DMD 보인자진단을위한다형분석 237 위한계치보다높게나타난다. 그러나 CPK치는채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복될수있다. 따라서 CPK 수치는보인자여부에대한상대적가능성만을제공한다 [2, 3]. DNA 분석법에의한보인자진단은 cdna

Save this PDF as:

Size: px
Start display at page:

Download "DMD 보인자진단을위한다형분석 237 위한계치보다높게나타난다. 그러나 CPK치는채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복될수있다. 따라서 CPK 수치는보인자여부에대한상대적가능성만을제공한다 [2, 3]. DNA 분석법에의한보인자진단은 cdna"


1 대한임상병리학회지 : 제 20 권제 2 호 2000 Korean J Clin Pathol 2000; 20: 분자유전학 듀센형근이영양증보인자진단을위한유전자다형분석 최종락 송경순 박숙자 * 연세대학교의과대학임상병리과학교실, 부산일신기독병원 * Genetic Polymorphism Analysis for the Detection of Duchenne Muscular Dystrohpy Carriers Jong Rak Choi, M.D., Kyung Soon Song, M.D., and Sook Ja Park, M.D.* Department of Clinical Pathology, College of Medicine, Yonsei University, Seoul, Department of Clinical Pathology, Ilsin Christian Hospital, Pusan, Korea* Background : Detection of Duchenne muscular dystrophy carriers can be made by serum creatine phosphokinase and molecular biologic methods such as restriction fragment length polymorphisms (RFLPs) and gene dosage analysis for deleted exons. We applied rapid and simple PCR- RFLP method to find informative markers for carrier diagnosis. Methods : 100 unrelated normal females (200 X-chromosomes) are included in this study. DNA isolated from their white blood cells was used to perform PCR-RFLP. Polymorphisms for pert series (87-8, 87-15, 84) and nearby exon 48 are detected by TaqI, BamHI, Xmnl, MaeIII, and MseI restriction sites, respectively. Allelic frequencies and heterozygosity rates were calculated to assess the diagnostic usefulness. Results : The allelic (+/-) frequencies of pert 87-8/TaqI, pert 87-15/BamHI, pert 87-15/XmnI, pert 84/MaeIII, and exon 48/MseI restriction sites were 0.36/0.64, 0.61/0.39, 0.43/0.57, 0.59/0.41, 0.84/0.16, respectively. The calculated/observed heterozygosity rates of those polymorphic sites were 46/39, 48/52, 49/55, 48/49, and 27/28, respectively. Conclusions : Heterozygosity rates of pert series and pert 84 were higher than those of pert 87-8 and exon 48 in Korean population. Three PCR-RFLPs (pert 87-15/XmnI, pert 87-15/BamHI, pert 84) were considered to be clinically useful for the diagnosis of carrier and the secondary use of pert 87-8 and exon 48 would improve the diagnosis of carrier. (Korean J Clin Pathol 2000; 20: ) Key words : Duchenne muscular dystrophy, Carrier diagnosis, PCR, RFLP 서 론 듀센형근이영양증 (Duchenne Muscu1ar Dystrophy: DMD) 접수 : 2000 년 2 월 15 일접수번호 : KJCP1379 수정본접수 : 2000 년 3 월 7 일교신저자 : 송경순우 서울시서대문구신촌동 134 연세대학교의과대학임상병리과전화 : , Fax: * 본논문은 1999 년도보건의료기술연구개발사업연구비 (HMP-97-NM ) 의지원으로이루어졌음. 은 X 성염색체열성으로유전되는가장흔한신경근육계유전질환으로약 3,500 명의출생남아중 1명의빈도로발병된다 [1]. 그러나약 30% 에서는가족력이없는가계에서발생될수있다 [2]. 따라서근육병의보인자진단을통한산전진단은특별한치료방법이없는근육병환자개인의육체적고통은물론주변가족들의정신적, 경제적부담을줄이고사전예방으로환자의발생을줄일수있다. 그러나, 듀센형근이영양증의보인자진단은아직도여러문제점이있다. 전통적으로흔히사용되는보인자진단검사는보인자로의심되는여자의혈청내 creatine phosphokinase (CPK) 수치를측정하는것이다. 보인자의약 70-75% 에서정상인의상 236

2 DMD 보인자진단을위한다형분석 237 위한계치보다높게나타난다. 그러나 CPK치는채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복될수있다. 따라서 CPK 수치는보인자여부에대한상대적가능성만을제공한다 [2, 3]. DNA 분석법에의한보인자진단은 cdna 소식자를이용하는 Southern blot법이있다 [4-6]. 이방법은결손된 exon과결손되지않은 exon의표지강도를비교하여측정하는것인데주관적이고시간이많이소요되며재료비가많이드는단점이있다. 또한유전자결손에의한경우가아닌다른유전자결손인경우에서는진단하기어렵다. 유전자결손이아닌가계에서보인자진단은제한효소단편장다형 (restriction fragment lengh polymorphism, RFLP) 분석을통해근육병유전자형을추정할수있다. 따라서여러연구자들에의해유용한 RFLP 검색을위한 DNA 소식자 (probe) 의개발이계속되어왔고 [7-9] 그중에서도 DMD 유전자부위내에존재하여약 4-6% 의 recombination 빈도를나타내는 pert 87 시리즈 (DXS 164: 87-1, 87-8, 87-15) 의유용성에관한보고가가장많다 [10-14]. 그리고국내에서도송등에의해정상한국인에서의이형접합 (heterozygosity) 양상및대립유전자비율을조사한바있다. 그러나이검사방법도 Southern blot을시행하기때문에시간이많이소요되며재료비가많이드는단점이있다. 이에저자들은 Southern blot의단점을줄인중합효소연쇄반응 (polymerase chain reaction, PCR) 법을이용하여정상한국여성에서 pert 87 시리즈외에 pert 84와 exon 48 부위의이형접합양상및대립유전자비율을조사하여보인자진단과산전진단의토대를마련하고자하였다. 대상및방법 1. 연구대상서로혈연관계가없는정상한국인여자 ( 총 X 염색체수 : 200) 를대상으로 DMD 유전자내표지자인 pert 시리즈 (DXS164: 87-8, 87-15의 2종, 84) 및 exon 48 부위에서각제한효소 (TaqI, BamHI, XmnI, MaeIII, MseI) 를사용하여 PCR-RFLP 법 ( 중합연쇄반응제한효소단편장다형 ) 분석을실시하였으며이를통해각유전자형의대립인자빈도와이형접합률을조사하였다. L의용해액을첨가하여 vortex를사용하여잘섞은후65 수조에서 10분간가온한다. 20 L의침전용액과 70 L의 chloroform을넣은후잘섞고원심분리 (12,000 g, 10분 ) 후상층액을다른미세원심분리관에옮긴다. 옮겨진상층액에 445 L의 TE 완충액, 5 L의 glycogen과 100% ethanol 1 ml을넣고얼음에 30분간침전시킨후상층액을버리고말린후 10 L의 TE 완충액을첨가하여 pellet을용해시켜사용하였다. 2) 시발체 (primers) pert 시리즈 (DXS164: 87-8, 87-15의 2종, 84) 및 exon 48 부위에서대한중합효소연쇄반응에사용한시발체는 Table 1에있는것과같다 [15-17]. 이시발체는국내의바이오니아사로부터제조하여사용하였다. 3) 유전자증폭및제한효소반응중합효소연쇄반응혼합액은 PCR 완충액 (50 mm KCl, 2.5 mm MgCl 2, 10 mm Tris-HCl ph 8.3) 에 dntp 각 0.25 mm 씩넣고 genomic DNA 2 L, Taq DNA polymerase 1 unit (Perkin-Elmer, Foster City, CA., USA) 를넣어총용량이 20 L가되도록하였다. 이호합액을 GeneAmp PCR System 9600 (Perkin-Elmer, Foster City, CA., USA) 을이용하여 94 에서 2분간처리한후다음반응 (94 에서 10초, 62 에서 10 초, 72 에서 15초 ) 을 40회반복하고 72 에서 5분간연장처리하였다. 각유전자의증폭산물에제한효소 TaqI, BamHI, XmnI, MseI (New England Biolab Inc., Beverly, MA., USA) 과 MaeIII (Boehringer Mannheim, Manheim, Germany) 를사용하여반응시켰으며, 방법은제조사에서제공하는지침서에따라시행하였다. 4) 결과의확인제한효소로처리한 12 L의반응산물에 loading dye 2 L 를섞어 1.5% agarose gels에서전기영동하였으며 ethidium bromide로염색하여 UV transilluminator에서반응산물을확인하였다. Size marker는 100 bp ladder (Gibco, Grand Island, NY., USA) 를사용하여크기를비교하였다. 예상되는반응산물의크기는 Table 1과같다. 2. 연구방법 1) DNA 추출 EDTA 항응고제를사용한말초혈액으로부터 Easy-DNA kit (Invitrogen, Carlsbad, CA., USA) 를사용하여 DNA를추출하였다. 추출방법은대체로제조사에서제공하는지침서에따라시행하였는데요약하면다음과같다. 냉동보관된혈액을녹여원심분리후원침된혈액 100 L를미세원심분리관에넣고 50 5) 결과의판정 Table 1에서처럼제한효소에절단된크기의반응산물이보이면 +allele으로, 절단된크기의반응산물이없으면 -allele으로판정하여이형접합양상및대립유전자비율을조사하였다.

3 238 최종락 송경순 박숙자 Table 1. Charateristics of primers used in this study Marker Primers* (5-3 ) Restriction enzyme Product size(bp) Allele polymorphisms pert87-8 GTCAGTTGGTCAGTAAAAGCC CAGATCAGTCGACCAATTAAAACCACAGCAG TaqI 155 pert87-15 CTGATCAGGATCCAGTAACGGAAAGTGC CTGATGAAATAATTCTGAATAGTCACAAAAAG BamHI 226 pert87-15 GACTGGAGCAAGGGTCGCC CTGATGAACAATTTCCCTTTCATTCCAG XmnI 740 pert84 CAGGGATGCAAAGGAACTGGG CAGTTTGTTTAACAGTCACTC MaeIII 225 exon48 AAGCTTGAAGACCTTGAAGAGC CCTGAATAAAGTCTTCCTTACCACAC MseI *reference 15, 16, 17. 결 과 1. pert 87-8/TaqI RFLP 분석결과 서로혈연관계가없는정상한국인여자 X 염색체 200개를대상으로하여 pert 87-8/TaqI RFLP 분석을한결과공통절편 (constant band) 인 10 bp 절편 ( 전기영동결과에나타나지않음 ) 과함께 74/71 bp(p) 와 145 bp(q) 절편들이함께관찰되었으며, 각각 0.36와 0.64의대립유전자빈도를나타내었다. 실제대상에포함된정상한국인여자 100명중 39명 (39%) 에서두대립인자를모두보유한이형접합상태임이관찰되었으며이론적 (p 2 +2pq+q 2 =1) 계산에의한 46% 보다낮은결과를보였다 (Table 2). 2. pert 87-15/BamHI RFLP 분석결과 서로혈연관계가없는정상한국인여자 X 염색체 200개를대상으로하여 pert 87-15/BamHI RFLP 분석을한결과, 공통절편인 10 bp 절편과함께 166/50 bp(p) 와 216 bp(q) 절편들 Table 2. Polymorphisms of the DMD in Korean population Marker Allelic frequency Heterozygosity (%) + allele - allele Calculated (n*) Observed (n ) pert87-8/taqi (200) 39 (39/100) pert87-15/bamhi (200) 52 (52/100) pert87-15/xmni (200) 55 (55/100) pert84/maeiii (200) 49 (49/100) exon48/msei (200) 28 (28/100) *No. of X chromosomes calculated; No. of heterozygotes/no. of females observed. 이각각 0.61, 0.39의대립유전자빈도로관찰되었다. 실제대상에포함된정상한국인여자 100명중 52명 (52%) 에서두대립인자를모두보유한이형접합상태임이관찰되었으며이론적계산에의한 48% 와유사한결과를보였다 (Table 2). 3. pert 87-15/XmnI RFLP 분석결과서로혈연관계가없는정상한국인여자 X 염색체 200개를대상으로하여 pert 87-15/XmnI RFLP분석을한결과, 520/210 bp(p) 와 730 bp(q) 와절편들이각각 0.43, 0.57의대립유전자빈도로관찰되었다. 실제대상에포함된정상한국인여자 100명중 55명 (55%) 에서두대립인자를모두보유한이형접합상태임이관찰되었으며이론적계산에의한 49% 에비해다소높은결과를보였다 (Table 2). 4. pert 84/MaeIII RFLP 분석결과서로혈연관계가없는정상한국인여자 X 염색체 200개를대상으로하여 pert 84/MaeIII RFLP 분석을한결과, 128/108 bp(p) 와 236 bp(q) 와절편들이각각 0.59, 0.41의대립유전자빈도로관찰되었다. 실제대상에포함된정상한국인여자 100명중 49명 (49%) 에서두대립인자를모두보유한이형접합상태임이관찰되었으며이론적계산에의한 48% 와유사한결과를보였다 (Table 2). 5. exon 48/MseI RFLP 분석결과서로혈연관계가없는정상한국인여자 X 염색체 200개를대상으로하여 exon 48/MseI RFLP 분석을한결과, 85/23 bp(p) 와 108 bp(q) 와절편들이각각 0.84, 0.16의대립유전자빈

4 DMD 보인자진단을위한다형분석 239 도로관찰되었다. 실제대상에포함된정상한국인여자 100명중 28명 (28%) 에서두대립인자를모두보유한이형접합상태임이관찰되었으며이론적계산에의한 27% 와유사한결과를보였다 (Table 2). 고 DMD의보인자진단방법은전통적인방법인혈청내 CPK 수치를측정하는방법에서부터최근에는분자생물학적검사인제한효소단편장다형검사와결손된 exon의 DNA 정량검사등여러방법들이개발되어보인자진단을통한이질환의발생을예방하고있다. 그러나혈청내 CPK 수치를측정하는방법은보인자의약 70-75% 에서만정상인의상위한계치보다높게나타나고, 채혈하는시간에따라다양한결과를보이며, 정상인과보인자의 CPK 수치가중복되어나타나상대적가능성만을제공한다 [2, 3]. 최근에는분자생물학검사의발달로여러보인자진단법이도입되고있는데그중의하나는결손된 exon의 DNA를직접정량검사하는방법이다 [4-6]. 그러나이검사법은 exon 결손외의유전자결함인점돌연변이경우에서는적용하기어려우며, 측정하는부위와다른 exon의결손일경우도진단에어려움이따르는문제점이있다. 다른한검사방법은제한효소를사용하여근육병환자가있는가계에서간접적으로보인자여부를측정하는방법이다. 이방법은 exon 결손이나중복이아닌유전자변이를보이는약 40% 의환자에서유용할수있다. 전통적으로는 Southern blot을이용하는 intragenic RFLP가많이사용되며그중에서도 X 성염색체 (Xp2l.2) 의 dystrophin 유전자위치에위치하는 int-ragenic probe인 pert 87-1, 87-8, 87-15와 4종류의제한효소 (BstN I, BstX I, Taq I, Xmn I) 를이용한 RFLP 분석 Table 3. Comparison of allele frequencies of DMD gene by RFLP between Koreans and Caucasians Marker pert87-8/taqi pert87-15/bamhi pert87-15/xmni pert84/maeiii exon48/msei 찰 Koreans This study *reference 20; reference 24; reference 14. Allelic frequency Song* Chinese Allele polymorphisms Cauasians 이가장보편화된방법이다 [14]. 그러나한종류의 RFLP 소식자를이용하게되면종종보인자진단에정보를줄수없는경우가생기므로대개는몇가지의소식자를병행사용하여야한다. 또한 dystrophin 유전자의크기 (11-12 cm) 는상당히크기때문에유전자결손부위와 intragenic RFLP 사이의약 5-10% 정도재조합이일어날가능성이있는것으로보고되고있다 [2, 18, 19]. 국내에서도송등에의해이러한방법을통해정상한국인에서의대립유전자의빈도와이형접합빈도를조사한바가있다 [20]. 본연구에서는 Southern blot 방법대신중합효소연쇄반응법을이용하여정상한국여성에서 pert 87 시리즈외에 pert 84와 exon 48 부위의이형접합양상및대립유전자비율을조사하여빠르고간편하게임상에적용할수있도록하였다. 그결과, 정상한국인에서발견된대립유전자의다형성은 Caucasian의경우와비교하여유사한다형성을나타내었으나대립유전자빈도에있어서는다소차이를보였다 (Table 3). 대립유전자빈도에있어비교가가능한 pert 87-8/TaqI의경우, Caucasian에서는절단부위의비보유자에비해보유자가많은반면한국인의경우는이와반대로절단부위보유자보다는비보유자의수가많음을알수있었다 [14]. 이결과는이전에송 [20] 등이보고한빈도와유사하였다. 그리고새로이이연구에포함한 pert 84/MaeIII의경우, Caucasian에서는절단부위의보유자에비해비보유자가많은반면한국인의경우는이와반대로절단부위비보유자보다는보유자의수가많음을알수있었다 [16]. 그러나 pert 87-17/XmnI의경우에는대립인자비율이거의반반으로유사하였다 [14]. 또한 exon 48/MseI의경우, Caucasian과한국인모두보유자의수가많음을보였다 [17]. pert 시리즈 (DXS164: 87-8, 87-15의 2종, 84) 및 exon 48 부위에서각제한효소 (TaqI, BamHI, XmnI, MaeIII, MseI) 를사용하여 PCR-RFLP 분석에의한결과에따르면, pert 87-15/BamHI, pert 87-15/XmnI과 pert 84/MaeIII의이형접합빈도가 50% 정도로보인자진단을위하여우선적용하면검색에용이할것으로사료된다. pert 87-8/TaqI, exon 48/MseI는먼저시행한 pert 시리즈가동형접합 (homozygosity) 로서정보가유용하지않은경우 2차적으로적용함이바람직하겠다. 따라서 DMD 환자의약 1/3은가족력이없이환자에서만산발적으로발생하는새로운돌연변이에의한것으로보고된 [21] 바있어이런경우는산전진단을통한예방이어려우나가족력이있는 2/3에서는간단한 PCR로 DMD 환자의약 60%[4, 22] 에달하는결손이있는환자의가계에서의보인자검색에적용할수있는 PCR 산물의정량분석 [23] 과더불어위연구에서처럼 PCR-RFLP를이용하면빠르고간편하게보인자여부를진단하여산전진단에도움을줄것으로사료된다.

5 240 최종락 송경순 박숙자 요약배경 : 듀센형근이영양증 (Duchenne muscular dystrophy: DMD) 의보인자진단방법은혈청내 creatine phosphokinase (CPK) 수치를측정하는방법에서부터최근에는분자생물학적검사인제한효소단편장다형검사와결손된 exon의 DNA 정량검사등여러방법들이개발되어보인자진단을통한이질환의발생을예방하고있다. 보인자진단에유용한표지자를찾기위해 Southern blot 방법보다빠르고간편한 PCR-RFLP 방법을적용하였다. 방법 : 서로혈연관계가없는정상한국인여자 ( 총 X 염색체수 : 200) 를대상으로 DMD 유전자내표지자인 pert 시리즈 (87-8, 87-15의 2종, 84) 및 exon 48 부위에서각제한효소 (TaqI, BamHI, XmnI, MaeIII, MseI) 를사용하여 PCR-RFLP 법 ( 중합연쇄반응제한효소단편장다형 ) 분석을실시하였으며, 각유전자형의대립인자빈도와이형접합률을조사하였다. 결과 : 유전자형 pert 87-8/TaqI, pert 87-15/BamHI, pert 87-15/XmnI, pert 84/MaeIII, exon 48/MseI에대한 +/- 대립인자빈도는각각 0.36/0.64, 0.61/0.39, 0.43/0.57, 0.59/0.41, 0.84/0.16 이었다. 또한각유전자형에대한이형접합률 (%) 은이론적예측치와실제관찰치가각각 46/39, 48/52, 49/55, 48/49, 27/28로서서로유사한결과를보였다. 결론 : 검사한표지자중 pert 87-15와 pert 84는한국인에서이형접합빈도가다른표지자 (pert 87-8/TaqI, pert exon 48/MseI) 에비해가장높아다형성에따른 family linkage analysis에우선적으로사용될수있으며이는 DMD 가계에서보인자검색에실질적인도움을줄수있을것으로사료된다. pert 87-15와 pert 84 검사결과동형접합인경우에는 2차적으로 pert 87-8/TaqI과 exon 48/MseI 등을적용함이바람직하겠다. 또한 PCR-RFLP법은종전의 Southern blot법에비해술식이간편하여보인자검색및산전진단에보다실용적인것으로사료된다. 참고문헌 1. Hoffman EP, Brown RH, Kunkel LM. Dystrophin : the protein product of the Duchenne muscular dystrophy locus. Cell 1987; 51: Schwartz LS, Tarleton J, Popovich B, Seltzer WK, Hoffman EP. Fluorescent multiplex linkage analysis and carrier detection for Duchenne/Becker muscular dystrophy. Am J Hum Genet 1992; 51: Gruemer HD, Miller WG, Chinchilli VM, Leshner RT, Blasco PA, Hassler CR, et al. Prediction of carrier status in Duchenne dystrophy by creatine kinase measurement. Am J Clin Pathol 1985; 84: Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C, Kunkel LM. Complete cloning of the Duchenne muscular dystrophy (DMD) cdna and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 1987; 50: Hodgson SV and Bobrow M. Carrier detection and prenatal diagnosis in Duchenne and Becker muscular dystrophy. Br Med Bull 1989; 45: Hu XY, Ray PN, Murphy EG, Thompson MW, Worton RG. Duplicational mutation at the Duchenne muscular dystrophy locus: its frequency, distribution, origin, and phenotypegenotype correlation. Am J Hum Genet 1990; 46: Hofker MH, Wapenaar MC, Goor N, Bakker E, van Ommen GJ, Pearson PL. Isolation of probes detecting restriction fragment length polymorphisms from X chromosome-specific libraries: potential use for diagnosis of Duchenne muscular dystrophy. Hum Genet 1985; 70: Francke U, Ochs HD, de Martinville B, Giacalone J, Lindgren V, Disteche C, et al. Minor Xp2l chromosome deletion in a male associated with expression of Duchenne muscular dystrophy, chronic granulomatous disease, retinitis pigmentosa, and McLeod syndrome. Am J Hum Genet 1985; 37: Hejtmancik JF, Harris SG, Tsao CC, Ward PA, Caskey CT. Carrier diagnosis of Duchenne muscular dystrophy using restriction fragment length polymorphisms. Neurology 1986; 36: Monaco AP, Bertelson CJ, Middlesworth W, Colletti CA, Aldridge J, Fischbeck KH, et al. Detection of deletions spanning the Duchenne muscular dystrophy locus using a tightly linked DNA segment. Nature 1985; 316: Monaco AP, Neve RL, Colletti-Feener C, Bertelson CJ, Kurnit DM, Kunkel LM. Isolation of candidate cdnas for portions of the Duchenne muscular dystrophy gene. Nature 1986; 323: Fischbeck KH, Ritter AW, Tirschwell DL, Bertelson CJ, Kunkel LM, Monaco AP, et al. Recombination with pert87 (DXS164) in families with X-linked muscu1ar dystrophy. Lancet 1986; 2: Lanman JT, Pericak-Vance MA, Bartlett RJ, Chen JC, Yamaoka L, Koh J, et al. Familial inheritance of a DXS164 deletion mutation from a heterozygous female. Am J Hum Genet 1987; 41: Katayama S, Montano M, Slotnick RN, Lebo RV, Golbus MS. Prenatal diagnosis and carrier detection of Duchenne muscular dystrophy by restriction fragment length polymorphism analysis with pert 87 deoxyribonucleic acid probes. Am J Obstet Gynecol 1988; 158: Roberts RG, Cole CG, Hart KA, Bobrow M, Bentley DR. Rapid carrier and prenatal diagnosis of Duchenne and Becker muscular dystrophy. Nucleic Acids Res 1989; 17: Roberts RG, Bobrow M, Bentley DR. A MaeIII polymorphism near the dystrophin gene promoter by restriction of amplified DNA. Nucleic Acids Res 1990; 18: Yau SC, Roberts RG, Bentley DR, Mathew CG, Bobrow M. A MseI

6 DMD 보인자진단을위한다형분석 241 polymorphism in exon 48 of the dystrophin gene. Nucleic Acids Res 1991; 19, Bartlett RJ, Pericak-Vance MA, Koh J, Yamaoka LH, Chen JC, Hung WY, et al. Duchenne muscular dystrophy: high frequency of deletions. Neurology 1988; 38: Abbs S, Yau SC, Clark S, Mathew CG, Bobrow M. A convenient multiplex PCR system for the detection of dystrophin gene deletions: a comparative analysis with cdna hybridisation shows mistypings by both methods. J Med Genet 1991; 28: 송경순, 최종락, 이창훈, 박영숙, 강성웅, 문재호. 한국인듀센형근디스트로피가계에서의보인자진단을위한 DNA 제한효소단편장다형에관한연구. 대한임상병리학회지 1996; 16: Boelter WD, Burt BA, Spector EB, Hinton DR, Pavlova Z, Fujimoto A. Dystrophin protein and RFLP analysis for fetal diagnosis and carrier confirmation of Duchenne muscular dystrophy. Prenat Diagn 1990; 10: Baumbach LL, Chamberlain JS, Ward PA, Farwell NJ, Caskey CT. Molecular and clinical correlations of deletions leading to Duchenne and Becker muscular dystrophies. Neurology 1989; 39: Prior TW, Papp AC, Snyder PJ, Highsmith Jr. WE, Friedman KJ, Perry TR, et al. Determination of carrier status in Duchenne and Becker muscular dystrophies by quantitative polymerase chain reaction and allele-specific oligonucleotides. Clin Chem 1990; 36: Soong BW, Tsai TF, Su CH, Kao KP, Hsiao KJ, Su TS. DNA polymorphisms and deletion analysis of the Duchenne-Becker muscular dystrophy gene in the Chinese. Am J Med Genet 1991; 38:


<30332D30392D30393828C3D6BFB5C3B62DC1B6C7D1B3AA292E687770> 원 저 접수번호:09-029(2차-0710) Multiplex Ligation-dependent Probe Amplification (MLPA) 방법에 의한 디스트로핀 유전자 돌연변이 분자학적 진단의 유용성 연세대학교 의과대학 신경과학교실, 진단검사의학교실 a 조한나 홍지만 이경아 a 최영철 Clinical Usefulness of Molecular Diagnosis

More information


<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information


뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

Microsoft Word - KSR2016S168

Microsoft Word - KSR2016S168 2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin

More information


05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information


Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information


<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information


DV690-N_KOR_110216.indd P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?

More information


Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information


untitled 대한수혈학회지:제21권 제2호, 2010 유전자 검사로 확인된 A 1 B weak 형 환자 1예 조치현ㆍ유병준ㆍ윤승규ㆍ최계령ㆍ최재열ㆍ김장수ㆍ임채승ㆍ김영기ㆍ이갑노 고려대학교 의과대학 진단검사의학교실 Using Genotyping to Identify an A 1 B weak Blood Group Chi-Hyun Cho, Byong-Joon Yoo, Seung-Gyu

More information


005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information


<32303136C7D0B3E2B5B520B9FDC7D0C0FBBCBABDC3C7E820C3DFB8AEB3EDC1F528C8A6BCF6C7FC292E687770> 20학년도 법학적성시험 1 제2교시 추리논증 성명 수험 번호 이 문제지는 35문항으로 구성되어 있습니다. 문항 수를 확인하십시오. 문제지의 해당란에 성명과 수험 번호를 정확히 쓰십시오. 답안지에 수험 번호, 문형, 성명, 답을 표기할 때에는 답안 작성 시 반드시 지켜야 하는 사항 에 따라 표기하십시오. 답안지의 필적 확인란 에 해당 문구를 정자로 기재하십시오.

More information


#Ȳ¿ë¼® A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information


14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information


untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information


<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

본 발명은 중공코어 프리캐스트 슬래브 및 그 시공방법에 관한 것으로, 자세하게는 중공코어로 형성된 프리캐스트 슬래브 에 온돌을 일체로 구성한 슬래브 구조 및 그 시공방법에 관한 것이다. 이를 위한 온돌 일체형 중공코어 프리캐스트 슬래브는, 공장에서 제작되는 중공코어 프

본 발명은 중공코어 프리캐스트 슬래브 및 그 시공방법에 관한 것으로, 자세하게는 중공코어로 형성된 프리캐스트 슬래브 에 온돌을 일체로 구성한 슬래브 구조 및 그 시공방법에 관한 것이다. 이를 위한 온돌 일체형 중공코어 프리캐스트 슬래브는, 공장에서 제작되는 중공코어 프 (51) Int. Cl. E04B 5/32 (2006.01) (19)대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 (11) 등록번호 (24) 등록일자 2007년03월12일 10-0693122 2007년03월05일 (21) 출원번호 10-2006-0048965 (65) 공개번호 (22) 출원일자 2006년05월30일 (43) 공개일자 심사청구일자

More information


뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information


대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information


<494352503131335FC1F8B9E6B1B3C0B02E687770> ICRP 간행물 113 진단 및 중재 절차를 위한 방사선방호 교육훈련 Education and Training in Radiological Protection for Diagnostic and Interventional Procedures 대한방사선방어학회 이 번역본 발간은 2011년도 원자력안전위원회 방사선안전기술 개 발사업 과제 지원(한국동위원소협회로 부터

More information


untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information


untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information


02Á¶ÇýÁø Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information


<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770> 醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의

More information


<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : Abstract R

More information

특허청구의 범위 청구항 1 어류를 13~23mm 범위 내의 크기로 파쇄한 어류 분말과 물을 중량 대비로 20~40%와 5~10%로 혼합하고, 단백질가 수분해효소를 상기 어류 분말과 물의 중량 대비로 0.1~5.0%로 첨가해서 원료를 준비하는 단계; 상기 준비한 원료를

특허청구의 범위 청구항 1 어류를 13~23mm 범위 내의 크기로 파쇄한 어류 분말과 물을 중량 대비로 20~40%와 5~10%로 혼합하고, 단백질가 수분해효소를 상기 어류 분말과 물의 중량 대비로 0.1~5.0%로 첨가해서 원료를 준비하는 단계; 상기 준비한 원료를 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) C12J 1/04 (2006.01) A23L 1/39 (2006.01) C12R 1/865 (2006.01) C12R 1/02 (2006.01) (21) 출원번호 10-2011-0053618 (22) 출원일자 2011년06월03일 심사청구일자 2011년06월03일

More information

<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770> 먹거리와 건강 황성수 인도주의실천의협의회( 황성수 의사님의 글 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.

More information


01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information


ºÎÁ¤¸ÆV10N³»Áö case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information


<303720C7CFC1A4BCF86F6B2E687770> 1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운

More information


2003_KR0411177.piv (19) 특허청(KR) (1) 등록특허공보(B1) (51) Int. Cl. (45) 공고일자 003년1월18일 B01J 9/14 (11) 등록번호 10-0411177 (4) 등록일자 003년1월0일 (1) 출원번호 10-001-003814 () 출원일자 001년05월0일 (73) 특허권자 한국화학연구원 305-343 대전 유성구 장동 100번지 (7) 발명자

More information


386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information


<30352EB0A3BAB4B8AE2E687770> The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and

More information


227-233Â÷¼øÁÖ 227 228 Table 1. The Results of PSNR (db) for Various Compression Rate Modality Case 5:1 10:1 20:1 40:1 80:1 MR 9 71.68 2.37 60.54 2.51 52.85 2.53 48.54 2.29 44.09 2.47 CT 9 51.90 1.67 63.70 2.02 57.32

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information


395-402Ȳ¼º¼ö 395 Fig. 1. Flow diagram showing selection of options for adequate screen recording on the CamStudio 396 Fig. 2 Flow diagram showing the menu buttons on the CamStudio and the process of recording after

More information


Æ÷Àå82š Lee, Kyungbae (E-mail : Lee, Jaehoon (E-mail : Sohn, Duecksu (E-mail : Kwon, Soonmin (E-mail : ABSTRACT PURPOSES : The purpose

More information

- 최원희ㆍ 김명희: 중년후기 여성의 집단회상 경험과 효과에 대한 연구 - 에 직면하며 심리 사회적인 역할갈등, 고립, 위축, 상실 감 등을 경험하게 된다. 이 시기동안 위기에 잘 대처하 지 못하면 자신에 대하여 실망하며 두려움과 슬픔 등 을 겪으면서 자아존중감이 낮아

- 최원희ㆍ 김명희: 중년후기 여성의 집단회상 경험과 효과에 대한 연구 - 에 직면하며 심리 사회적인 역할갈등, 고립, 위축, 상실 감 등을 경험하게 된다. 이 시기동안 위기에 잘 대처하 지 못하면 자신에 대하여 실망하며 두려움과 슬픔 등 을 겪으면서 자아존중감이 낮아 한국모자보건학회지 제15권 제1 호(2011년 1 월) J Korean Soc Matern Child Health 2011;15(1):48-59 E 1) 중년후기 여성의 집단회상 경험과 효과에 대한 연구 최 원 희ㆍ김 명 희 1 경남대학교 간호학과, 부산대학교 간호대학 1 = Abstract = The Experience and Effects of Group

More information


04-07도현수 대 한 외 상 학 회 지 Vol. 19, No. 2, December, 2006 원 저 임상실습과정 의과대학생을 대상으로 카데바 모델을 이용한 단순 봉합술 교육의 효율성 충남대학교 의과대학 응급의학교실 Abstract 도현수 민진홍 홍승우 한상균 김인수 유@ 승 이진웅 김승환 유인술 Evaluation of the Educational Efficacy of

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

Hardware Manual TSP100

Hardware Manual TSP100 Trademark acknowledgments TSP: Star Micronics., Ltd. Notice All rights reserved. Reproduction of any part of this manual in any form whatsoever, without STAR s express permission is forbidden. The contents

More information

분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김

분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김 목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...4 3. 자본금 변동사항...7 4. 주식의 총수 등...9 5. 의결권 현황...10 6. 배당에 관한 사항 등...10 II. 사업의 내용...12 III. 재무에 관한 사항...30 IV. 감사인의 감사의견 등...34 V. 이사의

More information


表紙(化学) 수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

<C7A5C1F65FC0FCB8E95F31502E6169> Waterproof underwater housing usable up to 33ft (10m) JIS IPX8 All purposes Dustproof, Fogproof, Sandproof, Snowproof, Waterproof case for smart devices. 360 360 Rotation DiCAPac Action Patented Product

More information

A n s w e r 4 0 0 20 13 40 13 14 1 13 14 15 16 17 20 % 13 13 5 13 2 47.0 ml 55.0 15.0 13 14 15 5.0 g/cm 1.8 kg B E A C 13 14 LNGLPGLNG LPG 15 << 13 A<

A n s w e r 4 0 0 20 13 40 13 14 1 13 14 15 16 17 20 % 13 13 5 13 2 47.0 ml 55.0 15.0 13 14 15 5.0 g/cm 1.8 kg B E A C 13 14 LNGLPGLNG LPG 15 << 13 A< 우공비Q 과학 2 (하) 정답 및 채움해설 빠른 정답 찾기 2~4 Ⅴ. 물질의 특성 1. 물질의 특성 ⑴ 5 2. 물질의 특성 ⑵ 9 3. 혼합물의 분리 13 Ⅵ. 일과 에너지 전환 4. 일 21 5. 에너지 27 Ⅶ. 자극과 반응 6. 감각 기관 39 7. 신경계 44 8. 항상성 48 13강 일차방정식의 풀이 1 A n s w e r 4 0 0 20 13

More information

A 001~A 036

A 001~A 036 4 3 2 0 8 91 0 1 2 3 4 5 6 08 09 00 01 02 03 04 18 19 10 29 20 22 23 39 30 31 32 33 48 49 40 41 59 50 69 1 2 3 4 1 2 3 4 1 4 7 10 13 1 2 3 4 5 6 rev. C C r C a f h f h L h h nrpm f h f n L C 3 P L

More information


05_최운선_53~67,68.hwp Journal of Korean Home Management Association ISSN(print) 1229-1331 Vol.30 No.6 Serial No.120 2012.12 국제결혼 한국인 남성의 결혼생활 대처전략에 관한 연구* The Coping Strategy of

More information

15 0211 C7 서울제이에스병원 (카티스템 치료) 서울제이에스병원 16 0211 C5 변석홍옥고 변한의원/산들건강 17 0225 B5 삼성 스마트에어컨 Q9000 삼성전자 멀티플랜 교보통합 CI 보험/NEW 새시 대 건강파트너/IBK 교보생명/삼성화재/ 연금 플러스

15 0211 C7 서울제이에스병원 (카티스템 치료) 서울제이에스병원 16 0211 C5 변석홍옥고 변한의원/산들건강 17 0225 B5 삼성 스마트에어컨 Q9000 삼성전자 멀티플랜 교보통합 CI 보험/NEW 새시 대 건강파트너/IBK 교보생명/삼성화재/ 연금 플러스 심의 번호 1502-1 신고/ 모니터 매체 구분 모니터 일반일간 국민일보 (4) 매체명 게재일 게재면 상품명 광고주 검토의견 0202 H4 2 0202 H6 3 0216 H6 동충일기/니햅/ 자하생력액/잇치/ 힘찬관절 엘란쎄/유한 덴탈케 어 가글/맥시부펜시 럽/비맥스 골드/ 프리페민/아로나민 골드 모드콜플루 4종/ 해림후코이단 동아제약/보령수앤수/ 경남제약/동화약품/

More information w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information

좋은 디자인은 곧 그것만의 아이덴티티 를 발견하는 것입니다. 대상과 관련된 수많은 정보의 맥락을 깊이있게 이해한 후 고유의 정보를 조합하는 것부터 시작하여 이를 통해 시간이 지날수록 개인과 커뮤니티, 인공과 자연, 과거와 미래가 소통할 수 있는 제품을 만듭니다. Company Introduction 1 3 Brand Profile (인프레임)은 큰산인디컴의

More information


<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information


11¹ÚÇý·É Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and

More information


도큐-표지 Study on the use of Animal Bones in Ancient China Bo Fengxian, Xu Chengwei, Liu Wen, Sun Shuping (Northwest A&F University) 我国古代对动物骨头的再利用 卜风贤 许成委 刘雯 孙署萍 西北农林科技大学 Abstract Based on Chinese historical documents,

More information

Microsoft Word - 001.doc

Microsoft Word - 001.doc 간호학석사학위 청구논문 조기진통 임부의 입원 후 스트레스와 간호요구 변화 연구 Change of Stress and Nursing Needs after Admission in Preterm Labor 2007년 8월 인하대학교 대학원 간호학과(간호학전공 간호학전공) 김 민 경 간호학석사학위 청구논문 조기진통 임부의 입원 후 스트레스와 간호요구 변화 연구 Change

More information

한국 출산력의 저하 요인에 관한 연구

한국 출산력의 저하 요인에 관한 연구 가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001

More information


(079-088)Kjbt015.hwp 대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base

More information


<4D6963726F736F667420506F776572506F696E74202D204F435720B5EEB7CFB0ADC0C7C0DAB7E12DBBFDC8B0BCD3C0C720BBFDB8EDB0FAC7D0> 생활 속의 생명과학 (Biological Science for Life) 13강. DNA 검사 13 주차 강의 DNA 검사 - 법의학 과학 앞에 완전범죄는 더 이상 없다 [아시아경제] 2009.4.15 범인라고 확신하고 추적하던 용의자의 DNA가 현장에서 발견된 것과 일치하지 않는다면, 형사는 용의자를 더 이상 잡아둘 수 없다. 결정적인 증거가 없기 때문이다.

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

9(3)-4(p ).fm

9(3)-4(p ).fm w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young

More information

440 /

440 / / 439 = Abstract = Diffusion-weighted Imaging in Isolated Vertigo Patients Having Risk Factors for Stroke Hyung Goo Kang, M.D., Yu Sang Yun, M.D., Jin Hee Yi, M.D., In Cheol Park, M.D., Kyeong Ryong Lee,

More information


03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information


DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

Click to add title

Click to add title Genetic and Conventional Tests of PNH 2010. 8. 25. 원자력병원진단검사의학과 장윤환 Agenda 1. Mutation analysis of the PIGA gene 2. Cytogenetic study 3. Ham test and sucrose hemolysis test 4. Gel microtyping system (Gel

More information

Buy one get one with discount promotional strategy

Buy one get one with discount promotional strategy Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70 경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법

More information

ALPHA I 500M(현대삼호) service manual(kor).hwp

ALPHA I 500M(현대삼호) service manual(kor).hwp ALPHA I 500M VER 2.0 2005. 01 (현대삼호)사용설명서 본 제품을 바르고 안전하게 사용하기 위해서 사용, 점 검, 수리 전에 반드시 본 내용을 읽어서 충분히 이해하 고 사용하십시오. Visit our website at 본 사 : 서울시 강남구 삼성동 157-37 (일송빌딩

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information


63-69±è´ë¿µ Study on the Shadow Effect of 3D Visualization for Medical Images ased on the Texture Mapping D.Y. Kim, D.S. Kim, D.K. Shin, D.Y. Kim 1 Dept. of iomedical Engineering, Yonsei University = bstract = The

More information

공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대

공학박사학위 논문 운영 중 터널확대 굴착시 지반거동 특성분석 및 프로텍터 설계 Ground Behavior Analysis and Protector Design during the Enlargement of a Tunnel in Operation 2011년 2월 인하대 저작자표시-비영리-동일조건변경허락 2.0 대한민국 이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. 이차적 저작물을 작성할 수 있습니다. 다음과 같은 조건을 따라야 합니다: 저작자표시. 귀하는 원저작자를 표시하여야 합니다. 비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

More information

많이 이용하는 라면,햄버그,과자,탄산음료등은 무서운 병을 유발하고 비만의 원인 식품 이다. 8,등겨에 흘려 보낸 영양을 되 찾을 수 있다. 도정과정에서 등겨에 흘려 보낸 영양 많은 쌀눈과 쌀껍질의 영양을 등겨를 물에 우러나게하여 장시간 물에 담가 두어 영양을 되 찾는다

많이 이용하는 라면,햄버그,과자,탄산음료등은 무서운 병을 유발하고 비만의 원인 식품 이다. 8,등겨에 흘려 보낸 영양을 되 찾을 수 있다. 도정과정에서 등겨에 흘려 보낸 영양 많은 쌀눈과 쌀껍질의 영양을 등겨를 물에 우러나게하여 장시간 물에 담가 두어 영양을 되 찾는다 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 공개실용신안공보(U) A23L 1/307 (2006.01) C02F 1/68 (2006.01) (21) 출원번호 20-2011-0002850 (22) 출원일자 2011년04월05일 심사청구일자 2011년04월05일 (11) 공개번호 20-2011-0004312 (43) 공개일자 2011년05월03일

More information

젊은 용산인(박종우 35회) / 9 용악회 히말라야 등반기 / 10 인터뷰(정희용 신임 총회장) / 20 이정복(6회 회장 보광상사 대표) 세월을 뒤돌아 보며 사는 삶보다는 세월을 바라보며 사는 삶이 훨씬 긍정적이고 적극 적인 삶이다. 그것은 시간에 뒤쳐지는 삶보다는 시간을 쫓지도 쫓기지도 않고 더불어 사 는 자유로운

More information

2015한국기업총람 만호제강(주) 129 (주)메리츠금융지주 130 메리츠종합금융증권(주) 130 메리츠화재해상보험(주) 131 명문제약(주) 131 (주)모나리자 132 (주)모나미 132 (주)모토닉 132 무림페이퍼(주) 133 무림피앤피(주) 133 (주)무학

2015한국기업총람 만호제강(주) 129 (주)메리츠금융지주 130 메리츠종합금융증권(주) 130 메리츠화재해상보험(주) 131 명문제약(주) 131 (주)모나리자 132 (주)모나미 132 (주)모토닉 132 무림페이퍼(주) 133 무림피앤피(주) 133 (주)무학 수록회사 차례 수록회사 차례 상 장 법 인 AK홀딩스(주) 27 AK홀딩스(주) 310 (주)BNK금융지주 31 CJ(주) 31 CS홀딩스(주) 32 (주)DGB금융지주 32 DRB동일(주) 32 DSR(주) 33 (주)E1 33 (주)GS 33 (주)GS리테일 34 (주)JB금융지주 34 JW중외제약(주) 35 (주)KB금융지주 35 KG케미칼(주) 35

More information


16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information


DBPIA-NURIMEDIA Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural

More information


<32303135B3E220C7CFB9DDB1E220BFACB1B8BAB8B0EDBCAD20C1A636B1C72E687770> 156 2015년 하반기 연구보고서 제 Ⅵ 권 날씨에 따른 생활시간 평균 분석 -여가활동시간을 중심으로- 강정희 Ⅰ. 연구배경 및 연구방법 (연구배경 및 목적) (배경) 다양하고 광범위한 생활시간조사 결과의 활용도를 향상하고, 부문별 생활시간 관련 연구는 많지만 사계절이 뚜렷한 우리나라의 특성을 반영한 날씨와 생활시간을 연계한 연구는 많지 않아 행정자료인 기상자료를

More information


untitled [ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings

More information

국제저널 36_표지내지모음.indd


More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information


002-022~41-기술2-충적지반 Improvement cases of waterproofing and auxiliary construction methods in alluvium soil tunnel In the past, subway tunnel is mostly applied to rock tunnel in order to secure the safety. But, in recent years,

More information


Pierce-Plus-Alpha.pdf Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies

More information

레이아웃 1

레이아웃 1 Disability & Employment 11. 8. 제1권 제호(통권 7호) pp.97~118 중증장애인직업재활지원사업수행시설의 효율성비교* 양숙미 남서울대학교 사회복지학과 부교수 전동일 가톨릭대학교 박사과정 요 약 본 연구는 직업재활시설의 중증장애인 직업재활지원사업에 대한 효율성을 평가하여 효 율적인 운영방안을 제시하는데 목적이 있다. 본 연구를 위해

More information


권유진 Malignant Peripheral Nerve Sheath Tumor of the Pancreas: A Case Report Malignant peripheral nerve sheath tumor (MPNST) is rare, soft tissue, spindle cell sarcoma of an ectomesenchymal origin. MPNSTs frequently

More information


<303933305FC7D1BEE7B4EB2DB9FDC7D0B3EDC3D132382D332E687770> 주취운전죄와 관련된 최근의 입법과 판례의 동향 박 찬 걸 * < 目 次 > Ⅰ. 문제의 소재 Ⅲ. 행위의 방법( 자동차 등을 운전하여 )과 Ⅱ. 행위의 주체( 술에 취한 상태에 있는 자 ) 관련된 동향 와 관련된 동향 Ⅳ. 글을 마치며 Ⅰ. 문제의 소재 도로교통법 1) 제44조에 의하면 누구든지 술에 취한 상태에서 자동차 등을 운전하여서는 아 니 되며(제1항),

More information


untitled 제 1 세부과제 안전한 예방접종 실천을 위한 전략 및 교육, 홍보 자료 개발 제 1 장. 서 론 제 1 절. 연구의 필요성 국가적인 차원에서 예방접종 사업은 전염병 관리를 위한 가장 중요한 방역 사업 중 하나로, 대다수의 전염병 발생률은 각종 전염병의 백신이 나온 후로 현저히 감소하였으며, 인류 역사상 가장 많은 생명을 전염병으로부터 구원해주었다. 그러나,

More information


untitled 2005년도 이렇게 달라집니다. Incheon Metropolitan City 목 차 일반행정 분야 인감증명 발급기관 확대 6 인감증명발급사실 확인시스템 운영 7 인감증명 수수료 동일 적용 8 인감증명 대리발급사실 통보 9 주민등록증 신규발급 신청자의 본인확인 방법 확대 10 주민등록증 분실신고자 범위 확대 11 주민등록증 주소변경사항 정리기관 확대 12 무인민원발급기

More information


<31312EC1DF2DBBFDB9B02E687770> 중 학 교 생 물 1 머리글 우리나라에 영재교육이 본격적으로 도입되어 시행된 것은 채 10년도 되지 않는다. 그 동안 우리 는 영재교육의 양적 확대에 주력해왔고, 이제는 어느 정도 정착 단계에 도달한 것으로 보인다. 그 러나 영재교육의 완전한 정착까지는 해결해야할 수많은 난제들이 남아있다. 그 중에 하나는 우리 가 과연 제대로 영재교육을 하고 있는가? 에

More information

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26

한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26 2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)

More information


03권동희(17-26)ok Geographical Analysis of National Monument Topography* Kwon, Dong-Hi 1) Abstract : As of January 2010, 59 topography have been designated as national monuments. From the geographical point of view, these

More information