(52) CPC 특허분류 A61K 31/7048 ( ) A61K 45/06 ( ) G01N 21/6486 ( ) G01N 33/5011 ( ) G01N 2800/52 ( ) - 2 -

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "(52) CPC 특허분류 A61K 31/7048 ( ) A61K 45/06 ( ) G01N 21/6486 ( ) G01N 33/5011 ( ) G01N 2800/52 ( ) - 2 -"

Transcription

1 (19) 대한민국특허청 (KR) (12) 공개특허공보 (A) (51) 국제특허분류 (Int. Cl.) A61K 39/395 ( ) A61K 31/353 ( ) A61K 31/7048 ( ) A61K 45/06 ( ) G01N 21/64 ( ) G01N 33/50 ( ) (52) CPC 특허분류 A61K 39/395 ( ) A61K 31/353 ( ) (21) 출원번호 (22) 출원일자 ( 국제 ) 2013 년 11 월 28 일 심사청구일자 없음 (85) 번역문제출일자 2015 년 06 월 11 일 (86) 국제출원번호 PCT/IL2013/ (87) 국제공개번호 WO 2014/ 국제공개일자 (30) 우선권주장 2014 년 06 월 05 일 61/731, 년 11 월 29 일미국 (US) (11) 공개번호 (43) 공개일자 2015년08월05일 (71) 출원인 예다리서치앤드디벨럽먼트캄파니리미티드 이스라엘레호보트 피. 오. 박스 95 웨이쯔만인스티튜트오브사이언스 (72) 발명자 야르덴, 요세프 이스라엘레호보트 , 웨이쯔만인스티튜트오브사이언스, 4 크타라브스트리트네브윌너 벤 - 체트릿, 니르 이스라엘레호보트 , 피. 오. 박스 95 웨이쯔만인스티튜트오브사이언스, 예다리서치앤드디벨럽먼트캄파니리미티드내 (74) 대리인 성낙훈 전체청구항수 : 총 22 항 (54) 발명의명칭종양전이를예방하고, 암을치료하고예후를예측하며, 추정상의전이억제인자물질을확인하는방법 (57) 요약 본발명은종양이신경교종이아니라는조건하에종양의전이를예방하는방법을제공한다. 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제물질을그것을필요로하는피험자에게투여하는것, 그리고그것에의해종양의전이를예방하는것을포함한다. 또한, 본발명은암을치료하는방법을제공한다. 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제물질및암의발병또는진행과관련된세포표면수용체의억제물질을그것을필요로하는피험자에게투여하는것, 그리고그것에의해암을치료하는것을포함한다

2 (52) CPC 특허분류 A61K 31/7048 ( ) A61K 45/06 ( ) G01N 21/6486 ( ) G01N 33/5011 ( ) G01N 2800/52 ( ) - 2 -

3 명세서청구범위청구항 1 종양이신경교종 (glioma) 이아니라는전제하에, 치료학적유효량의시냅토자닌 2(synaptojanin 2, SYNJ2) 의억제인자를대상에게투여하고, 그것에의해종양전이 (metastasis) 를예방하는것을포함하는, 종양전이를예방하는방법. 청구항 2 종양이신경교종이아니라는전제하에, 종양전이를예방하기위한시냅토자닌 2(SYNJ2) 의억제인자. 청구항 3 치료학적유효량의시냅토자닌 2(SYNJ2) 의억제인자및암의발병또는진행과연관된세포표면수용체 (cell surface receptor) 의억제인자를대상에게투여하고, 그것에의해암을치료하는것을포함하는, 암을치료하는방법. 청구항 4 암을치료하기위한, 시냅토자닌 2(SYNJ2) 의억제인자및암의발병또는진행과관련된세포표면수용체의억제인자. 청구항 5 제3항에있어서, 상기암의발병또는진행과관련된세포표면수용체는수용체티로신키나아제 (receptor tyrosine kinase) 인것을특징으로하는, 방법. 청구항 6 제5항에있어서, 상기수용체티로신키나아제는 ErbB 수용체인것을특징으로하는, 방법. 청구항 7 제6항에있어서, 상기 ErbB 수용체는표피성장인자수용체 (Epidermal Growth Factor Receptor, EGFR) 인것을특징으로하는, 방법. 청구항 8 시료물질 (test agent) 의존재하에서 PI(3,4,5)P 3 에서 PI(3,4)P 2 로의 SYNJ2-매개성프로세싱을분석하는것을포함하며, 여기에서시료물질의부재하에서동일하게비교했을때시료물질의존재하에서 PI(3,4,5)P 3 에서 PI(3,4)P 2 로의감소된프로세싱은종양전이의추정상의 (putative) 억제인자를가리키는것을특징으로하는, 종양전이의추정상의억제인자를확인하는방법. 청구항 9 제8항에있어서, 상기 PI(3,4,5)P 3 에서 PI(3,4)P 2 로의 SYNJ2-매개성프로세싱을분석하는것은경쟁검정법 (competition assay) 에의해수행되는것을특징으로하는, 방법. 청구항

4 제9항에있어서, 상기경쟁검정법은 PI(3,4)P 2 에결합된 PI(3,4)P 2 결합도메인을포함하는복합체로부터의 PI(3,4)P 2 결합도메인의치환을분석하는것을특징으로하는, 방법. 청구항 11 제9항또는제10항에서, 상기경쟁검정법은형광편광 (fluorescence polarization) 경쟁검정법인것을특징으로하는, 방법. 청구항 12 대상의암세포에서 SYNJ2의레벨또는활성을측정하는것을포함하고, 여기에서영향을받지않은대조군샘플의세포에서동일하게측정한것과비교하여대상의상기암세포에서의상기 SYNJ2 활성레벨에서의상향조절 (upregulation) 은나쁜예후 (prognosis) 를나타내는것을특징으로하는, 필요로하는대상에게서암의예후를예측을하는방법. 청구항 13 제12항에있어서, 우수한표준기법 (Gold standard method) 을사용하여예후를증강시키는것 (augmenting) 을더포함하는것을특징으로하는, 방법. 청구항 14 제13항에있어서, 상기우수한표준기법은마커 (marker) 의검출을포함하는것을특징으로하는, 방법. 청구항 15 제14항에있어서, 상기마커는 HER-2 및에스트로겐수용체 (estrogen receptor, ER) 로이루어지는군으로부터선택되는것을특징으로하는, 방법. 청구항 16 제1항또는제12항에있어서, 상기전이는 EGF 의존적인것을특징으로하는, 방법. 청구항 17 제3항또는제12항에있어서, 상기암은유방암인것을특징으로하는, 방법. 청구항 18 제1항또는제3항에있어서, 상기 SYNJ2의억제인자는소분자 (small molecule), 항체 (antibody), 펩티드 (peptide) 및핵산침묵화물질 (nucleic acid silencing agent) 로이루어진군으로부터선택되는것을특징으로하는, 방법. 청구항 19 제18항에있어서, 상기소분자는표 2에열거된분자들로부터선택되는것을특징으로하는, 방법

5 청구항 20 SYNJ2의억제인자및암의발병또는진행과연관된세포표면수용체의억제인자를패키징 (packaging) 하는패키징물질 (packaging material) 을포함하는, 암의치료또는암전이의예방을위한제조물 (article of manufacture). 청구항 21 제3항의방법또는제20항의제조물에있어서, 상기암의발병또는진행과연관된상기세포표면수용체의상기억제인자는항체인것을특징으로하는, 방법또는제조물. 청구항 22 제3항의방법또는제20항의제조물에있어서, 상기암의발병또는진행과연관된상기세포표면수용체의상기억제인자는소분자억제인자 (small molecule inhibitor) 인것을특징으로하는, 방법또는제조물. 발명의설명 [0001] 기술분야본발명은그것들의몇몇구현에있어서종양의전이 (metastasis) 를예방하고, 암을치료하고예후를예측 (prognosing) 하며, 추정상의전이억제인자 (putative metastasis inhibitor) 물질 (agent) 을확인하는방법에관한것이다. [0002] [0003] 배경기술세포운동성 (cell motility) 은종양의전이를포함하는, 다양한생리학적및병리학적과정들을지지한다 (Ridley, 2011). 이동 (migraion) 의시작은액틴중합 (actin polymerization) 및 Rho-패밀리 GTP 가수분해효소 (Rho-family GTPase) 에의해촉발되며, 이는층상위족 (lamellipodia) 및사상위족 (filopodia) 의형성을유발한다. 급증하는증거들이매트릭스분해에침투위족 (invadopodia) 이라불리는다른형태의액틴-촉발성돌출부 (actin-driven protrusion) 가연루되어있음을보여준다 (Murphy and Courtneidge, 2011). 전이를파종 (seed) 하기위하여, 이동성유방암세포 (migratory breast cancer cell) 는침투위족을형성하고, 주변의혈관안으로침투한다. 유방암세포의폐 (Minn et al., 2005) 및뇌 (Bos et al., 2009) 로의전이와연관된유전자발현양상 (gene expression signature) 을특성화하는것을목표로하는연구들은부위-특이적 (site-specific) 전이의기저를이루고있는유전자세트를확인하였다. 흥미롭게도, 양쪽세트모두상피세포성장인자 (epidermal growth factor, EGF) 패밀리의구성원 (member) 을포함하며, 이는공유수용체 (shared receptor) 인 EGFR에의한신호전달 (signaling) 이전이성파종 (metastatic dissemination) 을지원한다는것을암시한다. 세포내수송 (intracellular trafficking) 이세포이동과종양진행의핵심특징으로서부상하였다 (Mosesson et al., 2008). 예를들면, 돌연변이 (mutant) p53은강화된인테그린 (integrin) 및 EGFR 수송을통해전이를촉진하며, 이는 Rab-결합단백질 (Rab-coupling protein, RCP) 에의존한다는것이밝혀졌다 (Muller et al., 2010). Rab 단백질과마찬가지로, 포스포이노시티드 (phosphoinositides) 는소포의동일성 (vesicles identity) 을결정함으로써세포구획화 (cellular compartmentalization) 에있어서중추적인역할을한다 (Yuan and Cantley, 2008). 예를들면, 포스파티딜이노시톨 3-키나아제 (phosphatidylinositol 3-kinase, PI3K) 에의한 PI(4,5)P 2 ( 포스파티딜-이노시톨 4,5-비스포스페이트 (phosphatidyl-inositol 4,5-bisphosphate)) 의 D3 위치에서 의인산화는 PI(3,4,5)P 3 를생성하며, 그것은침투위족형성을위해필요하다 (Yamaguchi et al., 2011). 유사하게는, PI(4,5)P 2 는세포내이입 (endocytosis) 및액틴역동성 (actin dynamics) 을제어하는다중단백질 (multiple protein) 을조절하지만 (Saarikangas et al., 2010), 그것의레벨은두가지추가적인형태의효소에의해엄격하게제어된다 : 포스포리파아제 C(phospholipase C, PLCγ) 는 PI(4,5)P 2 가수분해를촉진하여, 이는코필린 (Cofilin)( 액틴-절단 (actin-severing) 단백질 ) 을활성화시키고, 유방의세포이동을촉발한다 (van Rheenen et al., 2007). 마찬가지로, 시냅토자닌 2(SYNJ2) 와같은이노시톨폴리포스페이트 5-포스파타아제 - 5 -

6 (inositol polyphosphate 5-phosphatases) 는이노시톨고리의 D5 위치를탈인산화시키고, 신경교종세포의이 동을조절한다 (Chuang et al., 2004; Malecz et al., 2000). 게다가, 어떤전립선암샘플에서는동형의돌연변 이 (homozygous mutation) 가확인되었다 (Rossi et al., Cancer Genet Cytogenet Sep; 161(2):97-103). 발명의내용 [0004] 해결하려는과제 본발명은종양전이를예방하고, 암을치료하고예후를예측하며, 추정상의전이억제인자물질을확인하는방 법을제공하는것을목적으로한다. [0005] [0006] [0007] [0008] [0009] [0010] [0011] [0012] [0013] 과제의해결수단발명의요약본발명의몇몇구현들의양상에따르면, 본발명은종양이신경교종 (glioma) 이아니라는전제하에종양전이를예방하는방법을제공하며, 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제인자를그것을필요로하는대상에게투여하는것, 그리고그것에의해종양전이를예방하는것을포함한다. 본발명의몇몇구현들의양상에따르면, 본발명은암을치료하는방법을제공하며, 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제인자및암의발병또는진행과연관된세포표면수용체 (cell surface receptor) 의억제인자를그것을필요로하는대상에게투여하는것, 그리고그것에의해암을치료하는것을포함한다. 본발명의몇몇구현들의양상에따르면, 본발명은종양이신경교종이아니라는전제하에종양전이를예방하기위한시냅토자닌 2(SYNJ2) 의억제인자를제공한다. 본발명의몇몇구현들의양상에따르면, 본발명은암을치료하기위한시냅토자닌 2(SYNJ2) 의억제인자및암의발병또는진행과연관된세포표면수용체의억제인자를제공한다. 본발명의몇몇구현들에따르면, 상기암의발병또는진행과연관된세포표면수용체는수용체티로신키나아제 (receptor tyrosine kinase) 이다. 본발명의몇몇구현들에따르면, 상기수용체티로신키나아제는 ErbB 수용체이다. 본발명의몇몇구현들에따르면, 상기 ErbB 수용체는상피세포성장인자수용체 (Epidermal Growth Factor Receptor, EGFR) 이다. 본발명의몇몇구현들의양상에따르면, 본발명은종양전이의추정상의억제인자를확인하는방법을제공하며, 상기방법은시료물질 (test agent) 의존재하에 PI(3,4,5)P 3 의 PI(3,4)P 2 로의 SYNJ2-매개성프로세싱 (SYNJ2-mediated processing) 을분석하는것을포함하며, 여기에서시료물질의부재하에서동일하게비교했을 때시료물질의존재하에서 PI(3,4,5)P 3 의 PI(3,4)P 2 로의감소된프로세싱은종양전이의추정상의억제인자를 나타낸다. [0014] 본발명의몇몇구현들에따르면, 상기 PI(3,4,5)P 3 의 PI(3,4)P 2 로의 SYNJ2- 매개성프로세싱을분석하는것은 경쟁검정법 (competition assay) 에의해수행된다. [0015] 본발명의몇몇구현들에따르면, 상기경쟁검정법은 PI(3,4)P 2 에결합되어있는 PI(3,4)P 2 결합도메인 (binding domain) 을포함하는복합체 (complex) 로부터 PI(3,4)P 2 결합도메인의이동 (displacement) 을분석한다. [0016] [0017] [0018] 본발명의몇몇구현들에따르면, 상기경쟁검정법은형광편광 (fluorescence polarization) 경쟁검정법이다. 본발명의몇몇구현들의양상에따르면, 본발명은그것들을필요로하는대상에서암의예후를예측하는방법을제공하며, 상기방법은대상의암세포에서 SYNJ2의레벨또는활성을측정하는것을포함하며, 여기에서영향을받지않은대조군샘플의세포에서동일하게측정한것과비교하여대상의암세포에서 SYNJ2 활성레벨의상향조절 (upregulation) 은나쁜예후 (poor prognosis) 를나타낸다. 본발명의몇몇구현들에따르면, 방법은우수한표준기법 (Gold standard method) 을사용하여예후를증강시키 - 6 -

7 는것 (augmenting) 을더포함한다. [0019] [0020] [0021] [0022] [0023] [0024] [0025] [0026] [0027] [0028] 본발명의몇몇구현들에따르면, 상기우수한표준기법은마커 (marker) 의검출을포함한다. 본발명의몇몇구현들에따르면, 상기마커는 HER-2 및에스트로겐수용체 (estrogen receptor, ER) 로이루어지는군으로부터선택된다. 본발명의몇몇구현들에따르면, 상기전이는 EGF 의존성이다. 본발명의몇몇구현들에따르면, 상기암은유방암이다. 본발명의몇몇구현들에따르면, 상기 SYNJ2의억제인자는소분자 (small molecule), 항체 (antibody), 펩티드 (peptide) 및핵산침묵화물질 (nucleic acid silencing agent) 로이루어진군으로부터선택된다. 본발명의몇몇구현들에따르면, 상기소분자는표 2에열거된분자들로부터선택된다. 본발명의몇몇구현들의양상에따르면, 본발명은암의치료또는암전이의예방을위한제조물 (article of manufacture) 을제공하며, SYNJ2의억제인자및암의발병또는진행과연관된세포표면수용체의억제인자를패키징 (packaging) 하는패키징물질 (packaging material) 을포함한다. 본발명의몇몇구현들에따르면, 상기암의발병또는진행과연관된세포표면수용체의억제인자는항체이다. 본발명의몇몇구현들에따르면, 상기암의발병또는진행과연관된세포표면수용체의억제인자는소분자억제인자이다. 달리정의하지않는한, 본원에사용된모든기술및 / 또는과학용어는그발명이속하는기술분야에서통상의지식을가진자에의해일반적으로이해되는것과동일한의미를가진다. 비록본원에기술된것들과유사하거나동등한방법들및물질들이본발명의구현들의실시또는테스트에사용될수있다할지라도, 예시적방법및 / 또는물질들을아래에설명한다. 갈등시, 정의들을포함하여본특허명세서는조절될것이다. 게다가, 물질들, 방법들및실시예들은단지예시적일뿐이며, 반드시한정하는것으로의도된것이아니다. [0029] 발명의효과 본발명에따르면종양전이를예방하고, 암을치료하고예후를예측하며, 추정상의전이억제인자물질을확인 하는방법을제공할수있다. [0030] 도면의간단한설명본발명의몇몇구현들은첨부된도면들을참조하여단지예의형태로만본원에기술된다. 이제특히도면들을상세하게참조하여, 자세한사항들은사례를들어, 발명의구현들의예시적논의를위한것임이강조된다. 이점과관련하여, 도면을예로들은설명은당업자들에게본발명의구현들이어떻게실시될수있는지명백하게해준다. 도면에서 : 도 1A-I는 EGF가유방세포의침습성성장 (invasive growth) 을촉진하며, 특정유전자세트를유도한다는것을보여준다. 도 1A - MCF10A 세포를성장인자의부재하에치상하고, 클러스터를형성시켰다. 72시간후, 세포를표시된성장인자로처리하여 ( 각 10 ng/ml로 ), 위상차이미지 (phase contrast image) 를 24시간후에획득하였다 ( 기준자 (scale bar), 50 μm). 도 1B - MCF10A 세포를표시된리간드의존재하에 (10 ng/ml), 나타나있는바와같이, 이동또는침습챔버에치상하고, 18시간후아래구획으로이동한세포를크리스탈바이올렛 (crystal violet) 으로염색하였다 ( 왼쪽패널 ). EGF 처리의효과에대해정규화된 (normalized) 이동및침습시그널의정량을나타내었다. 데이터는 2번반복한대표실험으로부터의세개의생물학적샘플 (biological triplicates) 의평균 ± S.D. 를나타낸다 ( 오른쪽패널 ). 도 1C - MCF10A 세포를억제인자 AG-1478(1 μm), U0126(5 μm) 또는보르트만닌 (Wortmannin)(200 nm) 을포함하거나포함하지않는, EGF 함유배지가담긴트랜스웰인서트 (transwell inserts) 에치상하고, 18시간동안이동하게하였다. 데이터는세개샘플의평균 ± S.D. 를나타낸다. 실험은두번반복하였다. 도 1D - ( 혈청에의해서가아니라 (Amit et al., 2007)) EGF에의해인간유방 MCF10A 세포로특이적으로유도된 425개의유전자리스트는 MDA-MB-231 세포의전이의상황하에서상향조절된유전자들 (1,597개) 과교차하였다 (Minn et al., 2005). 23개의중복된유전자들중하나는 5'-포스파티딜이노시 - 7 -

8 톨리피드포스파타아제 (5'-phosphatidylinositol lipid phosphatase) 시냅토자닌-2(SYNJ2) 를암호화한다. 도 1E - MCF10A 세포를 LacZ(crtl) 또는 SYNJ2-GFP(SYNJ2-OX) 를암호화하는렌티바이러스입자 (lentiviral particles) 로감염시켰다. 내재적 SYNJ2와 SYNJ2-GFP 융합단백질의발현레벨을면역학적블로팅 (immunoblotting) 으로검출하고, 튜불린 (tubulin) 에대한탐침 (probing) 으로동일한단백질로딩 (loading) 을확인하였다. 도 1F - MCF10A 세포의 Ctrl 및 SYNJ2-OX 클론을 EGF의부재 (NT의부재 ) 또는존재 (10 ng/ml) 하에이동챔버에치상하고 ( 세포 / 웰 ), 22시간동안이동하게하였다. 필터의다른쪽에도달한이동세포를크리스탈바이올렛으로염색하고, 이미지를얻었다. 도 1G - MCF10A 세포를 sirna 대조군 (sictrl) 또는 SYNJ2로유도된 sirna(sisynj2) 로형질감염시키고, SYNJ2의단백질레벨을 36시간후에면역학적블로팅으로검출하였다. Ras-GAP에대한면역학적블로팅으로동일한단백질로딩 (loading) 을확인하였다. 도 1H - G에존재하는세포를 EGF의부재 (NT의부재 ) 또는존재 (10 ng/ml) 하에이동챔버에치상하고 ( 세포 / 웰 ), 22시간동안이동하게하였다. 필터의하부면 (lower face) 에도달한이동세포를크리스탈바이올렛으로염색하고, 이미지를캡처하였다. 도 1I - MCF10A 세포의컨플루언트배양물 (confluent cultures) 을표시된 sirna로처리하였다. 일단단일층 (monolayer) 이형성되면, 그것들을스크래치완결 (scratch closure) 속도를관찰하는자동화된스크래칭시스템에넣었다. 도 2A-E는 EGF에의한 SYNJ2의전사적유도 (transcriptional induction) 가침습적성장을촉진한다는것을보여준다. 도 2A - 혈청에굶주린 (serum-starved) MCF10A 세포를 EGF(20 ng/ml) 또는혈청 (5%) 으로자극하고, SYNJ2 mrna 발현을마이크로어레이 (microarray) 또는 RT-qPCR을사용하여분석하였다. 도 2B - MCF10A 세포를 EGF로자극시키고, 지정된바와같이추출하고면역학적블로팅을하였다. 도 2C - GFP-SYNJ2(SYNJ2-OX) 를암호화하는바이러스또는대조군으로서 LacZ(Ctrl) 로감염된 MCF10A 세포를 EGF의부재또는존재하에 4일간배양하였다. 팔로이딘 (phalloidin) 및 DAPI를이용하여위상차 (phase contrast) 이미지 ( 상부, bar: 100 μm) 및공초점 (confocal) 이미지 ( 하부, bar: 20 μm) 를얻었다. 도 2D-E - MCF10A 세포를 EGF의부재 (NT의부재 ) 또는존재 (10 ng/ml) 하에이동또는침습챔버에서 ( 세포 / 웰 ) 22시간동안배양하였다. 필터의하부에도달한세포를염색하고, 필터의피복률 (coverage) 을정량하였다 ( 평균 ± S.D.). 도 3A-G는유방세포의이동및침습을수반하는리딩에지 (leading edge) 에대한 SYNJ2의유도성전위 (inducible translocation) 를나타낸다. 도 3A - 대조군 shrna(shctrl) 또는 SYNJ2에대해유도된 shrna(shsynj2) 와마찬가지로, MDA-MB-231 세포를 LacZ(ctrl) 또는 V5로태그된 SYNJ2(SYNJ2-V5) 를암호화하는렌티바이러스입자로감염시켰다. V5-SYNJ2 및내생적 (endogenous) SYNJ2의단백질레벨을면역학적블로팅으로검출하였다. AKT에대한면역학적블로팅으로동일한단백질의로딩 (loading) 을확인하였다. 도 3B - SYNJ2 또는대조군으로서 LacZ를안정하게과발현하는 MDA-MB-231 세포의위상이미지 ( 왼쪽패널 ) 및침습이미지 ( 오른쪽패널 ). 침습검정법 (invasion assay) 을사용하여, 세번반복하여침습능력 (invasive capacity) 을측정하였고, 침습세포를정량하여대조군 (Ctrl) 에대해정규화시켰다. 기준자 (Scale bar), 50 μm. 도 3C - MDA-MB- 231 세포를 SYNJ2로유도된 sirna 올리고뉴클레오티드 ( 또는 sictrl) 로형질감염시켰다. 36시간후, SYNJ2의단백질레벨을면역학적블로팅으로검출하였다. Ras-GAP에대한면역학적블로팅에으로동일한단백질의로딩을확인하였다. 도 3D - C로부터의세포를이동또는침습챔버에치상하고, 18시간동안배양하였다. 이동및침습시그널을정량하고, EGF로처리된 sictrl 세포에대해정규화시켰다. 나타낸데이터는세번반복실험의평균 ± S.D. 이다. 도 3E - GFP-SYNJ2를일시적으로발현하는 MDA-MB-231 세포를유리커버슬립에치상하고, TGF α(10 ng/ml) 로자극하였다. 타임-랩스현미경 (time-lapse microscopy) 사진을얻었다 ( 매 10초마다 ). 보여지는이미지는반전 (inverted) 된것이며, 검은점들 (spots) 은층상위족의기저에서의 SYNJ2 및그것의집합체 (assembly) 를나타낸다. 기준자, 10 μm. 도 3F - MDA-MB-231 세포를 TRITC-팔로이딘을사용하여내재적 SYNJ2 및 F-액틴 (F-actin) 에대해면역염색하였다. 네모친부분을확대하였다. 기준자, 10 μm. 도 3G - MCF10A 세포를 EGF로 18시간동안자극시킨후, TRITC-팔로이딘을사용하여내재적 SYNJ2에대해면역염색하고, F-액틴에대해서는대비염색을하였다. 기준자, 10μm. 도 4A-F는 SYNJ2의촉매활성이침습적성장에필수적이라는것을보여준다. 도 4A-B - 대조군세포뿐만아니라, SYNJ2(SYNJ2-OX) 또는 SYNJ2에대한 shrna(shsynj2) 를발현하는 MDA-MB-231도 5% 매트리겔 (Matrigel) 에시딩하였다. 6일후이미지를캡처하고, 침습성스페로이드 (invasive spheroids) 를정량하였다 ( 평균 ± S.D.). 기준자, 50 μm. 도 4C-D - shsynj2-발현 MDA-MB-231 세포를 WT SYNJ2(shSYNJ2+SYNJ2 WT ) 또는촉매활성에장애를가진 (catalytically disabled) 변이체 (shsynj2+synj2 CD ) 로감염시켰다. 세포를지정된바와같이추출하고면역학적블로팅을하거나, 침습챔버에서 18시간동안침습하게하였다. 침습된세포의이미지및그것 - 8 -

9 들의정규화된정량을나타내었다 ( 평균 ± S.D.). 도 4E - 피브로넥틴 (fibronectin) 상에성장시킨 shctrl 및 shsynj2 세포의주사전자현미경사진 (scanning electron micrograph) 을나타낸다. 기준자 2 μm. 도 4F - 팔로이딘및 DAPI로염색된표시된 MDA-MB-231 세포에서 F-액틴의이미지. Z-축섹션 ( 줄 ) 과확대된부위를나타내었다. 화살표는팽윤된구조 (swollen structures) 를표시한다. 기준자, 10 μm. 도 5A-H SYNJ2의세포내위치를나타낸다. 도 5A - GFP-SYNJ2를발현하는 MDA-MB-231 세포를 RFP-클라트린 (Clathrin) 으로형질감염시키고, 피브로넥틴이코팅된플레이트에치상하였다. 스피닝디스크현미경 (spinningdisc microscopy) 을사용하여, 매 5초마다세포의이미지를만들었다. 화살표는새롭게형성된리딩에지를표시한다. 기준자 5 μm. 도 5B - 리딩에지및세포체 (cell body) 의기저에서의 SYNJ2의조립 (assembly) 및분해 (disassembly)( 상부의두개의화살표 ) 를묘사한대표적시간프레임 (time frame). 아래줄을위하여, 세포를 mcherry-lifeact 플라스미드로형질감염시키고, 콜라겐에치상하였다. 그후, 1분간격으로세포의이미지를만들었다. 참조를위해화살표를삽입하였다. 시간의척도 (time scale) 가다르다는것에유의하라. 기준자, 1 μ m. 도 5C - TIRF 및동시형광현미경 (epifluorescence microscopy) 으로동시에세포의이미지를만들고, 시그널을카이모그래프 (kymograph) 로전환하였다 (X-축). 화살표는시그널개시 (initiation) 를표시한다. 기준자, 5 μm. 도 5D - 세포를 Dyngo-4a(30 μm; Dynamin-2 억제인자 ) 로처리하기 5분전그리고처리 5분후를스피닝디스크공초점현미경을사용하여이미지로만들었다. 기준자, 5 μm. 도 5E - GFP-SYNJ2를안정하게발현하는 MDA-MB-231 세포를 Dyngo-4a(30 μm; 30분 ) 와함께또는용매 (DMSO) 와함께배양하였다. 세포용해물 (lysate s) 을항-GFP 항체로 ( 또는항체를사용하지않고 ; -Ab) 면역침강 (immunoprecipitation) 시킨후, 표시된항체를사용하여세포용해물의샘플 (5%) 과함께면역학적블로팅을하였다. 도 5F - 세포를피브로넥틴에치상하여고정하고, 내재적 Rac1에대해면역염색하였다. 기준자, 10 μm. 도 5G - NSC-23766(5 μm) 으로 30분간처리하기 5분전그리고처리 5분후에공초점현미경을사용하여세포의이미지를만들었다. 기준자, 5 μm. 도 5H - MDA-MB-231 세포를표시된 sirna 올리고뉴클레오티드로처리하였다. 세포추출물을 SYNJ2 및 Ras-GAP에대해블로팅하였다. ELISA-기반검정법 (ELISA-based assay)( 세포골격 (Cytoskeleton)) 을사용하여 GTP-Rac1 레벨을검출하였다. 도 6A-D는리딩에지에대한 SYNJ2의국소화가카베올린 (caveolins) 의분포와는완전히다르며, F-액틴, 콜레스테롤및 PI3K에의존한다는것을보여준다. 도 6A - GFP-SYNJ2를발현하고 RFP-Cav1을동시발현 (coexpressing) 하는 MDA-MB-231 세포를시간에따라동시에이미지를만들고, 시그널을카이모그래프로전환하였다 (X 및 Y축 ). SYNJ2 조립체의일시적특성과카베올린 1의안정적인출현 (appearance) 에주목하라. 기준자, 5 μ m. 도 6B - 왼쪽패널은 150개의랜덤하게선택된 SYNJ2 집합체의분포 ( 벽공 (pits) 대수명 (lifetime) 의 %) 를묘사하고있고, 도 5A에서와같이이미지를만들었다 (5초간격, 단일면 (single plane), 스피닝디스크공초점 ). 오른쪽패널은 55초의수명을보여주는집합체의평균 (± SEM) 상대적세기를묘사하고있다. 도 6C - GFP-SYNJ2를안정하게발현하는 MDA-MB-231 세포를 MβCD(10 mm, 15분 ) 또는보르트만닌 (Wortmannin)(500 nm, 15분 ) 으로처리하였다. 처리하기이전또는처리한후에동일하게선택된세포의이미지를매 6초마다캡처하고, 시그널을 ( 왼쪽패널에서네모난삽도 (inset) 를나타내는 ) 카이모그래프로전환하였다. 기준자, 20 μm. 도 6D - GFP-SYNJ2와 lifeact-mcherry를안정하게동시발현하는 MDA-MB-231 세포를라트룬쿨린 B(LatrunculinB) 으로처리하였다 (1 μm, 15분 ). 처리이전또는처리후에이미지를얻었다. 기준자, 5 μm. 도 7A-E는 SYNJ2의고갈 (depletion) 이세포내소포에서 EGFR을차단시킴을보여준다. 도 7A - shrna 대조군 (shctrl) 또는 SYNJ2에특이적인 shrna(shsynj2) 를안정하게발현하는 MCF10A 세포를 EGF-함유배지에치상한지 3일후에추출하였다. SYNJ2, EGFR, EGFR의인산화된티로신 1068(pEGFR), 인산화된 ERK(phosphorylated ERK, perk) 및로딩대조군으로서 Ras-GAP을찾기위해면역학적블로팅을하였다. 도 7B - MCF10A 세포를 EGF 의존재하에 sirna 대조군또는 SYNJ2에대해유도된 sirna로형질감염시켰다. EGFR 및 SYNJ2 항체를이용하여공초점면역형광분석 (confocal immunofluorescence analysis) 을수행하였다. 단지 SYNJ2-결핍세포 ( 별표 ) 만이 EGFR 수송결함 (trafficking defects) 을나타냄에주목하라. 기준자, 10 μm. 도 7C - MDA-MB-231 세포의세가지파생세포를 EGFR에대해면역염색하고, DAPI 및 F-액틴에대해대비염색하였다 : (i) SYNJ2의발현이억제된 (knocked-down) 세포 (shsynj2; 왼쪽컬럼 ), (ii) 촉매활성이없는 (catalytically-dead) 형태에해당하는렌티바이러스유전자도입 (transfer) 에의해감염된동일한세포 (shsynj2+synj2 CD ; 중간컬럼 ), 및 (iii) SYNJ2의발현이억제되고, 야행형의형태가감염에의해도입된세포 (shsynj2+synj2 WT ; 오른쪽컬럼 ). 기준자, 20 μm. 도 7D - 유비퀴틴화된 (ubiquitinated) EGFR 레벨 ( 밀도측정 (densitometry)). 도 7E - MDA-MB-231 파생세포 (derivatives) 를 488-Tfn으로자극시켰다 (5분, 10 μg/ml). 세포를얼음으로고정시키고, 산으로세척한후, 시그널세기를분석하였다

10 도 8A-I는 SYNJ2가 EGFR 수송 (trafficking) 및화학주성 (chemotaxis) 을조절함을보여준다. 도 8A - 표시된 sirna로형질감염된 MDA-MB-231 세포의전추출물 (whole extracts) 을지정된바와같이면역학적블로팅을하였다. 도 8B - 표시된 MDA-MB-231 서브클론 (subclones) 에서표면 EGFR의 FACS( 왼쪽 ) 및 125 I-EGF 결합 ( 오른쪽 ; 세번의반복실험에서 ) 분석. 도 8C - shctrl 및 shsynj2 세포를피브로넥틴상에성장시키고, EGFR 및 F-액틴에대해면역염색하였다. 자, 20 μm. 도 8D - EGF 구배 (gradient) 에노출된화학주성챔버에서이동된 shctrl 및 shsynj2 MDA-MB-231 세포경로 (track) 의로즈플롯 (rose plots). 적색경로는 EGF를향해이동하는세포를나타낸다. 도 8E - 굶주린 MDA-MB-231 파생세포를 EGF(10 ng/ml) 로처리하고, 세포용해물에대해나타낸바와같이면역침강및면역학적블로팅을하였다. 도 8F - 세포를 C에서와같이배양하고, 활성 EGFR(pY1045) 및 F-액틴에대해면역염색하였다. 자, 10 μm. 도 8G - 표시된 MDA-MB-231 파생세포를 5시간동안 EGF(10 ng/ml) 로처리하고, 추출물을나타낸바와같이면역학적블로팅을하였다. 도 8H - 표시된 MDA-MB-231 파생세포를알렉사플루오르 488(Alexa Fluor 488)-Tfn(25 μg/ml; 5분 ) 에노출시키고, 표면에결합된리간드를제거하기위하여산으로세척하고, 표시된간격으로이미지를얻었다. 정규화된형광시그널을나타내었다. 자, 10 μm. 도 8I - sictrl 또는 sisynj2로전처리된 (pre-treated) MDA-MB-231 세포를알렉사플루오르 488-EGF(20 μg/ml; 10분 ) 로자극하고, 산으로세척하고, 표시된간격동안 37 에서배양하고, FACS로분석하였다. 도 9A-D는 SYNJ2가소포수송및초점부착부 (focal adhesion) 의형성양쪽모두에필요함을보여준다. 도 9A- MDA-MB-231 파생세포 (shctrl 및 shsynj2) 를고정하고, EEA1, F-액틴및핵 (nuclei)(dapi) 에대해염색하였다. 기준자, 10 μm. 도 9B - MDA-MB-231 파생세포, 즉 shctrl 및 shsynj2 세포를인테그린베타-1(integrin beta- 1), F-액틴및 DAPI로탐색하였다 ( 기준자, 20 μm). 도 9C - MDA-MB-231 세포를 48시간동안 sictrl 및 sisynj2로처리한후, 엔테그린베타-1 및인산화된 EGFR에대해면역염색하였다. 도 9D - 팍실린 (paxillin), 핵 (DAPI) 및 F-액틴 (TRITC-팔로이딘을사용하여 ) 에대한 MDA-MB-231 파생세포의면역형광분석. 팍실린시그널을초점부착부에관하여세포질부분 (cytoplasmic regions) 에서정량하고, 세포당초점부착부의수또한정량하였다. 또한, 초점부착부의형태는완벽한원 (circle) 으로부터의편차 (deviation) 를측정함으로써정량하였다 ( 편심률 (eccentricity)). 기준자, 10 μm. 도 10A-F는 SYNJ2의고갈이포스포이노시티드항상성 (phosphoinositide homeostasis) 을교란시키고, 초기엔도솜 (early endosome) 을팽창시키고, 초점부착부를분해함을보여준다. 도 10A - shctrl 또는 shsynj2를발현하는 MDA-MB-231 세포를 GFP-Rab4 플라스미드로형질감염시키고, 48시간후에세포를고정시키고, TRITC-팔로이딘을사용하여 F-액틴에대해대비염색하였다. 도 10B - MDA-MB-231 파생세포를 Rab5, F-액틴및핵 (DAPI) 에대해면역염색하였다. 이미지를평균세포면적 (average cell area) 뿐만아니라, Rab5-양성소포의크기와수에대해서도정량하였다. 기준자, 10 μm. 도 10C - 3 H-포스포이노시톨로표지된 MDA-MB-231 세포의파생세포로부터추출된포스포이노시티드를크로마토그래피로분리하고, 그것들의레벨을세가지다른실험으로측정하였다 (shctrl 세포에대해정규화된시그널 ). 도 10D - shctrl 및 shsynj2 MDA-MB-231 세포를 py1068-egfr, 팍실린및 F-액틴으로탐색하였다 ( 동시국소화 (co-localization) 시그널은흰색이다. 기준자, 10 μm). 도 10E - shctrl 및 shsynj2 MDA-MB-231 세포를시딩하였다. 부착되지않은세포들을 20분후에제거하고, 부착된세포들은이미지를만들고표면적 (surface area) 에대해정량하였다. 도 10F - shctrl 또는 shsynj2를안정적으로발현하는 MDA-MB-231 세포를 RTCA E-플레이트에치상하고, 실시간임피던스측정값 (real-time impedance measurements) 을 80분동안 5초간격으로기록한후, 추가로 80분동안 10분간격으로기록하였다. 2번반복실험한평균 (± S.D.) 을나타내었다. 도 11A-G는 SYNJ2가프로테아제의분비및침습위족의조립 (assembly) 을조절함을보여준다. 도 11A - shctrl 및 shsynj2 MDA-MB-231 세포를 5일간매트리겔에서배양하여고정하고, MMP-9에대해면역염색하였다. 시그널세기를히트-맵 (heat-map) 으로전환하고, 콜로니중심으로부터의거리에대해곡선으로나타내었다. 화살표는스페로이드의경계 (boundaries) 를나타낸다. 자, 50 μm. 도 11B - 대조군 MDA-MB-231 세포및 SYNJ2를안정적으로과발현하는세포로부터얻은상층액을젤라틴자이모그래피 (gelain zymography) 를사용하여 MMP-2 및 MMP- 9 활성에대해세번반복실험하여분석하였다. 도 11C - GFP-SYNJ2를안정적으로발현하는 MDA-MB-231 세포를가교결합된형광성젤라틴 (cross-linked fluorescent gelatin) 으로미리코팅된커버슬립에치상하였다. 3시간후, 세포를 GFP 및 F-액틴으로탐색하여침습위족성구조 (invadopodial structures) 를검출하였다 ( 화살표끝부분 ). 자, 10 μm. 도 11D - sictrl 또는 sisynj2 올리고뉴클레오티드로전처리된세포뿐만아니라, SYNJ2를과발현하는 MDA-MB-231 세포 (SYNJ2-OX) 또한가교결합된형광성젤라틴으로미리코팅된커버슬립상에치상하고, 세번의독립적인실험에서침습위족성구조를정량하였다. 도 11E - 표시된 sirnas로처리된 MDA- MB-231 세포의칩습위족성구조를 F-액틴또는 TKS5에대한염색뿐만아니라젤라틴분해에의해서도검출하였

11 다. 화살표끝부분 (Z-축이미지 ) 은침습위족을나타낸다. 자, 10 μm. 도 11F - sictrl 또는 sisynj2를발현하는 MDA-MB-231 세포를젤라틴이코팅된커버슬립상에치상하고, 팔로이딘및인산화된형태의 EGFR에대한항체 ( 티로신 (tyrosine) 1068) 를사용하여 C에서와같이처리하였다. 기준자, 10 μm. 도 11G - 표시된 MDA-MB- 231 파생세포에의해 3일에걸쳐영향을받은 (conditioned) 배양액을 EGF-유사리간드 (EGF-like ligands) 에대한 ELISA-기반검정법을사용하여검사하였다. 도 12A-G는 SYNJ2가매트릭스분해와침습위족의조립을조절함을보여준다. 도 12A - 표시된 sirna-처리된 MDA-MB-231 세포를세번반복치상하고, 3일간배양하여그것의영향을받은배양액을젤라틴 (0.1%) 이포매된 (embedded) 겔을사용하여전기영동적으로분리한후, MMP-2 및 MMP-9 단백질분해활성 (proteolytic activity) 을정량하기위해단백질을염색하였다. 도 12B - GFP-접합비드 (GFP-conjugated beads) 및 GFP- SYNJ2를안정하게발현하는 MDA-MB-231 세포의맑은 (cleared) 추출물을사용하는동시면역침강분석 (coimmunoprecipitation analysis). 도 12C - GFP-SYNJ2를안정하게발현하는 MDA-MB-231 세포를 RFP-코르탁틴 (Cortactin) 플라스미드로형질감염시키고, 콜라겐플레이트상에치상하였다. 생세포 (live cell) 이미지분석을 48시간후에수행하고, 주변 (peripheral) 및중심 (central) 세포부위모두의대표적인스냅샷이미지를캡처하였다. 기준자, 5 μm. 도 12D - 표시된 MDA-MB-231 세포의파생세포를 Tapp1(PI(3,4)P 2 바인더 (binder)) 의 Myc-태그된 PH 도메인 (Myc-tagged PH domain) 을암호화하는플라스미드로형질감염시키고, 48시간후에그것들을젤라틴이코팅된표면에치상하였다. F-액틴, 응집된 (aggregated) TKS5 및 PI(3,4)P 2 (Tapp1) 의동시분포 (co-distribution) 를시각화하고, 공초점현미경을사용하여정량하였다. 기준자, 10 μm. 도 12E - sictrl 또는 sisynj2를발현하는 MDA-MB-231 세포를 FITC-젤라틴코팅된유리커버슬립위에치상하여 3시간동안배양하였다. 그후, 세포를고정시키고, CD44에대해면역염색하고, TRITC-팔로이딘을사용하여 F-액틴에대해대비염색하였다. 형광현미경을사용하여세포를시각화하고, FITC-젤라틴매트릭스에서구멍 (holes) 을관찰함으로써침습위족을검출하였다. 프레임부분을확대하였다. 기준자, 10 μm. 도 12F - shctrl 및 shsynj2에의한표면발현의 FACS 분석을위해 CD44에대한항체를사용하였다. 표시된것들은프레임영역에해당하는세포의단편들이다. 도 12G - sictrl 또는 sisynj2로전처리된 MDA-MB-231 세포를 FITC-젤라틴코팅된유리커버슬립위에치상하여 3시간동안배양하였다. 그후세포를고정시키고, MT1-MMP에대해면역염색하고, TRITC-팔로이딘으로 F-액틴에대해대비염색하였다. 기준자, 10 μm. 도 13A-H는 SYNJ2의효소활성이유방종양세포의전이성확산 (metastatic spread) 을추진함을보여준다. 도 13A - 표시된 RFP-발현 MDA-MB-231 세포의파생세포 ( / 마우스 ) 를암컷 SCID 마우스 ( 그룹당 10-11마리 ) 의지방패드 (fat pad) 에이식하였다. 종양의크기 ( 평균 ± S.D.) 를이식후 2주및 6주에측정하였다. 도 13B-C - 액와 (axillary) 및원거리림프절 (distant lymph nodes)( 도 13B), 또는폐 ( 도 13C) 에서이식후 6주에나타난전이를나타낸것이다. 별표는 p 값을표시한다 : * < 0.05, ** < 0.01 및 *** < 도 13D-F - 대조군 (LacZ) 및 SYNJ2-과발현 (SYNJ2-OX) RFP-표지된 MDA-MB-231 세포를 A에서와같이동물에이식하고, 종양의크기 ( 도 13D) 뿐만아니라림프절에의전이 ( 도 13E) 및폐에의전이 ( 도 13F) 또한이식후 6주및 8주에정량하였다. 도 13G-H - 표시된 MDA-MB-231-RFP 파생세포를 5주령의암컷 SCID 마우스의정맥안으로 ( 마우스당 ; 꼬리정맥 ) 또는유방의지방패드 ( 마우스당 ) 안으로주입하였다. 4주후, 꼬리안으로주입된마우스로부터의폐를 RFP 시그널에대해검사하였다 ( 왼쪽및중간패널 ). 피콜의구배 (gradient of ficoll) 로샘플을정제하고, RFP-양성인혈중종양세포 (circulating tumor cells, CTC) 의수를 FACS 판독에대해점수를매기고, 종양무게에대해정규화하였다. 도 14는국소및원거리림프절전이의생체내 (in vivo) 영상이다. MDA-MB-231-RFP 세포가접종되고 6주후분석된마우스에서의국소 ( 동측 (ipsilateral)) 및원격 ( 반대측 (contralateral)) 림프절전이의대표적인이미지 ( 도 13b를참조 ). 영상화전에, 마우스를마취시키고, 림프절에서의전이의시각화및정량화를위해마우스의털을제거하였다. 도 15는세포이동및침습에서의 SYNJ2의통합된작용 (integrated action) 을나타내는작동모델 (working model) 이다. EGFR-로딩된재활용엔도솜 (EGFR-loaded recycling endosomes) 은배측막 (ventral membrane) 에서활성수용체에배치되고, 그후 PI3K의국소활성화가뒤따른다. PI3K에의한막에있는 (membranal) PI(4,5)P 2 의인산화는 PI(3,4,5)P 3 를생성하고, 그것은 SYNJ2에의해 PI(3,4)P 2 로탈인산화된다. 후자는코르탁틴을고정시키고, 액틴중합 (actin polymerization) 의핵을이루는 TKS5를동원 (recruit) 한다. 동시에, SYNJ2는세포외매트릭스 (extracellular matrix, ECM) 를분해하고새로운침습성구조, 침습위족을만들기위해, CD44와같은

12 접착성분자 (adhesion molecules) 의운반 (delivery) 및 MT1-MMP와같은프로테아제를조절한다. 유사한방식으로, 세포주변 (cell periphery) 으로의 EGFR의운반은 SYNJ2 ( 및포스포리파아제 C(phospholipase C)) 에의한 PI(4,5)P 2 의파괴 (breakdown) 를초래하고, 다이나민 (Dynamin) 및외피액틴섬유 (cortical actin fibres) 를분해시키기위한코필린 (Cofilin) 과같은액틴절단효소 (actin severing enzymes) 를국소적으로활성화시키며, 층상위족이라불리는액틴으로가득차고 (actin-filled), 인테그린이풍부한 (integrin-rich) 돌출부를수립한다. 수평의화살표는세포이동의방향을나타낸다. 원형질막 (plasma membrane) 의색이입혀진 (colorcoded) 부분은특정 PI 포스포리피드 (phospholipids) 를나타낸다. 도 16A-C는 SYNJ2가공격적인 (aggressive) 유방종양에서높게발현됨을보여준다. 도 16A - SYNJ2의존재비 (abundance)( 높음, 중간및낮음 ) 에따른 331개의침습적유방암종 (invasive breast carcinomas) 을계층별로분류하기위하여, 면역조직화학법 (immunohistochemistry) 및조직마이크로어레이 (tissue microarray) 를사용하였다. 종양의동류의분획 (relative fraction) 은임상학적하위형태 (subtypes) 에따라나타내었다. 도 16B - ( 오른쪽컬럼에확대되어있는 ) 동일성 (identity) 및패턴 (pattern) 을보여주는 SYNJ2 염색의대표적인이미지는내강형사례 (luminal case)( 별표는대조군으로서내피세포 (endothelial cells) 에의한발현을나타낸다 ) 와기저형 (basal-like) 및 HER2-과발현성유방종양모두에서관찰되었다. 도 16C - 286명 ( 왼쪽 ; GSE2034) 또는 99명 ( 오른쪽 ; GSE19783) 의유방암환자들의집단에서 SYNJ2 mrna 발현에따라계층별로분류된카플란-마이어곡선 (Kaplan-Meier curve). 도 17A-B는 SYNJ2의 5'-포스파타아제활성을측정하기위해사용된형광편광분석검정법의원리를보여준다. 도 17A는비결합된 PI(3,4)P 2 형광프로브는편광판독을저하시키는반면, 결합된 PI(3,4)P 2 형광프로브는편광판독을증가시키는일반적인원리를보여주는도식이다. 도 17B는편광값 (polarization value, mp) 에의해측정된것과같은 SYNJ2 5'-포스파타아제활성의검출을보여주는대표적인막대그래프이다. 도 18은 pet28 플라스미드안으로클로닝되고, 대장균 (E.coli) 에서발현된 Flag-TAPP1 PH 도메인-His의아미노산및핵산서열 ( 각각 SEQ ID NO:13 및 14) 을나타낸다. 상기 TAPP1-PH 도메인은노란색으로표시하였다. [0031] [0032] [0033] [0034] [0035] [0036] [0037] [0038] 발명을실시하기위한구체적인내용본발명의몇몇의구현에서, 본발명은종양전이를예방하고, 암을치료하고예후를예측하며, 추정상의전이억제인자물질을확인하는방법에관한것이다. 본발명의적어도하나의구현들을상세히설명하기전에, 본발명은반드시다음의설명에기재되거나실시예에의해예시된세부사항들에대한그것의적용으로한정되지않는다는것으로이해되어야할것이다. 본발명은다른구현들일수있거나다양한방식으로실시되거나수행될수있다. 성장인자는세포이동및전이를추진하지만, 그근본적인메커니즘은완벽하게이해되지않았다. 본발명은이제야시험관내 (in vitro) 에서침습위족및층상위족을조절하고, 생체내 (in vivo) 에서암전이를조절하는데있어서마스터모듈 (master module) 로서시냅토자닌-2(SYNJ2) 를확인하였다. 아래에그리고그이후의실시예부분에서설명된바와같이, 본발명은시험관내, 동물들에서그리고환자의시료들 (specimen) 에서의그것들의발견을입증한다. 특히, EGF로자극된유방세포를사용하여, 본발명자들은침습성표현형 (invasive phenotype) 에대하여리피드포스파타아제시냅토자닌 2(SYNJ2) 를관련짓고, 암환자의짧은생존률에대하여 SYNJ2를높게관련지었다. SYNJ2의발현억제는동물모델에서유방종양세포의전이를강건하게손상시켰다. 시험관내에서, SYNJ2-결핍세포는 EGFR과인테그린의경로를벗어난수송을나타내어, 기형의초점부착부를만들어내며, 층상위족의발달을정지시키고, 침습위족의소실을초래한다. 이론에얽매이지않고, 활성 EGFR의재활용은특정포스포이노시톨리피드의 SYNJ2-매개성탈인산화를국소적으로촉진하고, 그것에의해침습위족및층상위족모두의형성이유발되어, 종양진행을가능하게한다 ( 도 15를참조 ). 따라서, 본발명의양상에따라서, 본발명은종양이신경교종이아니라는전제하에종양전이를예방하는방법을제공하며, 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제인자를그것을필요로하는대상에게투여하는것, 그리고그것에의해종양전이를예방하는것을포함한다. 본원에서사용된것과같은문구 " 종양전이 (tumor metastasis)" 는그것의원발성위치 (primary location) 에서신체의다른부분으로퍼지는악성종양 (malignant tumor), 예를들어폐로전이하는유방암을말한다. 본원에사용된것과같은용어 " 암 (cancer)" 및 " 종양 (tumor)" 은상호교환적으로사용된다. 상기용어는비정상

13 적 (abnormal) 이고억제되지않는 (uncontrolled) 세포분열에의해야기된악성암종 (malignant growth) 또는 종양을말하다. [0039] [0040] [0041] [0042] 본원에사용된것과같은용어 " 예방 (preventing)" 은전이성과정 (process) 또는진행 (progression) 및후속전이 (subsequent metastasis) 를정지시키고 (arresting), 중단시키고 (halting), 억제시키는것 (inhibiting) 을말한다. 또다른양상에따르면, 본발명은암을치료하는방법을제공하며, 상기방법은치료학적유효량의시냅토자닌 2(SYNJ2) 의억제인자및암의발병또는진행과연관된세포표면수용체의억제인자를그것을필요로하는대상에게투여하는것, 그리고그것에의해암을치료하는것을포함한다. 본원에사용된것과같은용어 " 치료 (treating)" 는질환의진행을차단 (abrogating), 실질적으로억제 (inhibiting), 지연 (slowing) 또는역전 (reversing) 시키는것, 질환의임상학적 (clinical) 또는심미적 (aesthetical) 증상을실질적으로개선하는것, 또는질환의임상학적또는심미적증상의출현 (appearance) 을예방하는것을포함한다. 본발명의몇몇구현에따라치료 ( 또는예후예측 ) 될수있는암의비제한적인예는위장관 (gastrointestinal tract) 의종양 ( 결장암종 (colon carcinoma), 직장암종 (rectal carcinoma), 대장암종 (colorectal carcinoma), 대장암 (colorectal cancer), 대장선종 (colorectal adenoma), 유전성비용종증 (hereditary nonpolyposis) 타입 1, 유전성비용종증타입 2, 유전성비용종증타입 3, 유전성비용종증타입 6; 대장암, 유전성비용종증타입 7, 작은창자및 / 또는큰창자암종 (small and/or large bowel carcinoma), 식도암종 (esophageal carcinoma), 식도암이동반된변지종 (tylosis with esophageal cancer), 위암종 (stomach carcinoma), 췌장암종 (pancreatic carcinoma), 췌장내분비종양 (pancreatic endocrine tumors)), 자궁내막암종 (endometrial carcinoma), 융기성피부섬유육종 (dermatofibrosarcoma protuberans), 담낭암종 (gallbladder carcinoma), 담관종양 (biliary tract tumors), 전립선암 (prostate cancer), 전립선선암 (prostate adenocarcinoma), 신장암 (renal cancer)( 예를들어, 윌름스종양 (Wilms' tumor) 타입 2 또는타입 1), 간암 (liver cancer)( 예를들어, 간모세포종 (hepatoblastoma), 간세포암종 (hepatocellular carcinoma), 간세포암 (hepatocellular cancer)). 방광암 (bladder cancer), 배아형횡문근육종 (embryonal rhabdomyosarcoma), 생식세포종양 (germ cell tumor), 융모상피성종양 (trophoblastic tumor), 고환생식세포종양 (testicular germ cell tumor), 난소 (ovary), 자궁 (uterine), 난소상피 (epithelial ovarian) 의미성숙기형종 (immature teratoma), 천미골종양 (sacrococcygeal tumor), 융모막암종 (choriocarcinoma), 태반부착부위융모상피성종양 (placental site trophoblastic tumor), 상피성성인종양 (epithelial adult tumor), 난소암종 (ovarian carcinoma), 장액성난소암 (serous ovarian cancer), 난소성기삭종양 (ovarian sex cord tumor), 자궁암종 (cervical carcinoma), 자궁경부암종 (uterine cervix carcinoma), 소세포및비소세포폐암종 (small-cell and non-small cell lung carcinoma), 비인두암종 (nasopharyngeal carcinoma), 유방암종 (breast carcinoma)( 예를들어, 도관유방암 (ductal breast cancer), 침습성도관내유방암 (invasive intraductal breast cancer), 산발적 (sporadic); 유방암 (breast cancer), 유방암에대한민감성 (susceptibility), 타입 4 유방암 (type 4 breast cancer), 유방암- 1(breast cancer-1), 유방암-3(breast cancer-3; 유방-난소암 (breast-ovarian cancer)), 편평상피세포암종 (squamous cell carcinoma)( 예를들어, 두경부 (head and neck) 에서 ), 신경성종양 (neurogenic tumor), 성상세포종 (astrocytoma), 신경절모세포종 (ganglioblastoma), 신경모세포종 (neuroblastoma), 림프종 (lymphoma)( 예를들어, 호지킨병 (Hodgkin's disease), 비호지킨성림프종 (non-hodgkin's lymphoma), B세포림프종 (B cell lymphoma), 버킷림프종 (Burkitt lymphoma), 피부 T세포림프종 (cutaneous t cell lymphoma), 조직구림프종 (histiocytic lymphoma), 림프아구성림프종 (lymphoblastic lymphoma), T세포림프종 (T cell lymphoma), 흉선림프종 (thymic lymphoma)), 신경교종 (glioma), 선암 (adenocarcinoma), 부신종양 (adrenal tumor), 유전성부신피질암종 (hereditary adrenocortical carcinoma), 뇌악성종양 (brain malignancy (tumor)), 다양한다른암종들 (carcinomas)( 예를들어, 기관지대세포 (bronchogenic large cell) 암종, 도관 (ductal) 암종, 에를리히-레르트복수 (Ehrlich-Lettre ascites) 암종, 표피양 (epidermoid) 암종, 대세포 (large cell) 암종, 루이스폐 (Lewis lung) 암종, 수질 (medullary) 암종, 점액표피양 (mucoepidermoid) 암종, 연맥세포 (oat cell) 암종, 소세포 (small cell) 암종, 방추세포 (spindle cell) 암종, 유극세포 (spinocellular) 암종, 이행세포 (transitional cell) 암종, 미분화 (undifferentiated) 암종, 암육종 (carcinosarcoma), 융모막암종 (choriocarcinoma), 낭선암종 (cystadenocarcinoma)), 상의모세포종 (ependymoblastoma), 상피종 (epithelioma), 적백혈병 (erythroleukemia)( 예를들어, 프렌드 (Friend) 적백혈병, 림프구성 (lymphoblast) 적백혈병 ), 섬유육종 (fibrosarcoma), 거대세포종양 (giant cell tumor), 신경교종양 (glial tumor), 교모세포종 (glioblastoma)( 예

14 를들어, 다형성 (multiforme) 교모세포종, 성상세포종 (astrocytoma)), 신경교종 (glioma), 간세포암 (hepatoma), 이종융합세포 (heterohybridoma), 이종골수종 (heteromyeloma), 조직구종 (histiocytoma), 융합세포 (hybridoma) ( 예를들어, B세포 ), 부신종 (hypernephroma), 인슐린종 (insulinoma), 섬종양 (islet tumor), 각화종 (keratoma), 평활근모세포종 (leiomyoblastoma), 평활근육종 (leiomyosarcoma), 백혈병 (leukemia)( 예를들어, 급성림프성 (acute lymphatic) 백혈병, 급성림프구성 (acute lymphoblastic) 백혈병, 급성림프구성전B세포 (acute lymphoblastic pre-b cell) 백혈병, 급성림프구성 T세포 (acute lymphoblastic T cell) 백혈병, 급성거핵모구성 (acute megakaryoblastic) 백혈병, 단핵구성 (monocytic) 백혈병, 단핵구성-대식세포 (monocyticmacrophage) 백혈병, 골수아구성 (myeloblastic) 백혈병, 골수성 (myeloid) 백혈병, 골수단구성 (myelomonocytic) 백혈병, 형질세포성 (plasma cell) 백혈병, 전B세포성 (pre-b cell) 백혈병, 전골수성 (promyelocytic) 백혈병, 아급성 (subacute) 백혈병, T세포성 (T cell) 백혈병, 림프구성신생물 (lymphoid neoplasm) 백혈병, 골수성악성종양 (myeloid malignancy) 에대한소인 (predisposition), 급성비림프구성 (acute nonlymphocytic) 백혈병 ), 림프육종 (lymphosarcoma), 흑색종 (melanoma), 유방종양 (mammary tumor), 비만세포종 (mastocytoma), 수모세포종 (medulloblastoma), 중피세포종 (mesothelioma), 전이성종양 (metastatic tumor), 단핵구종양 (monocyte tumor), 다발성골수종 (multiple myeloma), 골수이형성증후군 (myelodysplastic syndrome), 골수종 (myeloma), 신아세포종 (nephroblastoma), 신경조직신경교종양 (nervous tissue glial tumor), 신경조직신경세포종양 (nervous tissue neuronal tumor), 신경초종 (neurinoma), 신경모세포종 (neuroblastoma), 핍지교종 (oligodendroglioma), 골연골종 (osteochondroma), 골골수종 (osteomyeloma), 골육종 (osteosarcoma), ( 예를들어, 유잉 (Ewing's) 육종 ), 유두종 (papilloma), 이행세포암종 (transitional cell carcinoma), 갈색세포종 (pheochromocytoma), 뇌하수체종양 (pituitary tumor)( 침습성 ), 형질세포종 (plasmacytoma), 망막모세포종 (retinoblastoma), 횡문근육종 (rhabdomyosarcoma), 육종 (sarcoma)( 예를들어, 유잉육종, 조직구세포 (histiocytic cell) 육종, 젠슨 (Jensen) 육종, 골원성 (osteogenic) 육종, 세망세포 (reticulum cell) 육종 ), 신경초종 (schwannoma), 피부종양 (subcutaneous tumor), 기형암종 (teratocarcinoma)( 예를들어, 다분화능세포 (pluripotent cell)), 기형종 (teratoma), 고환종양 (testicular tumor), 흉선종 (thymoma) 및모낭상피종 (trichoepithelioma), 위암 (gastric cancer), 섬유육종 (fibrosarcoma), 다형성교모세포종 (glioblastoma multiforme); 다발성사구종양 (multiple glomus tumor), 리-프라우메니증후군 (Li-Fraumeni syndrome), 지방육종 (liposarcoma), 린치암가계증후군 II(lynch cancer family syndrome II), 남성생식세포종양 (male germ cell tumor), 비만세포성백혈병 (mast cell leukemia), 갑상선수질암 (medullary thyroid cancer), 다발성뇌수막종 (multiple meningioma), 내분비샘종증 (endocrine neoplasia), 점액육종 (myxosarcoma), 부신경절종 (paraganglioma), 가족성비크롬친화성부신경절종 (familial nonchromaffin paraganglioma), 모기질세포종 (pilomatricoma), 유두암종 (papillary carcinoma), 가족성및산발성의횡문근소인증후근 (familial and sporadic, rhabdoid predisposition syndrome), 가족성횡문근종양 (familial rhabdoid tumor), 연조직육종 (soft tissue sarcoma) 및교모세포종을동반한타코트증후군 (turcot syndrome) 을포함하지만이에한정되지않는, 임의의고형 (solid) 또는비고형 (non-solid) 암및 / 또는암전이를포함한다. [0043] [0044] [0045] [0046] [0047] [0048] 특정구현에따르면, 암은유방암이다. 특정구현에따르면, 암 ( 또는암전이 ) 은 EGF-조절형 (EGF-regulated) 이다. 다른바람직한구현에따르면, 암은 EGFR 또는 HER2와같은 ErbB 수용체분자의과발현또는상향조절을특징으로한다. ( 상향조절로알려져있는 ) EGFR 과발현을야기하는돌연변이또는과활성화 (overactivity) 는폐암, 항문암및다형성교모세포종 (glioblastomamultiforme) 을포함하는수많은암과관련되어있다. 이후자의경우에는, EGFRvIII라불리는어느정도특이적인 EGFR의변이가종종관찰된다. EGFR 또는패밀리구성원의돌연변이, 증폭 (amplification) 또는오조절 (misregulation) 은모든상피성암 (epithelial cancer) 중약 30% 에관련되어있다. EGFR와관련된돌연변이는그것의지속적인활성화를야기할수있으며, 억제되지않는세포분열 - 암에대한소인 (predispositon) 을초래할수있다. 그결과, EGFR의돌연변이는여러가지형태의암에서확인되어왔으며, 그것은확대되는항암치료의종류 (class) 의표적이다 (Zhang 2007 J. Clin. Invest. 117 (8):2051-8). ERBB2 유전자의증폭또는과발현은유방암의대략 30% 에서발생한다. 그것은증가한질병의재발 (recurrence) 과더욱나쁜예후예측과강하게연관되어있다. 과발현은또한난소, 위에서발생하는것으로알려져있으며, 장액성자궁내막암종 (uterine serous endometrial carcinoma) 과같은자궁암의공격적인형태 (aggressive

15 form) 이다. [0049] [0050] [0051] [0052] [0053] [0054] [0055] [0056] [0057] [0058] 다음은수용체티로신키나아제 (receptor tyrosine kinase) 의 ErbB 패밀리의구성원이관련되어있는암의리스트이다. ErbB-1 - 부신피질암 (adrenocortical cancer), 담관계암 (biliary cancer), 자궁경부암, 대장암, 식도암 (esophageal cancer), 담낭암 (gallbladder cancer), 위암, 교모세포종 (glioblastoma), 두경부암 (head and neck cancer), 폐암 ( 비소세포 (non-small cell) 폐암, 편평세포암종 (squamous cell carcinoma), 선암 (adenocarcinoma) 및대세포 (large cell) 폐암 ), 췌장암 (pancreatic cancer), 침샘암 (salivary gland cancer), 설사 (diarrhea), 양성신생물 (benign neoplasm), 침습성암종 (invasive carcinoma), 피부병 (skin disease), 유방상피내암종 (ductal carcinoma in situ), 손톱주위염 (paronychia). ErbB-2 - 담관계암, 방광암, 유방암, 담관암종 (cholangiocarcinoma), 식도암, 담낭암, 위암, 교모세포종, 난소암, 췌장암, 침샘암. 특정구현에따르면, 상기암은유방또는위암이다. ErbB-3 - 유방암, 폐암및바이러스성백혈병 (viral leukemia). ErbB-4 - 유방암, 바이러스성백혈병, 수모세포종, 폐암및유방종양. 본원에사용된것과같은용어 " 대상 (subject)" 은암으로진단받은포유류 ( 예를들어, 인간 ) 를말한다. 본원에사용된것과같은시냅토자닌-2 또는 SYNJ2는시냅스성이노시톨-1,4,5-트리포스페이트 5-포스파타아제 2(Synapatic inositol-1,4,5-triphosphate 5-phosphatase 2), EC 을말한다. 시냅토자닌-2는보편적으로발현되는이노시톨폴리포스페이트 5-포스파타아제 (inositol polyphosphate 5-phosphatase)(SEQ ID NO:1 및 2, 각각폴리뉴클레오티드와관련이있으며, 폴리뉴클레오티드를암호화한다 ) 이다. 본원에사용된것과같은문구 " 시냅토자닌 2의억제인자 (inhiitor of synaptojanin 2, SYNJ2)" 는 SYNJ2의발현또는활성을감소시키거나하향조절하는분자를말한다. 하향조절은 10 %, 20 %, 30%, 40 %, 50 %, 60 %, 70 %, 80 %, 90 % 이상으로할수있거나, 완전한억제 ( 아래에기술된것과같이주어진검정법에의해측정된것으로서활성또는발현의 100% 소실 ) 일수있다. SYNJ2의발현을하향조절하는것은하기에기술된바와같이 DNA, RNA 또는단백질레벨에영향을미칠수있다. SYNJ2 활성은 (PI(3,4,5)P 3 를 PI(3,4)P 2 로전환하는포스파타아제로서의 ) 촉매적활성, ( 다이나민 (dynamin), 코르탁틴 (cortactin) 과상호작용하는 ) 그것의신호전달 (signaling) 활성 ( 도 5E-H 를참조 ), 또는세 포내국소화 (cellular localization) 를말한다. 후자의경우에있어서, SYNJ2 의억제인자는단백질의세포내국 소화를변경시킬수있다. [0059] [0060] [0061] [0062] [0063] 따라서, SYNJ2의하향조절은유전자를삽입하거나 (knock-in), 그것의전사및 / 또는번역을방해하는다양한분자들 ( 예를들어, 핵산침묵화물질, 예를들어, 핵산 (RNA) 침묵화물질, 예를들어안티센스 (antisense), sirna, shrna, 마이크로-RNA, 리보자임 (Ribozyme) 및 DNA 효소 (DNAzyme) 등 ) 을사용하여게놈및 / 또는전사체의레벨에영향을미치거나, 예를들어, 길항제 (antagonist), 폴리펩티드등을절단하는효소를사용하여단백질레벨에영향을미칠수있다. 다음은 SYNJ2의발현레벨및 / 또는활성을하향조절할수있는물질 (agents) 의리스트이다. SYNJ2를하향조절할수있는물질의한예는 SYNJ2에특이적으로결합할수있는항체또는항체단편이다. 바람직하게는, 상기항체는적어도하나의 SYNJ2의에피토프 (epitope) 에특이적으로결합한다. SYNJ2는세포성단백질이므로, 항체를세포내로도입하기위한조치를취한다. 본원에사용된것과같은용어 " 에피토프 (epitope)" 는항체의파라토프 (paratope) 가결합하는항원에있는항원결정부위 (antigenic determinant) 를말한다. 항원결정부위는주로아미노산또는탄수화물측쇄와같은분자들의화학적활성표면 (chemically active surface) 그룹들로이루어지며, 주로특이적인전하특성뿐만아니라특이적인 3차원구조특성도가진다. 본발명에사용된것과같은용어 " 항체 (antibody)" 는순수한 (intact) 분자뿐만아니라, Fab, F(ab')2 및대식세포에결합할수있는 Fv와같은그것의기능적단편 (functional fragment) 도포함한다. 이들기능적항체단편들은아래와같이정의된다 : (1) Fab는항체분자의 1가의 (monovalent) 항원결합단편을포함하며, 순수한경쇄 (light chain) 및하나의중쇄 (heavy chain) 의일부를얻기위해파파인효소를사용하여전항체 (whole

16 antibody) 의분해에의해생성될수있는단편이고 ; (2) Fab' 는펩신으로전항체를처리한후, 순수한경쇄및중쇄의일부를얻기위해환원 (reduction) 에의해얻어질수있는항체분자의단편이며 ; 항체분자당두개의 Fab' 단편이얻어질수있고 ; (3) (Fab')2는차후의환원없이펩신효소를사용하여전항체를처리하여얻어질수있는항체의단편이며 ; F(ab')2는두개의이황화결합 (disulfide bonds) 에의해결합된두개의 Fab' 단편의 2량체 (dimer) 이고 ; (4) Fv는두개의사슬로발현된경쇄의가변부위 (variable retion) 및중쇄의가변부위를포함하는유전자조작에의해생성된 (genetically engineered) 단편으로정의되고 ; (5) 단쇄항체 (Single chain antibody, "SCA") 는유전적으로융합된 (genetically fused) 단쇄분자로서적절한폴리펩티드링커 (linker) 에의해연결된, 경쇄의가변부위및중쇄의가변부위를포함하는유전자조작에의해생성된분자이다. [0064] [0065] [0066] [0067] [0068] [0069] 다클론 (polyclonal) 및단일클론 (monoclonal) 항체뿐만아니라그것의단편을생산하는방법은당업계에잘알려져있다 ( 예를들어, 본원에참조로서통합되어있는할로우및레인 (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988) 을참조 ). 본발명의몇몇구현에따른항체단편은항체의단백질분해성가수분해 (proteolytic hydrolysis) 에의해, 또는그단편을암호화하는 DNA의대장균또는포유동물의세포 ( 예를들어, 차이니즈햄스터의난소세포배양물또는다른단백질발현시스템 ) 에서의발현에의해제조될수있다. 항체단편은기존의방법에의한전항체의펩신또는파파인분해에의해얻어질수있다. 예를들면, 항체단편은 F(ab')2를나타내는 5S 단편을제공하기위해펩신을사용한항체의효소적절단에의해생성될수있다. 이단편은티올환원제 (thiol reducing agent) 및선택적으로 3.5S Fab' 1가의단편을생성하기위하여이황화결합의절단의원인이되는설피드릴기에대한차단기 (blocking group) 를사용하여더절단될수있다. 대안적으로, 펩신을사용한효소적절단은두개의 1가의 Fab' 단편및 Fc 단편을직접적으로생산한다. 이들방법들은예를들어, 골덴버그 (Goldengerg), U.S. Pat. Nos. 4,036,945와 4,331,647, 및본원에포함된참조들에의해설명되며, 특허들은그것들전체가참조로서본원에통합된다. 또한, 포터 R.R. 을참조하라 (Porter, R. R. Biochem. J. 73: (1959)). 그단편들이순수한항체에의해인식되는항원에결합하는한, 1가의경쇄-중쇄단편을만들기위한중쇄의분리, 단편의추가적절단과같은항체를절단하는다른방법또는다른효소적, 화학적또는유전적기술들또한사용될수있다. Fv 단편은중쇄가변부위 (VH) 및경쇄가변부위 (VL) 의조합을포함한다. 이조합은인바등에기술된바와같이비공유성 (noncovalent) 일수있다 (Inbar et al., Proc. Nat'l Acad. Sci. USA 69: (1972)). 대안적으로, 가변사슬은분자내이황화결합에의해결합될수있거나, 글루타르알데히드 (glutaraldehyde) 와같은화학물질에의해가교결합될수있다. 바람직하게는, Fv 단편은펩티드링커에의해연결된중쇄및경쇄가변부위를포함한다. 이들단쇄항원결합단백질 (single-chain antigen binding proteins, sfv) 은올리고뉴클레오티드에의해연결된중쇄가변도메인및경쇄가변도메인을암호화하는 DNA 서열을포함하는구조유전자를제작함으로써제조된다. 상기구조유전자는발현벡터내로삽입된후, 대장균과같은숙주세포내로도입된다. 재조합숙주세포는두개의가변도메인을연결하는링커펩티드를사용하여단일폴리펩티드사슬을합성한다. sfv를생산하기위한방법은예를들어, 전체내용이참조로서본원에포함되는, 문헌들 (Whitlow and Filpula, Methods 2: (1991); Bird et al., Science 242: (1988); Pack et al., Bio/Technology 11: (1993)) 및 U.S. Pat. No. 4,946,778에의해설명된다. 항체단편의다른형태는단일상보성결정부위 (complementarity determining region, CDR) 를암호화하는펩티드이다. CDR 펩티드 (" 최소식별단위 (minimal recognition unit)") 는관심항체의 CDR을암호화하는유전자를제작함으로써얻어질수있다. 이러한유전자는예를들어, 항체생산세포의 RNA로부터가변부위를합성하기위해중합효소연쇄반응 (polymerase chain reaction) 을사용하여제조된다. 예를들어, 라릭및프라이를참조하라 (Larrick and Fry, Methods, 2: (1991)). 항 SYNJ2는상업적으로입수가능하다. 항인간 SYNJ2 단일클론항체의공급회사의예는암스바이오 (Amsbio), 아틀라스안티바디스 (Atlas Antibodies), AbD 세로텍 (AbD Serotec), 유나이티드스테이츠바이오로지컬 (United States Biological), antibodies-conline.com, 젠웨이 (Genway), 프로테인테크그룹 (Proteintech Group) 등을포함하나, 이에한정되지않는다. 본발명의항체들은치료학적적용을위해비면역원성 (non-immunogenic) 이된다. 비-인간 ( 예를들어, 쥐과동물 ) 항체의인간화 (humanized) 형태는비-인간면역글로불린으로부터유래된최소서열을포함하는면역글로불린 (immunoglobulins), 면역글로불린사슬또는 (Fv, Fab, Fab', F(ab').sub.2 또는

17 항체의다른항원-결합부분서열 (subsequence) 과같은 ) 그것의단편의키메라분자 (chimeric molecule) 이다. 인간화항체는수용자 (recipient) 의상보성결정부위 (CDR) 를형성하는잔기를원하는특이성 (specificity), 친화도 (affinity) 및능력 (capacity) 을갖는마우스, 쥐또는토끼와같은비인간종 ( 공여자 (donor) 항체 ) 의 CDR 잔기로치환시킨인간면역글로불린 ( 수용자 (recipient) 항체 ) 을포함한다. 몇몇경우에, 인간면역글로불린의 Fv 프레임워크 (framework) 잔기는상응하는비-인간잔기로치환된다. 인간화항체는또한수용자항체또는도입된 CDR 또는프레임워크서열에서발견되지않는잔기를포함할수있다. 일반적으로, 인간화항체는하나이상, 전형적으로둘이상의가변도메인을실질적으로모두포함할수있고, 여기에서모든또는실질적으로모든 CDR 부위는비-인간면역글로불린의 CDR 부위에대응하며, 모든또는실질적으로모든 FR 부위는인간면역글로불린공통 (consensus) 서열의 FR 부위에해당한다. 또한, 인간화항체는선택적으로적어도면역글로불린불변부위 (constant region)(fc) 의일부, 전형적으로인간면역글로불린의불변부위의일부를포함할수있다 (Jones et al., Nature, 321: (1986); Riechmann et al., Nature, 332: (1988); and Presta, Curr. Op. Struct. Biol., 2: (1992)). [0070] [0071] [0072] [0073] [0074] 비-인간항체를인간화하기위한방법은당업계에잘알려져있다. 일반적으로, 인간화항체는비-인간공급원 (source) 으로부터유래되어도입된아미노산하나또는그이상의잔기를가진다. 이들비-인간아미노산잔기는종종외래잔기 (import residue) 로불리며, 전형적으로외래의가변도메인으로부터얻어진다. 인간화는인간항체의상응하는서열을설치류의 (rodent) CDR 또는 CDR 서열로치환하는것에의하여, 기본적으로윈터및그의동료들 (Winter and co-workers) 의방법에따라수행될수있다 (Jones et al., Nature, 321: (1986); Riechmann et al., Nature 332: (1988); Verhoeyen et al., Science, 239: (1988)). 따라서, 인간화항체는키메라항체이며 (U.S. Pat. No. 4,816,567), 여기에서실질적으로순수한인간가변도메인보다적게비-인간종으로부터유래된상응하는서열로치환된다. 실제로, 인간화항체는전형적으로몇몇의 CDR 잔기들및아마도몇몇의 FR 잔기들이설치류의항체에있는유사한부위들로부터유래된잔기들로치환된인간항체이다. 인간항체는또한파지디스플레이 (phage display) 라이브러리를포함하는, 당업계에공지된다양한기술들을사용하여생산될수있다 (Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)). 콜등및뵈르너등의기술또한인간단일클론항체의제조를위해이용할수있다 (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86-95 (1991)). 유사하게는, 인간항체는형질전환 (transgenic) 동물, 예를들어내재적면역글로불린유전자가부분적으로또는완전하게불활성화되어있는마우스내로인간면역글로불린유전자좌 (loci) 의도입에의해만들어질수있다. 유발 (challenge) 을통해인간항체생성이관찰되며, 이는유전자재배열 (gene rearrangement), 어셈블리 (assembly) 및항체레퍼토리 (antibody repertoire) 를포함하는모든사항들에서보여지는것과거의흡사하다. 이접근법은예를들어, U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016 및아래의과학간행물들 (Marks et al., Bio/Technology 10,: (1992); Lonberg et al., Nature 368: (1994); Morrison, Nature (1994); Fishwild et al., Nature Biotechnology 14, (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, (1995)) 에설명되어있다. SYNJ2의하향조절은또한 RNA 침묵 (silencing) 에의해달성될수있다. 본원에사용된것과같은문구 "RNA 침묵 (RNA silencing)" 은대응하는단백질-코딩유전자의발현을억제하거나 " 침묵시키는 (silencing)" RNA 분자에의해매개된조절메커니즘 ( 예를들어, RNA 간섭 (RNA interference, RNAi), 전사적유전자침묵 (transcriptional gene silencing, TGS), 전사후유전자침묵 (post-transcriptional gene silencing, PTGS), 진압 (quelling), 동시억제 (co-suppression) 및번역억제 (translational repression)) 의군을말한다. RNA 침묵은식물, 동물및진균을포함하는많은형태의생물체에서관찰되어왔다. 본원에사용된것과같은용어 "RNA 침묵화물질 (RNA silencing agent)" 은표적유전자의발현을특별히억제하거나 " 침묵시킬 " 수있는 RNA를말한다. 어떤구현에서, RNA 침묵화물질은전사후침묵메커니즘을통하여 mrna 분자의완전한프로세싱 ( 예를들어, 완전한번역및 / 또는발현 ) 을방지할수있다. RNA 침묵화물질은논코딩 (noncoding) RNA 분자, 예를들어그러한작은논-코딩 RNA가생성될수있는전구체 RNA들뿐만아니라쌍을이룬 (paired) 가닥들을포함하는 RNA 듀플렉스 (duplexes) 도포함한다. 대표적인 RNA 침묵화물질은 sirnas, mirnas 및 shrnas와같은 dsrnas를포함한다. 일구현에서, RNA 침묵화물질은 RNA 간섭을유도할수있다. 다른구현에서, RNA 침묵화물질은번역억제를매개할수있다. 본발명의구현에따르면, RNA 침묵화물질은표적 RNA( 예를들어, SYNJ2) 에특이적이며, 표적유전자에대해

18 99% 또는그보다적은전역상동성 (global homology), 예를들어, 표적유전자에대해 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% 보다적은전역상동성을나타내는유 전자또는스플라이싱변이체 (splice variant) 를교차 (cross) 억제하거나침묵시키지않는다. [0075] [0076] [0077] [0078] [0079] [0080] [0081] [0082] [0083] RNA 간섭은작은간섭 RNAs(short interfering RNAs, sirnas) 에의해매개된동물에서의서열-특이적전사후유전자침묵의프로세스를말한다. 식물에서의대응하는프로세스는흔히전사후유전자침묵또는 RNA 침묵으로일컬어지며, 진균에서는진압 (quelling) 으로도일컬어진다. 전사후유전자침묵의프로세스는외래유전자의발현을방지하기위해사용되는진화적으로-보존된 (evolutionarily-conserved) 세포방어메커니즘으로여겨지며, 보통다양한식물상 (flora) 및생물족 (phyla) 에의해공유된다. 이러한외래유전자발현으로만들어진방어는바이러스감염으로부터또는동족의단일-가닥 RNA 또는바이러스게놈 RNA를특이적으로파괴하는세포적반응을통해숙주게놈내로의트랜스포존요소 (transposon elements) 의랜덤통합으로부터유래된이중-가닥 RNAs(double-stranded RNAs, dsrnas) 의생성에대한반응으로진화될수있다. 세포에서의긴 dsrna들의존재는다이서 (dicer) 로불리는리보뉴클레아제 III(ribonuclease III) 효소의활성을자극한다. 다이서는작은간섭 RNA(siRNAs) 로알려져있는 dsrna의작은조각들내로의 dsrna의프로세싱에관련되어있다. 다이서활성으로부터유래된작은간섭 RNA들은전형적으로약 21 내지약 23 뉴클레오티드길이이고, 약 19 염기쌍의듀플렉스를포함한다. RNAi 반응은또한엔도뉴클레아제복합체 (endonucleae complex) 를특징으로하고, 보통 RNA-유도성침묵복합체 (RNA-induced silencing complex, RISC) 로칭하며, 그것은 sirna 듀플렉스의안티센스가닥에상보적인서열을가지는단일-가닥 RNA의절단을매개한다. 표적 RNA의절단은 sirna 듀플렉스의안티센스가닥에상보적인부위의중간에서일어난다. 따라서, 본발명의몇몇구현은 mrna로부터의단백질발현을하향조절하기위한 dsrna의사용을고려한다. 일구현에따르면, dsrna는 30 bp보다크다. 긴 dsrna( 즉, 30 bp보다큰 dsrna) 의사용은이들이중가닥 RNA 의긴부위가인터페론및 PKR 반응을유도하게될것이라고믿어지기때문에매우제한적이었다. 그러나, 긴 dsrna의사용은수많은 sirna들을시험할필요성을덜어주는최적의침묵서열을선택할수있게하는데있어서많은이점을제공할수있고 ; 긴 dsrna들은침묵라이브러리가 sirna에필수적일수있는복잡성을덜가질수있게해주며, 그리고아마도가장중요하게는, 긴 dsrna는치료제로서사용될때바이러스탈출성변이 (viral escape mutations) 를방지할수있다. 다양한연구들이긴 dsrna들이스트레스반응을유도하거나현저한약물부작용 (off-target effect) 을야기하는일없이유전자발현을침묵시키는데사용될수있다는것을입증하였다 - 예를들어, 스트라트등을참조하라 (Strat et al., Nucleic Acids Research, 2006, Vol. 34, No ; Bhargava A et al. Brain Res. Protoc. 2004;13: ; Diallo M., et al., Oligonucleotides. 2003;13: ; Paddison P.J., et al., Proc. Natl Acad. Sci. USA. 2002;99: ; Tran N., et al., FEBS Lett. 2004;573: ). 특히, 그것의몇몇구현에따른본발명은인터페론경로가활성화되지않은세포 ( 예를들어, 배아세포 (embryonic cell) 및난모세포 (oocytes)) 에서의유전자침묵을위한긴 dsrna(30 bp 이상의전사체 ) 의도입을고려하며, 예를들어, 빌리등을참고하라 (Billy et al., PNAS 2001, Vol 98, pages and Diallo et al, Oligonucleotides, October 1, 2003, 13(5): doi: / ). 그것들의몇몇구현에따른본발명은또한유전자발현을하향조절하기위해인터페론및 PKR 경로를유도하지않도록특별히설계된긴 dsrna의도입을고려한다. 예를들면, 시나가와및이시이 (Shinagwa and Ishii, Genes & Dev. 17 (11): , 2003) 는 RNA 폴리머라아제 II(Pol II) 프로모터로부터긴이중-가닥 RNA를발현하기위해 pdecap라명명된벡터를개발하였다. pdecap로부터의전사체는 ds-rna를세포질로내보낼수있게하는 5'-캡 (cap) 구조및 3'-폴리 (A) 꼬리 (poly(a) tail) 가모두결여되어있기때문에, pdecap로부터의긴 ds- RNA는인터페론반응을유도하지않는다. 포유동물계에서인터페론및 PKR 경로를회피하는다른방법은형질감염또는내재적발현중하나를통한작은간섭 RNA(siRNAs) 의도입에의한것이다. 용어 "sirna" 는 RNA 간섭 (RNAi) 경로를유도하는작은억제성 RNA 듀플렉스 (small inhibitory RNA duplexex) ( 일반적으로, 염기쌍사이 ) 를말한다. 비록 염기길이의화학적으로합성된 RNA 듀플렉스가동일위치에서 21mer와비교하여효능에있어서 100배정도를증가시킬수있음이최근알려졌으나, 전형적으로 sirna는중앙의 19 bp의듀플렉스부위및말단 (termini) 에있는대칭적 (symmetric) 2-염기 3'-돌출부 (overhangs) 와함께 21mer로서화학적으로합성된다. RNAi를유발하는데더욱긴 RNA들을사용하여얻어진관찰

19 된증가된효능은생성물 (21mer) 대신기질 (27mer) 을사용하여다이서를만들어내는것에대한이론을 제시하며, 이것은 RISC 내로의 sirna 의진입 (entry) 의속도또는효율을향상시킨다. [0084] [0085] [0086] [0087] [0088] [0089] [0090] [0091] [0092] 3'-돌출부의위치는 sirna의효능에영향을주며, 안티센스가닥에 3'-돌출부를가지는비대칭듀플렉스는일반적으로센스가닥에 3'-돌출부를가지고있는것들보다더강력하다 (Rose et al., 2005). 안티센스전사체를표적으로할때정반대의효능패턴이관찰되기때문에, 이는비대칭가닥의 RISC로의로딩 (loading) 에기인한다고여겨진다. 이중-가닥간섭 RNA( 예를들어, sirna) 의가닥들은헤어핀또는스템루프 (stem loop) 를형성하도록연결될수있다. 따라서, 언급한바와같은본발명의몇몇구현의 RNA 침묵화물질은또한짧은헤어핀 RNA(shRNA) 일수있다. 작은간섭 RNA 분자들의예는 SYNJ2의암호화부위 (coding region) 또는 에대한 sirna를교시하고있는추앙등 (Chuang et al. (supra) SJ2-1 (coding region ; 5 AACGTGAACGGAGGAAAGCAG, SEQ ID NO: 3), SJ2-2 (region in the 3 untranslated region; 5 CTCTTGCTGATACGCGATATT, SEQ ID NO: 4)) 또는러스크등 (Curr Biol Apr 15;13(8): Erratum in: Curr Biol Sep 30;13(19):1746) 에서발견할수있다. SYNJ2 mrna 레벨을성공적으로하향조절하는 sirna 서열의다른예는 GAAGAAACAUCCCUUUGAU (SEQ ID NO: 5) 및 GGACAGCACUGCAGGUGUU (SEQ ID NO: 6) 을포함하나, 이에한정되지않는다. 본원에사용된것과같은용어 "shrna" 는상보적서열의제1부위및제2부위를포함하는스템-루프구조를가지는 RNA 물질을말하며, 상기부위들의상보성의정도및방향은상기부위들사이에염기쌍이형성되기에충분하고, 상기제1 및제2부위는루프부위에연결되며, 상기루프는상기루프부위내에있는뉴클레오티드들 ( 또는뉴클레오티드유사체 ) 사이의염기쌍의결여에서비롯된다. 루프내의뉴클레오티드의수는 3 내지 23, 또는 5 내지 15, 또는 7 내지 13, 또는 4 내지 9, 또는 9 내지 11 사이및이를포함하는수이다. 루프내의몇몇의뉴클레오티드들은루프내의다른뉴클레오티드들과의염기쌍상호작용에관련될수있다. 루프를형성하는데사용될수있는올리고뉴클레오티드서열의예는 5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. (2002) Science 296: 550) 및 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454) 을포함한다. 그결과생성된단일사슬올리고뉴클레오티드는 RNAi 기구 (machinery) 와상호작용할수있는이중-가닥부위를포함하는스템-루프또는헤어핀구조를형성한다는것은당업자들에게인식될수있을것이다. SYNJ2 mrna 레벨을성공적으로하향조절하는 shrna 서열의예는 CCGGCCTACGATACAAGCGACAAATCTCGAAGATTTGTCGCTTGTATCGTAGGTTTTTG (SEQ ID NO: 7); CCGGCGAGAGGAGATCATTCGGAAACTCGAGTTTCCGAATGATCTCCTCTCGTTTTTG (SEQ ID NO: 8); CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCTCAAACTGTTCTTCCGGTTTTTG (SEQ ID NO: 9) 를포함하나, 이에한정되지않는다. 본발명의몇몇구현과함께사용하기에적합한 RNA 침묵화물질의합성은아래와같이얻어질수있다. 첫째로, SYNJ2 mrna 서열을 AA 디뉴클레오티드서열에대하여 AUG 시작코돈의하류쪽 (downstream) 으로스캔한다. 각 AA 및 3' 에인접한 19개뉴클레오티드의발생을잠재적인 sirna 표적부위로기록한다. 바람직하게는, 비번역부위 (untranslated regions, UTRs) 는조절단백질결합부위에더많이존재하기때문에, sirna 표적부위는오픈리딩프레임 (open reading frame) 으로부터선택한다. UTR-결합단백질및 / 또는번역개시복합체 (translation initiation complexes) 는 sirna 엔도뉴클라아제복합체의결합을방해할수있다 (Tuschl ChemBiochem. 2: ). 그러나 GAPDH에대해입증된바와같이비번역부위를대상으로하는 sirna들도얻을수있음을잘알수있을것이며, 여기에서 sirna는약 90% 의세포 GAPDH mrna의감소를매개하고, 단백질의레벨이완전히사라진 5' UTR을대상으로한다 (wwwdotambiondotcom/techlib/tn/91/912dothtml). 둘째로, 잠재적표적부위들을 NCBI 서버 (wwwdotncbidotnlmdotnihdotgov/blast/) 로부터입수가능한 BLAST 소프트웨어와같은임의의서열정렬소프트웨어를사용하여, 적합한유전체데이터베이스 ( 예를들어, 인간, 마우스, 쥐등 ) 와비교한다. 다른암호화서열에현저한상동성을나타내는추정상의 (putative) 표적부위를걸러낸다. sirna 합성을위한주형으로자격을충족하는 (qualilfying) 표적서열들을선택한다. 바람직한서열들은 55% 보다높은 G/C 함량을가지는것들과비교하여유전자스플라이싱을매개하는데더욱효과적인것으로증명된것들만큼낮은 G/C 함량을포함하는것들이다. 바람직하게는평가를위해표적유전자의길이에따라여러개의

20 표적부위를선택한다. 선택된 sirna들의더나은평가를위해, 바람직하게는음성대조군을결합에사용한다. 음성대조군 sirna는바람직하게는 sirna로서동일한뉴클레오티드구성 (composition) 을포함하지만, 유전체에대한상동성은상당히부족하다. 따라서, 임의의다른유전자에대해어떠한현저한상동성도보이지않는다면, 바람직하게는스크램블된 sirna의뉴클레오티드서열을사용한다. [0093] [0094] [0095] [0096] [0097] [0098] [0099] [0100] [0101] [0102] 본발명의몇몇구현의 RNA 침묵화물질은 RNA만을포함하는분자들만으로한정될필요는없으나, 화학적으로- 변경된뉴클레오티드및비-뉴클레오티드를더포함한다는것을이해할수있을것이다. 몇몇구현에서, 본원에서제공되는 RNA 침묵화물질은 " 세포-투과펩티드 (cell-penetrating peptide)" 와기능적으로관련될수있다. 본원에사용된것과같은 " 세포-투과펩티드 " 는짧은 ( 약 잔기 ) 아미노산서열, 또는세포의원형질막 (plasma membrane) 및 / 또는핵막 (nuclear membrane) 을가로지르는막-투과성복합체 (membrane-permeable complex) 의수송과관련된에너지-의존적 ( 즉, 비-엔도시토시스성 (non-endocytotic)) 전좌특성을부여하는기능적모티프 (functional motif) 를포함하는펩티드이다. 본발명의몇몇구현의막-투과성복합체에사용된세포-투과펩티드는바람직하게는적어도하나의비기능적시스테인잔기를포함하며, 이황화결합을위해변경된이중-가닥리보핵산 (ribonucleic acid) 과이황화결합을자유롭게형성하거나형성하도록유도된다. 이러한특성을부여하는대표적인아미노산모티프는그내용이참조로서본원에특별히포함되는 U.S. Pat. No. 6,348,185에열거되어있다. 본발명의몇몇구현의세포-투과펩티드는바람직하게는페네트라틴 (penetratin), 트랜스포탄 (transportan), pisl, TAT(48-60), pvec, MTS 및 MAP를포함하나, 이에한정되지않는다. RNA 침묵화물질을사용하여표적화될 mrna는그것의발현이원하지않는형질 (phenotypic trait) 과관련이있는것들을포함하나, 이에한정되지않는다. 표적이될수있는예시적 mrna는절단된 (truncated) 단백질을암호화하는 ( 즉, 결실 (deletion) 을포함하는 ) 것들이다. 따라서, 본발명의몇몇구현들의 RNA 침묵화물질은결실의양쪽에있는가교 (bridging) 부위를표적으로할수있다. 이러한 RNA 침묵화물질의세포내로의도입은변이된단백질의하향조절을야기할수있는반면, 남아있는변이되지않은단백질은영향을받지않을것이다. 다른구현에따르면, RNA 침묵화물질은 mirna일수있다. 용어 " 마이크로RNA(microRNA)", "mirna" 및 "mir" 은동의어이며, 약 뉴클레오티드길이의비암호화단일 -가닥 RNA 분자의집합을말하며, 유전자발현을조절한다. mirna들은광범위한생물체들 ( 바이러스, 인간 ) 에서발견되며, 발달, 항상성및질병의발생원인 (etiology) 에서역할을하는것으로밝혀졌다. 아래는 mirna 활성메커니즘의간단한설명이다. mirna를암호화하는유전자는번역되어 pri-mirna로알려진 mirna 전구체를생산한다. pri-mirna는전형적으로다중의 pri-mirna들을포함하는폴리시스트론성 (polycistronic) RNA의일부분이다. pri-mirna는스템및루프와함께헤어핀을형성할수있다. 상기스템은미스매치 (mismatched) 염기를포함할수있다. pri-mirna의헤어핀구조는 RNase III 엔도유클라아제인드로샤 (Drosha) 에의해인지된다. 드로샤는전형적으로 pri-mirna에있는말단루프 (terminal loop) 를인지하며, pre-mirna로알려진 뉴클레오티드의전구체를생성하기위해스템으로바뀌는대략두개의나선 (helical) 을절단한다. 드로샤는 5' 말단의인산기 (phosphate) 및 ~ 2개의뉴클레오티드 3' 돌출부를사용하여 pre-mirna 스템루프를만들어내는전형적인 RNase III 엔도유클라아제의엇갈린절단 (staggered cut) 으로 pri-mirna를절단한다. 드로샤절단부위너머까지미치는스템의대략하나의나선의회전 (helical turn)(~10 뉴클레오티드 ) 은효율적인프로세싱에필수적이다. 그후, pre-mirna는 Ran-GTP 및운반 (export) 수용체엑스포틴-5(Ex-portin-5) 에의해핵에서세포질로활발하게수송된다. 그후, pre-mirna의이중-가닥의스템은또한 RNase III 엔도뉴클레아제인다이서에의해인지된다. 다이서도스템루프의염기에서 5' 말단의인산기및 3' 돌출부를인지한다. 그후, 다이서는추가의 5' 말단의인산기및 ~ 2개의뉴클레오티드 3' 돌출부를남기는스템루프의염기를떠나서말단루프의 2개의나선의회전을절단한다. 그결과생성된미스매치를포함할수있는 sirna-유사듀플렉스는성숙한 mirna와 mirna* 로알려진유사한크기의단편을포함한다. mirna와 mirna* 은 pri-mirna 및 pre-mirna의서로다른쪽암 (arm) 으로부터유래될수있다. mirna* 서열은클로닝된 mirna의라이브러리에서찾을수있으나, 전형적으로 mirna들보다는빈도가낮다. 비록처음에 mirna* 를가진이중-가닥종으로서존재한다할지라도, mirna는최종적으로 RNA-유도성침묵복합체 (RNA-induced silencing complex, RISC) 로알려진리보뉴클레오단백질복합체내로단일-가닥 RNA로서통합

21 되어진다. 다양한단백질들이 RISC 를형성할수있으며, 이는 mirna/mirna* 듀플렉스, 표적유전자의결합 부위, mirna 의활성 ( 억제또는활성화 ) 에대한특이성 (specificity) 에가변성을부여할수있고, mirna/mirna* 듀플렉스의가닥은 RISC 안으로로딩된다. [0103] [0104] [0105] [0106] [0107] [0108] [0109] [0110] [0111] [0112] mirna:mirna* 듀플렉스의 mirna 가닥이 RISC 안으로로딩될때, mirna* 는제거되고분해된다. RISC 안으로로딩된 mirna:mirna* 듀플렉스의가닥은 5' 말단이덜철저하게쌍을이룬 (less tightly paired) 가닥이다. mirna:mirna* 의양쪽말단모두가대략동등하게 5' 페어링 (pairing) 을가지는경우에, mirna 및 mirna* 모두유전자침묵활성을가질수있다. RISC는 mirna와 mrna 간의높은상보성레벨에기초하여, 특히뉴클레오티드 2-7의 mirna에의해표적핵산을확인한다. 수많은연구들이번역의효과적인억제를달성하기위한 mirna와그것의 mrna 표적간의염기쌍필요조건을검토하여왔다 (reviewed by Bartel 2004, Cell ). 포유동물의세포에서, mirna의처음 8개의뉴클레오티드는중요할수있다 (Doench & Sharp 2004 GenesDev ). 그러나, 마이크로RNA의다른부분또한 mrna 결합에관여할수있다. 더욱이, 3' 말단에서의충분한염기페어링은 5' 말단에서의불충분한페어링을보충할수있다 (Brennecke et al, 2005 PLoS 3-e85). 전체유전체에결합하는 mirna를분석하는수치해석적연구는표적결합에서 mirna의 5' 말단에서의염기 2-7에대한특이적역할을시사하였으나, 주로 "A" 인것으로알려진첫번째뉴클레오티드의역할또한밝혀졌다 (Lewis et at 2005 Cell )). 유사하게는, 뉴클레오티드 1-7 또는 2-8은크렉등에의해표적을확인하고입증하는데사용되었다 (Krek et al., 2005, Nat Genet ). mrna에서의표적부위는 5' UTR, 3' UTR에있거나, 암호화부위에있을수있다. 흥미롭게도, 다중 mirna들은동일하거나다수의부위들을인지함으로써동일한 mrna 표적을조절할수있다. 가장많이유전적으로확인된표적들에서의다중 mirna 결합부위의존재는다중 RISC들의협동작업이가장효과적인번역억제를제공한다는것을나타낼수있다. mirna는두개의메커니즘 : mrna 절단또는번역억제중하나에의해 RISC가유전자발현을하향조절하도록유도할수있다. mrna가 mirna에대해어느정도의상보성을가지고있다면, mirna는 mrna를특이적으로절단할수있다. mirna가절단할때, 자르는부분 (cut) 은전형적으로뉴클레오티드페어링에서 mirna의잔기 10 및 11 사이이다. 대안적으로, mirna가 mirna에대해필요한정도의상보성을가지고있지않다면, mirna는번역을억제할수있다. 동물들은 mirna와결합부위사이에더욱낮은정도의상보성을가질수있으므로, 번역억제는동물들에서더욱일반적일수있다. mirna 및 mirna* 의임의의쌍의 5' 및 3' 말단에가변성이있을수있음에유의하여야만한다. 이가변성은절단부위와관련된드로샤와다이서의효소프로세싱에있어서의가변성때문일것이다. mirna 및 mirna* 의 5' 및 3' 말단에서의가변성은또한 pri-mirna 및 pre-mirna의스템구조에서의미스매치때문일수도있다. 스템가닥의미스매치는서로다른헤어핀구조의집단을생성시킬수있다. 스템구조에서의가변성은또한드로샤와다이서에의한절단생성물에도가변성을줄수있다. 용어 " 마이크로RNA 모방체 (microrna mimic)" 는 RNAi 경로에들어가유전자발현을조절할수있는합성비암호화 RNA를말한다. mirna 모방체는내재적마이크로RNA들 (mirnas) 의기능을모방하고, 성숙한이중가닥분자또는모방전구체 ( 예를들어, 또는 pre-mirnas) 로서설계될수있다. mirna 모방체는변경된또는변경되지않은 RNA, DNA, RNA-DNA 하이브리드또는대안적인핵산화합물 (nucleic acid chemistries)( 예를들어, LNAs 또는 2'-O,4'-C-에틸렌-가교핵산 (2'-O,4'-C-ethylene-bridged nucleic acid(ena)) 로이루어질수있다. 성숙한이중가닥 mirna 모방체에대하여, 듀플렉스부위의길이는 13-33, 또는 21-23의뉴클레오티드사이로다를수있다. mirna는또한적어도 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 또는 40개의뉴클레오티드를전부포함할수있다. mirna의서열은 pre-mirna의처음 13-33의뉴클레오티드일수있다. mirna의서열은또한 premirna의마지막 13-33의뉴클레오티드일수있다. mirna와암세포를접촉시키는것은다수의방식으로이루어질수있음은상기본원에제공된설명으로부터이해될수있을것이다 : 1. 성숙한이중가닥 mirna로암세포를일시적으로형질감염시킨다. 2. 성숙한 mirna를암호화하는발현벡터로암세포를안정하게또는일시적으로형질감염시킨다

22 [0113] [0114] [0115] [0116] [0117] [0118] [0119] [0120] [0121] [0122] 3. pre-mirna를암호화하는발현벡터로암세포를안정하게또는일시적으로형질감염시킨다. 상기 pre-mirna 서열은 45-90, 또는 60-70까지의뉴클레오티드를포함할수있다. 상기 pre-mirna의서열은본원에제시한바와같은 mirna 및 mirna* 를포함할수있다. 상기 pre-mirna의서열은또한 pri-mirna의 5' 및 3' 말단으로부터 0-160의뉴클레오티드를제외한 pri-mirna의것일수있다. 4. pri-mirna를암호화하는발현벡터로암세포를안정하게또는일시적으로형질감염시킨다. 상기 pri-mirna 서열은 45-30,000, 50-25,000, ,000, 1,000-1,500 또는 뉴클레오티드를포함할수있다. 상기 pri-mirna의서열은또한본원에제시한것과같은 pre-mirna, mirna와 mirna* 및그것들의변이체를포함할수있다. SYNJ2를하향조절할수있는다른약제는 SYNJ2의 mrna 전사체또는 DNA 서열을특이적으로절단할수있는 DNA 효소 (DNAzyme) 분자이다. DNA 효소는단일및이중가닥의표적서열모두를절단할수있는단일-가닥폴리뉴클레오티드이다 (Breaker, R.R. and Joyce, G. Chemistry and Biology 1995;2:655; Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 1997;943:4262). DNA 효소에대한일반적인모델 ("10-23" 모델 ) 이제안되어있다. "10-23" DNA 효소는각각 7 내지 9의데옥시리보뉴클레오티드의두개의기질-인식 (substrate-recognition) 도메인의옆에위치하는 15 데옥시리보뉴클레오티드의촉매도메인 (catalytic domain) 을가진다. 이런형태의 DNA 효소는퓨린 : 피리미딘접합부 (junctions) 에서그것의기질 RNA를효과적으로절단할수있다 (Santoro, S.W. & Joyce, G.F. Proc. Natl, Acad. Sci. USA 199; for rev of DNAzymes see Khachigian, LM [Curr Opin Mol Ther 4: (2002)). 단일및이중-가닥의표적절단부위를인식하는합성, 조작된 DNA 효소의제작및증폭의예는조이스등 (Joyce et al.,) 의 U.S. Pat. No. 6,326,174에기술되어있다. 인간유로키나아제 (Urokinase) 수용체를향하도록유도된유사한디자인의 DNA 효소는최근유로키나아제수용체발현을억제하며, 생체내에서결장암세포전이를성공적으로억제하는것으로관찰되었다 (Itoh et al, 20002, Abstract 409, Ann Meeting Am Soc Gen Ther 다른적용에서, bcr-ab1 발암유전자 (oncogene) 에상보적인 DNA 효소는백혈병세포에서의발암유전자의발현을억제하고, 만성골수성백혈병 (CML) 및급성림프구성백혈병 (ALL) 발생시자가골수이식 (autologous bone marrow transplant) 에서의재발률 (relapse rate) 을줄이는데성공하였다. SYNJ2의하향조절은또한 SYNJ2를암호화하는 mrna 전사체와특이적으로혼성화될수있는안티센스폴리뉴클레오티드를사용하여이루어질수있다. SYNJ2를효과적으로하향조절하기위해사용될수있는안티센스분자의디자인은안티센스접근법 (approach) 에중요한두가지양상을고려하여만들어져야만한다. 첫번째양상은적합한세포의세포질내로의올리고뉴클레오티드의운반이며, 두번째양상은그것의번역을억제하는방식으로세포내에서지정된 (designated) mrna 에특이적으로결합하는올리고뉴클레오티드의디자인이다. 선행기술은매우다양한세포형태들내로올리고뉴클레오티드를효과적으로운반하는데사용될수있는다수의운반전략들을교시하고있다 ( 예를들어, Luft J Mol Med 76: 75-6 (1998); Kronenwett et al. Blood 91: (1998); Rajur et al. Bioconjug Chem 8: (1997); Lavigne et al. Biochem Biophys Res Commun 237: (1997) and Aoki et al. (1997) Biochem Biophys Res Commun 231: (1997) 을참조 ). 게다가, 표적 mrna와올리고뉴클레오티드양쪽모두에서의구조적변경 (alteration) 의에너지론을설명하는열역학적사이클에기초하여그것들의표적 mrna에대해가장높게예측된결합친화성 (binding affinity) 를가지는서열들을확인하기위한알고리즘도이용할수있다 ( 예를들어, Walton et al. Biotechnol Bioeng 65: 1-9 (1999) 를참조 ). 이러한알고리즘은세포에서의안티센스접근법을시행하는데성공적으로사용되어왔다. 예를들면, 월튼등에의해개발된알고리즘덕분에과학자들은토끼베타-글로빈 (rabbit beta-globin, RBG) 에대한안티센스올리고뉴클레오티드및마우스종양괴사인자-알파 (tumor necrosis factor-alpha, TNF alpha) 전사체를성공적으로설계할수있었다. 같은연구그룹은최근에역학 (kinetic) PCR 기술에의해평가된것으로서세포배양액에서 3개의모델표적 mrna들 ( 인간락테이트디하이드로게나아제 (lactate dehydrogenase) A 및 B 및쥐의 gp130) 에대해합리적으로선택된올리고뉴클레오티드의안티센스활성이포스포디에스테르 (phosphodiester) 및포스포로티오에이트 (phosphorothioate) 올리고뉴클레오티드화합물을이용하는두개의세포형태에서의세개의서로다른표적에대한테스트를포함하는거의모든경우에서효과적인것으로드러났다고보고하였다. 게다가, 시험관내시스템을사용하는특정올리고뉴클레오티드의효율성을설계하고예측하기위한몇몇의접

23 근법들또한공개되어있다 (Matveeva et al., Nature Biotechnology 16: (1998)). [0123] [0124] [0125] [0126] [0127] [0128] [0129] [0130] 예를들어, (SYNJ2 단백질을암호화하는 ) SYNJ2 mrna를표적으로하는적합한안티센스올리고뉴클레오티드는하기의서열들중하나일수있다 : CCCTTTGTCTGCCACCTCCT (SEQ ID NO: 10), ACCCATCTTGCTCTCTCCC (SEQ ID NO: 11) and TCTTCCTCCACCACAGCACC (SEQ ID NO: 12). 몇몇의임상시험들은안티센스올리고뉴클레오티드의안정성, 가능성및활성을입증하였다. 예를들면, c-myb 유전자, p53 및 Bcl-2를표적으로하는안티센스올리고뉴클레오티드를통한혈액악성종양 (hematological malignancies) 의치료가임상시험에들어가환자들에의해받아들여지는것으로드러나는동안 (Gerwitz Curr Opin Mol Ther 1: (1999)), 암을치료하는데적합한안티센스올리고뉴클레오티드가성공적으로사용되어오고있다 (Holmund et al., Curr Opin Mol Ther 1: (1999)). 보다최근에, 인간헤파라나아제 (heparanase) 유전자발현의안티센스-매개성억제는마우스모델에서인간암세포의흉막파종 (pleural dissemination) 을억제하는것으로보고되었다 (Uno et al., Cancer Res 61: (2001)). 따라서, 현재의여론은상기기술한바와같이매우정확한안티센스설계알고리즘및매우다양한올리고뉴클레오티드운반시스템의생성으로이어지는안티센스기술분야의최근의발전이당업자들이과도한시행착오실험에의지할필요없이공지서열의발현을하향조절하는데적합한안티센스접근법을설계하고시행할수있게한다는것이다. SYNJ2를하향조절할수있는다른약제는 SYNJ2를암호화하는 mrna 전사체를특이적으로절단할수있는리보자임 (ribozyme) 분자이다. 리보자임은점점더관심단백질을암호화하는 mrna의절단에의한유전자발현의서열 -특이적(sequence-specific) 억제를위해사용되고있다 (Welch et al., Curr Opin Biotechnol. 9: (1998)). 임의의특정표적 RNA를절단하도록리보자임을설계할수있는가능성은그것들을기초연구및치료학적적용양쪽모두에있어서유용한도구가되도록만들었다. 치료영역에서, 리보자임은감염성질병에서의표적바이러스 RNA들, 암에서의우성종양유전자 (dominant oncogenes) 및유전성질환에서의특정체세포돌연변이 (somatic mutations) 에이용되어오고있다 (Welch et al., Clin Diagn Virol. 10: (1998)). 무엇보다도특히, HIV 환자들을위한몇몇의리보자임유전자치료프로토콜이이미제1상임상시험 (Phase 1 trials) 에들어갔다. 보다최근에, 리보자임은형질전환동물, 유전자표적검증 (validation) 및경로의해명 (pathway elucidation) 을위해사용되고있다. 몇몇의리보자임들이다양한임상시험단계에있다. ANGIOZYME은인간임상시험에서연구된첫번째화학적으로합성된리보자임이다. ANGIOZYME은신생혈관형성 (angiogenesis) 경로에서의중요성분인혈관내피성장인자수용체 (vascular endothelial growth factor receptor, VEGR-r) 의형성을특이적으로억제한다. 다른회사들뿐만아니라리보자임제약회사 (Ribozyme Pharmaceuticlas, Inc.,) 도동물모델에서항신생혈관형성치료법의중요성을입증하였다. C형간염바이러스 (Hepatitis C Virus, HCV) 의 RNA를선택적으로파괴하도록설계된리보자임인 HEPTAZYME는세포배양검정법에서 C형간염바이러스 RNA를감소시키는데효과적인것으로밝혀졌다 (Ribozyme Pharmaceuticals, Incorporated - WEB home page). SYNJ2를하향조절할수있는다른약제는 SYNJ2에결합하고 / 하거나 SYNJ2를절단하는임의의분자일수있다. 현재의교시들은세포운동성 (cellular motility) 에서 SYNJ2의역할의기본이되는일반적인메커니즘을밝혔다. 그원리를도 15에나타내었다. 따라서, 핵심적인사건 (key event) 은 SYNJ2의 EGF-유도성상향조절및그결과에따른세가지포스포이노시티드의감소를수반한다 : PI(4,5)P 2, PI(3,4,5)P 3 and PI(3,5)P 2. SYNJ2-매개성 PI(4,5)P 2 의탈인산화는포스포리파아제 C-감마에의한 PI(4,5)P 2 의분해및 PI3K에의한인산화에의해평행이되고, PI(3,4,5)P 3 를생성한다. 총괄적으로, EGF에의한세가지효소의자극은원형질막으로부터 PI(4,5)P 2 바인더그룹을분리시키며, 또한 PI(4,5)P 2 가전혀없는 (PI(4,5)P 2 -devoid) 세포내소포 (endocytic vesicle) 를생성한다. 동시에, SYNJ2는 PI(3,4,5)P 3 를 PI(3,4)P 2 로전환하며, 이것은침습위족의형성에필수적이다. 일단준비가되면, PI(3,4)P 2 는 TKS5와결합하고, 코필린이침습위족내에서액틴의반화살촉말단 (barbed end) 을생성할수있게하는다이나민 (Dynamin) 및코르탁틴-중심복합체 (Cortactin-centered complex) 를핵주위에모은다. 본발명의결과에따르면, SYNJ2는또한다음의침습위족성숙단계, 즉 MMP의분비및 MT1-MMP 및 CD44와같은다른표면분자들의운반에도관여한다. 유사한방식으로, SYNJ2는리딩에지로의 EGFR과인테그린의운반을조절하고코필린을활성화시키는것으로보이며, 층상위족돌출부의형성을지시하는중추적사건을조절한

24 다. [0131] [0132] 이러한발견들은추정상의종양전이억제물질인 SYNJ2 억제물질을확인하는데사용될수있다. 따라서, 본발명의양상에따르면, 본발명은추정상의종양전이억제물질을확인하는방법을제공하며, 상기 방법은시료의존재하에 PI(3,4,5)P 3 의 PI(3,4)P 2 로의 SYNJ2- 매개성프로세싱을분석하고, 여기에서상기시료 의부재하에서의그것과비교하여상기시료의존재하에서 PI(3,4,5)P 3 의 PI(3,4)P 2 로의감소된프로세싱은추정 상의종양전이의억제물질을나타낸다. [0133] [0134] [0135] 시료는생체분자 ( 단백질, 예를들어펩티드또는항체, 핵산분자, 예를들어침묵화물질, 탄수화물, 지질또는그것들의조합 ) 또는소분자 ( 예를들어, 화학물질 ) 일수있다. 상기방법은생체내 (in vivo) 또는시험관내 (in vitro) 에서이루어질수있다. 후자는세포계 (cellular system) 에서또는무세포계 (cell-free system) 를사용하여시행될수있다. 예시적검정법은경쟁검정법 (competition assay) 에의한 PI(3,4,5)P 3 의 PI(3,4)P 2 로의 SYNJ2-매개성프로세싱 을분석하는것을포함한다. [0136] [0137] [0138] 따라서, 상기경쟁검정법은 PI(3,4)P2에결합된 PI(3,4)P2 결합도메인을포함하는복합체로부터 PI(3,4)P2 결합도메인의변위 (displacement) 를테스트한다. 예시적구현에따르면, 형광편광 (fluorescence polarization) 경쟁검정법을사용하였다. 상기검정법은일단분자가더큰봉쇄 (sequestering) 요소 ( 예를들어, 단백질 ) 와결합하면공간에서의그것들의움직임은현저하게감소된다는이론에의존한다. 이현상은형광편광을분석한후샘플의병렬적이고수직적인평면으로부터의측정을가능하게하는형광프로브를사용하여검출되고측정될수있다. 따라서, 용액내에서결합하지않은형광분자는매우낮은편광판독 (readings) 을야기하지만, 이들분자에결합하는 ( 봉쇄하는 ) 검출기 (detector)( 예를들어, 결합단백질 ) 가용액에첨가되는경우, 형광분자는용액에서편광판독을증가시키는한정된조성물에서안정화된다. 예를들면, 상기검정법은재조합 SYNJ2 및그것의비형광성기질인 PI(3,4,5)P 3 과더불어, PI(3,4)P 2 결합도 메인 ( 예를들어, PH- 도메인 ; 예를들어, Tapp1 PH 도메인, SEQ ID NOs:15-16) 및형광성 PI(3,4)P 2 를포함할수 있다. SYNJ2 들의촉매활성의생성물은형광성 PI(3,4)P 2 를대체하므로형광편광은감소된다. [0139] 특정구현에따르면, 상용의 5' PI(3,4,5)P 3 포스파타아제활성형광편광검정법을사용하였다 ( 예를들어, Echelon Bioscience, cat. no. K-1400). [0140] 특정구현에따르면, 시료가제조되었는지에상관없이, SYNJ2 의촉매활성 ( 탈인산화 ) 을가능하게하는조건하에 서 SYNJ2 및기질로서 PI(3,4,5)P 3 를포함하는반응혼합물을배양하였다. 상기시료는예를들면, 소분자, 핵 산분자, 펩티드, 항체, 탄수화물또는그것들의조합일수있다. 배양후, PI(3,4)P2 생성물을포함하는용액을 PI(3,4)P2 결합단백질 ( 예를들어, Tapp1의 PH-도메인, SEQ ID NO:15) 및형광성 PI(3,4)P2의혼합물과혼합하고, 형광편광을측정하였다. 이검정법에서측정된편광값은결합된형광성 PI(3,4)P2 분자가 SYNJ2의효소활성에의해생성된비표지된 PI(3,4)P2로대체되기때문에감소하며, 용액내에서비결합된형광성 PI(3,4)P2 분자의양은증가한다. 시료의존재하에서형광편광의값이시료의부재하에서의값과비교하여증가하는경우에, 시료는추정상의 SYNJ2 억제물질이다. [0141] [0142] [0143] [0144] 일단확인되면, 항전이성약물로서시약의기능성은젤라틴-자이모그래피검정법, 트랜스웰검정법과같은적절한검정법및및아래에더예시될실험동물을사용하여더입증된다. 이방법론을사용하여, 본발명은본발명의몇몇구현에따라 SYNJ2 억제물질로서사용될수있는다수의소분자들을확인하였다. 이분자들을아래도 19에묘사하였으며, 실시예 10의표 2에나타내었다. 언급한바와같이, SYNJ2의억제물질은암의발병또는진행과연관된세포표며수용체의억제물질에더하여투여된다. 본발명의구현에따르면, 상기수용체는발암유전자이다. 본발명의교시에따라표적화될수있는수용체의예는 EGFR, PDGFR, VEGFR, FGFR 및 ErbB-2와같은수용체티로신키나아제 (receptor tyrosine kinase) 이다

25 [0145] [0146] [0147] [0148] [0149] [0150] [0151] [0152] [0153] 표적화될수있는다른표면분자는인테그린매트릭스메탈로프로테이나아제 (integrins matri metalloproteinase, MMPs), 다이나민 (dynamin), TKS5 및 CD44를포함한다. 세포표면분자의억제물질은당업계에잘알려져있다. 이러한억제물질의비제한적리스트를아래에제공한다. 따라서, 예를들어, 발암유전자로서의 EGFR의확인은 EGFR을겨냥하는항암치료의개발로이어진다. 세툭시맙 (cetuximab) 및파니투무맙 (panitumumab) 은단일클론항체억제물질의예이다. 임상개발에있는다른단일클론은잘루투무맙 (zalutumumab), 니모투주맙 (nimotuzumab) 및마투주맙 (matuzumab) 이다. 단일클론항체들은세포외리간드결합도메인을차단한다. 결합부위가차단되면, 시그널분자들은더이상거기에부착할수없고, 티로신키나아제를활성화시킨다. 다른방법은수용체의세포질쪽에있는 EGFR 티로신키나아제를억제하기위하여소분자를사용한다. 키나아제의활성없이 EGFR은그자체를활성화시킬수없고, 그것은하류쪽어댑터단백질 (adaptor proteins) 의결합을위한전제조건이다. 표면상으로, 성장을위해이경로에의존하는세포에서의신호전달연쇄반응 (signaling cascade) 을중단시킴으로써, 종양의증식및이동이줄어든다. 게피티닙 (gefitinib), 엘로티닙 (erlotinib) 및라파티닙 (lapatinib)(egfr과 ERBB2가혼합된억제물질 ) 은소분자키나아제억제물질의예이다. 다른예는 EGFR 을직접적으로겨냥하는이레사 (Iressa) 및타쎄바 (Tarceva) 를포함한다. HER2는단일클론항체트라스투주맙 (trastuzumab)( 허셉틴 (Herceptin) 으로판매되고있음 ) 의표적이다. 트라스투주맙은 HER2가과발현된암에만효과가있다. HER2 및 HER3 수용체의이합체화 (dimerization) 를억제하는다른단일클론항체인페르투주맙 (Pertuzumab) 은 2012년 6월에트라스투주맙과함께사용하도록 FDA에의해승인되었다. 게다가, 뉴백스 (NeuVax)(Galena Biopharma) 는 HER2를발현하는암세포를겨냥하고파괴하기위해 " 킬러 " T 세포를겨냥하는펩티드-기반면역치료제이다. HER2의발현은에스트로겐수용체를통한신호전달에의해조절된다. 에스트로겐수용체를통해작용하는에스트라디올 (estradiol) 및타목시펜 (tamoifen) 은 HER2의발현을하향조절한다. 본발명의교시에따라사용될수있는항체의예들을아래에열거하였으며, 어떤식으로든한정하고자하는것은아니다. [0154] 항체 상표명 승인 형태 표적 승인된치료 날짜 알렘투주맙 (Alemtuzumab) 캠파스 (Campath) 2001 인간화 CD52 만성림프성백혈병 베바시주맙 (Bevacizumab) 아바스틴 2004 인간화 혈관내피 대장암 브렌툭시맙베도틴 (Brentuximab vedotin) 세툭시맙 (Cetuximab) 젬투주맙오조가마이신 (Gemtuzumab ozogamicin) 이브리투모맙튜세탄 (Ibritumomab tiuxetan) (Avastin) 애드세트리스 (Adcetris) 얼비툭스 (Erbitux) 마일로타그 (Mylotarg) 제발린 (Zevalin) 표 1 성장인자 2011 키메라 CD30 호지킨성 2004 키메라상피세포 성장인자 림프종, 미분화성 대세포림프종대장암 수용체 2000 인간화 CD33 급성골수성백혈 병 ( 칼리키아마이신 (c alicheamicin) 과함께 ) 2002 쥐 CD20 비호지킨성 림프종 ( 이트륨 -90 및인듐 -111 과함께 )

26 파니투무맙 (Panitumumab) 리툭시맙 (Rituximab) 트라스투주맙 (Trastuzumab) 벡티빅스 (Vectibix) 리툭산 (Rituxan), 맙테라 (Mabthera) 허셉틴 (Herceptin) 2006 인간상피세포 성장인자 대장암 수용체 1997 키메라 CD20 비호지킨성림프 종 1998 인간화 ErbB2 유방암 [0155] [0156] [0157] [0158] [0159] [0160] [0161] [0162] [0163] 본원에기술된것과같은 SYNJ2의억제인자및선택적으로세포표면수용체의억제물질은그자체로 (per se) 또는적절한담체또는첨가제와함께혼합된약제학적조성물로대상에게투여될수있다. 본원에사용된것과같은 " 약제학적조성물 (pharmaceutical compostion)" 은생리학적으로적합한담체및첨가제와같은다른화학적성분들과함께본원에기술된하나또는그이상의활성성분의조제물 (preparation) 을말한다. 약제학적조성물의목적은생물체에합성물의투여를용이하게하는것이다. 본원에서용어 " 활성성분 (active ingredient)" 은생물학적효과를나타내는 (accountable) SYNJ2의억제인자 ( 및선택적으로세포표면수용체의억제인자 ) 를말한다. 아래에서, 상호교환적으로사용될수있는문구 " 생리학적으로허용가능한담체 (physiologically acceptable carrier)" 및 " 약제학적으로허용가능한담체 (pharmaceutically acceptable carrier)" 는생물체에현저한자극을야기하지않고, 투여된화합물의생물학적활성및특성을없애지않는담체또는희석제를말한다. 보조약은이러한문구들하에포함된다. 본원에서용어 " 부형제 (excipient)" 는활성성분의투여를더용이하게하기위해약제학적조성물에첨가되는비활성물질을말한다. 제한없이, 부형제의예는칼슘카보네이트 (calcium carbonate), 칼슘포스페이트 (calcium phosphate), 다양한당및전분의형태, 셀룰로오스유도체 (cellulose derivatives), 젤라틴, 식물성오일및폴리에틸렌글리콜 (polyethylene glycols) 을포함한다. 약물의제형화및투여를위한기술은참조로서본원에포함되는 " 레밍턴의약학 " 에서찾을수있다 ("Remington's Pharmaceutical Sciences." Mack Publishing Co., Easton, PA, latest edition). 투여의적절한방법은예를들어, 경구 (oral), 직장 (rectal), 점막관통 (transmucosal), 특히척추강내 (intrathecal), 직접적인심실내 (intraventricular), 심장내 (intracardiac), 예를들어오른쪽또는왼쪽심실강 (ventricular cavity) 내로, 주간부관상동맥 (common coronary artery) 내로, 정맥내 (intravenous), 복강내 (intraperitoneal), 비강내 (intranasal) 또는안구내 (intraocular) 주입뿐만아니라, 근육내 (intramuscular), 피하 (subcutaneous) 및골수내 (intramedullary) 주입을포함하는경비 (transnasal), 장내 (intestinal) 또는비경구적 (parenteral) 운반도포함할수있다. 중추신경계 (central nervous system, CNS) 로의약물운반을위한기존의접근법은 : 신경외과수술전략 ( 예를들어, 뇌내주입 (intracerebral injection) 또는뇌혈관내주입 (intracerebroventricular infusion); 혈액뇌장벽 (blood brain barrier, BBB) 의내재적수송경로중하나를이용하기위한시도로약제의분자적조작 (molecular manipulation)( 예를들어, 스스로혈액뇌장벽을통과할수없는약제와함께내피세포표면분자에친화력을가지는수송펩티드를포함하는키메라융합단백질의생산 ); 약제의지질용해도 (lipid solubility) 를증가시키도록설계된약학적전략 ( 예를들어, 지질또는콜레스테롤담체에의수용성약제의포합 (conjugation)); 및 ( 경동맥내로의만니톨용액의주입 (infusion) 또는안지오텐신 (angiotensin) 펩티드와같은생물학적활성제의사용으로인한 ) 고삼투압성붕괴 (hyperosmotic disruption) 에의한혈액뇌장벽의원형 (integrity) 의일시적붕괴를포함한다. 그러나, 각각의이들전략은침습적수술절차와관련하여내재하는위험, 내재적수송계에내재하는한계에의해정해진크기의한계, 중추신경계의바깥에서활성화될수있는담체모티프로구성된키메라분자의전신적 (systemic) 투여와관련된잠재적으로바람직하지않은생물학적부작용, 및혈액뇌장벽이붕괴되어차선의운반방법이되도록한뇌부위내에서뇌손상발생가능성의위험과같은한계를가진다. 대안적으로, 전신적방식보다는예를들어, 환자의조직부위내로의직접적인약제학적조성물의주입을통하

27 여국소적으로약제학적조성물을투여할수있다. [0164] [0165] [0166] [0167] [0168] [0169] [0170] [0171] [0172] 용어 " 조직 (tissue)" 은기능또는기능들을수행하도록만들어진세포들로구성된생물체의일부분을말한다. 예로는뇌조직, 안구조직, 피부조직, 간조직, 췌장조직, 골조직, 연골조직, 결합 (connective) 조직, 혈액조직, 근육조직, 심장조직, 뇌조직, 혈관조직, 신장조직, 폐조직, 생식선 (gonadal) 조직, 조혈 (hematopoietic) 조직을포함하나, 이에한정되지않는다. 본발명의몇몇구현의약제학적조성물은당업계에잘알려진프로세스에의해, 예를들어기존의혼합, 용해, 과립화, 드라제화 (dragee-making), 부양화 (levigating), 에멀전화, 캡슐화, 트랩핑 (entrapping) 또는동결건조 (lyophilizing) 프로세스를사용하여제조될수있다. 따라서, 본발명의몇몇구현에따라사용하기위한약제학적조성물은활성성분의조제물로의가공을용이하게하며, 약제학적으로사용될수있는부형제및보조제를포함하는하나또는그이상의생리학적으로허용가능한담체를사용하여기존의방식으로제형화될수있다. 적절한제형은선택된투여의방법에의존한다. 주입을위해서, 약제학적조성물의활성성분은수용액, 바람직하게는행크용액 (Hank's solution), 링거액 (Ringer's solution) 과같은생리학적으로서로섞이는완충액 (physiologically compatible buffers) 또는생리학적염완충액 (physiological salt buffer) 로제형화될수있다. 점막관통투여를위해서, 투과되어야할장벽 (barrier) 에적합한투과제 (penetrant) 가제형화에사용된다. 이러한투과제당업계에일반적으로공지되어있다. 경구투여를위해서, 약제학적조성물은당업계에잘알려져있는약제학적으로허용가능한담체와함께활성성분을조합함으로써쉽게제형화될수있다. 이러한담체는환자에의한경구섭취 (oral ingestion) 를위해, 약제학적조성물이정제 (tablets), 알약 (pills), 당의정 (dragees), 캡슐 (capsules), 액체 (liquids), 젤 (gels), 시럽 (syrups), 슬러리 (slurries), 현탁제 (suspensions) 등으로제형화될수있게한다. 경구사용을위한약학적조제물은고체부형체를사용하고, 선택적으로생성된혼합물을분쇄 (grinding) 하고, 원한다면적합한보조제를첨가한후과립의혼합물을가공하여정제또는당의정핵 (core) 으로만들어질수있다. 적합한부형제는특히락토오스, 수크로오스, 만니톨또는소르비톨을포함하는당과같은필러 (fillers); 예를들어, 옥수수전분 (maize starch), 밀전분, 쌀전분, 감자전분, 젤라틴, 검트래거캔스 (gum tragacanth), 메틸셀룰로오스 (methyl cellulose), 히드록시프로필메틸-셀룰로오스 (hydroxypropylmethyl-cellulose), 소디움카복시메틸셀룰로오스 (sodium carboxymethylcellulose); 및 / 또는폴리비닐피롤리돈 (polyvinylpyroolidone, PVP) 과같은생리학적으로허용가능한폴리머이다. 원한다면, 가교결합된폴리비닐피롤리돈, 한천 (agar) 또는알긴산, 또는소디움알기네이트 (sodium alginate) 와같은그것들의염과같은붕해제가첨가될수있다. 당의정핵은적당한코팅물로제공된다. 이러한목적으로, 농축당용액이사용될수있으며, 선택적으로검아라빅 (gum arabic), 탈크, 폴리비닐피롤리돈, 카르보폴겔 (carbopol gel), 폴리에틸렌글리콜, 티타늄디옥사이드, 래커액 (lacquer solutions) 및적당한유기용매또는용매혼합액이포함될수있다. 활성성분함유량 (dose) 의상이한조합을확인하거나특성화하기위해, 정제또는당의정코팅물에염료 (dyestuffs) 또는안료 (pigments) 가첨가될수있다. 경구용으로사용될수있는약제학적조성물은젤라틴과글리세롤또는소르비톨과같은가소제로제조된연질의밀봉 (soft, sealed) 캡슐뿐만아니라젤라틴으로제조된푸쉬-핏 (push-fit) 캡슐도포함한다. 푸쉬-핏캡슐은락토오스와같은필러, 전분과같은결합제, 탈크또는마그네슘스테아레이트와같은활택제및선택적으로안정화제를포함한혼합물에활성성분을포함할수있다. 연질캡슐에서, 활성성분은지방유 (fatty oils), 액체파라핀또는액체폴리에틸렌글리콜과같은적당한액체에용해되거나현탁될수있다. 또한, 안정화제도첨가될수있다. 모든경구투여용제제는선택된투여방법에적합한용량이어야한다. 구강투여를위해서, 조성물은기존의방식으로제형화된정제또는마름모꼴캔디 (lozenges) 의형태를취할수있다. 비강흡입에의한투여를위해서, 본발명의몇몇구현에따라사용하기위한활성성분은적당한추진제, 예를들어, 디클로로디플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄또는이산화탄소를사용하여가압팩또는네브라이저 (nebulizer) 로부터에어로졸분무프리젠테이션 (aerosol spray presentation) 의형태로편리하게전달된다. 가압에어로졸의경우에있어서, 투여단위 (dosage unit) 는계량된양 (metered amount) 을전달하기위한밸브 (valve) 를제공함으로써결정될수있다. 주입기 (dispenser) 에서의사용을위한, 예를들어, 젤라틴캡슐및카트리지 (cartridges) 는화합물과락토오스또는전분과같은적당한분말기제

28 (powder base) 의분말혼합물을함유하도록제형화될수있다. [0173] [0174] [0175] [0176] [0177] [0178] [0179] [0180] [0181] [0182] [0183] [0184] 본원에기술된약제학적조성물은예를들어, 급속주입 (bolus injection) 또는연속주입 (continuous infusio n) 에의한비경구투여를위해제형화될수있다. 주사를위한제형은단위투여형태 (unit dosage form) 로, 예를들어앰풀 (ampoules) 또는선택적으로방부제가첨가된다회용저장용기 (multi-dose containers) 에존재할수있다. 조성물은유성또는수성비히클에녹인현탁액, 용액또는에멀전일수있고, 현탁제, 안정화제및 / 또는분산제와같은제형화제 (formulatory agent) 를포함할수있다. 비경구투여를위한약제학적조성물은수용성형태로활성조제물의수용액을포함한다. 또한, 활성성분의현탁액은적절한유성또는수성기반의주사현탁액으로제조될수있다. 적합한친지질용매또는비히클은참기름과같은지방유, 또는에틸올리에이트, 트리글리세리드또는리포좀과같은합성지방산에스테르를포함한다. 수성주사현탁액은소디움카복시메틸셀룰로오스, 소르비톨또는덱스트란과같은현탁액의점도를증가시키는물질을포함할수있다. 선택적으로, 현탁액은또한고농도의용액을제조할수있게활성성분의용해도를증가시키는적절한안정화제또는약제를포함할수있다. 대안적으로, 활성성분은사용하기전적절한비히클, 예를들어멸균주사용증류수 (sterile pyrogen-free water) 에기반한용액과함께구성되기위한분말형태일수있다. 본발명의몇몇구현의약제학적조성물은또한예를들어, 코코아버터또는다른글리세리드와같은종래의좌약기제 (suppository base) 를사용하여좌약또는정체관장제 (retention enema) 와같은직장조성물로제형화될수도있다. 본발명의몇몇구현의상황하에서사용하기에적합한약제학적조성물은활성성분이성취하고자하는목적을달성하는데효과적인양으로포함된조성물을포함한다. 더욱상세하게는, 치료학적유효량은질환 ( 예를들어, 암또는전이성암 ) 의증상을예방, 완화또는개선하거나치료될대상의생존을연장시키는데유효한활성성분 (SYNJ2 억제인자 ) 의양을의미한다. 치료학적유효량의결정은특히본원에제공된상세한설명을고려하여당업자들의능력내에서충분히이루어질수있다. 본발명의방법에사용된임의의제조물을위해서, 치료학적유효량또는투여량 (dose) 은처음에시험관내검정법및세포배양검정법으로부터추정될수있다. 예를들면, 투여량은동물모델에서원하는농도또는역가 (titer) 를달성하도록만들어질수있다. 이러한정보는인간에게유용한투여량을더욱정확하게결정하기위해사용될수있다. 본원에기술된활성성분의독성및치료학적효능은시험관내, 세포배양또는실험동물에서표준약제학적절차에의해측정될수있다. 이들시험관내및세포배양검정법및동물실험으로부터얻어진데이터는인간에게사용하기위한투여의범위를정하는데사용될수있다. 투여량은사용될투여형태및사용될투여방법에따라달라질수있다. 정확한제형, 투여경로및투여량은환자의조건을고려하여의사에의해선택될수있다 ( 예를들어, Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1을참조 ). 투여의양및간격은활성성분이생물학적효과를유도하거나억제하기에충분한 ( 최소유효농도 (minimal effective concentration, MEC)) SYNJ2 억제인자레벨을제공하도록개별적으로조정될수있다. 최소유효농도는각조제물에따라달라질수있으나, 시험관내데이터로부터예측될수있다. 최소유효농도를달성하는데필요한투여량은개체의특성및투여경로에의존할것이다. 검출검정법은혈장농도를측정하는데사용될수있다. 치료될질환의심각도및민감성에따라, 약의투여 (dosing) 는며칠내지는몇주로이어지는치료의과정에따라, 또는치유가되거나질병상태의축소가이루어질때까지단일또는복수의투여가될수있다. 투여되는조성물의양은물론치료될대상, 고통의심각도, 투여방식, 처방한의사의판단에따라달라질수있다. 본발명의몇몇구현의조성물은원한다면활성성분을포함하는하나또는그이상의단위투여형태를포함할수있는, FDA 승인키트와같은팩또는디스펜서장치로존재할수있다. 팩은예를들어, 발포제팩 (blister pack) 과같은금속또는플라스틱호일 (foil) 을포함할수있다. 팩또는디스펜서장치는투여를위한설명서를수반할수있다. 팩또는디스펜서는또한약제의제조, 사용또는판매를규제하는정부기관에의해규정

29 된형태로용기와관련된주의사항에의해수용될수있고, 이러한주의사항은인간또는가축의투여에대한조성물형태의기관에의한승인을반영한다. 이러한주의사항은예를들어, 미국식품의약품국 (U.S. Food and Drug Administration) 에의해승인된라벨이거나승인된제품첨가물 (insert) 일수도있다. 혼화성 (compatible) 의약제학적담체로제형화된본발명의제조물을포함하는조성물또한제조되어적절한용기에보관될수있고, 상기에더상세히설명한바와같이지시된질환의치료를위한표지가붙을수있다. [0185] [0186] [0187] [0188] [0189] [0190] 세포이동에대한 SYNJ2의기여와같은방식으로, 본발명의발명자들은암의공격적하위형태에서 SYNJ2가예후예측마커 (prognostic marker) 로서사용될수있음을암시하는 SYNJ2 mrna 및단백질레벨의현저한상향조절을관찰하였다. 따라서, 본발명의양상에따르면, 본발명은암의예후예측이필요한대상에서암을예후예측하는방법을제공하며, 상기방법은대상의암세포에서의 SYNJ2의레벨또는활성을측정하는것을포함하고, 여기에서영향을받지않은대조군샘플의세포에서의 SYNJ2의활성레벨과비교하여대상의상기암세포에서의상기 SYNJ2의상기활성레벨에서의상향조절은나쁜예후 (poor prognosis) 의지표이다. 본원에사용된것과같은용어 " 예후예측 (prognosing)" 은질병 ( 암 ) 의결과를알아내는것을말한다. 본원에사용된것과같은 " 나쁜예후 (poor prognosis)" 는질병의재발위험성의증가및 / 또는질병으로인한사망위험성의증가를말한다. 본원에사용된것과같은용어 " 레벨 (level)" 은 DNA( 유전자증폭 ), RNA 또는단백질에서의발현레벨을말한다. 본원에사용된것과같은 "SYNJ2 활성 (SYNJ2 activity)" 은주로그것의포스파타아제활성, 즉 PI(3,4,5)P 3 를 PI(3,4)P 2 로전환하는활성을말한다. [0191] [0192] [0193] [0194] [0195] [0196] [0197] [0198] 특정구현에따르면, 상기활성은시험관내활성검정법을사용하여분석된다. 시험관내활성검정법 (In vitro activity assays): 이들방법에서, 특정효소 ( 이경우에는포스파타아제 ) 의활성은세포로부터추출된단백질혼합물에서측정된다. 상기활성은비색법 (colorimetric method) 을잘이용하여분광광도계 (spectrophotometer) 에서측정될수있거나, 비변성 (non-denaturing) 아크릴아마이드겔 ( 즉, 활성겔 ) 에서측정될수있다. 그다음의전기영동에서, 겔을기질과비색시약 (colorimetric reagent) 을포함하는용액에침지시킨다. 그결과얻어진염색된밴드는관심단백질의효소활성과일치한다. 만약잘조정되었고 (well-calibrated) 반응의선형구간 (linear range) 내라면, 샘플에존재하는효소의양은생성된색 (color) 의양에비례한다. 효소의기준 (standard) 은일반적으로양적정확도를향상시키기위해사용된다. SYNJ2에특이적인검정법은상기에기술하였으며, PI(3,4,5)P 3 에서 PI(3,4)P 2 로의전환활성을테스트한다. 단백질발현및 / 또는활성을검출하는방법 SYNJ2의단백질발현은당업계에공지된방법을사용하여측정될수있다. 효소결합면역흡착법 (Enzyme linked immunosorbent assay, ELISA): 이방법은미세역가플레이트 (microtiter plate) 의웰과같은표면에단백질기질을포함하는샘플 ( 예를들어, 고정세포 (fixed cells) 또는단백질성용액 (proteinaceous solution)) 의고정을포함한다. 효소에결합된기질특이적항체를사용하여기질에결합할수있게하였다. 그후, 항체의존재를검출하고, 항체에결합된효소를이용하는비색반응에의해정량하였다. 이방법에흔히사용되는효소는서양고추냉이과산화효소 (horseradish peroxidase) 및알칼리포스파타아제 (alkaline phosphatase) 를포함한다. 만약잘조정되었고반응의선형구간내라면, 샘플에존재하는기질의양은생성된색의양에비례한다. 기질의기준은일반적으로양적정확도를향상시키기위해사용된다. 웨스턴블롯 (Western blot): 이방법은아크릴아마이드겔을사용하여다른단백질로부터기질을분리한후, 그기질을막 ( 예를들어, 나일론또는 PVDF) 으로옮기는것을포함한다. 그후, 기질의존재를기질에특이적인항체에의해검출하며, 이는항체결합시약으로차례차례검출한다. 항체결합시약은예를들어, 단백질 A 또는다른항체일수있다. 항체결합시약은방사성표지될수있거나, 상기기술된것과같이효소에결합될수있다. 검출은오토래디오그래피 (autoradiography), 비색반응또는화학발광 (chemiluminescence) 에의해이루어질수있다. 이방법은전기영동하는동안아크릴아마이드겔에서의이동거리를나타내는막상에서의상대적위치에의해기질의양의정량및그것의존재의확인모두를가능하게한다. 방사성면역검정법 (radio-immunoassay, RIA): 하나의버전에서, 이방법은특정항체및아가로스비드와같은

30 침전가능한 (precipitable) 담체상에고정된방사성표지된항체결합단백질 ( 예를들어, I 125 로표지된단백질 A) 을이용한원하는단백질 ( 즉, 기질 ) 의침전 (precipitation) 을포함한다. 침전된펠릿에서의카운트 (count) 수 는기질의양에비례한다. [0199] [0200] [0201] [0202] [0203] [0204] [0205] [0206] [0207] [0208] RIA의대안적인버전에서, 표지된기질및비표지된항체결합단백질이사용된다. 알려지지않은양의기질을함유하는샘플이다양한양으로첨가된다. 표지된기질에서침전된카운트의감소는첨가된샘플에서의기질의양에비례한다. 형광활성화세포분류 (fluorescence activated cell sorting, FACS): 이방법은기질특이적항체에의한세포내에서 (in situ) 의기질의검출을포함한다. 상기기질특이적항체는형광단 (fluorophore) 에결합된다. 검출은세포가광선 (light beam) 을통과해서지나갈때각세포로부터방사된빛의파장을판독하는세포분류장치 (cell sorting machine) 로이루어진다. 이방법은두개또는그이상의항체를동시에사용할수있다. 면역조직화학적분석 (immunohistochemical analysis): 이방법은기질특이적항체에의해고정된세포내에서 (in situ) 의기질의검출을포함한다. 상기기질특이적항체는형광단에결합된효소일수있거나, 형광단에결합될수있다. 검출은현미경및주관적 (subjective) 또는자동 (automatic) 평가에의해이루어진다. 효소결합항체가사용된다면, 비색반응이필요할수있다. 면역조직화학후종종예를들어헤마톡실린 (hematoxylin) 또는김사 (Giemsa) 염색을사용하는세포핵의대비염색이이루어진다. 현장활성 (in situ activity) 검정법 : 이방법에따르면, 활성효소를포함하는세포상에발색기질 (chromogenic substrate) 이사용되며, 상기효소는기질이빛또는형광현미경으로볼수있는발색생성물을생성하도록분해되는반응을촉매한다. 대안적으로또는추가적으로, SYNJ2의레벨은당업계에잘알려져있고몇몇은아래에기술된방법을사용하여 RNA 레벨에서검출된다. RNA 발현레벨을검출하는방법본발명의몇몇구현의세포에서의 RNA의발현레벨은당업계에공지된방법을사용하여검출될수있다. 노던블롯분석법 (Northern Blot analysis): 이방법은 RNA들의혼합물에있는특정 RNA의검출을포함한다. RNA 샘플은염기쌍사이의수소결합을보호하는약제 ( 예를들어, 포름알데히드 ) 로처리함으로써변성되어, 모든 RNA 분자들이접히지않은, 선형의구조를가지도록한다. 각각의 RNA 분자들은그후겔전기영동에의해크기에따라분리되고, 변성된 RNA들의부착을위한니트로셀룰로오스또는나일론-기반의막으로옮겨진다. 그후, 상기막을표지된 DNA 프로브에노출시킨다. 프로브는방사성동위원소 (radio-isotopes) 또는효소결합뉴클레오티드를사용하여표지될수있다. 검출은오토래디오그래피, 비색반응또는화학발광을사용하여이루어질수있다. 이방법은특정 RNA 분자의양의정량및전기영동하는동안겔에서의이동거리를나타내는막에서의상대적위치에의한그것의정체의검출모두를가능하게한다. RT-PCR 분석 : 이방법은상대적으로적은 RNA 분자들의 PCR 증폭을사용한다. 먼저, RNA 분자들을세포로부터정제하고, (MMLV-RT와같은 ) 역전사효소 (reverse transcriptase enzyme) 및올리고 (oligo) dt, 랜덤헥사머 (random heamer) 와같은프라이머또는유전자특이적프라이머를사용하여상보적 DNA(complementary DNA, cdna) 로전환시킨다. 그후, 유전자특이적프라이머및 Taq DNA 폴리머라아제를사용하여, PCR 기계에서 PCR 증폭반응을수행한다. 당업자들은유전자특이적프라이머의길이와서열및특정 RNA 분자를검출하는데적합한 PCR 조건 ( 즉, 어닐링온도, 사이클의수등 ) 을선택할수있다. 반정량적 RT-PCR(semi-quantitative RT- PCR) 반응은 PCR 사이클의횟수를조정하고, 공지의대조물질과증폭산물을비교함으로써사용될수있음을이해할수있을것이다. RNA 인시츄혼성화염색 (RNA in situ hybridizatoin stain): 이방법에서 DNA 또는 RNA 프로브는세포에존재하는 RNA 분자에부착된다. 일반적으로, 세포는먼저세포구조를보존하고 RNA 분자가분해되는것을방지하기위하여현미경슬라이드에고정된후, 표지된프로브를포함하는혼성화버퍼에넣어진다. 상기혼성화버퍼는프로브의비특이적결합을회피함과동시에그자리에서 (in situ) 그것들의표적 mrna 분자들과 DNA 또는 RNA 프로브의특이적혼성화를가능하게하는, 포름아미드및염 ( 예를들어, 소디움클로라이드및소디움시트레이트 ) 와같은시약을포함한다. 당업자들은특정프로브와세포의형태에대해혼성화조건 ( 즉, 온도, 염및포름아미드의농도등 ) 을조정할수있다. 혼성화후, 임의의비결합프로브를세척하고, 결합프로브는공지의방법을사용하여검출한다. 예를들어, 방사성표지된프로브가사용된다면, 슬라이드는그후방사성표지된프

31 로브를사용하여생성된시그널을나타나게하는사진유제 (photographic emulsion) 로처리되고 ; 프로브가효소로표지된다면, 그후비색반응의형성을위해효소-특이적기질이첨가되고 ; 프로브가형광성표지를사용하여표지된다면, 그후결합된프로브는형광현미경을사용하여보여지고 ; 프로브가태그 ( 예를들어, 디곡시게닌 (digoxigenin), 비오틴등 ) 를사용하여표지된다면, 그후결합된프로브는공지의방법을사용하여검출될수있는태그-특이적항체와의상호작용후에검출될수있다. [0209] [0210] [0211] [0212] [0213] [0214] [0215] [0216] 인시츄 RT-PCR 염색 (in situ RT-PCR stain): 이방법은 Nuovo GJ 등 (Nuovo GJ, et al., Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cdna. Am J Surg Pathol. 1993, 17: ) 및 Komminoth P 등 (Komminoth P, et al., Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Pathol Res Pract. 1994, 190: ) 에기술되어있다. 간단하게는, RT-PCR 반응은 PCR 반응을위해표지된뉴클레오티드를혼입시키는것에의해고정된세포에서수행된다. 상기반응은아르크투르스엔지니어링 (Arcturus Engineering; Mountainview, CA) 로부터입수가능한레이저-캡처마이크로디섹션 (laser-capture microdissection) PixCell I LCM 시스템과같은특정인시츄 RT-PCR 기구를사용하여수행된다. DNA 마이크로어레이 (microarrays)/dna 칩 (chips): 수천개의유전자의발현이 DNA 마이크로어레이를사용하여동시에분석될수있으며, 이는특정발달과정또는생리학적반응동안생물체의완전한전사프로그램 (complete transcriptional program) 의분석을가능하게한다. 수천개의각각의유전자서열들로이루어진 DNA 마이크로어레이는유리현미경슬라이드와같은지지체의표면상의꽉찬공간에부착되어있다. DNA 마이크로어레이를제조하기위한다양한방법들이개발되어있다. 한방법에서는, 분석을위해각유전자의암호부위의대략 1 킬로베이스 (kilobase) 의분절 (segment) 이각각 PCR 증폭된다. 유리현미경슬라이드의표면상의밀접하게배치된지역 (closely spaced zones) 에각각증폭된 DNA 샘플을적용하기위해로봇장비들이사용되며, 그뒤 DNA 서열을지지체의표면에결합시키기위해열처리및화학처리로처리하여그것들을변성시킨다. 전형적으로, 이러한어레이는약 2 2 cm 이고, 각각약핵산 6000 스팟 (spots) 을포함한다. 다른기술에서, 주로 20 뉴클레오티드길이의다중 DNA 올리고뉴클레오티드는지지체의표면상의작은스퀘어존에서수만의동일한올리고뉴클레오티드가합성되도록지지체의표면에공유적으로결합된첫번째뉴클레오티드로부터합성된다. 단일유전자로부터얻은다중올리고뉴클레오티드서열은그유전자발현의분석을위한슬라이드의주변부위 (neighboring region) 에합성된다. 그러므로, 수천의유전자들이하나의유리슬라이드상에나타내어질수있다. 이러한합성올리고뉴클레오티드의어레이는상기기술한바와같은 "DNA 마이크로어레이 (DNA microarrays)" 와는대조적으로당업계에서 "DNA 칩 (DNA chip s)" 으로칭해질수있다 (Lodish et al. (eds.). Chapter 7.8: DNA Microarrays: Analyzing Genome-Wide Expression. In: Molecular Cell Biology, 4th ed., W. H. Freeman, New York. (2000)). 예후예측은명확한기준법 (gold standard method), 예를들어영상기법 (imaging method), 생검 (biopsy sampling), 마커발현 (marker expression), 면역조직화학등을사용하여입증될수있다. 다음은유방암에대한특정예이지만, 이로한정하고자하는것이아니다. 유방암의예후예측은주로종양의크기 (T), 림프절주변부로의전이상태 (N) 및다른기관으로의원격전이 (distant metastasis)(m) 를평가하는수술후의질병의병기 (stage)(tnm 병기 ) 에의해결정된다. TNM 병기에따라분류된환자의예후예측은동일한병기에서도서로다르다. 즉, 동일한병기의유방암에서도예후예측은에스트로겐또는프로게스테론수용체 (ER 또는 PR) 의발현및 HER2의과발현또는유전자의증폭에의해결정될수있다. SYNJ2를검출하기위해상기에기술된본발명의몇몇구현의약제들은바람직하게는적절한사용설명서및암의병기및 / 또는예후를진단및 / 또는평가하는데사용하기위한 FDA 승인을나타내는표지와함께진단키트 / 제조물 (article of manufacture) 에포함될수있다. 이러한키트는예를들어, 적어도하나의상기기술된진단제 ( 예를들어, 항 SYNJ2 항체, 예를들어항-HER2 및 / 또는항 ER 또는이들표적에대한올리고뉴클레오티드프로브 / 프라이머와함께 ) 를포함하는적어도하나의용기, 및다른용기에포장된영상화제 (imaging reagent)( 예를들어, 효소, 2차항체, 버퍼, 발색기질, 형광성물질 ) 를포함할수있다. 키트는또한적절한버퍼와키트의유통기한을개선하기위한방부제를포함할수있다. 용어 " 포함하다 (comprises or includes)", " 포함하는 (comprising or including)", " 가지는 (having)" 및그것들

32 의활용은 " 포함하지만이에한정되지않는 (including but not limited to)" 을의미한다. [0217] [0218] [0219] [0220] [0221] [0222] [0223] [0224] 용어 " 이루어지는 (consisting of)" 은 " 포함하며그것으로한정되는 (including and limited to)" 을의미한다. 용어 " 필수적으로이루어지는 (consisting essentially of)" 은부가구성요소, 단계및 / 또는부분들이청구된조성물, 방법또는구조의기본적인그리고신규한특성을실질적으로 (materially) 변경하지않는경우에만, 그조성물, 방법또는구조가부가구성요소, 단계및 / 또는부분을포함할수있다. 본원에사용된것과같은단수형태 ("a", "an" 및 "the") 는달리전후사정을명확하게지시하지않는한복수의참조를포함한다. 예를들면, 용어 " 화합물 (a compound)" 또는 " 적어도하나의화합물 (at least one compound)" 은그것들의혼합물을포함하는, 다수의화합물을포함할수있다. 본명세서전체에걸쳐, 본발명의다양한구현들은범위형식 (range format) 으로개시될수있다. 범위형식을이용한설명은단순히편의성과간결함을위함이며, 본발명의권리범위를완고하게한정하는것으로해석되어서는안된다는것을이해하여야한다. 따라서, 범위에대한설명은상기범위내의개별적인절대값들 (numerical value) 뿐만아니라구체적으로개시된모든가능한하위범위 (subranges) 를포함하는것으로고려되어야한다. 예를들어, 1 내지 6과같은범위의설명은예를들어, 1, 2, 3, 4, 5 및 6과같은상기범위내의개별적인값들뿐만아니라구체적으로개시된 1 내지 3, 1 내지 4, 1 내지 5, 2 내지 4, 2 내지 6, 3 내지 6 등과같은하위범위들을포함하는것으로고려되어야한다. 이것은상기범위의폭과는관계없이적용된다. 수치범위가본원에개시된다면, 그것은개시된범위내의임의의인용된숫자 ( 분수 (fractional) 또는적분 (integral)) 를포함한다. 문구제1의지시숫자와제2의지시숫자 " 범위 (ranging)/ 사이의범위 (ranges between)", 및제1의지시숫자 " 내지 " 제2의지시숫자 " 범위 (ranging)/ 까지의범위 (ranges from)" 는본원에서상호교환적으로사용되며, 제1 및제2의지시숫자및그사이에있는모든분수및적분수치를포함한다. 본원에사용된것과같은용어 " 방법 (method)" 은화학, 약학, 생물학, 생화학및의약분야의실무자들에게알려졌거나그들에의해공지의방식들, 수단들, 기술들및공정들로부터쉽게개발된방식들, 수단들, 기술들및공정들을포함하나이제한정되지않는, 주어진임무를수행하기위한방식들, 수단들, 기술들및공정들을말한다. 본원에사용된것과같은용어 " 치료 (treating)" 는질환의진행을끝내고 (abrogating), 실질적으로억제하고 (inhibiting), 지연 (slowing) 또는역전 (reversing) 시키고, 질환의임상학적또는심미적증상을실질적으로개선하거나, 질환의임상학적또는심미적증상의출현을실질적으로예방하는것을포함한다. 명확성을위해독립된구현의맥락에서기술된본발명의어떤특징들은또한단일의구현으로조합하여제공될수도있다. 역으로, 간결성을위해단일의구현의맥락에서기술된본발명의다양한특징들또한별도로또는본발명의임의의적절한하위조합 (subcombination) 으로또는본발명의임의의다른기술된구현에적합하게제공될수있다. 다양한구현들의맥락에서기술된어떤특징은그구현이그러한특징들없이작동하지않는한, 그구현들의필수적인특징으로고려되지않는다. 상기에기술되고아래의청구항에청구된것과같은본발명의다양한구현들및양상들은하기의실시예들에서실험적근거를찾는다. [0225] [0226] [0227] 실시예이제하기의실시예들을참고하여, 상기명세서와함께비제한적인방식으로본발명의몇몇구현들을설명한다. 일반적으로, 본원에사용된명명법및본발명에사용된실험실절차들은분자, 생화학, 미생물학및재조합 DNA 기술을포함한다. 이러한기술들은문헌들에자세하게설명되어있다 ( 예를들면, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed

33 (1994); "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol , Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996) 를참조 ; 본원에모두개진된것처럼참조로서본원에포함된다 ). 다른일반적인참조들도이문서전체에걸쳐제공된다. 그안에들어있는절차들은당업계에잘알려져있는것으로생각되며, 독자의편의를위해제공된다. 그안에포함된모든정보들은참조로서본원에포함된다. [0228] [0229] [0230] [0231] [0232] [0233] [0234] [0235] 실시예 1 물질및방법세포이동, 침습및화학주성검정법트렌스웰트레이 (BD bioscience) 의상부구획의 3개의웰에세포를치상하고, 18시간동안막을통과하여이동하도록하였다. 그후에, 세포를파라포름알데히드 (3%) 로고정하고, 트리톤 X-100(0.05%) 을침투시키고, 메틸바이올렛 (0.02%) 으로염색하였다. 필터의상측에서자라는비-이동세포들을제거하고, 이동된세포들의사진을찍었다. 바이오코트매트리겔챔버 (BioCoat Matrigel Chambers) 를사용하여침습검정법을수행하였다. 화학주성을위하여, 이비디 (ibidi, Munchen, Germany) 로부터구입한챔버와타임랩스이미징 (time lapse imaging) 을사용하였다. ImageJ를이용하여세포핵의위치를추적하였다. 포스포이노시티드분석이노시톨을포함하지않은배지에서 30분간세포를배양하고, [ 3 H]-이노시톨및투석된혈청 (dialyzed serum)(10%) 모두가첨가된배지로바꾸었다. 3일동안세포를배양하고, 세척하고 1M HCl로추출한다음에 1M 메탄올로추출하였다. 그후, 세포를긁어모으고클로로포름으로추출한후, 메탄올 :0.1M EDTA(pH 8.0) 로추출하고, 유기상 (organic phase) 을증발시켰다. 그후에, 추출물을탈아세틸화시키고, 직렬로두개의 partisphere SAX 컬럼 (Whatman) 및암모늄포스페이트 (ph 6.0) 의 4단계기울기를사용하여음이온-교환 HPLC(Agilent 120 0) 으로분리하였다. 방사성표지된용출액 (elute) 을온라인플로우신틸레이션분석기 (online flow scintillation analyzer) 로검출하고, ProFSA 소프트웨어 (Perkin-Elmer) 를사용하여정량하였다. 젤라틴자이모그래피 MMP-2의활성을검출하기위하여, 생물학적샘플을 10% 폴리아크릴아미드 /0.1% 젤라틴-포매 (gelatin-embedded) 겔상에서전기영동적으로분리하였다. 그후, 겔을 2.5% 트리톤 X-100으로세척하고, 0.2 M NaCl, 5 mm CaCl 2, 1 μm ZnCl 2, 0.02% Brij 35 및 1 mm p- 아미노페닐머큐릭아세테이트 (p-aminophenylmercuric acetate) 를포함 하는 50 mm 트리스 -HCl(pH 7.5) 에서 37 에서 36 시간동안배양하였다. [0236] [0237] 동물에서의전이 (metastasis) 테스트 암컷 CB-17 SCID 마우스 (Harlan Laboratories, Haslett, MI; 그룹당 15 마리 ) 의지방패드 (fat pad) 에 MDA-MB- 231 세포 ( 세포 / 마우스 ) 를이식하였다. 이식 2주및 6주후마우스를마취시키고, 종양의크기를측정하고림프절에의전이를형광쌍안 (fluorescent binocular) 현미경을사용하여시각화하였다. 폐전이에대해서는, 마우스를희생시킨뒤폐를제거하여세척하고, 형광쌍안현미경을사용하여이미지를얻었다. 림프절전이의분석을위해양측 (two-sided) 피셔의정확검정법 (Fischer's exact test) 을사용하였다. 종양성장의측정

34 에는유의확률 (Exact-sig)(2 1-tailed) 만 - 위트니테스트 (Mann-Whitney test) 를사용하였다. [0238] [0239] [0240] [0241] [0242] [0243] [0244] [0245] [0246] 시약달리지시하지않는한, 인간재조합성장인자및다른물질들은시그마사 (Sigma, St. Louis, MO, USA) 로부터구입하였다. 면역학적블로팅을위한방사성물질및화학발광키트는아머샴사 (Amersham, Buckinghamshire, UK) 로부터입수하였다. EGFR-키나아제억제물질 AG1478, MEK 억제물질 U0126 및 PI3K 억제물질보르트만닌은칼바이오켐사 (Calbiochem, San Diego, CA) 로부터입수하였다. 상처-치유검정법 (wound-healing assay) 을위한플레이트는이비디사 (ibidi, Munich, Germany) 로부터입수하였다. 타임-랩스이미징을위한 35-mm 유리바닥디쉬는마텍사 (MaTek, Ashland, MA) 로부터구입하였다. EGF-수용체에대한쥐단일클론항체 (mab) 111.6은우리실험실에서만들었다. 웨스턴블롯분석을위한항-EGFR은알렉시스사 (Alexis, Lausen, Switzerland) 로부터입수하였다. 항 Ras-GAP 및항-AKT 항체는산타크루즈바이오테크놀로지사 (Santa Cruz Biotechnology, Santa Cruz, CA) 로부터입수하였다. 항-EEA1, 항-Rab5, 항-Rab4 및항 Rac1은 BD 트랜스덕션연구소 (BD Transduction Laboratories, Franklin Lakes, NJ) 로부터입수하였다. 항-SYNJ2 mab는압노바사 (Abnova, Taipei, Taiwan) 로부터입수하였다. 다음의 2차항체들을사용하였다 : 서양고추냉이퍼록시다아제 (Horseradish peroxidase, HRP) 에접합된염소항-마우스 IgG 및염소항-토끼 IgG 항체는잭슨이뮤노리서치연구소 (Jackson ImmunoResearch Laboratories, Bar Harbor, Maine) 로부터구입하였다. 텍사스-레드트랜스페린 (texas-red transferrin), 염소항마우스 Alexa-488, Alexa-555 및 Alexa-647 2차항체들은인비트로젠사 (Invitrogen, Carlsbad, CA) 로부터구입하였다. sirna 대조군은 " 써모사이언티픽다마콘사 (Thermo scientific Dharmacon)" cat. D 로구입하였고 ; SYNJ2에대한 sirna 서열은 SEQ ID NO:6 - GGACAGCACUGCAGGUGUU에제시한바와같고 ; 모든 shrna 는시그마이스라엘사 (SIGMA Israel) 로부터구입하였고 ; shrna 대조군 - cat. SHC002; 사용된 SYNJ2에대한 shrna 서열은 CCGGCCGGAAGAACAGTTTGAGCAACTCGAGTTGCTCAAACTGTTCTTCCGGTTTTTG (SEQ ID NO: 9) 이다. 세포주 (cell lines) 및형질감염 MCF10A 세포를항생제, 인슐린 (10 μg/ml), 콜레라독소 (0.1 μg/ml), 하이드로코르티손 (hydrocortisone)(0.5 μg/ml), 가열-불활화말혈청 (heat-inactivated horse serum)(5% vol/vol) 및 EGF(10 ng/ml) 이첨가된 DMEM:F12(1:1) 배지에서배양하였다. 인간유방 MDA-MB-231 세포를 10% 가열불활화우태아혈청 (fetal calf serum)(gibco), 1 mm 소디움피루베이트및페니실린-스트렙토마이신혼합물 (100 unit/mol; 0.1 mg/ml; Beit Haemek, Israel) 이첨가된 RPMI-1640(Gibco BRL; Grand Island, NY) 에서배양하였다. MDA-MB-231-RFP의안정한세포주를하다사데가니교수 (Prof. Hadasa Degani, The Weizmann Institute of Science, Israel) 로부터얻었다. 제조사 (Roche, Mannheim, Germany) 의가이드라인에따라 Fugen-HD를이용하여플라스미드형질감염을수행하였다. 대안적으로, sirna 올리고뉴클레오티드를이용하는일시적 mrna 발현억제 (transient mrna knockdown) 실험을위하여, 세포를올리고펙타민 (Oligofectamine)(Invitrogen) 으로형질감염시켰다. 렌티바이러스성벡터 (lentiviral vector) 및바이러스생산제조사 (Sigma) 의가이드라인에따라비표적 shrna 헤어핀 ( 대조군 ) 및인간 SYNJ2를겨냥한헤어핀을 HEK-293T 세포에서생산하였다. 표적세포를폴리브렌 (polybrene)(8 μg/ml) 이첨가된 shrna를암호화하는렌티바이러스로감염시키고, 퓨로마이신 (puromycin)(2 μg/ml) 의존재하에서 4일간배양하였다. 제조사의가이드라인에따라, ViraPower 렌티바이러스발현시스템 (Invitrogen) 을사용하여인간 SYNJ2의안정한유전자-특이적운반을수행하였다. 면역형광법및이미지처리세포를피브로넥틴코팅된커버슬립상에서 48시간동안배양하였다. 처치후, 세포를세척하고, 0.02% 트리톤 X-100 및 3% 파라포름알데히드를사용하여투과성을높이고, 20분간고정하였다. Slidebook TM 의지시하에 Zeiss LSM-710 현미경또는스피닝디스크현미경 (Zeiss 100, NA 1.45; Yokogawa CSU-22; Zeiss fully automated, inverted 200 M; Photometrics HQ-CCD camera) 중하나그리고고체레이저 (solid state laser)(473, 561 및 660 nm, 노출시간 : 초 ) 를사용하여공초점현미경을사용하였다. 압전제어식 (piezo electrically controlled) 스테이지의위치를바꾸면서 Z-축을따라서매 ms마다 3D 이미지스택 (stacks) 을얻었다 (step size: μm). 대안적으로, 델타비전시스템 (DeltaVision system, Applied Precision, Issaqua, WA) 을이용하여생세포형광현미경을사용하였으며, 프리즘소프트웨어 (priism software) 를사용하여이미지를

35 처리하였다. [0247] [0248] EGF 의방사성표지 인간재조합 EGF 를하기와같이 IODOGEN 으로표지하였다 : Iodogen 으로코팅된튜브 (1 mg 의시약 ) 에서 EGF(5 μ g) 와 Na 125 I(1mCi) 를혼합하였다. 23 에서 15 분배양한후, 알부민을첨가하여최종농도를 0.1 mg/ml 로 만들고, 상기혼합물을 Excellulose GF-5 컬럼으로분리하였다. [0249] [0250] [0251] [0252] [0253] [0254] 수용체하향조절검정법대조군을치상한추가적인웰과함께, MDA-MB-231 세포를 24-웰플레이트에각시점에대해 3회씩시딩하였다. 48시간후, 세포를 4시간동안기아상태 (starved) 에놓아두고, 지시된시간간격동안 37 에서 EGF(2 ng/ml) 로자극하였다. 그뒤에, 그것들을얼음위에놓고결합버퍼 (binding buffer)(dme 배지, 알부민 1%, Hepes 20 mm, ph 7.5) 로한번세척하고, 표면결합 EGF를제거하기위해약산 (mild acid)/ 중염 (mild salt)(0.2 M Na Acetate buffer ph 4.5, 0.5 M NaCl) 으로세척하였다. 그후, 4 에서 1.5시간동안방사성표지된 EGF와함께세포를배양하고, 결합버퍼로세척하였다. 대조군웰을방사성표지된 EGF 및초과량의비표지된 EGF와함께배양하였다. 마지막으로, 세포를 1M NaOH로용해하고, 감마카운터 (γ-counter) 를이용하여방사능 (radioactivity) 을측정하였다. 데이터는시간 0에상대적인세포표면상의수용체의백분율을나타낸다. 표면 EGF-수용체의확인대조군을치상한추가적인웰과함께, 세포 ( / 웰 ) 를 24-웰플레이트에 3회씩시딩하였다. 그후, 4 에서 1.5시간동안방사성표지된 EGF와함께세포를배양하고, 결합버퍼로세척하였다. 대조군웰을방사성표지된 EGF 및초과량의비표지된 EGF와함께배양하였다. 마지막으로, 세포를 1M NaOH 용액으로용해하고, 방사능 (radioactivity) 을측정하였다. 데이터는대조군세포에상대적인세포표면상의수용체의백분율을나타낸다. 면역블로팅분석세포를얼음처럼차가운식염수로잠시세척하고, 완충세제용액 (25 mm HEPES (ph 7.5), 150 mm NaCl, 0.5% Na-데옥시콜레이트 (Na-deoxycholate), 1% NP-40, 0.1% SDS, 1 mm EDTA, 1 mm EGTA, 0.2 mm Na 3 VO 4 및 1:1000으 로희석된프로테아제억제인자칵테일 (a protease inhibitor cocktail)) 로긁어내었다. 동일한겔로딩을위하여, BCA 시약 (Pierce) 을사용하여단백질농도를측정하였다. 겔전기영동후, 단백질을니트로셀룰로오스막으로옮겼다. 막을 10% 저지방우유를포함하는 TBST 버퍼 (0.02 M Tris-Hcl (ph 7.5), 0.15 M NaCl 및 0.05% Tween 20) 로차단시키고, 1시간동안 1차항체로블로팅하고, TBST로세척하고, HRP가접합된 2차항체와함께 30분간배양하였다. [0255] [0256] [0257] [0258] 상처치유 ( 스크래치 ) 검정법제조사 (ibidi, Germany) 의프로토콜에따라상처치유검정법을수행하였다. 간단하게는, MCF10A 세포를단백질분해처리 (trypsinized) 하고, EGF-결핍 (deprived) 배지에재현탁시켜 ( cells/ml) 각웰안에 70 μl를넣으면 24시간내에전면배양층 (confluent layer) 이형성된다. 그후, 멸균핀섹을사용하여배양-인서트를제거하고, 2시간동안세포를이동시켰다. 전자주사현미경 (scanning electron microscopy) 및투과전자현미경 (transmission electron microscopy) 세포를 4% 파라포름알데히드및 2% 수크로오스가첨가된식염수로고정하였다. 샘플을세척하고, 2차고정액 (fixative) 으로고정하였다 (1% 수크로오스및 5 mm CaCl 2 가첨가된, 0.1 M 카코딜레이트버퍼 (cacodylate buffer) 에녹인 3% 파라포름알데히드및 2.5% 글루타르알데히드, ph 7.4). 세포를 0.1 M 카코딜레이트버퍼로세척하고, 1시간동안카코딜레이트버퍼에녹인 1% 오스뮴테트록사이드 (osmium tetroxide) 로후고정 (postfixed) 시켰다. 전자주사현미경 (SEM) 을위하여, 후고정된샘플을두번세척하고, 5분간 1% 타닌산 (tannic aci d) 으로처리한후, 다시세척하고 30분간 1% 우라닐아세테이트 (uranyl acetate) 로처리하였다. 등급별에탄올 (graded ethanol) 로샘플을탈수시키고, 금-팔라듐필름과함께스퍼터링 (sputtering) 함으로써전도성을갖게하였다. 전자주사현미경을사용하여샘플의사진을찍었다 (Leo Supra 55/Vp Zeiss, Thornwood, NY). [0259] [0260] 수용체재활용검정법 (Receptor recycling assay) MDA-MB-231 세포를알렉사플루오르 488- 트랜스페린 (Alexa Fluor 488-transferrin)( 혈청을포함하지않는배지

36 에 25 μg /ml) 과함께 37 에서 30 분간또는알렉사플루오르 488-EGF(40 ng/ml) 과함께 10 분간전배양하였다. [0261] 내재화된 (internalized) 리간드의재활용을감안하여, 지정된시간간격동안 37 에서이동하기전에, 산성버 퍼 (150mM NaCl, 1mM MgCl 2, 0.125mM CaCl 2, 0.1M 글리신 ) 에서 4 에서 30 분간배양하여표면결합리간드를분 리하였다. 영상화 (imaging) 또는 FACS 중어느하나로세포를분석하였다. [0262] [0263] [0264] [0265] [0266] [0267] 실시간세포임피던스검정법 (Real-time cell impedance analysis, RTCA) RTCA-Xcelligence 시스템 (Roche Diagnostics, Mannheim, Germany) 을이용하여세포의퍼짐 (spreading) 및부착 (adhesion) 의측정값을기록하였다. 금마이크로전극 (gold microelectrode) E-플레이트-16을식염수로한번세척하였다. 먼저세포 ( 웰당 2,500) 를시딩한후, 지정된간격으로임피던스데이터 ( 세포인덱스 ; 측정된전기적임피던스에서의상대적인변화로서얻어짐 ) 를기록하였다. 제조사로부터제공되는소프트웨어패키지 1.2를사용하여데이터를분석하였다. TAPP1-PH 도메인발현및정제 TAPP1-PH 도메인및 N-말단플래그태그 (Flag tag) 및 C-말단 6xHis 태그 (SEQ ID NO:13, 도 18) 을암호화하는구조물을 pet28 플라스미드안으로클로닝하고, 200 μm IPTG로유도한후대장균 (E.coli) BL21(DE3) 에서발현시켰다. 세균을 15 에서배양한후, 세포파쇄기 (cell disrupter) 로파쇄하였다. 원심분리에의해세포찌꺼기를제거하고, 50 mm 트리스 (ph 8), 0.5 M NaCl, 및 20 mm 이미다졸로평형화된 Ni 컬럼 (HisPrep FF 16/10, GE Healthcare) 상에단백질을포획하였다. 상기단백질을 0.5 M 이미다졸을포함하는동일한버퍼로용출하였다. TAPP1-PH 도메인을포함하는분획을 50 mm 트리스 (ph 8) 및 100 mm NaCl을포함하는버퍼로평형화된크기배재컬럼 (size exclusion column)(hiload_26/60_superdex 75, GE Healthcare) 안으로주입하였다. TAPP1-PH 도메인을포함하는혼합피크 (pooled peak) 를 20 mm 소디움포스페이트버퍼 (ph 7.2) 를이용하여 3배희석하고, 동일한포스페이트버퍼로평형화된양이온교환컬럼 (cation exchange column)(hitrap_sp_ff_5ml, GE Healthcar e) 에로딩하였다. 1 M NaCl을포함하는포스페이트버퍼의선형구배 (linear gradient) 를이용하여컬럼으로부터순수한단백질을용출하였다 (TAPP1-PH 도메인은 200 mm NaCl에서용출한다 ). SDS-PAGE에의해평가된것으로서순수한 TAPP1-PH 도메인을포함하는분획을함께모으고, 브래드퍼드시약 (Bradford reagent) 및 OD 280 (20,520의흡광계수 (extinction coefficient)) 양자화 (auqntization) 로단백질농도를측정하였다. SYNJ2의 5' 포스파타아제활성판독출력 (read out) 으로서형광편광에근거하여, PI(3,4)P2를생성하기위해 PI(3,4,5)P3로부터 5-포스페이트를가수분해하는 SYNJ2의능력의측정값을경쟁검정법 (competitive assay) 에의해기록하였다. 유리튜브에 100 μl의 SOPS(Avanti Inc., 50 mg / ml in chloroform) 및 50 μl의콜레스테롤 (Sigma Aldrich, 10 mg / ml in chloroform) 을첨가하여안정화 SOP 지질믹스 (stabilizing SOP lipid mix)(x50) 를제조하였다. 상기믹스를알맞은질소스팀을사용하여공기-건조시켜클로로포름을증발시켰다. 그후, 증발된지질믹스를상온에서 1분볼텍싱하여 10 ml의 0.25 mg/ml C 12 E 8 (Avanti Inc.) 에재현탁시켰다. 반응믹스는테스트된화합물과함 께또는그것없이, PBS, DTT, MgCl 2 ( 모두시그마알드리치사 (Sigma Aldrich) 로부터입수 ), SOP 지질믹스 (x50), 전장의정제된 SYNJ2(OriGene, cat no. TP315160) 및 PI(3,4,5)P3(Echelon Bioscience, cat no. P- 3908) 를포함한다. 일단 PI(3,4,5)P3가첨가되면, SYNJ2의 5'-포스파타아제활성에의해 PI(3,4)P2를생성하도록 33 에서 8분간반응믹스를배양하였다. 그후 PBS, DTT, 검출단백질 (TAPP1의 PH 도메인 ), SOP 지질믹스 (x50), 형광-표지된 PI(3,4)P2(Echelon Bioscience, cat no. C34M6) 및 EDTA(Sigma Aldrich) 를포함하는검출믹스를첨가하여반응물의배양을중단시켰다. BODIPY TMR 염료 (550 nm 여기 (excitation)/580 nm 편광방출필터 (polarizing emission filters)) 와호환되는적절한플레이트판독기및필터세트를사용하여형광편광을측정하였다. 비표지 PI(3,4)P2 대조군은에셜론바이오사이언스사 (Echelon Bioscience) 로부터구입하였다 (Cat no. P-3408). [0268] [0269] [0270] 실시예 2 SYNJ2의 EGF-유도성발현증가는유방세포침습을촉진한다인간유방상피세포 (MCF10A) 는 EGF 패밀리리간드와함께배양하였을때는강력한이동성 (migratory) 및침습성표현형을나타내지만 ( 도 1A 및도 1B), 혈청을이용한처리는세포의운동성을추진하기에불충분하다

37 EGFR(AG1478), MEK(U0126) 또는 PI3K(Wortmannin) 의억제인자와함께 EGF의공배양은운동성을감소시키고 ( 도 1C), 이는 MEK/ERK 및 PI3K의활성모두가 EGF-유도성이동에있어서필수적이라는것을암시한다. 중요하게는, EGFR-유도성운동성표현형 (motile phenotype) 은 425개의유전자의전사적상향조절과연관이있다 (Amit et al., 2007). 전이를추진하는유전자를확인하기위하여, 이유전자-세트를유방암세포의전이성서브-클론을생체내에서선별하는동안상향조절하에있는더큰유전자세트와교차시켰다 (Minn et al., 2005). 23개의중복되는유전자의군 ( 도 1D) 은시냅토자닌-2(SYNJ2) 를암호화하는유전자에포함되고, 리피드포스파타아제는신경교종세포침습에관련된다 (Chuang et al., 2004). SYNJ2의 EGF-유도성상향조절을 PCR 및면역학적블로팅으로입증하였다 ( 도 2A 및 2B). [0271] 다음으로, MCF10A 세포를형질전환시키고, SYNJ2를안정하게발현하도록서브클로닝하였다 (GFP 융합으로 ; SYNJ2-OX, 도 1E). EGF-결핍배지에치상하였을때, SYNJ2-OX 세포는강화된기저막 (basal) 및 EGF-유도성이동및침습능력과함께, 세포막주름짓기 (membrane ruffling) 를특징으로하는전-이동 (pro-migratory) 표현형을나타내었다 ( 도 2D 및 2C). 반대로, 작은간섭 RNA(siRNAs; 도 1G) 는개별적이동및집단이동뿐만아니라세포의침습도현저하게감소시켰다 ( 도 2E, 1H 및 1J). 결론적으로, SYNJ2의 EGF-유도성상향조절은유방세포가강한 (robust) 침습성표현형을나타내게한다. [0272] [0273] [0274] [0275] 실시예 3 SYNJ2의포스파타아제활성은유방세포의침습성에있어서필수적이다생체내실험을가능하게하기위하여, sh대조군 (shcontrol) 또는 SYNJ2-특이적헤어핀 (shsynj2; 도 3A) 을발현하는서브클론뿐만아니라, SYNJ2 또는 LacZ( 대조군 ) 중어느하나를과발현하는서브클론도만들기위해, 고전이성 MDA-MB-231 유방암레드형광단백질 (Red fluorescent protein, RFP) 을발현하는세포를사용하였다. 세포를 3D 배양으로성장시켰을때 ( 도 4A), SYNJ2의강화된발현은 2D 배양 ( 도 3B) 및광범위한침습성암 (arm) 에연장된형태 (elongated morphology) 를제공하였다. 반대로, SYNJ2 발현억제는침습성패턴을제거하였다 ( 도 4B). 유사하게는, 과발현은 3.2 배까지로침습능력을강화시켰고 ( 도 3B), 발현억제 ( 도 3C) 는이동및침습 ( 도 3D) 을억제하였다. 촉매적포스파타아제활성의역할을시험하기위하여, WT SYNJ2 또는촉매활성이없는 (catalytically-dead) 형태 (D388A 및 D726A; 도 4C) 중어느하나를암호화하는렌티바이러스성입자를가진 shsynj2의포스파타아제 / 뉴클레아제도메인 (Pfam: PF03372) 내의각각의보존된 WXGDXN(F/Y)R 모티프 (Jefferson and Majerus, 1996) 에점돌연변이 (point mutation) 를도입하였다. WT SYNJ2와는달리, 돌연변이의재발현은침습능력을회복시키는데실패하였으며 ( 도 4D), 이는 SYNJ2의포스파타아제활성이침습성표현형에필수적이라는것을암시한다. shsynj2 세포를이동시키는것에대한실패는주사전자현미경 ( 도 4E) 및 F-액틴염색양쪽모두에의해더뒷받침되며, 그것은심각한액틴조직화결함 (actin organization defects) 및세포의길이의증가 ( 도 4F) 를보였다. 중요하게는, 원형부분 (circular moieties) 주변에군집화된 (clustered) 액틴패치 (actin patches) 에도주목하였다 ( 도 4F; 화살표 ). 따라서, shsynj2 세포의타임-랩스현미경분석은비정상적인세포내이입성소포의존재를확인시켜주었으며, 이는 SYNJ2 발현억제가소포이동의경로를벗어나게한다는것을암시한다. 다음으로, SYNJ2의세포내국소화 (subcellular localization) 를조사하였다. GFP-SYNJ2를발현하는 MDA-MB-231 세포의타임-랩스이미지 ( 도 3E) 뿐만아니라항-SYNJ2 항체를이용한면역형광 ( 도 3F) 도 SYNJ2 분포의두가지주요패턴을나타내었다 : 리딩에지에위치한작은주변조립체 (peripheral assemblies)( 도 3E에서의검은색화살표 ), 및세포중심에더근접하게위치한큰조립체의두번째집단 ( 파란색화살표 ). 특히, EGFR 리간드 (TGF- 알파 ) 를이용한 MDA-MB-231 세포의짧은자극후, SYNJ2는형성되는리딩에지의아래에서최근에만들어진층상위족의기저부분에서빠르게조립된다 ( 도 3E, 3F). 흥미롭게도, MCF10A 세포를이용하여수행된유사한분석도 SYNJ2가처음에는세포-세포간간극 (junctions) 에서 F-액틴과함께동시-국소화되지만, EGF를이용한자극하에서는리딩에지, 전형적으로는층상위족의기저부분으로이동한다 ( 도 3G). 결론적으로, 이들관찰은성장인자가 SYNJ2의발현레벨뿐만아니라, 리딩에지로의그것의역동적인동원 (dynamic recruitment) 또한조절한다는것을나타낸다. [0276] [0277] 실시예 4 배측막으로의 SYNJ2 의동원은다이나민및 Rac1 에의존한다

38 [0278] [0279] [0280] SYNJ2의국소화부위의역동성을조사하기위하여, GFP-SYNJ2 MDA-MB-231을안정하게발현하는서브클론 (GFP- SYNJ2 세포 ) 을만들고, GFP-SYNJ2 반점 (puncta) 의형성및소모 (consumption) 를분석하였다. 이것들을속도론적으로구별되는하위-집단 (kinetically distinct sub-populations) 으로분류하였다 : 주름막 (ruffling membrane) 에국소화된역동적반점및세포중심부쪽의별개의부위에국소화된반점 ( 도 5A). 특히, GFP-SYNJ2 반점은 RFP-클라트린경쇄 A(RFP-Clathrin light chain A)( 도 5A) 또는 RFP-카베올린 1(RFP-Caveolin 1)( 도 6A) 을특징으로하는조립체들과최소한의겹침 (overlap) 을나타내었으며, 이는클라트린-코팅된구멍 (pits) 에또는카베올라 (caveolae) 에의소수의국소화를암시한다. 중요하게는, 새롭게형성된주변의 (peripheral) 반점은그것들의출현이층상위족의국소적형성보다앞서기때문에발생기 (nascent) 층상위족으로알려지고있다. 반대로, 액틴과동시국소화되어있는더중심부에있고안정한반점의클러스터는 30분까지지속되었다 ( 도 5B). 따라서, 개별적인조립체의추적 (tracking)( 도 6B, 왼쪽 ) 은몹시넓은분포의수명 (lifetime) 을나타내었다 : 짧은-수명 (~20-40초, 조립체의 60%), 중간-수명및긴-수명 ( 조립체의 ~10%) 의조립체. 중간그룹의개시후에형광세기는지속적으로증가한반면, 조립체는움직임의관점에서정지상태를유지하였다 ( 도 6B; 오른쪽 ). 이역동적패턴은클라트린-코팅된구멍의그것과닮았으며 (Ehrlich et al., 2004), 수송중간물질의형성및소모를시사한다. 배측막에서의주로 GFP-SYNJ2의바이모달성구획화 (compartmentalization) 는동시형광 (epifluorescence)( 적색 ; Z 차원에서변화를위한상대적세기 ) 및내부전반사 (total internal reflection) 현미경 (TIRF, 녹색 ; ~ 200 nm 깊이로제한됨 ) 모두를사용하는실험에서동시발생적출현 (synchronous appearance) 및형광시그널의소실에의해보강된다. 반점이그것들의수명내내노란색을나타내기때문에, 본발명자들은 SYNJ2가배측원형질막의평평한면 (plane) 안에모인다고결론지었다. 억제인자의패널을사용함으로써, 조립체는콜레스테롤결핍에의해극적으로억제되며 ( 도 6C; 왼쪽 ), 이는콜레스테롤이풍부한막의마이크로도메인이배측막으로 SYNJ2를동원하는데필요하다는것을암시한다. 유사한억제효과가보르트만닌에의해유도되었으며 ( 도 6C; 오른쪽 ), 이는 PI3K의역할을암시한다. 또다른동원은클라트린-의존성및클라트린-독립성담체의절단 (scission) 단계를매개하는커다란 GTPase인다이나민의억제인자인 Dyngo- 4a를사용하여밝혀졌고, 이억제는 U-형태의함입 (invagination) 중간물질의축적을야기한다 (Macia et al., 2006). Dyngo-4a가원형질막에서 SYNJ2의역동적조립체를강력하게저지하였기때문에 ( 도 5D), 본발명자들은 SYNJ2가다이나민에의해조절된발생기의수송중간물질로동원되었다고결론지었다. 다이나민은세포이동과침습의조력자 (facilitator) 로서관련되어왔기때문에 (Kruchten and McNiven, 2006), SYNJ2와그것의물리적상호작용을테스트하였다. 이실험은세포내이입및액틴-기반이동양쪽모두에서의다이나민의확장된역할과함께, 활성다이나민및 SYNJ2 사이의복합체형성 ( 도 5E) 을확인시켜주었다. SYNJ2는 GTP-로딩된 Rac1과물리적으로상호작용할수있고 (Malecz et al., 2000), Rac1의유도성활성화는내재화 (internalization) 및그다음의재활용 (recycling) 을필요로한다 (Palamidessi et al., 2008). 이런이유로, Rac1과동시에일어나는 SYNJ2의주변반점의동시발생을테스트하였다. 사실, 내재적 Rac1의면역염색은 GFP-SYNJ2의주변반점과의동시-국소화를밝혀내었다 ( 도 5F). 더욱이, (NSC-23766을이용한 ) Rac1으로의 GTP 로딩의억제는 GFP-SYNJ2 반점의수를극적으로감소시켰다 ( 도 5G). 상호보완적으로, SYNJ2 발현억제는 MDA-MB- 231 세포에서 GTP-로딩된 Rac1의레벨을감소시켰다 ( 도 5H). SYNJ2의막으로의동원에서 Rac1과액틴세포골격 (cytoskeleton) 의조절역할에따라, 라트룬쿨린 (Latrunculin) 을이용한액틴역동성의억제는 GFP-SYNJ2 역동성을없앴다 ( 도 6D). 종합하면, 이들결과는콜레스테롤, 3'-포스포이노시티드, 액틴및활성 Rac1에의존하는다이나민-매개성세포내이입경로 (dynamin-mediated endocytic pathway) 와함께주변 SYNJ2 조립체와결부되어있다. 특히, 이경로는이동하는섬유아세포의리딩에지에서빠른막과부착의교체 (turnover) 를가능하게하는클라트린-독립성담체와몇몇의속성을공유한다 (Howes et al., 2010). [0281] [0282] [0283] 실시예 5 SYNJ2는세포표면수용체의소포수송을조절한다비록 EGF-처리된 shsynj2-mcf10a 세포가대조군세포와관련하여높은레벨의전체그리고인산화된 EGFR을나타내었다할지라도, 이것은 ERK의높은활성화보다는낮은것으로이해된다 ( 도 7A). 이점에대하여, SYNJ2 발현억제는커진세포내소포에 EGFR을포집 (trapped) 한다는점에주의하여야한다 ( 도 7B). 포집 (trapping) 과일치하게, MDA-MB-231 세포의면역학적블로팅은 EGFR 레벨이 sisynj2 세포에서는안정화되었음을유사하게보여주었지만 ( 도 8A), 두가지방법의사용에의한표면 EGFR의정량은현저하게낮은표면레벨을나타내었다 ( 도

39 8B). EGFR의세포내포집은그것들의잘-특성화된화학주성기능 (Mouneimne et al., 2006; van Rheenen et al., 2007), EGFR은유방세포의리딩에지에국소화되지만 shsynj2 세포의 EGFR은그것들의극성분포 (polarized distribution) 를잃고커다란액틴으로도배된 (actin-decorated) 소포에축적된다는것과일맥상통하는기능적인결과를가진다 ( 도 8C). 특히, shsynj2 세포에서관찰된 EGFR 수송결함은 WT SYNJ2에구제될수있으나, 촉매적활성이없는형태에의해서는구제될수없고 ( 도 7C), 이는 SYNJ2의포스파타아제활성이 EGF의구배 (gradients) 에반응하는화학주성을매개하는, 리딩에지와 EGFR의왕복소포수송에필수적이라는것을나타낸다. 이모델과일치하게, shsynj2 세포는 EGF의구배에따라이동하는능력을심각하게잃어버린다 ( 도 8D). [0284] SYNJ2-결핍세포에서의 EGFR의비정상적인축적은 EGFR 운반에서의결함, 억제된재활용, 또는손상된분해를위한분류 (sorting), 유비퀴틴화에의해조절되는프로세스를반영할수있다 (Goh et al., 2010). 손상된분류와일치하게, SYNJ2-결핍세포는현저하게높은기저 EGFR의유비퀴틴화를나타내었고, 그것은 EGF에반응하여단지약하게변경되었을뿐이다 ( 도 8E 및 7D). 게다가, 티로신 1045의인산화에의한분해를위해태그되었음에도불구하고 ( 유비퀴틴리가아제 c-cbl을위한도킹부위 (docking site); 도 8F), EGF 자극실험은정상적인활성화 ( 티로신 1068 인산화 ) 를확인시켜주었으나, shsynj2 세포에서는결함성분해를확인시켜주었다 ( 도 8G). 재활용결함을해결하기위하여, EGFR의약한재활용뿐만아니라트랜스페린수용체 (transferrin receptor, TfR) 의광범위한재활용에도형광성리간드를사용하였다. 비록 TfR 내재화에는영향을주지않았으나, 재활용은 shsynj2 세포에서현저하게감소하였고, 반대로 SYNJ2-OX 세포에서는현저하게증가되었다 ( 도 8H 및 7E). 비슷하게, 유세포분석기 (flow cytometry) 분석은형광성-EGF의결함성재활용을나타내었고 ( 도 8I), 생세포이미지는 SYNJ2-결핍세포의커다란소포내로의리간드축적을확인시켜주었다. 결론적으로, 이들결과는 SYNJ2가 EGFR 및 TfR 양쪽모두의재활용을추진하는데필수적이라는것을나타낸다. [0285] [0286] [0287] 실시예 6 SYNJ2 발현억제는포스포이노시톨리피드의항상성을교란시키고, 세포내이입및부착모두를변경한다세포내이입성시스템 (endocytic system) 은특정포스포이노시티드 (PI) 로정의되는몇몇의구별되는구획을유지하며 (Gruenberg and Stenmark, 2004), 본발명의분석은 SYNJ2에의강력한의존성을밝혀내었다. 예를들어, EEA1, PI(3)P-바인더에대한초기엔도솜의조사에의해, SYNJ2-결핍세포에서그것의공간조직 (spatial organization) 이현저하게변경되어있음을발견하였다 ( 도 9A). 유사하게는, GFP-태그된 Rab4를이용한재활용구역의조사는 shsynj2 세포의원형액틴패치 (patches) 와의강력한관련성을밝혀내었다 ( 도 10A). 초기엔도솜의다른마커인 Rab5의분포또한 SYNJ2에의의존을반영한다 ( 도 10B). 반면, Rab5-양성소포의수는 shsynj2- 결핍세포에서현저히낮아졌고, 그것들의평균크기는증가하였으며, 그것들은원형액틴패치에부분적으로국소화되었다 ( 도 9A). 포스포이노시티드에서의근본적인변경을밝혀내기위하여, 생합성적으로표지된 shctrl 및 shsynj2 MDA-MB-231 세포를비교한후, 그것들의포스포리피드를추출하였다 ( 도 10C). 그결과들은주로 PI(3)P, 그러나 PI(4,5)P 2 및 PI(3,5)P 2 도 shsynj2 세포에서높은레벨로존재하는반면 PI(4)P의레벨은바뀌 지않고유지되었고, PI(3,4)P 2 및 PI(3,4,5)P 3 의레벨은모두이방법에의해거의검출할수없음을보여주었다. 이들결과들은 SYNJ2가주로 PI들의 D5 위치를표적으로한다는생각을확인시켜줌에도불구하고, 본발명자들은오히려관찰된한정적전역효과 (global effect) 가더욱큰국소적차이를나타낸다고가정하였다. 결론적으로, 이들관찰은 SYNJ2가초기엔도솜에서의전달물질분류 (cargo sorting) 뿐만아니라차후의재활용단계까지도조절한다는것을재차확인하였다. [0288] EGFR과비슷한 RTK의재활용과마찬가지로, 인테그린의소포수송및팍실린 (Paxillin) 과같은하류쪽파트너와의그것들의상호작용은세포이동및초점부착부 (focal adhesion, FA) 의성숙에중요한역할을한다 (Guo and Giancotti, 2004). 따라서, 베타-1 인테그린및인산화된-EGFR(pEGFR) 은 MDA-MB-231 세포의 FA에국소화된다. 그와대조적으로, 커다란소포에서의비정상적인축적으로인하여, 두가지단백질모두 SYNJ2-결핍세포의주변부에의국소화에실패하였다 ( 도 10D, S5B 및 S5C). 더욱이, 성숙한 FA의마커로서팍실린을사용하여, FA는 shsynj2 세포에서둥글고상대적으로짧은외관인것으로추정된다는것을발견하였다 ( 도 9D). 종합하면, 이들관찰은 SYNJ2가두가지방법을사용하여세포확산 (cell spreading) 을측정함으로써조사된시나리오인기질부착 (substrate adhesion) 에필요하다는것을의미한다 ( 도 10E 및 10F). 그결과는인테그린및 RTK 양쪽모두의 FA로의결함성운반에기인한 shsynj2 세포의감쇠된 (attenuated) 부착을입증하였다

40 [0289] [0290] [0291] [0292] 실시예 7 SYNJ2는침습위족의조립을조절한다 MDA-MB-231 세포의매트릭스-기반 3D 배양은보통 V자모양 (wedge-shaped) 의돌출부를나타내지만, shsynj2 세포는둥그스름한신장 (roundish extensions) 을나타내며 ( 도 11A), 이는불완전한매트릭스분해를암시한다. 이를테스트하기위하여, MMP-9의공초점면역형광이미지를얻었고, shsynj2 스페로이드는그것들의경계에서 MMP-9의존재비 (abundance) 의상대적격감 (sharp decrease) 을나타내었으며 ( 도 11A), 이는손상된분비에기인한것일가능성이있다. 사실, 조정배지 (conditioned media) 에서수행된자이모그래피검정법은 sisynj2 올리고뉴클레오티드로처리된세포에의한결함성 MMP-9 분비를확인시켜주었으나, MMP-2 분비는변경되지않고유지되었다 ( 도 12A). 반대로, SYNJ2를과발현하는세포에의해조정된배지는 MMP 분비에서의 SYNJ2의선상개입 (in line involvement) 으로, MMP-9의활성에상당한증가를나타내었다 ( 도 11B). 국소단백질분해 (focal proteolysis) 를가시화하기위하여, 세포를가교-결합형광성젤라틴상에치상하고, 침습위족으로불리는액틴-중심성 (actin-centered) 의매트릭스분해세포소기관 (matrix-degrading organelles) 에대해조사하였다 (Murphy and Courtneidge, 2011). 이전의보고에따라, 활성매트릭스단백질분해는세포체 (cell body) 의아래쪽에국소화된액틴점 (actin dots) 과일치한다. 중요하게는, SYNJ2-GFP 반점은이들구조들과동시-국소화되며 ( 도 11C, 화살표 ), 이는도 5B에나타낸액틴-관련긴수명의반점과닮았다. SYNJ2의발현레벨은침습위족의발생과명확하게관련이있고 ; SYNJ2 과발현은침습위족-포함세포의단편을거의두배로늘리지만, sisynj2는침습위족의발생정도를현저하게감소시키며 ( 도 11D), 이는인과관계 (causal relationship) 를나타낸다. 다음으로, SYNJ2와잘특성화된침습위족의마커인코르탁틴사이의잠재적인물리적연관성을조사하였고, SYNJ2와코르탁틴은침습위족및리딩에지양쪽모두에동시국소화될뿐만아니라 ( 도 12C), 동시면역침강 (co-immunoprecipitate) 도된다는것을발견하였다 ( 도 12B). SYNJ2에대한촉발역할 (driving role) 을확고히확립하기위하여 TKS5를관찰하였고, PI(3,4)P 2 및코르탁틴의바인더는침습위족의 이정표로서의역할을한다 (Courtneidge et al., 2005). 예상한바와같이, 내재적 TKS5는대조군 MDA-MB-231 세포에서의매트릭스분해의다수의배측부위에국소화되었지만, 어떠한활성부위도 sisynj2 세포에서거의발견되지않았고, TKS5는그것의배측위치를잃어버렸다 ( 도 6E; X-Y 및 Z 패널 ). 게다가, 침습위족성 TKS5는 PI(3,4)P 2 에고정되므로 (Oikawa et al., 2008), PI(3,4)P 2 -결합도메인, 즉 Tapp1의 PH 도메인을프로브로서사용하였다. 이전의보고들과일치하게, ph 도메인의이소성 (ectopic) 발현은침습위족의수는감소시켰으나, 그럼에도불구하고남아있는시그널은 TKS5 및액틴중심과함께동시에국소화된다 ( 도 12D). 결론적으로, SYNJ2 는 TKS5의참여 (engagement) 에선행하는단계에필요한것으로나타났고, 이는 PI3K(Yamaguchi et al., 2011) 와 SYNJ2의순차적인 (sequential) 작용과일치하였으며, 각각 PI3K의 EGFR-유도성활성화부위에 TKS5를고정시키기위해 PI(3,4,5)P 3 를생성한후 PI(3,4)P 2 를생성한다. [0293] EGFR-PI3K-SYNJ2 시나리오에의거하면, 단백질분해적활성 (proteolytically active) 의침습위족에서 EGFR의활성형 (pegfr) 을검출하였으나, SYNJ2-결핍세포의 EGFR은팽창된소포에국소화되어있었다 ( 도 11F). 국소수용체활성화에관련된메커니즘은여전히알려져있지않다. 하나의모델에따라, MMP-7 및 CD44를포함하는복합체에의한헤파린-결합 EGF(heparin-binding EGF, HB-EGF) 와같은프로-리간드 (pro-ligand) 의절단은 EGFR을국소적으로자극할수있다 (Yu et al., 2002). 이모델에의거하면, SYNJ2 존재비는 EGFR 리간드의분비와관련이있으며 ( 도 11G), 침습위족의액틴중심과 CD44의동시국소화를검출하였다 ( 도 12E). 비슷하게는, 유세포분석기를사용하여 CD44의표면발현이대조군세포에비례하여 shsynj2 세포에서강력하게억제되었음을발견하였다 ( 도 12F). 침습위족의성숙에있어서또다른중요한단계는가용성 MMP를활성화시키는막유형-1 매트릭스메탈로프로테이나아제 (membrane type-1 matrix metalloproteinase, MT1-MMP) 의동원이다 (Wang and McNiven, 2012). 따라서, 대조군세포에서 MT1-MMP는침습위족돌출부의부위와일치하지만, sisynj2 세포의 MT1-MMP 분자는커다란응집체를형성하며, 이는매트릭스분해와는관련이없다는것을발견하였다 ( 도 9E). 종합하면, 이들관찰은 SYNJ2가프로테아제및두개의이전에는인정받지못했던상주하는 (residents) CD44와활성 EGFR 모두를이세포소기관으로표적화하기위한것일뿐만아니라, 침습위족의프라이밍 (priming) 에필수적이라는것을나타낸다. [0294] [0295] 실시예 8 SYNJ2 는유방동물모델에서종양의성장및전이확산을촉진한다

41 [0296] 생체내전이성파종 (dissemination) 에대한 SYNJ2 의효과를평가하기위하여, MDA-MB-231-RFP 세포 ( 및파생세 포 ) 를암컷마우스의유방지방패드안으로이식하고, 2 주또는 6 주후에종양의크기 ( 도 13A) 및전이 ( 도 13B) 를모두측정하였다. 원발성종양 (primary tumor) 의성장은 shsynj2 와 ' 비능동적구제 (inactive rescue)'(shsynj2+synj2 CD ) 군에비해 shctrl과 shsynj2+synj2 WT (" 능동적구제 (active rescue)") 군에서더욱현저하게빨랐다. 전이성거동 (behavior) 은 SYNJ2와유사하게관련이있으며 ; shsynj2 및 ' 비능동적구제 ' 군은국소 (local) 및원격 (distant) 림프절에대한전이성확산에현저한감소를보였다 ( 도 13B 및 14). 원격전이를조사하기위하여, 마우스를희생시키고, 그것들의폐를평가하였다. shsynj2 세포또는 ' 비능동적구제 ' 세포가이식된동물의폐는 shctrl 또는 ' 능동적구제 ' 세포가접종된동물과비교하여전이의수와크기에극적인감소를나타내었다 ( 도 13C). 종합하면, 이들결과는전이촉진에 SYNJ2가연루되어있음을보여준다. [0297] 유사하게는, SYNJ2를과발현하는이종이식편 (xenografts) 을관찰하였다. 예상한바와같이, SYNJ2-OX 세포는종양이더빠르게성장하게하였고 ( 도 13D), 그것들은또한림프절전이 (nodal metastases) 의조기발생을나타내었다 ( 도 13E). 강한 (robust) 림프관침습과일치하게, SYNJ2-OX 세포가이식된동물의폐는전이의수의증가를나타내었다 ( 도 13F). 다음으로, 혈관내침투 (intravasation) 또는혈관외유출 (extravasation) 에대한 SYNJ2의효과를테스트하였다. 이런이유로, MDA-MB-231-RFP 세포의서브클론을암컷마우스의혈액의흐름 (circulation)( 꼬리정맥 ) 내로직접주사하고, 폐의군체형성 (lung colonization)( 혈관외유출 ) 의수를측정하고, 또는그것들을지방패드내로이식하여혈중종양세포 (circularing tumor cells, CTCs; 혈관내침투 ) 로서혈액에서의수를측정하였다. 이들실험은각각의원발성종양사이에서의크기차이를고려한것임에주의한다. 정규화된결과는 SYNJ2가혈관내침투 (p = ) 및혈관외유출 (p = , 도 13G) 양쪽모두에필요하다는것을나타낸다. 이결론을 GFP-SYNJ2 과발현세포를사용하여추가로테스트하였다 ( 도 13H). 특히, 이실험에서얻어진세포내침투결과는통계학적유의성을나타내었으나, 원격의기관을일혈시키고군집화시키는데더나은 SYNJ2-OX 세포의능력은유의함에도달하지못하였고, 이는국소및원격전이에서관찰된 SYNJ2의강력한효과가주로림프및혈관내로의강화된혈관내침투때문임을암시한다. [0298] [0299] [0300] [0301] 실시예 9 SYNJ2는공격적인간유방종양과연관이있다인간의암에대한 SYNJ2의관련성을해결하기위하여, NCI-60 패널의 60개의인간암세포주에서 SYNJ2의전사체레벨을분석하였다. 운동성표현형에대한기여도에의거하여, SYNJ2의높은전사체레벨은간엽성 (mesenchymal) 표현형과연관이있음을발견하였다. 다음으로, 유방암종 NJ2의일련의 331개의파라핀-포매샘플을면역염색하였다 ( 도 16A). 중요하게는, SYNJ2의발현세기는 HER2 과발현 (p < 0.001) 및 / 또는에스트로겐수용체의결여 (p < 0.001) 로정의되는예후적으로불리한하위유형과분명히연관되어있다. 그러나, SYNJ2의존재비및수명, 조직학적하위유형, 액와림프절 (axillary lymph node) 상태및분화등급 (differentiation grade) 사이에어떠한현저한연관성도발견되지않았다. 흥미롭게도, SYNJ2의염색패턴또한다양하였으며 ; HER2+ 종양은주로세포막질성 (membranal) 염색을나타내었지만, 루미날 (luminal) 및삼중음성 (triple negative) 종양은세포질성 (cytoplasmic) 염색을나타내었다 ( 도 16B). 이결과를뒷받침하기위하여, 두집단의유방암샘플에서 SYNJ2 mrna 레벨을분석하였고, 짧은환자의생존율과관련성이있음을발견하였다 ( 도 16C). 대체적으로, 이들관찰은유방암의진행에서의 SYNJ2의관여를뒷받침하지만, 전사체상향조절의배후에있는메커니즘은미해결상태이다. 요약하면, 상기관찰들은임상학적데이터및시험관내실험과함께동물에서이루어졌으며, 이는침습위족및리딩에지로의세포표면분자의왕복수송에서있어서의포스포이노시티드의주요한역할때문에 SYNJ2에의한이노시톨리피드의탈인산화가전이성프로세스에매우중요하다는것을명확히보여준다. 아래에작동모델 (working model) 을나타내었으며 ( 도 15), 종양진행의넓은맥락에서의 SYNJ2의다수의기능을논의한다. [0302] [0303] [0304] 실시예 10 SYNJ2의 5' 포스파타아제활성의선택적억제인자 SYNJ2 포스파타아제활성의선택적억제인자를확인하기위하여, 본발명자들은분자들은공간내에서끊임없이회전하고움직이고있으나, 일단다른커다란성분 ( 예를들어, 단백질 ) 에결합되면그것들의움직임이극적으로

42 제한된다는원리에의존하는형광편광경쟁검정법을사용하였다. 움직임에서의이러한변화는, 비결합된상태에서매우낮은편광판독을야기하는형광성분자들 ( 즉, 프로브 ) 을사용하여검출되고측정될수있지만, 이들분자들이결합하는검출자 ( 예를들어, 결합단백질 ) 가용액에첨가되는경우상기형광성분자들은용액내에서편광판독을증가시키는한정된 (confined) 조성물에서안정화된다 ( 도 17A). [0305] [0306] 수행된선별에서, 본발명자들은서로다른화합물의존재하에서, PI(3,4)P2를생산하기위해 PI(3,4,5,)P3의 5' 위치를탈인산화시키기위한 SYNJ2의효소활성을측정하였다. 일단효소반응이완료 / 정지되면, PI(3,4)P2 생성물을포함하는용액을 PI(3,4)P2 결합단백질 ( 검출자 ) 과형광성 PI(3,4)P2( 프로브 ) 의혼합물과혼합하였다. 사용된검출단백질은 PI(3,4)P2와선택적으로결합하는정제된 Tapp1의 PH-도메인이다 (SEQ ID NO:15). 도 17B 에나타낸바와같이, 결합된 PI(3,4)P2 형광프로브가 SYNJ2의효소활성에의해생성된비표지된 PI(3,4)P2로치환되었기때문에, 이검정법에서측정된편광값은감소하였으며, 이용액에서비결합된형광프로브의양은증가하였다. 아래의표 2는 SYNJ2에의해 PI(3,4)P2의생성을억제할수있는, 이방법에서사용하여확인된다양한화합물을묘사한것이다

43 표 2 [0307]

44 [0308]

45 [0309] [0310] [0311] [0312] 논의세포이동및암전이의통합적인마스터조절자로서의 SYNJ2의기능이입증되었으며, 이는특정막서브-도메인의동일성 (identity) 을결정하는 2차전달자 (second messengers) 및이정표 (signposts) 양쪽모두로서작용하는 PI 포스포리피드의레벨을조절하는그것의능력에기인한것일가능성이있다. 다수의 SYNJ2의작용의또다른반영은주로침습위족및층상위족에대한바이모달성 (bimodal) 배측국소화 (ventral localization) 이다. 따라서, SYNJ2는액틴역동성 (actin dynamics) 의중요한조절자 ( 예를들어, 다이나민, 코르탁틴및 Rac1) 와함께물리적복합체를형성한다. SYNJ2의작용을이해하기위한하나의핵심은세포내이입성수송 (endocytic trafficking) 을조절하는능력이다. 끊임없이액틴-기반돌출부 (actin-based protrusion) 를공급하는소포에서의원형질막일부의빈번한패키징은세포의이동을추진한다 (Ridley, 2011). 층상위족의 SYNJ2는놀랄만한역동성을나타내며 ( 도 3B), 생세포이미지는 SYNJ2 동원 (recruitment) 이새로운층상위족형성의부위를표시한다는것을나타낸다. 리딩에지에위치하는 SYNJ2 분자는다이나민, Rac1, 액틴중합및콜레스테롤에의존하지만, 그것의분포는카베올린-1 및클라트린의그것과는구별되기때문에, 본발명자들은그것이클라트린-독립성담체 (Clathrin-independent carriers, CLICs) 의다이나민-의존성변이체를대표하며, 이것이리딩에지에서의막의턴오버 (turnover) 를지속시킨다고추정하였다 (Howes et al., 2010). 일련의명쾌한연구는뉴런에서의시냅스성소포재활용에 SYNJ1가연루되어있음을보여주었다 (Cremona et al., 1999). 마우스에서, SYNJ1의결실은정상-상태 (steady-state) PI(4,5)P 2 의상승, 클라트린-코팅된소포의 축적및세포내이입후 (post-endocytic) 소포재이용 (reavailability) 의지연을야기한다 (Mani et al.,

46 2007). 이들관찰은소포의피복배출 (vesicle coat shedding) 을가능하게할수있는 PI(4,5)P 2 의탈인산화가표현형의기저를이루고있다는것을암시한다. 유추하자면, 본발명의 SYNJ2-결핍유방세포는활성 EGFR의세포내축적을나타낸다. 세포내이입경로의수용체유비퀴틴화상태및마커들은수송이분류 (sorting) 엔도솜에서정지되고, 거기에서내재화된수용체는정상적으로재활용또는분해중어느하나로이동된다는것을나타내었다. 상상컨대, 상기결함은소포의피복또는그것의액틴코멧꼬리 (comet tail) 와연관된 PI(4,5)P 2 -결합단백질을분해하지못하는것에기인한다 (Kaksonen et al., 2003). 따라서, SYNJ1 제거 (ablation) 에대해관찰된시냅스전달 (synaptic transmission) 에서의결함과유사하게, SYNJ2의손실은운동성에필수적인표면분자의수송을정지시키기때문에세포이동및침습을심각하게손상시킨다. [0313] SYNJ2- 결핍세포에서관찰된각각초기 (early) 및말기 (late) 엔도솜의조절자인 PI(3)P 및 PI(3,5)P 2 의증가 ( 도 5C) 는추가적인수송메커니즘을제시한다. PI(3,5)P 2 의조절역할은인테그린및몇몇의 Rab 단백질과같은다중바인더의확인에의해보강되었다 (Catimel et al., 2008). PI(3)P는 PIKfyve에의해인산화되며, 5-키나아제 (5-kinase) 는 MT1-MMP를침습위족으로운반하는경로인엔도솜과트랜스-골지네트워크 (trans-golgi network) 사이에서의순환 (cycling) 에연루되어있다 (Poincloux et al., 2009). 그러므로, PI(4,5)P 2 의탈인산화에더하여, SYNJ2는초기엔도솜의 PI(3)P 풀 (pool) 을미세조정 (fine tune) 하기위해 PI(3,5)P 2 를가공하고, EGFR뿐만아니라 MT1-MMP의세포내이입및인테그린의재활용모두를조정하는것으로예상된다. [0314] 동물안으로도입하였을때, shsynj2 MDA-MB-231 세포는림프절및혈관에도달하는능력이감소되었기때문에, 전이능력 (potential) 을심하게잃어버린다 ( 도 13A-H). 이들결과와시험관내표현형을통합시키기위한시도로, 도 15에나타낸것은세포운동성에서의 SYNJ2의역할의근본적인메커니즘이다. 따라서, 핵심사건은 SYNJ2의 EGF-유도성상향조절과그결과에따른세가지포스포이노시티드 : PI(4,5)P 2, PI(3,4,5)P 3 및 PI(3,5)P 2 의결핍 (depletion) 을수반한다. SYNJ2-매개성 PI(4,5)P 2 탈인산화는포스포리파아제 C-감마 (phospholipase C-gamma) 에의한 PI(4,5)P 2 의분해및 PI3K에의한인산화와병행되어, PI(3,4,5)P 3 를생성한다. 총괄적으로, EGF에의한세가지효소의자극은원형질막으로부터 PI(4,5)P 2 바인더군을분리하고, 또한 PI(4,5)P 2 가없는세포내이입성소포를생성한다. 동시에, SYNJ2는 PI(3,4,5)P 3 를 PI(3,4)P 2 로전환하며, 이는침습위족형성에필수적이다. 이모델에의거하여, PI3K가침습위족의형성에필요하다는것이보고되어있다. 일단제자리에서, PI(3,4)P 2 는 TKS5와결합하고, 침습위족내에서코필린이액틴의반화살촉말단 (barbed end) 을생성할수있게하는다이나민 (Dynamin) 및코르탁틴-중심복합체 (Cortactin-centered complex) 를응집한다. 본발명의결과에따르면, SYNJ2는또한다음의침습위족성숙단계, 즉 MMP의분비및 MT1-MMP 및 CD44와같은다른표면분자들의운반에도관여한다. 유사한방식으로, SYNJ2는리딩에지로의 EGFR 과인테그린의운반을조절하고, 코필린을활성화시키는것으로보이며, 층상위족돌출부의형성을지시하는중추적사건을조절한다. [0315] [0316] 시험관내에서의세포이동및동물에서의전이에대한 SYNJ2의역할에의거하여, 본발명의유방암샘플의조사는질병의공격적인하위형태에서 SYNJ2 mrna 및단백질레벨의현저한상향조절을관찰하였다. 게다가, 두집단으로부터의데이터를사용하여, 높은 SYNJ2 mrna 발현과짧은생존률의유방암환자사이에서의관련성을관찰하였다. 요약하면, 본연구는필수적인전이-개시성사건 (metastasis-initiating events) 을침습위족의이정표인 PI(3,4)P 2 를생성할뿐만아니라, PI(4,5)P 2 에서의순차적작용이리딩에지에서액틴역동성을조절하는, PI3K 의 EGF- 유도성국소활성화및 SYNJ2 의전역상향조절에따른결과로보았다. 게다가, 본연구는 SYNJ2 에의한 PI(3,4)P2 의생성을선택적으로억제하는다양한화합물들을확인하였다. [0317] [0318] 비록본발명은그것들의특정구현들과함께기술하였지만, 많은변형들, 변경들및변화들이당업자들에게이해될것이라는것은명백하다. 따라서, 이는부가된청구항의정신및넓은범위에포함되는모든이러한변형들, 변경들및변화들까지도포괄한다. 이명세서에언급된모든간행물, 특허및특허출원서는각개별적인간행물, 특허및특허출원서가특별히그리고개별적으로참조로서본원에포함되는것으로나타내지는바와같은정도로, 명세서내에참조로서그것의전체내용이본원에포함된다. 또한, 이명세서에서임의의참조의인용또는식별은이러한참조를본발명에대한선행기술로이용할수있다고인정하는것으로해석되어서는안된다. 섹션의제목이사용될경우, 그것

47 들은반드시한정하는것으로해석되어서는안된다. [0319] [0320] [0321] [0322] [0323] [0324] [0325] [0326] [0327] [0328] [0329] [0330] [0331] [0332] [0333] [0334] [0335] 참조 ( 다른참조들은본문에포함된다 ) Amit, I., Citri, A., Shay, T., Lu, Y., Katz, M., Zhang, F., Tarcic, G., Siwak, D., Lahad, J., Jacob- Hirsch, J., et al. (2007). A module of negative feedback regulators defines growth factor signaling. Nat Genet 39, Augoff, K., Das, M., Bialkowska, K., McCue, B., Plow, E.F., and Sossey-Alaoui, K. (2011). mir-31 is a broad regulator of beta1-integrin expression and function in cancer cells. Molecular cancer research : MCR 9, Bos, P.D., Zhang, X.H., Nadal, C., Shu, W., Gomis, R.R., Nguyen, D.X., Minn, A.J., van de Vijver, M.J., Gerald, W.L., Foekens, J.A., et al. (2009). Genes that mediate breast cancer metastasis to the brain. Nature 459, Catimel, B., Schieber, C., Condron, M., Patsiouras, H., Connolly, L., Catimel, J., Nice, E.C., Burgess, A.W., and Holmes, A.B. (2008). The PI(3,5)P2 and PI(4,5)P2 interactomes. J Proteome Res 7, Chuang, Y.Y., Tran, N.L., Rusk, N., Nakada, M., Berens, M.E., and Symons, M. (2004). Role of synaptojanin 2 in glioma cell migration and invasion. Cancer research 64, Courtneidge, S.A., Azucena, E.F., Pass, I., Seals, D.F., and Tesfay, L. (2005). The SRC substrate Tks5, podosomes (invadopodia), and cancer cell invasion. Cold Spring Harb Symp Quant Biol 70, Cremona, O., Di Paolo, G., Wenk, M.R., Luthi, A., Kim, W.T., Takei, K., Daniell, L., Nemoto, Y., Shears, S.B., Flavell, R.A., et al. (1999). Essential role of phosphoinositide metabolism in synaptic vesicle recycling. Cell 99, Ehrlich, M., Boll, W., Van Oijen, A., Hariharan, R., Chandran, K., Nibert, M.L., and Kirchhausen, T. (2004). Endocytosis by random initiation and stabilization of clathrin-coated pits. Cell 118, Gewinner, C., Wang, Z.C., Richardson, A., Teruya-Feldstein, J., Etemadmoghadam, D., Bowtell, D., Barretina, J., Lin, W.M., Rameh, L., Salmena, L., et al. (2009). Evidence that inositol polyphosphate 4-phosphatase type II is a tumor suppressor that inhibits PI3K signaling. Cancer cell 16, Goh, L.K., Huang, F., Kim, W., Gygi, S., and Sorkin, A. (2010). Multiple mechanisms collectively regulate clathrin-mediated endocytosis of the epidermal growth factor receptor. The Journal of cell biology 189, Gruenberg, J., and Stenmark, H. (2004). The biogenesis of multivesicular endosomes. Nat Rev Mol Cell Biol 5, Guo, W., and Giancotti, F.G. (2004). Integrin signalling during tumour progression. Nat Rev Mol Cell Biol 5, Howes, M.T., Kirkham, M., Riches, J., Cortese, K., Walser, P.J., Simpson, F., Hill, M.M., Jones, A., Lundmark, R., Lindsay, M.R., et al. (2010). Clathrin-independent carriers form a high capacity endocytic sorting system at the leading edge of migrating cells. The Journal of cell biology 190, Jefferson, A.B., and Majerus, P.W. (1996). Mutation of the conserved domains of two inositol polyphosphate 5-phosphatases. Biochemistry 35, Kaksonen, M., Sun, Y., and Drubin, D.G. (2003). A pathway for association of receptors, adaptors, and actin during endocytic internalization. Cell 115,

48 [0336] [0337] [0338] [0339] [0340] [0341] [0342] [0343] [0344] [0345] [0346] [0347] [0348] [0349] [0350] [0351] [0352] Kruchten, A.E., and McNiven, M.A. (2006). Dynamin as a mover and pincher during cell migration and invasion. Journal of cell science 119, Macia, E., Ehrlich, M., Massol, R., Boucrot, E., Brunner, C., and Kirchhausen, T. (2006). Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell 10, Malecz, N., McCabe, P.C., Spaargaren, C., Qiu, R., Chuang, Y., and Symons, M. (2000). Synaptojanin 2, a novel Rac1 effector that regulates clathrin-mediated endocytosis. Curr Biol 10, Mani, M., Lee, S.Y., Lucast, L., Cremona, O., Di Paolo, G., De Camilli, P., and Ryan, T.A. (2007). The dual phosphatase activity of synaptojanin1 is required for both efficient synaptic vesicle endocytosis and reavailability at nerve terminals. Neuron 56, Minn, A.J., Gupta, G.P., Siegel, P.M., Bos, P.D., Shu, W., Giri, D.D., Viale, A., Olshen, A.B., Gerald, W.L., and Massague, J. (2005). Genes that mediate breast cancer metastasis to lung. Nature 436, Mosesson, Y., Mills, G.B., and Yarden, Y. (2008). Derailed endocytosis: an emerging feature of cancer. Nat Rev Cancer 8, Mouneimne, G., DesMarais, V., Sidani, M., Scemes, E., Wang, W., Song, X., Eddy, R., and Condeelis, J. (2006). Spatial and temporal control of cofilin activity is required for directional sensing during chemotaxis. Curr Biol 16, Muller, P.A.J., Caswell, P.T., Doyle, B., Iwanicki, M.P., Tan, E.H., Karim, S., Lukashchuk, N., Gillespie, D.A., Ludwig, R.L., Gosseline, P., et al. (2010). Mutant p53 drives invasion by promoting integrin recycling. Cell 139, Murphy, D.A., and Courtneidge, S.A. (2011). The 'ins' and 'outs' of podosomes and invadopodia: characteristics, formation and function. Nat Rev Mol Cell Biol 12, Oikawa, T., Itoh, T., and Takenawa, T. (2008). Sequential signals toward podosome formation in NIH-src cells. The Journal of cell biology 182, Oser, M., Yamaguchi, H., Mader, C.C., Bravo-Cordero, J.J., Arias, M., Chen, X., Desmarais, V., van Rheenen, J., Koleske, A.J., and Condeelis, J. (2009). Cortactin regulates cofilin and N-WASp activities to control the stages of invadopodium assembly and maturation. The Journal of cell biology 186, Palamidessi, A., Frittoli, E., Garre, M., Faretta, M., Mione, M., Testa, I., Diaspro, A., Lanzetti, L., Scita, G., and Di Fiore, P.P. (2008). Endocytic trafficking of Rac is required for the spatial restriction of signaling in cell migration. Cell 134, Poincloux, R., Lizarraga, F., and Chavrier, P. (2009). Matrix invasion by tumour cells: a focus on MT1-MMP trafficking to invadopodia. Journal of cell science 122, Ridley, A.J. (2011). Life at the leading edge. Cell 145, Saarikangas, J., Zhao, H., and Lappalainen, P. (2010). Regulation of the actin cytoskeleton-plasma membrane interplay by phosphoinositides. Physiol Rev 90, Sossey-Alaoui, K., Downs-Kelly, E., Das, M., Izem, L., Tubbs, R., and Plow, E.F. (2011). WAVE3, an actin remodeling protein, is regulated by the metastasis suppressor microrna, mir-31, during the invasion-metastasis cascade. International journal of cancer Journal international du cancer 129, Valastyan, S., Chang, A., Benaich, N., Reinhardt, F., and Weinberg, R.A. (2011). Activation of mir-31 function in already-established metastases elicits metastatic regression. Genes & development 25,

49 [0353] [0354] [0355] [0356] [0357] [0358] Valastyan, S., Reinhardt, F., Benaich, N., Calogrias, D., Szasz, A.M., Wang, Z.C., Brock, J.E., Richardson, A.L., and Weinberg, R.A. (2009). A pleiotropically acting microrna, mir-31, inhibits breast cancer metastasis. Cell 137, van Rheenen, J., Song, X., van Roosmalen, W., Cammer, M., Chen, X., Desmarais, V., Yip, S.C., Backer, J.M., Eddy, R.J., and Condeelis, J.S. (2007). EGF-induced PIP2 hydrolysis releases and activates cofilin locally in carcinoma cells. The Journal of cell biology 179, Wang, Y., and McNiven, M.A. (2012). Invasive matrix degradation at focal adhesions occurs via protease recruitment by a FAK-p130Cas complex. The Journal of cell biology. Yamaguchi, H., Yoshida, S., Muroi, E., Yoshida, N., Kawamura, M., Kouchi, Z., Nakamura, Y., Sakai, R., and Fukami, K. (2011). Phosphoinositide 3-kinase signaling pathway mediated by p110alpha regulates invadopodia formation. The Journal of cell biology 193, Yu, W.H., Woessner, J.F., Jr., McNeish, J.D., and Stamenkovic, I. (2002). CD44 anchors the assembly of matrilysin/mmp-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes & development 16, Yuan, T.L., and Cantley, L.C. (2008). PI3K pathway alterations in cancer: variations on a theme. Oncogene 27,

50 도면 도면

51 도면

52 도면

53 도면

54 도면

55 도면

56 도면

57 도면

58 도면

59 도면

60 도면

61 도면

62 도면

63 도면

64 도면

65 도면

66 도면

67 도면 18 서열목록 SEQUENCE LISTING <110> Yeda Research and Development Co. Ltd. Yarden, Yosef Ben-Chetrit, Nir <120> METHODS OF PREVENTING TUMOR METASTASIS, TREATING AND PROGNOSING CANCER AND IDENTIFYING AGENTS WHICH ARE PUTATIVE METASTASIS INHIBITORS

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분 세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 11 곡선과곡면 01 Spline 곡선 02 Spline 곡면 03 Subdivision 곡면 C n 연속성 C 0 연속성 C 1 연속성 2 C 2 연속성 01 Spline 곡선 1. Cardinal Spline Curve 2. Hermite Spline Curve 3. Bezier Spline Curve 4. Catmull-Rom Spline Curve 5.

More information

<B3EDB4DC28B1E8BCAEC7F6292E687770> 1) 초고를읽고소중한조언을주신여러분들게감사드린다. 소중한조언들에도불구하고이글이포함하는오류는전적으로저자개인의것임을밝혀둔다. 2) 대표적인학자가 Asia's Next Giant: South Korea and Late Industrialization, 1990 을저술한 MIT 의 A. Amsden 교수이다. - 1 - - 2 - 3) 계량방법론은회귀분석 (regression)

More information

특허청구의 범위 청구항 1 제1 내지 제6 암이 각각의 관절부를 가지며 형성되며, 상기 제1 내지 제6 암 각각은 제1 내지 제6 링크에 의해 링크되고, 상기 제1 내지 제6 암 내부에는 각각의 암을 구동하는 구동모듈이 각각 내장되며, 상기 구동모듈 각각의 선단에는 1

특허청구의 범위 청구항 1 제1 내지 제6 암이 각각의 관절부를 가지며 형성되며, 상기 제1 내지 제6 암 각각은 제1 내지 제6 링크에 의해 링크되고, 상기 제1 내지 제6 암 내부에는 각각의 암을 구동하는 구동모듈이 각각 내장되며, 상기 구동모듈 각각의 선단에는 1 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) B25J 9/06 (2006.01) B25J 19/02 (2006.01) (21) 출원번호 10-2011-0079361 (22) 출원일자 2011년08월10일 심사청구일자 2011년08월10일 (65) 공개번호 10-2013-0017122 (43) 공개일자 2013년02월20일

More information

특허청구의 범위 청구항 1. 1종 이상의 병원체 폴리펩티드가 임의의 균주로부터 제시되지 않는, 개별 대상체에 존재하는 병원체의 다중 균주로부터의 1종 이상의 폴리펩티드를 코딩하는 핵산을 포함하는 단리된 항원 제시 세포 (APC). 청구항 2. 제1항에 있어서, 상기 핵

특허청구의 범위 청구항 1. 1종 이상의 병원체 폴리펩티드가 임의의 균주로부터 제시되지 않는, 개별 대상체에 존재하는 병원체의 다중 균주로부터의 1종 이상의 폴리펩티드를 코딩하는 핵산을 포함하는 단리된 항원 제시 세포 (APC). 청구항 2. 제1항에 있어서, 상기 핵 (19)대한민국특허청(KR) (12) 공개특허공보(A) (51) Int. Cl. C12Q 1/70 (2006.01) C12Q 1/68 (2006.01) (11) 공개번호 (43) 공개일자 10-2007-0058503 2007년06월08일 (21) 출원번호 10-2007-7005912 (22) 출원일자 2007년03월14일 심사청구일자 없음 번역문 제출일자 2007년03월14일

More information

248019_ALIS0052.hwp

248019_ALIS0052.hwp Generation history for optimization eneration history of optimization 불평형질량 편심량 회전수 축외경 축내경 축길이 베어링간격위치 베어링강성 교배 대상이되는개체의수 집단의크기 돌연변이 대상이되는유전자수 집단내전체유전자수 와 와 Generation history

More information

특허청구의 범위 청구항 1 복수개의 프리캐스트 콘크리트 부재(1)를 서로 결합하여 연속화시키는 구조로서, 삽입공이 형성되어 있고 상기 삽입공 내면에는 나사부가 형성되어 있는 너트형 고정부재(10)가, 상기 프리캐스 트 콘크리트 부재(1) 내에 내장되도록 배치되는 내부

특허청구의 범위 청구항 1 복수개의 프리캐스트 콘크리트 부재(1)를 서로 결합하여 연속화시키는 구조로서, 삽입공이 형성되어 있고 상기 삽입공 내면에는 나사부가 형성되어 있는 너트형 고정부재(10)가, 상기 프리캐스 트 콘크리트 부재(1) 내에 내장되도록 배치되는 내부 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) E01D 19/12 (2006.01) E01D 2/00 (2006.01) E01D 21/00 (2006.01) (21) 출원번호 10-2011-0036938 (22) 출원일자 2011년04월20일 심사청구일자 2011년04월20일 (65) 공개번호 10-2012-0119156

More information

이 장에서 사용되는 MATLAB 명령어들은 비교적 복잡하므로 MATLAB 창에서 명령어를 직접 입력하지 않고 확장자가 m 인 text 파일을 작성하여 실행을 한다

이 장에서 사용되는 MATLAB 명령어들은 비교적 복잡하므로 MATLAB 창에서 명령어를 직접 입력하지 않고 확장자가 m 인 text 파일을 작성하여 실행을 한다 이장에서사용되는 MATLAB 명령어들은비교적복잡하므로 MATLAB 창에서명령어를직접입력하지않고확장자가 m 인 text 파일을작성하여실행을한다. 즉, test.m 과같은 text 파일을만들어서 MATLAB 프로그램을작성한후실행을한다. 이와같이하면길고복잡한 MATLAB 프로그램을작성하여실행할수있고, 오류가발생하거나수정이필요한경우손쉽게수정하여실행할수있는장점이있으며,

More information

Chapter 4. LISTS

Chapter 4. LISTS C 언어에서리스트구현 리스트의생성 struct node { int data; struct node *link; ; struct node *ptr = NULL; ptr = (struct node *) malloc(sizeof(struct node)); Self-referential structure NULL: defined in stdio.h(k&r C) or

More information

Janeway's Immunology

Janeway's Immunology Chapter 5 T 림프구에대한항원제시 (Antigen presentation to T lymphocytes) 2014 년도 2 학기약품면역학제 5 강 (1/43) 적응면역반응 (adaptive immune response) 주조직적합복합체 (major histocompatibility complex, MHC) 항원처리 (antigen processing)

More information

실용신안 등록청구의 범위 청구항 1 톤백마대가 설치될 수 있도록 일정간격을 두고 설치되는 한 쌍의 지지프레임과, 상기 지지프레임과 지지프레임의 상부를 서로 연결하는 한 쌍의 연결프레임과, 상기 연결프레임의 상부에 일정간격을 두고 다수 설치되어 상기 톤백마대와 그 투입구

실용신안 등록청구의 범위 청구항 1 톤백마대가 설치될 수 있도록 일정간격을 두고 설치되는 한 쌍의 지지프레임과, 상기 지지프레임과 지지프레임의 상부를 서로 연결하는 한 쌍의 연결프레임과, 상기 연결프레임의 상부에 일정간격을 두고 다수 설치되어 상기 톤백마대와 그 투입구 (19) 대한민국특허청(KR) (12) 공개실용신안공보(U) (51) 국제특허분류(Int. Cl.) B65B 67/12 (2006.01) B65D 88/16 (2006.01) (21) 출원번호 20-2012-0003587 (22) 출원일자 2012년05월01일 심사청구일자 2012년05월01일 (11) 공개번호 20-2013-0006479 (43) 공개일자

More information

신규투자사업에 대한 타당성조사(최종보고서)_v10_클린아이공시.hwp

신규투자사업에 대한 타당성조사(최종보고서)_v10_클린아이공시.hwp 신규투자사업에 대한 타당성 조사 (요약본) 2015. 4. 지방공기업평가원 제주관광공사가부족한쇼핑인프라를보완하고, 수익을제주관광진흥에재투자하여 관광산업활성화와관광마케팅재원확보 라는양대목적달성에기여하고공기업으로서사회적책임을다하고자시내면세점사업에투자하려는의사결정에대한타당도는전반적으로볼때 긍정 으로평가할수있음 역할및필요성 대내 외환경 정책및법률 경제성기대효과

More information

untitled

untitled DOI: 10.3857/JKSTRO.2008.26.2.113 노령의 피부암에서 방사선치료 계명대학교 의과대학 동산의료원 방사선종양학교실 김 진 희 목 적: 노령의 피부암에서 방사선치료 후 국소 제어률, 생존율, 실패양상, 부작용을 알아보기 위해 이 연구를 시행 하였다. 대상 및 방법: 1990년 1월부터 2002년 10월까지 계명대학교 동산의료원 방사선종양학과에서

More information

- 2 -

- 2 - 터키 / 공통 가이드라인명 GMP Kılavuzu GMP 가이드라인 제정일 상위법 Ÿ Ÿ 제정배경 범위 주요내용 Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ 의약품제조시, 제조허가증, 의약품의용도및판매허가요구사항, 안정성, 품질및품질부적합으로인한피해로환자가발생하지않도록제조하기위함임. 화학합성의약품, 생물의약품, 방사성의약품, 임상시험용의약품, 무균의약품, 사람혈액및혈장의약품,

More information

550호(01-09)

550호(01-09) T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 8 11 13 24 25 27 29 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine

More information

Microsoft PowerPoint - 발표자료(KSSiS 2016)

Microsoft PowerPoint - 발표자료(KSSiS 2016) Sang Jun Kim, MD, PhD Application of 3D Printing in the Orthotic Fields Hallux Valgus, Charcot Marie Tooth, ADL Kit, Foot Insole, Wrist Pain, Foot Drop Development of Automated Program for Ankle Foot Orthosis

More information

특허청구의 범위 청구항 1 맨홀 일부분에 관통되게 결합되는 맨홀결합구와; 상기 맨홀결합구의 전방에 연통되게 형성되어 토양속에 묻히게 설치되고, 외주면에는 지하수가 유입될 수 있는 다수의 통공이 관통 형성된 지하수유입구와; 상기 맨홀결합구의 후방에 연통되고 수직으로 세워

특허청구의 범위 청구항 1 맨홀 일부분에 관통되게 결합되는 맨홀결합구와; 상기 맨홀결합구의 전방에 연통되게 형성되어 토양속에 묻히게 설치되고, 외주면에는 지하수가 유입될 수 있는 다수의 통공이 관통 형성된 지하수유입구와; 상기 맨홀결합구의 후방에 연통되고 수직으로 세워 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 공개특허공보(A) G01F 23/02 (2006.01) G01F 23/00 (2006.01) (21) 출원번호 10-2007-0096769 (22) 출원일자 2007년09월21일 심사청구일자 전체 청구항 수 : 총 5 항 (54) 지하수위 관측장치 2007년09월21일 (11) 공개번호 10-2009-0031004

More information

암센터뉴스레터1

암센터뉴스레터1 CANCER HOSPITAL News News Letter For Yonsei University Gangnam Severance Hospital http://gs.iseverance.com 2012.06.21 2012.08.16 2012.09.19 2012.10.04 2012.10.25 CONTENTS 2012.07.27 2012.10.06 2012.11.06

More information

<C6EDC1FD2DBBFDB8EDB0F8C7D020C6AFC7E3C3E2BFF820B1E6B6F3C0E2C0CC2031333032303420B1B9C0E5B4D4BCF6C1A4B9DDBFB52E687770> 발간등록번호 11-1430000-000000-00 생명공학 특허출원 길라잡이 화학생명공학심사국 생명공학심사과 발 간 사 특허청은 지식재산 주관부처로서 제4기 책임운영기관 출범과 함께 세계 최고 수준으로의 심사품질 향상과 지식재산대중화를 최우선 목표로 추진하고 있으며, 심사품질 향상을 위한 노력으로 화학생명공학심사국에서는 화학 및 생명공학 분야의 최근 기술

More information

노인의학200303.PDF

노인의학200303.PDF 2 1. 2. 1) 2) 3) 3. 4. 1) 2) 3) Microcell 4) 5) 5. 6. 1.. (organism).,...?,??.,. 1935 McCay 27 . 1960 Hayflick. 10 (cytogerontology)... 2. 1),,,,.,,,.. (lipofuscin) (fluidity),., (microvilli)..,, (heat

More information

<30352EB0A3BAB4B8AE2E687770>

<30352EB0A3BAB4B8AE2E687770> The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 08921-01304 부처명 방송통신위원회 연구사업명 방송통신기술개발사업 연구과제명 안전한 전자파환경 조성 주관기관 한국전자통신연구원 연구기간 2008.01.01 ~ 2012.12.31-2 -

이 발명을 지원한 국가연구개발사업 과제고유번호 08921-01304 부처명 방송통신위원회 연구사업명 방송통신기술개발사업 연구과제명 안전한 전자파환경 조성 주관기관 한국전자통신연구원 연구기간 2008.01.01 ~ 2012.12.31-2 - (19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) H05K 9/00 (2006.01) H04B 1/38 (2006.01) (21) 출원번호 10-2011-0134285 (22) 출원일자 2011년12월14일 심사청구일자 없음 기술이전 희망 : 기술양도, 실시권허여, 기술지도 전체 청구항 수 : 총 1 항 (54)

More information

(지도6)_(5단원 156~185)

(지도6)_(5단원 156~185) 1 _ 2_ 3_ 4_ 01 158 159 참고 자료 160 161 162 163 02 164 165 참고 자료 166 167 168 169 활 동 지 03 170 171 172 173 활동의 결과이다. 신경 세포와 신경 세포 간에 화학 물질을 방출하여 전기 신호를 전달해 주는 시냅스 활동은 우리 뇌가 새로운 경험을 할 때마다 변한다. 기분 나쁜 경험을 하면

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 국립암센터 호스피스완화의료사업과 장윤정 국가암관리사업 암진단 말기암 진단 사망 항암치료 완화의료 사별관리 암예방 검진 재가암환자사업 말기암환자 완화의료 암등록 치료비지원 완화의료=증상완화+죽음+사별 Ref) Cancer Control knowledge into action ; palliative care, WHO 2007 호스피스=죽음 가까이의 집중적인 돌봄

More information

항은 발명의 상세한 설명에는 그 발명이 속하는 기술분야에서 통상의 지식을 가진 자 (이하 통상의 기술자 라고 한다)가 용이하게 실시할 수 있을 정도로 그 발명의 목적 구성 및 효과를 기재하여야 한다고 규정하고 있다. 이는 특허출원된 발명의 내용을 제 3자가 명세서만으로

항은 발명의 상세한 설명에는 그 발명이 속하는 기술분야에서 통상의 지식을 가진 자 (이하 통상의 기술자 라고 한다)가 용이하게 실시할 수 있을 정도로 그 발명의 목적 구성 및 효과를 기재하여야 한다고 규정하고 있다. 이는 특허출원된 발명의 내용을 제 3자가 명세서만으로 대 법 원 제 2 부 판 결 사 건 2013후518 권리범위확인(특) 원고, 상고인 코오롱인더스트리 주식회사 소송대리인 변리사 경진영 외 2인 피고, 피상고인 토요보 가부시키가이샤(변경 전: 토요 보세키 가부시키가이샤) 소송대리인 변호사 박성수 외 4인 원 심 판 결 특허법원 2013. 1. 25. 선고 2012허6700 판결 판 결 선 고 2015. 9.

More information

차 례 4

차 례 4 제 50 회전국과학전람회 2004. 07. 20 차 례 4 - 1 - 표 2. 천체의화각 표 1. 초점거리와화각 - 2 - 그림 1. 목성의표면구조 - 3 - 그림 2. 목성위성의상호현상 - 4 - π 공전속도 원궤도의반지름 π 그림 3. 케플러회전 - 5 - 표 3. 목성의궤도자료 표 4. 목성의물리자료 표 5. 4 대위성의궤도자료및물리자료 - 6 - 그림

More information

AAHI의 목적 아시아계 미국인 건강위원회 아시아계 미국인 건강위원회(Asian American Health Initiative: AAHI)는 아시아계 미국인과 비아시아계 미국인 간에 존재하는 보건 불균형을 없애는 데 도움을 주고자 2005 회계 연도에 기금이 마련되어

AAHI의 목적 아시아계 미국인 건강위원회 아시아계 미국인 건강위원회(Asian American Health Initiative: AAHI)는 아시아계 미국인과 비아시아계 미국인 간에 존재하는 보건 불균형을 없애는 데 도움을 주고자 2005 회계 연도에 기금이 마련되어 KOREAN 아시아계 미국인 지역사회의 암 안내서 아시아계 미국인 건강위원회 몽고메리 카운티 보건 복지부 AAHI의 목적 아시아계 미국인 건강위원회 아시아계 미국인 건강위원회(Asian American Health Initiative: AAHI)는 아시아계 미국인과 비아시아계 미국인 간에 존재하는 보건 불균형을 없애는 데 도움을 주고자 2005 회계 연도에

More information

3 Contents 8p 10p 14p 20p 34p 36p 40p 46P 48p 50p 54p 58p 생명다양성재단 영물이라는 타이틀에 정 없어 보이는 고양이, 날카롭게 느껴지시나요? 얼음이 따뜻함에 녹듯이, 사람에게 경계심 많은 길고양이도 곁을 내어주면 얼음 녹듯이 당신을 바라봅니다. 길 위에 사는 생명체라 하여 함부로 대하지 말아주세요. 싫으면 외면해주세요.

More information

슬라이드 1

슬라이드 1 강력한성능! 인터넷 / 업무용데스크탑 PC NX-H Series Desktop PC NX1- H700/H800/H900 NX2- H700/H800/H900 NX1-H Series 사양 Series 제품설명 ( 모델명 ) NX1-H Series, 슬림타입 기본형모델중보급형모델고급형모델 NX1-H800:112SN NX1-H800:324SN NX1-H800:534MS

More information

Jkafm093.hwp

Jkafm093.hwp 가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 RecurDyn 의 Co-simulation 와 하드웨어인터페이스적용 2016.11.16 User day 김진수, 서준원 펑션베이솔루션그룹 Index 1. Co-simulation 이란? Interface 방식 Co-simulation 개념 2. RecurDyn 과 Co-simulation 이가능한분야별소프트웨어 Dynamics과 Control 1) RecurDyn

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

동위원소검사학 강의11

동위원소검사학 강의11 동위원소검사학강의 10 Tumor marker and Cancer 1. AFP (Alpha feto protein) 1). 개요 1956년 Bergstrand 와 Czar는전기영동을이용하여 fetal serum 내 protein 중 α-1 region에존재하는 AFP(alpha-fetoprotein) 의존재를처음으로밝혀냈으며그후 1964년 Tatarinov는

More information

제98회 공동 건강교실 - 2005 한국인의 암 - 부인암의 예방과 치료 2005. 4.20 배 덕 수 성균관대 의대 교수 / 삼성서울병원 산부인과 김 병 기 성균관대 의대 교수 / 삼성서울병원 산부인과 목 차 자궁경부암의 예방과 치료 (강연 : 배덕수( 裵 悳 秀 ) 삼성서울병원 산부인과 교수) Ⅰ. 자궁경부암의 소개 Ⅱ. 자궁경부암의 원인 Ⅲ. 자궁경부암의

More information

化學科

化學科 Department of Life Sciences 1 2 3 학과명 전공분야 생명과학세미나 1, 2 생명과학세미나 3, 4 생명과학최신동향 1, 2 과목명학점 ( 시간 ) 코드이수구분 각 1(1) 각 1(1) 각 1(1) LIS901, 902 LIS903, 904 LIS911, 912 기초공통기초공통기초공통 생명과학과 생화학 생화학 1, 2( 영강 ) 고급생화학

More information

특허청구의 범위 청구항 1 뉴클레오사이드, 뉴클레오사이드 역전사효소 억제제, 비-뉴클레오사이드 역전사효소 억제제, 프로테아제 억제제, 아만타딘, 리만타딘, 자나미비르 및 오셀타미비르로 이루어진 그룹 중에서 선택된 항-바이러스제에 작 동적으로 부착된 아미노인지질에 결합하

특허청구의 범위 청구항 1 뉴클레오사이드, 뉴클레오사이드 역전사효소 억제제, 비-뉴클레오사이드 역전사효소 억제제, 프로테아제 억제제, 아만타딘, 리만타딘, 자나미비르 및 오셀타미비르로 이루어진 그룹 중에서 선택된 항-바이러스제에 작 동적으로 부착된 아미노인지질에 결합하 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) A61K 39/395 (2006.01) A61K 39/42 (2006.01) A61K 38/17 (2006.01) (21) 출원번호 10-2005-7000602 (22) 출원일자(국제출원일자) 2003년07월15일 심사청구일자 2008년07월07일 (85) 번역문제출일자 2005년01월12일

More information

wtu05_ÃÖÁ¾

wtu05_ÃÖÁ¾ 한 눈에 보는 이달의 주요 글로벌 IT 트렌드 IDG World Tech Update May C o n t e n t s Cover Story 아이패드, 태블릿 컴퓨팅 시대를 열다 Monthly News Brief 이달의 주요 글로벌 IT 뉴스 IDG Insight 개발자 관점에서 본 윈도우 폰 7 vs. 아이폰 클라우드 컴퓨팅, 불만 검증 단계 돌입 기업의

More information

Microsoft PowerPoint - 27.pptx

Microsoft PowerPoint - 27.pptx 이산수학 () n-항관계 (n-ary Relations) 2011년봄학기 강원대학교컴퓨터과학전공문양세 n-ary Relations (n-항관계 ) An n-ary relation R on sets A 1,,A n, written R:A 1,,A n, is a subset R A 1 A n. (A 1,,A n 에대한 n- 항관계 R 은 A 1 A n 의부분집합이다.)

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) A61K 31/519 (2006.01) A61K 31/4162 (2006.01) A61P 19/00 (2006.01) A61P 19/10 (2006.01) (21) 출원번호 10-2013-0039066 (22) 출원일자 2013년04월10일 심사청구일자 2013년04월10일

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 A1100-0801-2739 부처명 지식경제부 연구관리전문기관 연구사업명 IT핵심기술개발 연구과제명 융합형 포털서비스를 위한 이용자 참여형 방송기술개발 기여율 주관기관 전자부품연구원 연구기간 2008년 03월 01일 ~ 2

이 발명을 지원한 국가연구개발사업 과제고유번호 A1100-0801-2739 부처명 지식경제부 연구관리전문기관 연구사업명 IT핵심기술개발 연구과제명 융합형 포털서비스를 위한 이용자 참여형 방송기술개발 기여율 주관기관 전자부품연구원 연구기간 2008년 03월 01일 ~ 2 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) G06Q 30/00 (2006.01) G06Q 50/00 (2006.01) (21) 출원번호 10-2008-0133476 (22) 출원일자 2008년12월24일 심사청구일자 2008년12월24일 (65) 공개번호 10-2010-0074918 (43) 공개일자 2010년07월02일

More information

Pierce-Plus-Alpha.pdf

Pierce-Plus-Alpha.pdf Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies

More information

권유진

권유진 Malignant Peripheral Nerve Sheath Tumor of the Pancreas: A Case Report Malignant peripheral nerve sheath tumor (MPNST) is rare, soft tissue, spindle cell sarcoma of an ectomesenchymal origin. MPNSTs frequently

More information

<30322EBFC0BCF6BFB52E687770>

<30322EBFC0BCF6BFB52E687770> 성염색체 이상의 산전 상담 성균관대학교 의과대학 삼성서울병원 산부인과 오 수 영 Soo-Young Oh, M.D., Ph.D. Department of Obstetrics and Gynecology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea 1서 성염색체이상은

More information

(72) 발명자 정종수 서울특별시 서대문구 모래내로 319, 101동 405호 (홍은동, 진흥아파트) 김정환 서울특별시 구로구 구로동로21길 7 (구로동) - 2 -

(72) 발명자 정종수 서울특별시 서대문구 모래내로 319, 101동 405호 (홍은동, 진흥아파트) 김정환 서울특별시 구로구 구로동로21길 7 (구로동) - 2 - (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) B01J 23/34 (2006.01) B01J 37/02 (2006.01) B01J 37/08 (2006.01) B01D 53/86 (2006.01) (21) 출원번호 10-2010-0098306 (22) 출원일자 2010년10월08일 심사청구일자 2010년10월08일

More information

C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 최근히트상품 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략

C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 최근히트상품 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략 Global Market Report 16-035 2016 브라질소비시장, 이런상품을주목하라! C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 4 5 1. 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 11 20 1. 최근히트상품 2. 2016 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략 27 30

More information

Custom sirna Genepharma 는 ISO9000 품질경영시스템인증을획득하여 high quality, high purity 의 custom sirna 를생산, 제공해드립니다. 기본제공되는 duplex type 은 HPLC 정제로 unpaired single

Custom sirna Genepharma 는 ISO9000 품질경영시스템인증을획득하여 high quality, high purity 의 custom sirna 를생산, 제공해드립니다. 기본제공되는 duplex type 은 HPLC 정제로 unpaired single 2016 GenePharma RNAi Solution GenePharma는 RNAi 전문 기업으로 고효율, 고순도의 sirna, mirna mimics, mirna inhibitor, shrna plasmid를 최적의 가격으로 제공해드립니다. 코스모진텍은 국내 단독 대리점으로 전제품에 대한 상담, 견적, 발주를 진행합니다. 또한, 온라인 주문(www.cosmogenetech.com)으로

More information

Windows Server 2012

Windows Server  2012 Windows Server 2012 Shared Nothing Live Migration Shared Nothing Live Migration 은 SMB Live Migration 방식과다른점은 VM 데이터파일의위치입니다. Shared Nothing Live Migration 방식은 Hyper-V 호스트의로컬디스크에 VM 데이터파일이위치합니다. 반면에, SMB

More information

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï 실과056-094 2013.1.9 7:22 PM 페이지67 MDPREP_RipControl 2007 개정 5학년 검정 지도서 각론 알짜 정리 67 영양소 힘을 내는 일(탄수화물/지방/단백질) 몸의 조직 구성(지방/단백질/무기질/물) 몸의 기능 조절(단백질/무기질/비타민/물) 식품 구성 자전거의 식품과 영양소 식품군 곡류 탄수화물 우리가 활동하는데 필요한 힘을

More information

<30352EB0A3BAB4B8AE2E687770>

<30352EB0A3BAB4B8AE2E687770> The Korean Journal of Hepatology 2008 ; 14 : 532-536 DOI: 10.3350/kjhep.2008.14.4.532 이번 호의 간 병리(36) 점액과다분비 담관세포암종 순천향대학교병원 병리과 진윤미 진소영 bstract Mucin hypersecreting cholangiocarcinoma Yoon-Mi Jeen, M.D.,

More information

서 인코딩한 데이터를 무선으로 송신하기 위한 무선 송신 수단; 및 통화중 상기 입력 수단으로부터의 음원 데이터 전송신 호에 따라 상기 저장 수단에 저장되어 있는 해당 음원 데이터를 상기 디코딩 수단에 의해 디코딩하고, 상기 디코딩한 음원 데이터와 상기 입력 수단을 통해

서 인코딩한 데이터를 무선으로 송신하기 위한 무선 송신 수단; 및 통화중 상기 입력 수단으로부터의 음원 데이터 전송신 호에 따라 상기 저장 수단에 저장되어 있는 해당 음원 데이터를 상기 디코딩 수단에 의해 디코딩하고, 상기 디코딩한 음원 데이터와 상기 입력 수단을 통해 (51) Int. Cl. H04B 1/40 (2006.01) (19)대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 (11) 등록번호 (24) 등록일자 2006년11월23일 10-0646983 2006년11월09일 (21) 출원번호 10-2004-0053063 (65) 공개번호 10-2006-0004082 (22) 출원일자 2004년07월08일

More information

exp

exp exp exp exp exp exp exp exp exp exp exp exp log 第 卷 第 號 39 4 2011 4 투영법을 이용한 터빈 블레이드의 크리프 특성 분석 329 성을 평가하였다 이를 위해 결정계수값인 값 을 비교하였으며 크리프 시험 결과를 곡선 접합 한 결과와 비선형 최소자승법으로 예측한 결과 사 이 결정계수간 정도의 오차가 발생하였고

More information

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770>

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770> 고1 융합 과학 2011년도 1학기 중간고사 대비 다음 글을 읽고 물음에 답하시오. 1 빅뱅 우주론에서 수소와 헬륨 의 형성에 대한 설명으로 옳은 것을 보기에서 모두 고른 것은? 4 서술형 다음 그림은 수소와 헬륨의 동위 원 소의 을 모형으로 나타낸 것이. 우주에서 생성된 수소와 헬륨 의 질량비 는 약 3:1 이. (+)전하를 띠는 양성자와 전기적 중성인 중성자

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

(72) 발명자 박병희 충청북도 청원군 부용면 부강행산로 232, 구 183-1 바자지 바랏 대전시 유성구 신성동 19 박병기 대전시 유성구 어은동 한빛A 106-302 이 발명을 지원한 국가연구개발사업 과제고유번호 10033744201113100600011645100

(72) 발명자 박병희 충청북도 청원군 부용면 부강행산로 232, 구 183-1 바자지 바랏 대전시 유성구 신성동 19 박병기 대전시 유성구 어은동 한빛A 106-302 이 발명을 지원한 국가연구개발사업 과제고유번호 10033744201113100600011645100 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2013년08월12일 (11) 등록번호 10-1295372 (24) 등록일자 2013년08월05일 (51) 국제특허분류(Int. Cl.) D01F 8/12 (2006.01) D01D 5/00 (2006.01) D04H 1/42 (2006.01) (73) 특허권자 한국화학연구원 대전광역시

More information

* Factory class for query and DML clause creation * tiwe * */ public class JPAQueryFactory implements JPQLQueryFactory private f

* Factory class for query and DML clause creation * tiwe * */ public class JPAQueryFactory implements JPQLQueryFactory private f JPA 에서 QueryDSL 사용하기위해 JPAQuery 인스턴스생성방법 http://ojc.asia, http://ojcedu.com 1. JPAQuery 를직접생성하기 JPAQuery 인스턴스생성하기 QueryDSL의 JPAQuery API를사용하려면 JPAQuery 인스턴스를생성하면된다. // entitymanager는 JPA의 EntityManage

More information

gnu-lee-oop-kor-lec06-3-chap7

gnu-lee-oop-kor-lec06-3-chap7 어서와 Java 는처음이지! 제 7 장상속 Super 키워드 상속과생성자 상속과다형성 서브클래스의객체가생성될때, 서브클래스의생성자만호출될까? 아니면수퍼클래스의생성자도호출되는가? class Base{ public Base(String msg) { System.out.println("Base() 생성자 "); ; class Derived extends Base

More information

Microsoft Word - FunctionCall

Microsoft Word - FunctionCall Function all Mechanism /* Simple Program */ #define get_int() IN KEYOARD #define put_int(val) LD A val \ OUT MONITOR int add_two(int a, int b) { int tmp; tmp = a+b; return tmp; } local auto variable stack

More information

歯19-손태중.PDF

歯19-손태중.PDF 7 1 2001 ; 115-130 (11), WHO The Morphology of Liver through the Electron Microscope (11) Tae Joong Sohn, M.D., Ph.D. Emeritus Prof essor, School of Medicine, Kyungpook National University, Head, WHO Collaborating

More information

6. Separate HDD by pulling in the arrow direction. * Cautions Avoid lifting HDD excessively, because Connector can be damaged ODD Remove

6. Separate HDD by pulling in the arrow direction. * Cautions Avoid lifting HDD excessively, because Connector can be damaged ODD Remove 3-1. Disassembly and Reassembly R510 [Caution] Attention to red sentence. 2 2 1. Before disassembling, the AC adaptor and Battery must be separated. 2. AS mark No.1/2 put KNOB-Battery to end of each side,

More information

질병 1 유병자 2 20 ~ 30대 환자 3 발생률 4 남성의 발생률 5 소아 발생률 6 환자 5년 생존율 7 고혈압 환자 8 뇌경색증 진료 인원 9 치매 증가율 치료비 1 소아 진료비 2 노인 월평균 진료비 사망 1 폐 사망률 2 3대 사망원인 3 여성 10대 사인

질병 1 유병자 2 20 ~ 30대 환자 3 발생률 4 남성의 발생률 5 소아 발생률 6 환자 5년 생존율 7 고혈압 환자 8 뇌경색증 진료 인원 9 치매 증가율 치료비 1 소아 진료비 2 노인 월평균 진료비 사망 1 폐 사망률 2 3대 사망원인 3 여성 10대 사인 숫자로 보는 질병과 건강 질병 1 유병자 2 20 ~ 30대 환자 3 발생률 4 남성의 발생률 5 소아 발생률 6 환자 5년 생존율 7 고혈압 환자 8 뇌경색증 진료 인원 9 치매 증가율 치료비 1 소아 진료비 2 노인 월평균 진료비 사망 1 폐 사망률 2 3대 사망원인 3 여성 10대 사인 4 연령별 사망원인 5 남성의 자살률 6 환자 보호자 우울증 10

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

본 발명은 중공코어 프리캐스트 슬래브 및 그 시공방법에 관한 것으로, 자세하게는 중공코어로 형성된 프리캐스트 슬래브 에 온돌을 일체로 구성한 슬래브 구조 및 그 시공방법에 관한 것이다. 이를 위한 온돌 일체형 중공코어 프리캐스트 슬래브는, 공장에서 제작되는 중공코어 프

본 발명은 중공코어 프리캐스트 슬래브 및 그 시공방법에 관한 것으로, 자세하게는 중공코어로 형성된 프리캐스트 슬래브 에 온돌을 일체로 구성한 슬래브 구조 및 그 시공방법에 관한 것이다. 이를 위한 온돌 일체형 중공코어 프리캐스트 슬래브는, 공장에서 제작되는 중공코어 프 (51) Int. Cl. E04B 5/32 (2006.01) (19)대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 (11) 등록번호 (24) 등록일자 2007년03월12일 10-0693122 2007년03월05일 (21) 출원번호 10-2006-0048965 (65) 공개번호 (22) 출원일자 2006년05월30일 (43) 공개일자 심사청구일자

More information

정신분석학자 나게라도 고갱의 의자 가 양성적 갈등 을 드러내는 그림이라고 보았다. 그는 고흐 가 화려한 양탄자를 깔고 열 두 송이의 해바라기를 그려 벽에 거는 등 고갱이 머물 방을 정성스럽게 꾸몄 던 사실에서 고흐의 심리 속에 감추어진 여성성을 읽어 냈다. 나게라는 고

정신분석학자 나게라도 고갱의 의자 가 양성적 갈등 을 드러내는 그림이라고 보았다. 그는 고흐 가 화려한 양탄자를 깔고 열 두 송이의 해바라기를 그려 벽에 거는 등 고갱이 머물 방을 정성스럽게 꾸몄 던 사실에서 고흐의 심리 속에 감추어진 여성성을 읽어 냈다. 나게라는 고 2012 수능대비 추경문 선생의 [ 인터넷 수능 비문학] 언어 특강! [50강] EBS 연계 활용법[10]- 적용(3) [ 2011 EBS 인터넷수능 비문학 142쪽 ] [1~3] 다음 글을 읽고 물음에 답하시오. 자화상은 화가들이 자신을 그린 그림이다. 흔히 자화상이라고 하면 귀를 자른 고흐의 자화상과 같이 강 렬해서 한번 보면 절대 잊기 어려운 그림들을

More information

튦 NO. 2155 Since 1969 2016. 06. 15 www.catholicfound.org www.cmc.or.kr blog.naver.com/cmc_health twitter.com/cmcmedicalnews www.facebook.com/cmcmedicalnews 02 CATHOLIC MEDICAL TIMES Vol.2155 2016.06.15 03

More information

(019-021)......-..............

(019-021)......-.............. 창밖의 BT 한국 BT맨의 외국사는 이야기 연변에서 온 편지 정규재 BT 북칼럼 바이오분야 신간소개 BT에세이 연구란 무엇인가? 유영제 연금술사 전영중 연탄가스와 고스톱 김은기 나의 묻지-마-벤처 장호남 법에서 바라본 BT EPO관련 Amgen의 특허전략 이처영 생물공학 PUZZLE 만화로 보는 BT이야기 최달수 영화속 BT 스토리 버블보이 박태현 생활속 BT

More information

<B1DDBFACC5ACB8AEB4D02DC6EDC1FD28C3D6C1BE292DB1B3C1A4BFCFB7E128BABCB5E5BBE8C1A6292E687770> 2013 2013년 보건소 금연클리닉 상담매뉴얼 보건소 금연클리닉 / 7 Part 1 제1부 보건소 금연클리닉 개요 9 1장 보건소 금연클리닉의 개요 9 1. 보건소 금연클리닉 추진개요 9 2. 지역사회 금연사업 추진체계 10 제2부 보건소 금연클리닉 상담개요 12 1장 금연상담 개요 12 1. 금연상담 제공 12 2. 금연성공 평가 13 2장 금연상담 기록

More information

재생의료용어집 발행인 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 발행처 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 400-712 인천광역시 중구 서해대로 366 정석빌딩 C동 806호 Tel. 032-890-0998 www.gsrac.org 편집 감수 _ 아주대학교

재생의료용어집 발행인 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 발행처 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 400-712 인천광역시 중구 서해대로 366 정석빌딩 C동 806호 Tel. 032-890-0998 www.gsrac.org 편집 감수 _ 아주대학교 재생의료용어집 재생의료용어집 발행인 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 발행처 _ 글로벌 줄기세포/재생의료 연구개발촉진센터 400-712 인천광역시 중구 서해대로 366 정석빌딩 C동 806호 Tel. 032-890-0998 www.gsrac.org 편집 감수 _ 아주대학교 이해방 교수 아주대학교 민병현 교수 파미셀 주완석 이사 한국 조직공학 재생의학회

More information

04 Çмú_±â¼ú±â»ç

04 Çмú_±â¼ú±â»ç 42 s p x f p (x) f (x) VOL. 46 NO. 12 2013. 12 43 p j (x) r j n c f max f min v max, j j c j (x) j f (x) v j (x) f (x) v(x) f d (x) f (x) f (x) v(x) v(x) r f 44 r f X(x) Y (x) (x, y) (x, y) f (x, y) VOL.

More information

- 2 -

- 2 - 보도자료 미래부 - 부산시, 아시아디지털방송아카데미 ( 가칭 ) 설립공동협력키로 - 부산콘텐츠마켓 과함께아시아공동체의방송발전에크게기여할것 - - 1 - - 2 - - 3 - [ 붙임 1] 아시아디지털방송아카데미설립 MOU 체결 ( 안 ) ㆍ 2 7 6 10 5-4 - 참고 1 상호협력양해각서 (MOU) ( 안 ) 아시아디지털방송아카데미설립 운영을위한 상호협력양해각서

More information

특허청구의 범위 청구항 1 고유한 USB-ID를 가지며, 강제 포맷이나 프로그램 삭제가 불가능한 CD영역과 데이터의 읽기, 쓰기가 가능한 일 반영역으로 분할되어 있고 상기 CD영역에 임산부 도우미 프로그램이 임산부 PC(200)에 연결되면 자동 설치 및 실행되게 탑재된

특허청구의 범위 청구항 1 고유한 USB-ID를 가지며, 강제 포맷이나 프로그램 삭제가 불가능한 CD영역과 데이터의 읽기, 쓰기가 가능한 일 반영역으로 분할되어 있고 상기 CD영역에 임산부 도우미 프로그램이 임산부 PC(200)에 연결되면 자동 설치 및 실행되게 탑재된 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2010-0042502 (43) 공개일자 2010년04월26일 (51) Int. Cl. G06Q 50/00 (2006.01) (21) 출원번호 10-2008-0101675 (22) 출원일자 2008년10월16일 심사청구일자 전체 청구항 수 : 총 13 항 2008년10월16일 (71)

More information

명세서청구범위청구항 1 갠트리의헤드로부터방사선을조사하는선형가속기에사용되고, 상기헤드에설치되고, 방사선이조사되는환자의치료중심을향해레이저를쏘고환자의체표면에서반사된레이저를감지하여환자의체표면까지의거리를측정하는레이저거리측정기 ; 상기레이저거리측정기의데이터를수신하여 SSD(sou

명세서청구범위청구항 1 갠트리의헤드로부터방사선을조사하는선형가속기에사용되고, 상기헤드에설치되고, 방사선이조사되는환자의치료중심을향해레이저를쏘고환자의체표면에서반사된레이저를감지하여환자의체표면까지의거리를측정하는레이저거리측정기 ; 상기레이저거리측정기의데이터를수신하여 SSD(sou (19) 대한민국특허청 (KR) (12) 등록특허공보 (B1) (51) 국제특허분류 (Int. Cl.) A61N 5/10 (2006.01) (21) 출원번호 10-2014-0107105 (22) 출원일자 2014 년 08 월 18 일 심사청구일자 (56) 선행기술조사문헌 JP2012024909 A* JP2012501792 A* US20100280374 A1

More information

Microsoft PowerPoint - ch09 - 연결형리스트, Stack, Queue와 응용 pm0100

Microsoft PowerPoint - ch09 - 연결형리스트, Stack, Queue와 응용 pm0100 2015-1 프로그래밍언어 9. 연결형리스트, Stack, Queue 2015 년 5 월 4 일 교수김영탁 영남대학교공과대학정보통신공학과 (Tel : +82-53-810-2497; Fax : +82-53-810-4742 http://antl.yu.ac.kr/; E-mail : ytkim@yu.ac.kr) 연결리스트 (Linked List) 연결리스트연산 Stack

More information

120~151역사지도서3

120~151역사지도서3 III 배운내용 단원내용 배울내용 120 121 1 2 122 3 4 123 5 6 124 7 8 9 125 1 헌병경찰을앞세운무단통치를실시하다 126 1. 2. 127 문화통치를내세워우리민족을분열시키다 1920 년대일제가실시한문화 통치의본질은무엇일까? ( 백개 ) ( 천명 ) 30 20 25 15 20 15 10 10 5 5 0 0 1918 1920 ( 년

More information

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

*2007BT..........

*2007BT.......... BT 정보 교육 최신 BT 공개특허 이처영 Experimental Biology 2007 Meeting을 다녀와서 전희진 제4회 ASM Conference on Biofilm 참관기 김재은 BT News 정보 교육 최신 BT 공개특허 5T국제특허법률사무소 이처영박사 1. 미생물 발명의 명칭 출원인 발명자 공개번호 숙신산 생산이 증가된 돌연변이 대장균 균주 라이스

More information

[NO_11] 의과대학 소식지_OK(P)

[NO_11] 의과대학 소식지_OK(P) 진 의학 지식과 매칭이 되어, 인류의 의학지식의 수준을 높 여가는 것이다. 하지만 딥러닝은 블랙박스와 같은 속성을 가지고 있어서, 우리는 단지 결과만을 알 수 있기 때문에 이런 식의 의학지 식의 확장으로 이어지기는 힘들 수 있다는 것을 의미한다. 이것은 실제로 의학에서는 인공지능을 사용하게 될 때 여러 가지 문제를 만들 수 있다. 뿐만 아니라, 인간이 이해

More information

TGDPX white paper

TGDPX white paper White Paper DDoS 공격 대응의 새로운 패러다임 AhnLab TrusGuard DPX Revision Version: AhnLab TrusGuard DPX White Paper ver. 1.0 Release Date: April, 2010 AhnLab, Inc. 6th Fl., CCMM Bldg. 12 Yeouido-dong, Yeongdeungpo-gu,

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Korean Society for Biotechnology and Bioengineering Journal 31(1): 52-57 (2016) http://dx.doi.org/10.7841/ksbbj.2016.31.1.52 ISSN 1225-7117 / eissn 2288-8268 연구논문 돌연변이 p53 단백질의 Silencing 에의한사람유방암세포의 in

More information

Microsoft Word - im_1001.doc

Microsoft Word - im_1001.doc 1 암 정복의 현주소 김창민 국립암센터 To whom correspondence should be addressed. E-mail cmkim53@ncc.re.kr 목 차 1. 암의 기원과 특성 1-1. 암의 기원 1-2. 암세포의 생물학적 특성 1-3. 다단계발암론 2. 암 발생의 원인과 현황 2-1. 암 발생 원인 2-2. 암 발생 현황 3. 암 진단과 치료

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

(72) 발명자 이대훈 경기도 성남시 분당구 정자동 파크뷰 611동 901호 박준호 경기도 안산시 상록구 사1동 1323-14 - 2 -

(72) 발명자 이대훈 경기도 성남시 분당구 정자동 파크뷰 611동 901호 박준호 경기도 안산시 상록구 사1동 1323-14 - 2 - (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) G01N 3/30 (2006.01) (21) 출원번호 10-2008-0090352 (22) 출원일자 2008년09월12일 심사청구일자 2008년09월12일 (65) 공개번호 10-2010-0031318 (43) 공개일자 2010년03월22일 (56) 선행기술조사문헌 KR200430499

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

Minimally invasive parathyroidectomy

Minimally invasive parathyroidectomy 2013. 2. 2 대한간암연구학회 7차 심포지움 및 학술대회 Indication and Clinical Outcomes of Metachronous HCC Metastasectomy Shin Hwang Division of Liver Transplantation and Hepatobiliary Surgery, Department of Surgery, Asan

More information

특허청구의 범위 청구항 1 소스 컴퓨팅 디바이스로부터 복수의 컴퓨팅 디바이스들 중 적어도 하나의 컴퓨팅 디바이스로의 무선 액세스 포 인트를 통한 데이터 송신들에 대한 (i) 현재 데이터 레이트 및 (ii) 최고 데이터 레이트를 구축하는 단계; 상기 복수의 컴퓨팅 디바이

특허청구의 범위 청구항 1 소스 컴퓨팅 디바이스로부터 복수의 컴퓨팅 디바이스들 중 적어도 하나의 컴퓨팅 디바이스로의 무선 액세스 포 인트를 통한 데이터 송신들에 대한 (i) 현재 데이터 레이트 및 (ii) 최고 데이터 레이트를 구축하는 단계; 상기 복수의 컴퓨팅 디바이 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2013년11월27일 (11) 등록번호 10-1333908 (24) 등록일자 2013년11월21일 (51) 국제특허분류(Int. Cl.) H04W 28/10 (2009.01) H04W 28/22 (2009.01) (21) 출원번호 10-2011-7031262 (22) 출원일자(국제)

More information

특허청구의 범위 청구항 1 삭제 청구항 2 삭제 청구항 3 하기 (A), (B) 및 (E)를 함유하는 세정제 조성물로서, (A)와 (B)의 배합 비율이 (A)/(B) = 99/1~70/30(중량% 비)이며, 또한, 이 조성물 중의 전체 계면활성제 성분 중에서 (A)의

특허청구의 범위 청구항 1 삭제 청구항 2 삭제 청구항 3 하기 (A), (B) 및 (E)를 함유하는 세정제 조성물로서, (A)와 (B)의 배합 비율이 (A)/(B) = 99/1~70/30(중량% 비)이며, 또한, 이 조성물 중의 전체 계면활성제 성분 중에서 (A)의 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) A61K 8/46 (2006.01) A61K 8/36 (2006.01) A61Q 19/10 (2006.01) (21) 출원번호 10-2005-7021010 (22) 출원일자(국제) 2004년04월28일 심사청구일자 2008년12월26일 (85) 번역문제출일자 2005년11월04일

More information

특허청구의 범위 청구항 1 커넥터 인서트(connector insert)와 커넥터 리셉터클(connector receptacle) 사이에 접속을 형성하는 방법으로 서, 복수의 리셉터클 패드 사이의 접속들을 식별하는 단계; 상기 복수의 리셉터클 패드 사이의 접속들의 식별

특허청구의 범위 청구항 1 커넥터 인서트(connector insert)와 커넥터 리셉터클(connector receptacle) 사이에 접속을 형성하는 방법으로 서, 복수의 리셉터클 패드 사이의 접속들을 식별하는 단계; 상기 복수의 리셉터클 패드 사이의 접속들의 식별 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) G06F 13/40 (2006.01) (21) 출원번호 10-2013-7030838 (22) 출원일자(국제) 2012년04월24일 심사청구일자 2013년11월20일 (85) 번역문제출일자 2013년11월20일 (86) 국제출원번호 PCT/US2012/034822

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

20 A. Mechanism 1) Base-catalyzed aldol reaction a 3 2 new bond 3-ydroxybutanal ( -hydroxyaldehyde, racemic mixture) 2 + a + pk a 20 arbanion En

20 A. Mechanism 1) Base-catalyzed aldol reaction a 3 2 new bond 3-ydroxybutanal ( -hydroxyaldehyde, racemic mixture) 2 + a + pk a 20 arbanion En 19 hap 19 : Enolate Anions and Enamines 19.1 Formation and eactions of Enolate Anions : An verview α- of aldehydes or ketones : acidic (pk a = 20) 2 : Alkylation by S2 substitution Br a + 2 + a + 2 arbanion

More information

untitled

untitled FOR YOUR PREMIUM LIFESTYLE CONTENTS 2014 AUTUMN FOR YOUR PREMIUM LIFESTYLE One for One [ 2074 ] 10-0394K Gift Set Business Support Tools sabn Telecom Amway TV s BEST OF NATURE. BEST OF

More information

소개 Mac OS X (10.9, 10.10, 10.11, 10.12) 와 OKI 프린터호환성 Mac OS X 를사용하는 PC 에 OKI 프린터및복합기 (MFP) 제품을연결하여사용할때, 최고의성능을발휘할수있도록하는것이 OKI 의목 표입니다. 아래의문서는 OKI 프린터및

소개 Mac OS X (10.9, 10.10, 10.11, 10.12) 와 OKI 프린터호환성 Mac OS X 를사용하는 PC 에 OKI 프린터및복합기 (MFP) 제품을연결하여사용할때, 최고의성능을발휘할수있도록하는것이 OKI 의목 표입니다. 아래의문서는 OKI 프린터및 OKI 프린터호환성 Mac OS X 와호환성 Ma(10.9) Ma(10.10) Ma(10.11) Ma(10.12) 버전 : 7.8 날짜 : 2017-05-10 소개 Mac OS X (10.9, 10.10, 10.11, 10.12) 와 OKI 프린터호환성 Mac OS X 를사용하는 PC 에 OKI 프린터및복합기 (MFP) 제품을연결하여사용할때, 최고의성능을발휘할수있도록하는것이

More information

01 08 01 유전자가위 기술 소개 및 활용 유전자가위 기술은 2011년과 2013년에 각각 권위 있는 학술지 Nature methods와 기초과학연구원, 유전체교정연구단 김은지, 김진수 Science에 의해 올해의 실험기법(Method of the Year), 올해

01 08 01 유전자가위 기술 소개 및 활용 유전자가위 기술은 2011년과 2013년에 각각 권위 있는 학술지 Nature methods와 기초과학연구원, 유전체교정연구단 김은지, 김진수 Science에 의해 올해의 실험기법(Method of the Year), 올해 06 01 02 03 밀, 쌀, 옥수수 다음으로 많이 소비되는 식량은 바나나입니다. 다른 농산물과는 달리 식용바나나는 씨가 없어 꺾꽂이 방식으로 재배하고 있기 때문에 세계적으로 같은 품종의 바나나가 재배되어 소비되고 있습니다. 그러나 현재 전 세계 바나나 수출 비중의 약 96%를 차지하는 품종인 캐번디시(Cavendish) 품종이 치명적인 곰팡이균에 감염되어

More information

untitled

untitled FOR YOUR PREMIUM LIFESTYLE WINTER 2013 20 FOR YOUR PREMIUM LIFESTYLE 2013 Winter CONTENTS Wellness Beauty Living CONTENTS 2013 Winter FOR YOUR PREMIUM LIFESTYLE One for One Hyper Store [ 2074 ] 10-0394K

More information

Wnt signaling 과 adipogenesis

Wnt signaling 과 adipogenesis Wnt signaling 과 adipogenesis 지방 조직(adipose tissue)을 이루는 지방세포(adipocyte)는 지방(fat)을 포함하고 있는 세 포로써 체내 지방 대사를 조절 하는 것 뿐 아니라 여러가지 분비물질들을 통하여 식욕 조절 등의 기능을 하는 것이 잘 알려져 있으며 당 대사에도 관여하여 전반적인 에너지 항상성 유 지를 담당하고 또한

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월

이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173

More information

<31312EC1DF2DBBFDB9B02E687770>

<31312EC1DF2DBBFDB9B02E687770> 중 학 교 생 물 1 머리글 우리나라에 영재교육이 본격적으로 도입되어 시행된 것은 채 10년도 되지 않는다. 그 동안 우리 는 영재교육의 양적 확대에 주력해왔고, 이제는 어느 정도 정착 단계에 도달한 것으로 보인다. 그 러나 영재교육의 완전한 정착까지는 해결해야할 수많은 난제들이 남아있다. 그 중에 하나는 우리 가 과연 제대로 영재교육을 하고 있는가? 에

More information

Korean J Otorhinolaryngol-Head Neck Surg 2016;59(3):233-7 Fig. 1. Representative imaging of right metastatic lymphadenopathy in cancer of unknown prim

Korean J Otorhinolaryngol-Head Neck Surg 2016;59(3):233-7 Fig. 1. Representative imaging of right metastatic lymphadenopathy in cancer of unknown prim online ML Comm Case Report Korean J Otorhinolaryngol-Head Neck Surg 2016;59(3):233-7 / pissn 2092-5859 / eissn 2092-6529 http://dx.doi.org/10.3342/kjorl-hns.2016.59.3.233 Case of Metachronous Human Papilloma

More information