36(2) 16.fm

Save this PDF as:

Size: px
Start display at page:

Download "36(2) 16.fm"


1 w ³wz The Korean Journal of Mycology The Korean Society of Mycology Kor. J. Mycol. 36(2) : (2008) Aspergillus nidulans Ÿ w y w sila» w Áš Á½w Áw³ Áw z Áw ,4 1Ÿw w, 2ûw ew, 3w œw, 4Ÿw œw Isolation and Functional Analysis of the sila Gene That Controls Sexual Development in Response to Light in Aspergillus nidulans Sang-Yong Han 1, Jin-A Ko 1, Jong-Hak Kim 1, Kyu-Yong Han 2, Kap-Hoon Han 3 and Dong-Min Han 1,4 1 Division of Life Sciences, Wonkwang University, Iksan , Korea 2 Department of Dental Hygiene, Namseoul University, Chonan , Korea Department of Pharmaceutical Engineering, Woosuk University, Wanju , Korea 4 Institute of Biotechnology, Wonkwang University, , Korea 3 (Received December 17, Accepted December 27, 2008) ABSTRACT: When a homothallic ascomycete Aspergillus nidulans is exposed to visible light, cleistothecial development is inhibited. The light response of development in A. nidulans implies the existence of delicate regulation process including reception and translocation of light signaling and determination of development. Previously, mutants that could develop cleistothecia even in the presence of relatively intensive visible light were isolated and several complementation groups were identified. A gene that was able to complement the sila98 mutation, which was responsible for preferred cleistothecia development under visible light, was isolated from AMA-NotI genomic library. The sila gene retained in the 4.3 kb recovered genomic library DNA has an open reading frame (ORF) consisted of 2,388 bp nucleotides, interrupted by 3 introns and consequently encoding 795 amino acids. The putative SilA carries a Zn 2 Cys 6 binuclear cluster motif at N terminus and shows high amino acid sequence similarity to Aro80p of Saccharomyces cerevisiae. Deletion mutants of sila showed a strong induction of sexual development under visible light, indicating that SilA is involved in the negative regulation of sexual development in response to the light. KEYWORDS:Aspergillus nidulans, Light, Sexual development, sila, Transcription factor û³ w ³ (sexual) (asexual) y. s(vegetative cell) w (haploid)š, (diploid) y ù kù. ³ Aspergillus nidulans w y 3 y ƒ, w yƒ, ƒ w w, š ƒ w š nondisjunction w yw (parasexual cycle) (Pontecorovo et al., 1953). q ww z w q(coenocytic hyphae) w (dikaryon) û pw q ascogenous hyphae yw ww(karyogamy) ùš (meiosis) e, z s w wù û(ascus) 8 ûs(ascospore)ƒ *Corresponding author < q w z q w cleistothecium ü ù. w yw w s (conidia) x ƒ x š (Adams and Yu, 1998),»ù» w w. x w w, s x 200 ƒ vwš (Clutterbuck, 1969), s xwš ³ l mrna w cdna w 1,200 ƒ š (Timberlake, 1980), 6% w, sx pw w 300. mrna ƒ s y w. w y y w 189

2 190 w flug(lee and Adams, 1994), y w flbb, flbc, flbd(adams and Yu, 1998) š. y Aspergillus yù Saccharomyces Neurospora y w p š y w. y w k ù(han et al., 1994). w x A. nidulans s x y w» w», y w wü» w r ƒ wš. A. nidulans y w e y w ³ ww p ƒ w y š yƒ y w y(han et al., 2003)., š s k y yƒ š, s yƒ (acetate) k y. ƒ y» y y y y û wš. w ³ š ¼ z œ» wš w» w, w x (hypoxia) x»(anaerobic) y ƒ (Han et al., 1990). w 1M KCl, 0.5 M MgSO 4 p(salt stress) 1.2 M sorbitol n p(osmotic stress) w p(light stress) y pƒ w y š y ù {k s y s sƒ y ùküš. w p w y w w l w wš. p w y w w p ƒ w w k w w, š n k k œ w w w, w p w w ƒ 8 ƒƒ 6 complementation w q ƒƒ sila98, silb216, silc18, sild6, sile11, silf174 (Min et al., 2007). sila98 w sila w wš, w x w» wš w. ³, l, A. nidulans x ³ Fungal Genetics Stock Center(FGSC) A4 w q x ³ pyrg89 ƒ A773³ w vea + pyrg89 t w w HSY2(veA +, argb::trpc, ana1) w w. Escherichia coli ³ DH5α w. w» w genomic library FGSC w prg3-ama1-noti library w š, w plasmid DNA DNA s w l pbluescript II SK( )(Stratagene, USA) T-Easy vector (Promega, USA) w. (CM) (MM) Han (1990) w. A. nidulans ³ 37 o C, 3 w, w w vw ƒ w. g j» ww» w sodium deoxycholate ƒ 500 mg/l ƒw. s 3 w l 0.01% Tween80 yw w w 1ml w, xy w. y z w» w z, 24 w wš wk w(han et al., 1990). E. coli ³ LB, ampicillin kanamycin ƒ LB MacConkey agar w. DNA sila» w» w AMA1- Notlibrary NotI-SmaI 4.3 kb genomic DNAƒ r üš pbluescript II SK jw psila w wz w (Fig. 1). r SalI self ligation 6 kb(psila9803) SalI-SalI 1.3 kb r(psila9804), PstI self ligation 5.7 kb(psila9801), PstI-PstI r 1.6 kb(psila9802) pbluescript II SK subcloningw» w. j ww» w v DNA alkaline lysis(sambrook et al., 1989) w w, wz ù A. nidulans xyl v DNA z, š Southern analysis ww» w genomic DNA Lee and Taylor(1990) w., ³ ƒ 20~60 mg p, 400 µl Lysis buffer[50 mm Tris-Cl(pH 8.0), 50 mm EDTA(pH 8.0), 3% SDS, 1% 2-mercaptoethanol] ƒw yww. tube 65 C 1 k o z, phenol/chloroform wš k e

3 의 광 조건하 유성분화에 관여하는 sila 유전자의 분리 및 기능분석 Aspergillus nidulans 191 Fig. 1. DNA sequence and Physical map of sila gene. (A) The complete sequence of SmaI-NotI DNA fragment which includes the whole sila ORF is shown. Underlined capitalized letters are binuclear zinc cluster motif and underlined small alphabet regions indicate introns. (B) Restriction map and gene structure of sila gene. sila ORF is indicated as arrow. Introns and Zn2Cys6 binuclear zinc cluster motif are represented as black boxes and dashed box, respectively.

4 192 w Table 1. Oligonucleotide primers used in this study Name SAS 1 OMK24 OMK25 OMK26 OMK27 OMK28 argb Forward argb Reverse SAS22 SAS23 Sequences (5'-3') ACAATGTCCAAAGGCACG AAGGGTTCGTGAGCATACCC CAAATGAGGCCTCTAAACTGGTCAGGCAAGGGATACAAGCCTTG CAAGGTAGATCCAGGCCTAACACAAAGAGTGTGTGGTTGAGGGCAG CTGACGTAGCAAGCACTGCA GCGATCATTTAGGCTGTG GACCAGTTTAGAGGCCTC GTGTTAGGCCTGGATCTA CCCTCGAGGGCCACACTCTTAC CCCTCGAGGGGAATTTGATTGT Fig. 2. Multiple alignment of Zn 2 Cys 6 binuclear zinc cluster motif between various fungal transcription factors. g. DNA Sambrook(1989) w DNA w. UV mw yw ³ complementationw ywš, A. nidulans ƒ (autonomous replication) AMA1 ƒš l w šz xy genomic library prg3-ama1-noti library w xy w. A. nidulans xy Min (2007) w E. coli xy CaCl 2 w (Sambrook et al., 1989). wz Min (2007) ww. ORF w PCR RT-PCR rtaq ExTaq(Takara, Japan) w, reverse transcriptase AMV(Promega, USA) w. 0.7% agarose gel» w, DNA band UltraClean TM 15 DNA Purification Kit w z, pgem -T Easy Vector System I w j w. (deletion) w w Double-Joint PCR (Yu et al., 2006) ww. omk24, omk25 primer(table 1; Fig. 3A, ) 5'-flanking region, omk26, omk27 primer(table 1; Fig. 3A, ) 3'- flanking region sw PCR wwš, argb argb Forward, argb Reverse primer (Table 1; Fig. 3A, ) PCR ww PCR ü. PCR PCR 3 r w ww PCR wwš, annealingw PCR mixture x wš nested primer SAS1, omk28(table 1; Fig. 3A, ) PCR w sila deletion w PCR w xy ³ HSY2 x yw(fig. 3A). sila x l w» w A. nidulans x ³ genomic DNA x w SAS22 SAS23 primer(table 1) PCR ww sila ORF sww 2.4 kb PCR product š, pgem T-Easy l jw.» z» psilaoet8 ü. psilaoet8 niia promoter swwš prb2-1 vector ƒƒ XhoI w ligation wš E. coli xy psilao21 w. Southern Northern hybridization 0.7% TAE agarose gel DNA» w 0.4 N NaOH w upward capillary mw Hybond TM - N + g. DNA k z, cross linking w UV wš Modified church buffer(church and Gilbert, 1984) [α- 32 P] labeled probe w hybridization ww. Probe Random primer labeling kit(takara, Japan) w w. Hybridization z, membrane 2Ü SSC 0.5% SDS yw 10 wš, w w z 1Ü SSC 0.1% SDS yw 65 o C 30 w. membrane 70 o C KODAK BioMax MS Film(Kodak, USA) g. Northern A. nidulans RNA ³ ƒ 50~100 mgl Easy-BLUE TM (intron) w w. RNA( 20 mg) 1.0% formaldehyde agarose gel»w, 20Ü SSC w upward capillary mw Hyboind TM -N+ g

5 의 광 조건하 유성분화에 관여하는 sila 유전자의 분리 및 기능분석 193 Aspergillus nidulans Fig. 4. Phenotype of sila over-expression strain. (A) Confir- mation of over-expression of sila by Northern blot analysis. (B) Phenotypes of sila over-expression strain (OSILA11). AT (ammonium tartrate); repression condition, SN (sodium nitrate); induction condition. 이 되게 희석하여 배양접시 당 500 µl를 접종한 다음 4 일간 배양하여 관찰하였다. 유성분화의 비율은 36 mm 안에 있는 cleistothecia의 수를 세었고, 무성포자의 비율 은 36 mm 안에 있는 무성포자를 0.01% Tween 80 1 ml 에 희석시켜 haemacytometer를 이용하여 광학현미경으로 포자의 수를 세어 조사하였다. ml 2 2 결과 및 고찰 유전자의 클로닝과 염기서열 결정 A. nidulans 야생형 균주는 빛의 존재하에서는 유성생식 이 강하게 억제되는 특성을 가지고 있다. 기존의 연구에 서 자외선을 이용하여 돌연변이를 유발시킨 무성포자를 3,500 Lux의 형광등 빛이 존재하는 조건에서 완전배지에 서 배양하였을 때 자낭각(cleistothecia)을 생성하는 돌연 변이균주들 8종을 분리하였다(Min et al., 2007). 이들은 각각 6종의 서로 다른 complementation 그룹에 속하는 것으로 판명되었으며 각각의 돌연변이 유전자들은 sila98, silb216, silc18, sild6, sile11, silf174로 명명되었다(Min et al., 2007). 분리된 돌연변이균주들을 complementation 하는 유전자를 확보하고자, genomic library를 이용하여 형질전환을 실시하였다. 약 20,000여 pyrg 형질전환체를 분석하여 sila98 돌연변이를 complementation하는 genomic DNA 조각 NotI-SmaI 4.3 kb를 확보하였다. sila 유전자를 분석하기 위해 라이브러리 절편 4.3 kb의 genomic DNA를 포함하는 psila의 restriction map과 DNA의 염기서열을 결정하였으며 Open Reading Frame (ORF)이 중단되는 부위를 중심으로 RT-PCR을 수행하여 sila Fig. 3. Construction and phenotypes of sila deletion mutant. (A) Schematic diagram of generation of the sila gene deletion construct by DJ-PCR. (B) Schematic diagram of replacement of sila by a selection marker, argb. (C) Confirmation of the sila gene deletion by Southern hybridization. (D) Phenotype of sila deletion mutant (KSILA-3) and sila allelic mutant (SIL98). 다. Hybridization, probe labelling, washing 그리고 signal detection 은 Southern hybridization과 같은 방법으 로 수행하였다. 표현형 및 유성분화와 무성분화 비율 조사 A. nidulans의 야생형 균주 및 sila 유전자의 결손 돌연 변이 균주의 무성포자를 0.01% Tween 80으로 수확하여 glucose 1%의 고체 최소배지에 접종량이 cells/ 6 +

6 194 w intron yw(fig. 1). sila 3 intron 4 exon x, 3 w intron ƒƒ 52 bp(intron I), 58 bp (intron II), 57 bp (intron III) j» ƒš. ORF 2,388 bp» 795 yywš (Fig. 1).» m NCBI(Nation Center for Biotechnology Information) A. nidulans genome database(http://www.ncbi.nlm.nih.gov) w w, sila chromosome VII e wš AN annotation yw. sila sila DNA» NCBI Blastn w Saccharomyces cerevisiae aromatic w y ARO80 ùkû, SilA N-terminus 24l 59¾ ³ p(fungal specific) Gal4 type Zn 2 Cys 6 binuclear cluster DNA binding motif ƒš ùkû(fig. 2). w s w GATA boxù TATA box w GATA box 174 bp w wš TATA box 40 bp w GATA box e 174 bp GATA boxƒ w wš. š pw ws ó (telomere)» 34 bp~ 766 bp. sila sila»»w A. nidulans x ³ double crossing-over mw w(homologous recombination) w j w w. sila w» wpsila x»w Double-Joint PCR(DJ-PCR; Yu et al., 2006) ww PCR x y ³ HSY2 xy w(fig. 3). argb + xy sila98 w x xy 4 w Southern hybridization mw sila ƒ ywš w (Fig. 3C). Fig. 3B x sila ORF ü PvuII ƒ ù argb ü. x ORF 3' probe w 3.7 kb DNAƒ sila ORFƒ argb ey sila ORF PvuII 7.8 kb DNA ùkù. Fig. 3C yw ew š. sila x» w yƒ x ù,, šn(0.6 M KCl) p ƒ w k y w. šn x y w w(fig. 3D). ù sila98 w Ÿ p w»(cleistothecium) xw(fig. 3D), sila ƒ pw w y w w š. sila x(over-expression) sila x SilA pw w y w». sila ƒ w xù p x w w e» w nitrate w š ammonium w niia vl w. sila niia vl»w ww x l psilao21 w yp ³ HSY2 xy w. mw xy Southern hybridization ww wù copy ³ OSILA21³ ³ w Northern Hybridization ww x yw (Fig. 4). txx w» w niia vl x w ammonium tartrate niia vl x w sodium nitrate ƒw w ƒƒ wš, niia vl x w sodium nitrate 0.1% 0.6% k w. x ³ x txx ƒ j sila xù x w» SilA ƒ x j w e (Fig. 4). Aspergillus nidulans y ƒ ùš yƒ š yƒ. w yƒ w y w ƒ w. w w» w Ÿ w y w sila98 w, w wš A. nidulans

7 Aspergillus nidulans Ÿ w y w sila» 195 AMA-NotI genomic libraryl sila98 w sila w. sila ORF 2,388 bp» š 795 yywš. Saccharomyces cerevisiae ARO80 SilA N 51.9% ƒ Zn 2 Cys 6 motif š. sila Ÿ w š sorbitol yƒ. sila ƒ šn y w wš w. sila niia promoter xg x x j Ÿw w. šx Adams, T. H. and Yu, J. H Coordinate control of secondary metabolite production and asexual sporulation in Aspergillus nidulans. Curr. Opin. Microbiol. 1: Church, G. M. and Gilbert, W Genomic sequencing. Proc. Natl. Acad. Sci. USA 81: Clutterbuck, A. J A mutational analysis of conidial development in Aspergillus nidulans. Genetics 63: Han, D. M., Han, Y. J., Lee, Y. H., Jahng, K. Y,, Jahng, S. H. and Chae, K. S Inhibitory conditions of asexual development and their application for the screening of mutants defective in sexual development. Kor. J. Mycol. 18: Han, D. M., Han, Y. J., Chae, K. S., Jang, K. Y. and Lee, Y. H Effects of cariou carbon sources on the development of Aspergillus nidulans with vela+ or vela1 allele. Kor. J. Mycol. 22: Han, K. H. Lee, D. B., Kim, J. H., Kim, M. S., Han, K. Y., Kim, W. S., Park, Y. S., Kim, H. B. and Han, D. M Environmental factors affecting development of Aspergillus nidulans. J. Microbiol. 41: Lee, B. N. and Adams, T. H Overexpression of flba, and early regulator of Aspergillus asexual sporulation, leads to activation of brla and premature initiation of development. Mol. Microbiol. 14: Lee, S. B. and Taylor, J. W Isolation of DNA from fungal mycelia and single spores. in PCR Protocol; A Guide to Methods and Application pp Min, J. Y., Kim, H. R., Han, K. H. and Han, D. M Isolation and characterization of Aspergillus nidulans mutants which undergo sexual development in light exposure. Kor. J. Microbiol. 43: Pontecorvo, G., Roper, J. A., Hemmons, L. M., MacDonald, K. D. and Bufton, A. W. J The Genetics of Aspergillus nidulans, Advances in Genetics. 5: Sambrook, J., Fritsch, E. F. and Maniatis, T Molecular Cloning: Alaboratory manual, 2nd ed. CSH. Timberlake, W. E Developmental gene regulation in Aspergillus nidulans, Developmental Biol. 78: Yu, J. H Heterotrimeric G protein signaling and RGSs in Aspergillus nidulans, J. Microbiol. 44:

11(5)-12(09-10)p fm

11(5)-12(09-10)p fm w wz J. Kor. Soc. Cloth. Ind. 11«5y, 2009 Vol. 11, No. 5, pp.799-807(2009) w w * k ƒm w pg p w, ƒm w q w A Qualitative Research on Pursuing Image and Appearance Management Behavior of Brides Eun-Joo Bae

More information


605.fm Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **

More information


82-01.fm w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information


12(2)-04.fm J. Korean. Soc. Living. Environ. Sys. Vol. 12, No. 2, pp 106~111(2005) w y y w z œ k üœ» p ½ Á Á Á ³ Á Á½Ÿ w w w, *g», ** w w Effects of Strategies to Improve Indoor Air Quality at Pre-occupancy Stage

More information


14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

9(3)-4(p ).fm

9(3)-4(p ).fm w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young

More information


01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

8(2)-4(p ).fm

8(2)-4(p ).fm w wz J. Kor. Soc. Cloth. Ind. 8«2y, 2006 Vol. 8, No. 2, pp.177-182(2006) x w e w 1) Á Ÿ 1) Á»û 2) 1) ƒm w q w 2) w w w The Effect of Media on Taking Plastic Surgery Chong-Hee Yun 1), Su-Kwang Sung 1) and

More information


untitled [ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings

More information


16(5)-06(58).fm Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.336 y-y w Sm-Fe w ƒ w zá *Á w»» The Effect of Excess Samarium Oxide on the PreparationG of Sm-Fe Alloy Powder by Reduction-diffusion

More information


416.fm Journal of the Korean Housing Association Vol. 20, No. 4, 2009 œ qp œ y An Analysis of Change on the Apartment Unit Plans and the Interior Spaces Related to Women * Choi, ByungSook ** Park, JungA "CTUSBDU

More information


16(4)-05.fm w m y Vol. 16(4), p. 53~61, 2011 œ 광물찌꺼기에함유된오염물질의안정화를위한표면차폐재의성능평가 ½ ³ 1 Á 1 *Á½ 2 Á½ 2 Á 3 Á 3 1 w œ w œw, 2 ( ) f lp, 3 w Ÿw œ Ÿw» Evaluation of Surface Water-preventing Materials on Stabilization of

More information


17.393~400(11-033).fm Journal of the Korea Concrete Institute Vol. 23, No. 3, pp. 393~400, June, 2011 GGGGG DOI 10.4334/JKCI.2011.23.3.393 x RC { sƒ y y 1) *Á½ 1) Á 2) 1) y w œw 2) w œw Bond Strength Evaluation of RC Beams

More information

12(3) 10.fm

12(3) 10.fm KIGAS Vol. 12, No. 3, September, 2008 (Journal of the Korean Institute of Gas) ü LP ƒ š Database w š Á Á½z w ywœw (2008 6 10, 2008 8 12 (1 ), 2008 9 5 (2 ), 2008 9 5 k) Constructing a Database Structure

More information

w w l v e p ƒ ü x mw sƒw. ü w v e p p ƒ w ƒ w š (½kz, 2005; ½xy, 2007). ù w l w gv ¾ y w ww.» w v e p p ƒ(½kz, 2008a; ½kz, 2008b) gv w x w x, w mw gv

w w l v e p ƒ ü x mw sƒw. ü w v e p p ƒ w ƒ w š (½kz, 2005; ½xy, 2007). ù w l w gv ¾ y w ww.» w v e p p ƒ(½kz, 2008a; ½kz, 2008b) gv w x w x, w mw gv ª Œª Œ 30ƒ 5A Á 2010 9œ pp. 475 ~ 484 gj p ª v e p p PSC ƒ gv : II. x w Precast Concrete Copings for Precast Segmental PSC Bridge Columns : II. Experiments and Analyses ½kzÁ½ Á zá x Kim, Tae-HoonÁKim,

More information


415.fm Journal of the Korean Housing Association Vol. 20, No. 4, 2009 xw z œ p w A Study on the Spatial Characteristics of the Concept of Non-sedentary in Contemporary Multi-housing Planning ½ * Kim, Mi-Kyoung

More information


16-15(3)-07(최장경).fm Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,

More information


49(6)-06.fm Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 중학교과학교과서불꽃반응실험에서선스펙트럼관찰의문제점분석및개선연구 ½ Á Á * w w yw (2005. 10. 4 ) An Analysis and Improvement of the Line Spectrum

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일

More information


01.01~08(유왕진).fm JOURNAL OF KOREA SOCIETY OF PACKAGING SCIENCE & TECHNOLOGY. Vol. 14, No. 1 1~8 (2008) s w Á w» w Comparative Study on the Changes and Prospects of Flexible Food Packaging Design Kyung Soo Noh and Wang

More information


18211.fm J. of the Korean Sensors Society Vol. 18, No. 2 (2009) pp. 168 172 p k ù p p l xá xá ³ Á *Á w * Fabrication of the CNT-FET biosensors with a double-gate structure Byunghyun Cho, Byounghyun Lim, Jang-Kyoo

More information

14(4) 09.fm

14(4) 09.fm J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 4, pp 343~350(2007) w y y w z 14 «4 y 2007 yw» l s p»xá ³ *w w w œw, **w w w The Property of Pressure Distribution of Hybrid Underfloor Air Distribution

More information


27(5A)-07(5806).fm ª Œª Œ 27ƒ 5A Á 2007 9œ pp. 753 ~ 758 gj pœw gj p { x A New Test Method for Pure Isotropic Flexural Tensile Strength of Concretes Ÿ Á y Á x Zi, GoangseupÁOh, HongseobÁChoi, Jinhyek Abstract Proposed is

More information


25(6)-21(김유곤).fm Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 25, No. 6, 483-491, 2012 http://dx.doi.org/10.5806/ast.2012.25.6.483 Study on stability test of in process sample of recombinant Protein

More information

( )-7.fm

( )-7.fm J. of the Korean Sensors Society Vol. 19, No. 4 (2010) pp. 297 305 y x f w p j q v mg sƒ Á *Á«kw**Á **, Design and evaluation of wireless sensor network routing protocol for home healthcare Seung-Chul

More information


untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information


41(6)-09(김창일).fm 269 Ar v Na 0.5 K 0.5 NbO 3 t ½ t,, ½ w,, ½ w»œw Surface Reaction of Na 0.5 K 0.5 NbO 3 Thin Films in Inductively Coupled Ar Plasma w t œwz J. Kor. Inst. Surf. Eng. Vol. 41, No. 6, 2008. < > Dong-Pyo Kim,

More information


fm [ ] w wz Kor. J. Mater. Res. Vol. 17, No. 3 (2007) Sn-3.0 Ag-0.5 Cu/OSP 무연솔더접합계면의접합강도변화에따른전자부품열충격싸이클최적화 y Á½{ *Á Á½Ÿ * t sƒ l *w wœ w wœ œw Thermal Shock Cycles Optimization of Sn-3.0 Ag-0.5 Cu/OSP Solder

More information


06.177~184(10-079).fm Journal of the Korea Concrete Institute Vol. 23, No. 2, pp. 177~184, April, 2011 GGGGG DOI 10.4334/JKCI.2011.23.2.177 x w w MRS w p s y 1) Á z 2) Á x 3) * 1) wû w œw 2) w œw 3) w Nonlinear Analysis for

More information


03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information


93.fm Journal of the Korean Ceramic Society Vol. 45, No. 10, pp. 625~630, 2008. Effect of Storage Conditions on the Setting Properties of Brushite Bone Cement Containing Granular β-tricalcium Phosphate Sun-Ae

More information


201.fm Jour. Korean Earth Science Society, v. 31, no. 2, p. 119 128, April 2010 (w ) w x 1, *Á 2 1w Ÿ, 305-350, Ÿ w 92 2 w w œw, 402-751, Ÿ û x 253 A Comparative Analysis of Linearity and Range of Gravity and

More information


7(4)-07.fm w» wz, 7«4y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 4, (2005), pp. 282~288 ƒ ù k š w k 1 Á 2 Á 1 Áy y 1 Á 1 Á x 1 Á û 1 1 w û, 2 w (2005 11 15 ; 2005 12 2 ) Aboveground

More information


DBPIA-NURIMEDIA Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 23, No. 5, 505-510, 2010 kš wk wy»yw ¼ w w yw Electrochemical determination of hydrogen peroxide using carbon paste biosensor bound with

More information


69-1(p.1-27).fm 28 wœ p y mw š * x yw x mw šƒ w ƒ š w x ƒ y y mw œw w w x v w š w. x mw w p j wš y y w ù wœ p y mw yw w ƒ w. I. II. wœ ü wœ xy III. wœp y mw š IV. I. 1. e w ƒ e w s x y e š p š w v. w x yw x mw šƒ w ƒ.

More information

9(2)-12(p ).fm

9(2)-12(p ).fm w wz J. Kor. Soc. Cloth. Ind. 9«2y, 2007 Vol. 9, No. 2, pp.167-175(2007) 30 q q f œ w q œw œ Transition of Fashion Trends and Fashion Colors in Recent 30 Years Kyung-Hee Lee Dept. of Textile & Fashion

More information


PDF v s u e q g y vœ s s œx}s Enhancing the Night Time Vehicle Detection for Intelligent Headlight Control using Lane Detection Sungmin Eum Ho i Jung * School of Mechanical Engineering Hanyang University,

More information


인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information


09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

8(3)-15(p ).fm

8(3)-15(p ).fm w wz J. Kor. Soc. Cloth. Ind. 8«3y, 2006 Vol. 8, No. 3, pp.357-362(2006) w p k sƒ ½ Á Á w w w A Study on the Mechanical and Hand Properties of the Lining Fabrics Myung-Ok Kim, Mi-Kyung Uh and Myung-Ja

More information


13(1)-04.fm w CAD/CAM wz 13«1y 2008 2 pp. 27-35» 조선형강디지털가상공장구축및활용 w *, **, ½ ***, kx***, ½ ****, ***** Constructions and Applications of Digital Virtual Factory for Section-steel Shop in Shipbuilding Company Sang

More information


<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information


18103.fm J. of the Korean Sensors Society Vol. 18, No. 1 (009) pp. 8 3 VO w PCM yá Á Á Ÿ Built-in protection circuit module by using VO temperature sensors K. H. Song, J. B. Choi, M. W. Son, and K. S. Yoo Abstract

More information

m, w, w w. xœ y t y w en, ùw,, ƒ y (, 1994; w, 2000). ƒ x œ (NGA; National Geospatial-intelligence Agency) t t wù x (VITD; Vector product Interim Terr

m, w, w w. xœ y t y w en, ùw,, ƒ y (, 1994; w, 2000). ƒ x œ (NGA; National Geospatial-intelligence Agency) t t wù x (VITD; Vector product Interim Terr ª Œª Œ 26ƒ 1D Á 2006 1œ pp. 195~202 ˆ «~ ª xœ k» w en Analysis of Infiltration Route using Optimal Path Finding Methods and Geospatial Information ûáx Á y³á Bang, Soo NamÁHeo, JoonÁSohn, Hong GyooÁLee,

More information


untitled PMIS 발전전략 수립사례 A Case Study on the Development Strategy of Project Management Information System 류 원 희 * 이 현 수 ** 김 우 영 *** 유 정 호 **** Yoo, Won-Hee Lee, Hyun-Soo Kim, Wooyoung Yu, Jung-Ho 요 약 건설업무의 효율성

More information


16(5)-04(61).fm Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.326 ƒ w Fe œ w Cu wy SPS (II) II. w SPS p ½ *Á½ Á½{ a Á½ š b w œw, a w» gœ, b y œ Production of Fe Amorphous Powders by Gas-Atomization

More information

한국 출산력의 저하 요인에 관한 연구

한국 출산력의 저하 요인에 관한 연구 가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001

More information


18(3)-10(33).fm Journal of Korean Powder Metallurgy Institute Vol 18 No 3 011 DOI: 10150/KPMI01118383 e x 5Mg(OH) MgSO 3H O x w MgO NH OH w a báv y aá½xk aá½ aá½ cá½ bá½ a * aw» l bš w œw ck Effect of MgO and NH OH on

More information


fm Journal of the Korea Concrete Institute Vol. 24, No. 1, pp. 061~0, February, 2012 GGGGG http://dx.doi.org/10.44/jkci.2012.24.1.061 기포제종류및희석농도에따른기포콘크리트의특성 ½ 1) Á 1) Áy y 2) Á 1) * 1)œ w œw 2) œ w ywœw Properties

More information


03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information


pn10-26.fm k Jigu-Mulli-wa-Mulli-Tamsa Vol. 13, No. 3, 2010, p. 187~197 w ûw û š ³ sƒ * w w w Paleoseismological Study and Evaluation of Maximum Earthquake Magnitude along the Yangsan and Ulsan Fault Zones in the

More information


75.fm Journal of the Korean Ceramic Society Vol. 44, No. 8, pp. 451~456, 2007. A Study of Sintering Behavior and Crystallization in Li 2 O-Al 2 -SiO 2 (LAS) Glass System by RSM Kyu Ho Lee, Young Seok Kim, Young

More information


16(5)-03(56).fm Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.316 ƒ w Fe œ w Cu wy SPS (I) I. ƒ wy y Á xá½ Á½ *Á½{ a w œw, a w» gœ Production of Fe Amorphous Powders by Gas-atomization Process

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information


13(4)-06.fm w w m y wz Vol. 13, No. 4, pp. 40~53, 2008 œ w d : û 1,2 Á»k 1 Áš 1 Áš 1 *Á y 2 1w w 2 œ w w w y w A Study of Improvement for the Prediction of Groundwater Pollution in Rural Area: Application in Keumsan,

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information


DBPIA-NURIMEDIA Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information


05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information


49(6)-10.fm Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 고등학교과학동아리활동에서수준별선택실험모형의적용효과 y*á Á š w š w w w yw (2004. 12. 14 ) The Effects of Differentiated Experiments Used

More information


09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

(000-000)실험계획법-머리말 ok

(000-000)실험계획법-머리말 ok iii Design Analysis Optimization Design Expert Minitab Minitab Design Expert iv 2008 1 v 1 1. 1 2 1. 2 4 1. 3 6 1. 4 8 1. 5 12 2 2. 1 16 2. 2 17 2. 3 20 2. 4 27 2. 5 30 2. 6 33 2. 7 37 2. 8 42 46 3 3.

More information


17(1)-08(06).fm Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2010.17.1.052 š p x œ w Al jy p sƒ xá a Á Á½x * swœ w œw, a x HYSCO» Microstructure and Mechanical Behavior of Ultrafine Grained Bulk Al

More information


04-42(1)-09(김동원).fm 21 w t œwz J. Kor. Inst. Surf. Eng. Vol. 42, No. 1, 2009. < > PET»q SiO 2 rd ITO» Ÿw p a, ½ a, ³ a, a, y b a» w œw, b ( ) w p A Study on Adhesion and Electro-optical Properties of ITO Films Deposited on

More information


<352E20BAAFBCF6BCB1C5C320B1E2B9FDC0BB20C0CCBFEBC7D120C7D1B1B920C7C1B7CEBEDFB1B8C0C720B5E6C1A1B0FA20BDC7C1A120BCB3B8ED28313531323231292D2DB1E8C7F5C1D62E687770> 통계연구(2015), 제20권 제3호, 71-92 변수선택 기법을 이용한 한국 프로야구의 득점과 실점 설명 1) 김혁주 2) 김예형 3) 요약 한국 프로야구에서 팀들의 득점과 실점에 영향을 미치는 요인들을 규명하기 위한 연구를 하였 다. 2007년부터 2014년까지의 정규리그 전 경기 자료를 대상으로 분석하였다. 전방선택법, 후방 소거법, 단계별 회귀법, 선택법,

More information


노인의학200303.PDF 2 1. 2. 1) 2) 3) 3. 4. 1) 2) 3) Microcell 4) 5) 5. 6. 1.. (organism).,...?,??.,. 1935 McCay 27 . 1960 Hayflick. 10 (cytogerontology)... 2. 1),,,,.,,,.. (lipofuscin) (fluidity),., (microvilli)..,, (heat

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information


03.fm 29«6y (2009. 12) w œwz 257 š³ š p e ³ w y Á Á½ y *Á **Á y w» w w e lg Effects of Si and Mo on the Temperature-Dependent Properties of High Si High Mo Ductile Cast Irons Kyeong-Hwan Choe, Sang-Mok Lee,

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information


18(3)-09(34).fm Journal of Korean Powder Metallurgy Institute Vol 18 No 011 DOI: 104150/KPMI0111877 s WC-Co w g p w LiCoO w bá½ a* a cáv y aw» l bw» c w» l œw Synthesis of LiCoO Powders using Recycled Cobalt Precursors

More information


8.fm wz (2009), 39 «2y J. Kor. Pharm. Sci., Vol. 39, No. 2, 127-131 (2009) t y»» w»» w s sƒ ½x»Á½ ká w 1 Á x 1 Á½ 1 Á½ 2 Áx 2 Á û w w w, 1 t t»»», 2 û w œ w (2009 3 25 Á2009 3 31 Á2009 4 1 ) Cytotoxicity Evaluation

More information

( )-42.fm

( )-42.fm Journal of the Korean Ceramic Society Vol. 47, No. 3, pp. 256~261, 2010. DOI:10.4191/KCERS.2010.47.3.256 Effect of Al Alloy Composition on Physical and Crystallographical Properties of Plasma Electrolytic

More information


02양은용 The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),

More information


20(1)-12[PM리뷰].fm J Kor Powd Met Inst Vol 0 No 1 013 DOI: 104150/KPMI01301060 PM Review s l ƒ z w Á yá aá bá vc w aw» pk bw»» c w œw Trend in Research and Development of Recovery of Valuable Metallic Powder from Wasted

More information


Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information


05.581~590(11-025).fm Journal of the Korea Concrete Institute Vol. 23, No. 5, pp. 581~590, October, 2011 GGGGG http://dx.doi.org/10.4334/jkci.2011.23.5.581 š p w» j v p 1 Á 2 Á½ 2 Á 1 * 1 š w zy œw 2 w» Characteristics of Early-Age

More information

[ ]-13.fm

[ ]-13.fm J. of the Korean Sensors Society Vol. 19, No. 2 (2010) pp. 155 159 0.96( p ½ Á Á Dielectric and piezoelectric properties of 0.96( lead-free ceramics Mi-Ro Kim, Seok-Jin Yoon, and Ji-Won Choi Abstract 0.96(

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information


<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2 014 p. ; cm. -- ( 연구보고 ; 14-25) 참고문헌 수록

국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2 014 p. ; cm. -- ( 연구보고 ; 14-25) 참고문헌 수록 A Study on Creation of Input Calculation Table for Cities and Counties of Gangwon Province 국립중앙도서관 출판시도서목록(CIP) 강원도 시군별 투입산출표 작성 연구 / 김진기, 박봉원 [ 공저]. -- 춘천 : 강원발전연구원 (Research Institute for Gangwon) 2

More information

특허청구의 범위 청구항 1 Na-알지네이트(Na-alginate), 합성 제올라이트(synthetic zeolite)와 분말활성탄(powdered activated carbon) 을 혼합하여 2 ~ 6 %의 CaCl 2 용액에서 경화시켜 만들어진 직경 1 ~ 5 mm의

특허청구의 범위 청구항 1 Na-알지네이트(Na-alginate), 합성 제올라이트(synthetic zeolite)와 분말활성탄(powdered activated carbon) 을 혼합하여 2 ~ 6 %의 CaCl 2 용액에서 경화시켜 만들어진 직경 1 ~ 5 mm의 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C02F 3/10 (2006.01) (21) 출원번호 10-2006-0053240 (22) 출원일자 2006년06월13일 심사청구일자 (56) 선행기술조사문헌 JP01207193 A KR1020030092674 A 2006년06월13일 (45) 공고일자 2007년10월29일

More information

42.1(20) fm

42.1(20) fm KOREAN J. FOOD SCI. TECHNOL. Vol. 42, No. 1, pp. 119~123 (2010) p w w p *Áw 1 w w, 1 w t l Sensory Profiling of Rice Wines Made with Nuruks Using Different Ingredients Seung-Joo Lee* and Byung-Hak Ahn

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information


뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information


16(5)-02(57).fm Jurnal f Krean Pwder Metallurg Institute Vl. 16, N. 5, 2009 DI: 10.4150/KPMI.2009.16.5.310 /ekœ w TiC/C w w ¼ *Áw a w œ w œw, a Snthesis f TiC/C Cmpsite Pwder b the Carbthermal Reductin Prcess Gil-Geun

More information


15(1)-04(국)(p.27-33).fm w wz «y Kor. J. Clin. Pharm., Vol., No.. y sƒ Áwx Á ³ Á Ÿ y w w w w w Analysis of Drug Use Reviews in Pediatirc Inpatients Eun Jeong Shin, Hun Joo Ha Wan Gyoon Shin and Kwang Jun Park Graduate School of

More information


<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information


(019-021)......-.............. 창밖의 BT 한국 BT맨의 외국사는 이야기 연변에서 온 편지 정규재 BT 북칼럼 바이오분야 신간소개 BT에세이 연구란 무엇인가? 유영제 연금술사 전영중 연탄가스와 고스톱 김은기 나의 묻지-마-벤처 장호남 법에서 바라본 BT EPO관련 Amgen의 특허전략 이처영 생물공학 PUZZLE 만화로 보는 BT이야기 최달수 영화속 BT 스토리 버블보이 박태현 생활속 BT

More information

8-VSB (Vestigial Sideband Modulation)., (Carrier Phase Offset, CPO) (Timing Frequency Offset),. VSB, 8-PAM(pulse amplitude modulation,, ) DC 1.25V, [2

8-VSB (Vestigial Sideband Modulation)., (Carrier Phase Offset, CPO) (Timing Frequency Offset),. VSB, 8-PAM(pulse amplitude modulation,, ) DC 1.25V, [2 VSB a), a) An Alternative Carrier Phase Independent Symbol Timing Offset Estimation Methods for VSB Receivers Sung Soo Shin a) and Joon Tae Kim a) VSB. VSB.,,., VSB,. Abstract In this paper, we propose

More information

( )-10.fm

( )-10.fm J. f the Krean Sensrs Sciety Vl. 19, N. 6 (2010) pp. 483 489 DOI : 10.5369/JSST.2010.19.6.483 pissn 1225-5475/eISSN 2093-7563 p w» w v y Á Temperature sensr withut reference resistr by indium tin xide

More information

( )-44.fm

( )-44.fm Journal of the Korean Ceramic Society Vol 47, No, pp 6~67, 010 DOI:104191/KCERS010476 The Properties and Uniformity Change of Amorphous SiC:H Film Deposited using Remote PECVD System with Various Deposition

More information


1611-01제호 발 행 인 : 안 성 모 편 집 인 : 이 원 균 대한치과의사협회 발행 홈페이지:www.kda.or.kr 주2회발행(월 목) 2008년 1월 21일 (월) 1966년 12월 15일 창간 The Korean Dental Association News 제1611호 구강보건정책관 설치 추진위 출범 알 림 범치과계 단체장 참여 첫 회의 치과 의료계 전담부서인 보건

More information


25(6)-16(김영희).fm Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 25, No. 6, 441-446, 2012 http://dx.doi.org/10.5806/ast.2012.25.6.441 Distribution of heavy metals and mercury in sediment from the lake

More information

41.4(8) fm

41.4(8) fm KOREAN J. FOOD SCI. TECHNOL. Vol. 41, No. 4, pp. 399~404 (2009) The Korean Society of Food Science and Technology Bacillus subtilis Lactobacillus plantarum yw t e w Á û * œ w tœw Effect of the Mixed Culture

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information


PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

(72) 발명자 이지영 서울특별시 관악구 솔밭로7길 16, 302동 1004호 (봉천동, 낙성대 현대홈타운) 임재욱 경기도 수원시 권선구 권중로 31, 신안 303동 1002호 (권선동, 풍림아파트) 박경열 경기도 화성시 석우동 55번지 동탄예당마을 롯데 캐슬아파트 1

(72) 발명자 이지영 서울특별시 관악구 솔밭로7길 16, 302동 1004호 (봉천동, 낙성대 현대홈타운) 임재욱 경기도 수원시 권선구 권중로 31, 신안 303동 1002호 (권선동, 풍림아파트) 박경열 경기도 화성시 석우동 55번지 동탄예당마을 롯데 캐슬아파트 1 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2012년06월26일 (11) 등록번호 10-1160095 (24) 등록일자 2012년06월20일 (51) 국제특허분류(Int. Cl.) C12N 15/82 (2006.01) A01H 1/00 (2006.01) C12N 15/29 (2006.01) C07K 19/00 (2006.01)

More information