 hcg 처리에의해유도되는소포체스트레스가 IRE1/XBP1 경로의활성을유발하는것을확인할수있었다.
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationMicrosoft Word - 03-송창화.doc
Journal of Bacteriology and Virology 2012. Vol. 42, No. 3 p.196 202 http://dx.doi.org/10.4167/jbv.2012.42.3.196 Review Article Endoplasmic Reticulum Stress Responses and Apoptosis Chang-Hwa Song * Department
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information01_( ) 구승회.hwp
대한비만학회지 : 제 20 권제 2 호 2011 종설 비만과 ER Stress 성균관대학교의과대학분자세포생물학교실및삼성생명과학연구소 구승회 * Obesity and ER Stress Seung-Hoi Koo * Department of Molecular Cell Biology and Samsung Biomedical Research Institute, Sungkyunkwan
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information07(JLS_140171).hwp
Journal of Life Science 2014 Vol. 24. No. 10. 1085~1091 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.10.1085 Effects of Selenate on dipocyte Differentiation
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )
Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information<30315F D C1F6BBF3B0ADC1C25FB9DAB1D9B1D428B1E8B5CEB8B8BCF6C1A4292E687770>
대한내분비학회지 : 제 23 권제 1 호 2008 지상강좌 소포체스트레스 (Endoplasmic Reticulum Stress) 와당뇨병 계명대학교의과대학내과학교실 김미경 박근규 Endoplasmic Reticulum Stress and Diabetes Mi Kyung Kim, Keun Gyu Park Department of Internal Medicine,
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information590호(01-11)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationⅢ Ⅲ Ⅰ Ⅰ Ⅰ α < < < < < χ χ Ⅰ Ⅱ Ⅲ Ⅰ Ⅲ Ⅰ Bagozzi, R., & Dholakia, U. (2002). Intentional Social Action in Virtual Communities. Journal of Interactive Marketing, 16(2), 2-21. Borkovec, T. D. (1976).
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 3~30 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 01. 08 2016. 01. 09 2016. 02. 25 ABSTRACT
More information한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
More information도비라
광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information