<B3AAB3EBB9B0C1FAC0C7C0AFC7D8BCBAC6F2B0A1B9D7B1D9B7CEC0DAB0C7B0ADC0E5C7D8BFB9B9E6B4EBC3A E687770>

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "<B3AAB3EBB9B0C1FAC0C7C0AFC7D8BCBAC6F2B0A1B9D7B1D9B7CEC0DAB0C7B0ADC0E5C7D8BFB9B9E6B4EBC3A E687770>"

Transcription

1 보건분야-연구자료연구원 나노물질의유해성평가및근로자건강장해예방대책 - 은나노물질위해성평가를위한생체지표개발 -

2

3

4 보건분야-연구자료연구원 나노물질의유해성평가및근로자건강장해예방대책 - 은나노물질위해성평가를위한생체지표개발 -

5

6

7 요약문 1 요약문 1. 과제명 : 나노물질의유해성평가및근로자건강장해예방대책 - 은나노물질위해성평가를위한생체지표개발 - 2. 연구기간 : ~ 연구자 : 연구책임자이병훈 4. 연구목적 : 본 연구의 최종목적은 은나노물질의 유해성을 평가하여 이를 제조하고 가공하는 작업장의 근로자 건강장해 예방대책을 수립하는 것이다. 이를 달성하기 위해 본 연구에서는 은나노물질의 호흡기노출에 따른 신경독 성 및 위해성평가에 활용할 수 있는 독성생체지표를 개발하고 이를 작업장의 근로자들에게 적용 가능성을 확인하고자 하였다. 5. 연구내용 1) 국내외 사용되는 나노물질의 특성 및 현황조사 2) 문헌검색 및 선행 연구를 통한 특정 크기 및 농도의 은나노입자의 후각망 울을 통한 신경계 흡수 확인 3) Nose-only Exposure 장치를 이용해 은나노입자 (GMD :22 nm, 1.91 x 10 7 particles/cm 3 ) 를 C57BL/6 마우스에 단회 및 2주간 반복노출 4) 표적장기 ( 대뇌, 소뇌, 혈액, 간, 심장, 폐, 신장, 비장, 정소 ) 적출 후 ICP-MS를 이용한 은나노입자의 장기분포 분석 5) 유전자칩을 이용하여 은나노물질 노출에 의해 특이적으로 변화되는 유전 체분석

8 2 나노물질의유해성평가및근로자건강장해예방대책 6) 은나노물질에의해발현이변화되는유전자정보의통합분석및검증 7) 생체지표로응용하기위해혈액중유전자발현분석 8) 근로자건강장해예방대책 - 정책제안 6. 활용계획 본연구의결과로얻어진은나노입자특이유전자발현결과는은나노입자에노출된작업장근로자의건강영향평가에활용할수있으며, 근로자의위해성평가를위한생체지표로활용될수있다 7. 연구결과 나노물질은현재생활전반에서널리사용되고있으며, 은나노물질의이용역시빠르게증가하고있지만, 나노물질이인체에미치는영향에대한연구는아직부족한실정이다. 따라서작업장에서근로자에게노출되었을때유발될수있는건강영향에대한연구가필요하다. 본연구에서는문헌검색을통해특정크기의은나노입자가후각망울을통해뇌로이행됨을확인하였고, 은나노물질의호흡기노출에따른건강영향및위해성평가생체지표를발굴하기위하여 C57BL/6 마우스에 nose-only exposure system 을통하여은나노입자 (GMD :22 nm, 1.91 x 10 7 particles/cm 3 ) 를단회혹은 2주반복노출시켰다. 노출후표적장기 ( 대뇌, 소뇌, 혈액, 간, 심장, 폐, 신장, 비장, 정소 ) 로의분포를 ICP-MS 를이용해분석하였고, 대뇌및소뇌에서의유전체변화를마이크로어레이를이용해분석한후 realtime PCR 을이용해검증하였다. 단회노출시 1.5 배이상변화한유전자가 t-test 결과 4개, ANOVA 결과 109 개얻어졌으며, 2주반복노출시 1.5 배이상변화한유전자가대뇌에서의 t-test 결과 22 개, 소뇌에서는 13 개의유전자를얻어졌다. 이들유전자를 PCR 로검증한결과마이크로어레이결과신뢰성있게재현됨을볼수있었다. 또한은나노물질에노출된근로자의위해성평

9 요약문 3 가를위한노출지표발굴을위한혈액에서의유전자분석결과 Arg2, Iifit1, Rabep1 등 3개의유전자는혈액에서유의미하게변화하여노출생체지표로의개발가능성을보였다. 8. 중심어 은나노입자, 흡입노출, 마이크로어레이, 신경독성, 생체지표

10 4 나노물질의유해성평가및근로자건강장해예방대책 차 례 I. 서 론 나노물질의 정의 11 1) 나노물질이란? 11 2) 나노물질의 종류 13 3 ) 나노 기술 응용분야 나노물질의 국내외 사용현황 22 1) 국내 사용현황 22 2) 국외 사용현황 나노물질이 인체에 미치는 영향 및 위해성 29 1) 나노물질이 인체에 미치는 긍정적인 영향 29 2) 나노물질이 인체에 미치는 독성 나노물질에 대한 노출 흡입독성시험의 개요 50 1) 흡입독성시험 50 I I. 연 구 내 용 및 방 법 연구내용 연구 방법 54 1) 은나노물질의 제조 및 특성 분석 54 2) 실험동물 및 흡입노출 55 3 ) 흡입노출시킨 은나노물질의 장기분포 57 4 ) 유전자 발현 분석 57 I I I. 연 구 결 과 은나노 입자 크기 분석 59

11 차례 5 1) 나노입자 크기 분석 59 2) 노출시간 별 나노입자 크기 변화 은나노물질 단회노출에 따른 유전자 발현 분석 62 1) 마이크로어레이 실험을 위한 R NA 분석 63 2) 마이크로어레이 결과 64 3 ) R e a l t i me P CR 를 이용한 마이크로어레이 결과의 검증 76 4 ) 단회노출실험의 클러스터 분석 78 5) 단회노출실험의 온톨로지 분석 은나노물질 반복노출에 따른 유전자 발현 분석 80 1) 마이크로어레이 실험을 위한 R NA 분석 80 2) 마이크로어레이 결과 80 3 ) Re a l t i me PCR 을 이용한 마이크로어레이 결과 확인 91 4 ) 은나노물질 반복노출실험의 클러스터 분석 95 5) 은나노물질 반복노출실험의 온톨로지 분석 96 6 ) 은나노물질의 장기분포 생체지표 개발을 위한 혈액에서의 유전자 분석 99 I V. 고 찰 연구결과의 활용 101 1) National Institute for Occupational Safety and Health (NIOSH) 의 Na n o t e c h n o l o g y Re s e a r c h Ce n t e r ( NTRC) 103 2) NTR C 의 4 대 목표 ) NTRC 10 대 중점과제 108 V. 결 론 133 VI. 참 고 문 헌 136

12 6 나노물질의유해성평가및근로자건강장해예방대책 표차례 표 1 은나노의 향균작용 메커니즘 18 표 2. 관세청, 품목별 수출입 23 표 3. 통계청 광공업동태조사 25 표 4. 특허청 국내 특허출원 현황 27 표 5. 일반시민과 근로자에서의 나노물질 노출원 및 노출경로 49 표 6. 은나노물질 단회노출실험구성 56 표 7. 은나노물질 반복노출실험구성 56 표 8. 나노입자의 시간별 농도 및 크기 분석 61 표 9. 마이크로어레이 분석에 적합한 RNA 의 기준 63 표 10. 단회노출시 two-way ANOVA 분석 결과 유전자 변화량이 2배 이상인 유 전자 66 표 11. 단회노출실험에서 r ea l t i me PCR 에 사용된 pr i me r 의 염기서열 76 표 12. 단회노출실험시 대뇌에서 마이크로어레이 결과와 realtime PCR 결과 비 교 77 표 13. 표 13. 반복노출실험의 one-way ANOVA 결과 소뇌에서의 변화량이 1.5 배 이상인 유전자 83 표 14. 표 14. 반복노출실험의 t-test 결과 대뇌에서의 변화량이 1.5 배 이상인 유 전자 86 표 15. 반복노출실험의 t-test 결과 소뇌에서의 변화량이 2배 이상인 유전자 89 표 16. 반복노출실험에서 r e a l t i me P CR 에 사용한 p r i me r 의 염기서열 91 표 17. 반복노출실험 시 대뇌에서 마이크로어레이 결과와 realtime PCR 결과 비 교 93

13 차례 7 표 18. 반복노출실험시소뇌에서마이크로어레이결과와 realtime PCR 결과비교 94 표 19. 은나노물질반복노출실험결과의온톨로지분석 97 표 20. 반복노출실험에서의은나노물질의조직분포 98 표 21. 마이크로어레이와뇌및혈액에서의 PCR 결과비교 100

14 8 나노물질의유해성평가및근로자건강장해예방대책 그림차례 그림 1. 나노입자의 크기 비교 11 그림 2. 나노입자의 크기 12 그림 3. F u l l u r e n e 의 구조 13 그림 4. SWCNT 및 MWCNT 의 구조 14 그림 5. 덴드리머 구조 15 그림 6. 양자점 모식도 16 그림 7. 응용 연구분야별 나노재료 세계시장 규모 전망 21 그림 8. 은나노 용액 수출입 현황 24 그림 9. 은나노 기술 적용 제품의 국내 시장 규모 26 그림 10. 연도별 은나노 기술 출원 동향 26 그림 11. 나노물질의 종류별 사용현황 28 그림 12. 나노물질을 이용한 암의 진단 및 치료 30 그림 13. 나노물질을 이용한 약물 전달시스템 30 그림 14. 나노물질을 이용한 암의 조영 31 그림 15. 표적 지향적 나노의약품의 제조 32 그림 16. 입자상 물질의 호흡기 노출시 크기에 따른 예상 침착부위 35 그림 17. 흡입된 입자상물질의 크기별 대식세포 처리효율 및 폐 잔존비율 36 그림 18. 나노물질에 노출된 세포에서 산화스트레스 및 염증반응의 유발 37 그림 19. MnO 2 aerosols (3-8 nm) 을 흡입시킨 후 폐, 후각망울 및 뇌의 각 조 직에서 F e 과 Mn 농도 39 그림 20. 작은 크기의 MnO 2 (1.6 μm) 와 큰 크기의 MnO (18 μm) 를 흡입한 후 조직에서 Mn 농도 40

15 차례 9 그림 21. 초미세입자에 노출시킨 쥐의 뇌에서 NF-kB TNF-α 및 I L 그림 22. 미토콘드리아의 기능에 미치는 나노입자의 영향 41 그림 23. 신경전달물질의 분비에 미치는 나노입자의 영향 41 그림 24. 활성산소종 형성에 미치는 나노입자의 영향 42 그림 25. TiO 2 노출후 시간에 따른 뇌세포의 mitochondria 에 미치는 영향 43 그림 26. TiO 2 나노입자 노출 후 H 2 O 2 및 O 2 - 생성 43 그림 27. FI TC- 포합된 de xt r a n b e a d ( r e d) 의 공초점현미경 사진. 44 그림 28. TiO 2 의 전자현미경 사진 45 그림 29. SE M 사진을 통한 은나노입자의 크기 분석 59 그림 3 0. 은나노입자의 크기 분포도 60 그림 3 1. 은나노입자의 시간별 농도 분포 62 그림 3 2. RNA 분석을 위한 Bi o a n a l y z e r 분석 예 63 그림 3 3. 표준화를 통한 실험 군간 편차 개선 - Hi s t o g r a m 64 그림 3 4. 표준화를 통한 실험 군간 편차 개선 - b o x p l o t 64 그림 3 5. 은나노물질 단회노출시험 및 통계분석 흐름도 65 그림 36. 마이크로어레이 와 realtime PCR 에서의 유전자 변화 비교 77 그림 37. 은나노물질 단회노출 시 유전자 발현 Hierarrhical Clustering 78 그림 3 8. 단회노출실험결과의 온톨로지 분석 79 그림 3 9. 표준화를 통한 실험 군간 편차 개선 - Hi s t o g r a m 81 그림 4 0. 표준화를 통한 실험 군간 편차 개선 - b o x p l o t 81 그림 4 1. 은나노물질 반복노출시험 및 통계분석 흐름도 ( 대뇌 ) 82 그림 4 2. 은나노물질 반복노출시험 및 통계분석 흐름도 ( 소뇌 ) 82 그림 43. 대뇌에서 마이크로어레이 결과와 realtime PCR 결과 비교 92 그림 4 4. 소뇌에서 마이크로어레이 결과와 r e a l t i me P CR 결과 비교 94 그림 45. 은나노물질 반복노출 시 유전자 발현 Hierarrhical Clustering 95

16 10 나노물질의유해성평가및근로자건강장해예방대책 그림 4 6. 은나노물질반복노출실험의온톨로지분석 96 그림 47. 반복노출실험에서은나노물질노출시간에따른혈액에서의유전자발현변화 99 그림 4 8. 은나노물질노출된근로자위해성평가개요 102 그림 4 9. NI OS H NTR C 의 o p e r a t i o n a l mo d e l 107 그림 50. NTR C 의 10 대중점과제 108 그림 51. 위해성평가에서 research, assessor, manager 의협력관계 112 그림 52. 근로자노출에관한나노기술관리방향 116 그림 53. 나노기술작업장에서의안전및건강을위한중점분야 129

17 I. 서론 11 I. 서론 1. 나노물질의정의 1) 나노물질이란? 나노는난쟁이를뜻하는그리스어나노스 (nanos) 에서유래하였다. 1나노초 ( ns ) 는 10 억분의 1초를뜻한다. 1나노미터 ( nm ) 는 10 억분의 1m 로서사람머리카락굵기의 10만분의 1, 대략원자 3 4 개의크기에해당한다. 나노기술은 100 만분의 1을뜻하는마이크로를넘어서는미세한기술로서 1981 년스위스 IBM 연구소에서원자와원자의결합상태를볼수있는주사형터널링현미경을개발하면서부터본격적으로등장하였다. 미국 일본등의선진국에서는 1990년대부터국가적연구과제로삼아연구해오고있다. ( 그림 1) 그림 1. 나노입자의크기비교

18 12 나노물질의유해성평가및근로자건강장해예방대책 많은미세입자들도일반적인물질과유사한특성을보이지만, 입자의크기가 점점작아져 100nm, 10nm 의크기로작아지게되면일반적인물리적특징과는 전혀다른특징이나타나게된다. ( 그림 2) 그림 2. 나노입자의크기

19 I. 서론 13 예를들어일반적인 금 은보통우리가생각하는것처럼노란색을띄지만, 크기가 20nm 이하가되면금은빨간색을띠게된다. 또 은 도나노크기가되면노란색을띠게된다. 이처럼입자가나노크기로작아지면, 색깔과같은물리적성질뿐만아니라화학적성질도크게달라지게된다. 나노입자의크기가나노수준으로작아지게되면결국입자의표면적이급격히증가하게되며표면적의증가로인해입자의반응성이증가하게된다. 표면적이넓기때문에화학반응에유리하게되며따라서나노물질이촉매제로서널리응용될수있다. 예를들면매우안정하여화학반응에잘참여하지않는금은나노크기가되면매우강한촉매반응성을보이게된다. 2) 나노물질의종류 (1) 플러렌 C60 화합물로, 탄소원자 60 개가서로연결되어마치축구공모양으로생긴분자구조이다. 탄소 60 개로만들어진플러렌 (C 60 ) 이외에탄소 70 개 (C 70 ), 탄소 84개 (C 84 ) 로만들어진다양한탄소수의플러렌이합성되었다. 현재광선역학요법을이용한항암제, 항에이즈제등의의약품, 수명이긴리튬이온전지, 연료전지용수소가스저장, 초미세입자인공다이아몬드, 공업용연마제등다양한분야에서쓰이고있다. ( 그림 3) 그림 3. Fullurene 의구조

20 14 나노물질의유해성평가및근로자건강장해예방대책 (2) 탄소나노튜브 탄소 나노튜브 (Carbon Nanotube) 는 1991 년 일본의 스미모 리지마 박사에 의 해 발견된 이후 빠른 속도로 발전하고 있으며, 다양한 응용 가능성을 갖고 있는 획기적인 신소재이다. 구리의 1000배나 되는 우수한 전기전도도, 강철의 100배 수준인 뛰어난 역학적 강도 등 물리적ㆍ화학적ㆍ구조적 특징으로 21 세기를 이 끌어갈 첨단 신소재로 각광을 받고 있다. ( 그림 4) 탄소나노튜브는 벽을 이루고 있는 탄소원자의 결합 수에 따라 구분된다. 우선 단중벽 나노튜브 (Single-wall Nanotube) 는 탄소원자로 구성된 벽이 하나인 튜브 형태로 전기전도성, 열전도성이 가장 우수하다. 탄소원자로 구성된 벽이 두개인 이중벽 나노튜브 (Double-wall Nanotube) 는 전기전도성과 기계적 특성이 뛰어나 며, 다중벽 나노튜브 (Multi-wall Nanotube) 는 하나의 튜브에 탄소원자로 구성된 벽이 여러 겹인 튜브 형태로 전기 및 열적 특성은 다소 떨어지나 기계적 특성 이 우수하고 제조가 용이해 응응범위가 넓다. 이밖에 단일벽 나노튜브가 여러 개 붙어서 다발을 이룬 튜브 형태인 다발형 나노튜브 (Rope Nanotube) 가 있다. 그림 4.. SWCNT( 좌 ) 및 MWCNT( 우 ) 의구조

21 I. 서론 15 (3) 덴드리머덴드리머는그리스어로나무를뜻하는 Dendron" 에서그명칭이유래되었으며고분자화합물의생성반응이자라는나뭇가지처럼뻗어나간다고하여붙여진이름이다. 덴드리머는중심이비어있고외부는다양한화학단위와반응할수있는반응기가존재하며또한일정하게반복되는단위구조가추가되어성장하므로이러한합성방법을이용하면덴드리머의분자량이나표면작용기를조절할수있게된다. 이러한특성으로인해덴드리머를약물을선택적으로운반하는데사용할수있다. ( 그림 5) 그림 5. 덴드리머구조 (4) 양자점양자점 (quantum dot) 은나노크기의 II-IV 반도체입자 (CdSe, CdTe, CdS 등 ) 이중심을이루는입자이다. 양자점은약 2 10nm 크기의중심과주로 ZnS 등으로이루어진껍질 (Shell) 로구성되며수용액상에분산시키기위해고분자코팅을한 10 15nm 크기의나노입자이다. 고분자의외부에는용도에따라여러가지연결기가결합되어있는데, 현재세포또는생체분자와의특이적반응을

22 16 나노물질의유해성평가및근로자건강장해예방대책 일으키기위한연결기가결합된양자점이가장많이시판되고있다. 양자점의들뜬상태의전자가전도대에서가전자대로내려오면형광이발생하게되는데이런특이하고유용한광학적성질때문에기초적물성연구및다른물질과의상호작용연구가활발히진행되고있다. ( 그림 6) 그림 6. 양자점모식도 (5) Titanium Dioxide 널리사용되는무기색소물질로, 마이크로크기의 TiO 2 가루는이미표면코팅이나, 종이, 플라스틱등에사용되고있다. 작은나노입자에는강한자외선차단능이있어, 자외선차단제의성분으로사용되고있다. (6) 금속나노입자가 ) 금나노입자퍼듀대학교농업및생물학공학과조셉이루데이아라즈교수와공동연구원들은금나노입자를유방암세포의단백질마커로이용하여향후암을진단하고치료하는도구로사용할수있는가능성을보여주었다. 또다른연구로조지아텍과샌프란시스코캘리포니아대학연구진은구형금나노입자를막대로모양을바꿈으로써암세포를보다효과적으로찾아내고죽

23 I. 서론 17 일수있는새로운방법을개발해냈다. 이는유방암처럼피부밑에숨어있는암세포를찾아내어, 건강한세포에는영향을주지않고레이저로암세포를파괴할수있었다고발표하였다. 금나노입자나나노로드 (nanorods) 는세포표면에특정마커에결합하도록설계된것으로바이러스보다작은크기를가진다. 연구원들은세포외부의단백질에있는표면마커를분석하여세포의다양한정보를얻었다. 이러한분석을통하여특정암세포에대한아주중요한정보를얻을수있게되었다. 나 ) 은나노입자 ( 가 ) 은나노의개요은 (Ag) 은전자파차단에탁월한효과가있을뿐만아니라, 전도율이다른금속에비해서높다. 또주변환경의오염도에따라민감하게변화되는반응을보이고항균, 살균, 방취기능이우수한특징을지니고있다. 특히 650 가지이상의세균을죽이는것으로알려져있다. 은파우더는이미미국 FDA 로부터살균제로승인을받았다. 특히은이가지고있는항균, 살균, 방취기능은나노화시키면더욱더강력한항균, 살균, 방취기능을한다. 연구결과에의하면 650 종의세균과바이러스를멸균할수있으며유해균, 곰팡이균, 무좀균, 알레르기성균등에번식억제및살균기능이탁월하여최근문제가되고있는병원내에서의 2차감염도방지할수있다. 은나노의향균작용메커니즘은아직명확하게밝혀지지않았으나, 다음 3가지의기전에의해항균작용을나타내는것으로알려져있다. ( 표 1) 나노화된은은우수한자외선차단기능을가지고있어서섬유, 화장품, 선글라스등에응용하는것도가능하다. 은나노는전자파차폐기능뿐아니라, 뛰어난전기전도성을가지며정전기

24 18 나노물질의유해성평가및근로자건강장해예방대책 발생방지에도큰역할을한다. 또한은처리가된면과안된면과의기온차이가나는걸이용하여항온및단열기능도가능하다. 무엇보다도은나노는다양한기능과함께대량생산이가능하다는특징을가지고있어앞으로응용범위가넓어져여러산업분야에적용및활용이무한히가능한것으로평가받고있다. 표 1. 은나노의향균작용메커니즘 ( 한국특허정보원 ) 항균작용기전 은의 양이온 (Ag+) 에 의한 항균 및 살균작용 활성산소에 의한 살균작용 금속 (Metal) 으로서의 항균 및 살균작용 내용 세균의 -SH 기, -COOH 기,-OH 기 등과 강하게 결합하여 세균의 세포막을 파괴 또는 세포의 기 능을 교란시키는 것으로 추정 콜로이드 은이 촉매작용을 하여 산소가 활성산 소로 전환되어 살균작용을 발휘하는 것으로 추 정 100nm 200nm 정도의 미생물이 이를 섭취가 가능하고, 섭취시 호흡기 장애 및 대사장애로 균이 죽는다고 추정 A. 은나노물질의이용현황 1 기능성식품및생활용품 치약, 칫솔, 비누, 샴푸, 주방세제및세탁세제, 아토피성피부질환치료제, 구 강악취제거제, 목욕첨가제, 화장품 2 의약품가려움증치료제, 습진, 무좀치료제, 의약품보관용기, 무균제품, 소독및살균제, 항생제, 비염치료제, 감기치료제

25 I. 서론 19 3 섬유제품침대및이불베게, 모포등침구류옷감류, 마스크양말, 운동화, 실내화, 구두깔창정수기필터 4 가전제품 냉장고, 세탁기, 전자파차단용 5 식품위생제품 식품포장지, 항균용기 3) 나노기술응용분야 (1) 전자 / 통신ㆍ낮은전력소모, 저생산비용을갖고백만배이상의성능을갖는나노구조의마이크로프로세서소자ㆍ10 배이상의대역폭과높은전달속도를갖는통신시스템ㆍ현재보다수천배크고크기는작은대용량정보저장장치ㆍ대용량정보를수집처리하는집적화된나노센서시스템ㆍ정보저장, 메모리반도체, 포켓사이즈슈퍼로보트 (2) 재료 / 제조ㆍ기계가공하지않고정확한모양을갖는나노구조금속및세라믹ㆍ분자단위에서설계된고강도의소재, 고성능의촉매ㆍ뛰어난색감을갖는나노입자를이용한인쇄ㆍ나노크기를측정할수있는새로운표준

26 20 나노물질의유해성평가및근로자건강장해예방대책 ㆍ절삭공구나전기적, 화학적, 구조적응용을위한나노코팅 (3) 의료ㆍ진단학과치료학의혁명을가능케하는빠르고효과적인염기서열분석ㆍ원격진료및생체이식소자를이용한효과적이고저렴한보건치료ㆍ나노구조물을통한새로운약물전달시스템ㆍ내구성및생체친화력있는인공기관ㆍ인체의질병을진단, 예방할수있는나노센싱시스템 (4). 생명공학ㆍ하이브리드시스템의합성피부, 유전자분석 / 조작ㆍ분자공학으로제작된생화학적으로분해가능한화학물질ㆍ동식물의유전자개선ㆍ동물에의유전자와약물공급ㆍ나노배열에기반한분석기술을이용한 DNA 분석 (4) 환경 / 에너지ㆍ새로운배터리, 청정연료의광합성, 양자태양전지ㆍ나노미터크기의다공질촉매제ㆍ극미세요염물질을제거할수있는다공질물질ㆍ자동차산업에서금속을대체할나노입자강화폴리머ㆍ무기물질, 폴리머의나노입자를이용한내마모성, 친환경성타이어

27 I. 서론 21 (5) 국방ㆍ무기체계의변화 ( 소형, 고속, 장거리이동 ) ㆍ무인원격무기 ( 무인잠수함, 무인전투기, 원격센서시스템 ) ㆍ은폐 (Stealth) 무기 (6) 항공우주ㆍ저전력, 항방사능을갖는고성능컴퓨터ㆍ마이크로우주선을위한나노기기ㆍ나노구조센서, 나노전자공학을이용한항공전자공학ㆍ내열, 내마모성을갖는나노코팅 그림 7. 응용연구분야별나노재료세계시장규모전망 (( 주 )Business Communications Co. Inc 보고서에서발췌 )

28 22 나노물질의유해성평가및근로자건강장해예방대책 2. 나노물질의국내외사용현황 1) 국내사용현황 (1) 은나노사용의예가 ) 은나노가전은나노의가장대표적인적용예가은의살균, 항균, 탈취효과를가전제품에접목한것인데이는 웰빙가전 의하나인트렌드로자리잡은이른바 은나노가전 이라고불리는것으로, 현재냉장고, 에어컨, 가습기, 세탁기, 청소기, 공기청정기등의다양한제품에적용되고있다. 나 ) 은나노건축자재새집증후군이란집이나건물을새로지을때사용하는건축자재나벽지등에서나오는유해물질로인해거주자들이느끼는건강상문제및불쾌감을이르는용어이다. 여러휘발성유기화합물이배출되는데여기에는벤젠, 톨루엔, 클로로포름, 아세톤, 스틸렌, 포름알데히드등의발암물질이포함되어있다. 라돈, 석면, 일산화탄소, 이산화탄소, 질소산화물, 오존, 미세먼지, 부유세균과같은오염물질도포함되어있다. 사람이이러한오염에짧은기간노출이되면두통, 눈 코 목의자극, 기침, 가려움증, 현기증, 피로감, 집중력저하등의증상이생길수있다. 그러나오랜기간노출이되면호흡기질환, 심장병, 암등의질병이나타날수도있다. 따라서이러한피해를줄이기위해서는화학물질을함유하고있는마감재대신친환경소재를사용해야한다. 은나노기술의발전은건축내장재로부터방출되는유해물질의차단과제거를위해활용된다. 도료, 바닥재, 시멘트, 벽지, 접착제등에은나노성분을첨가하여친환경적소재로사용하고자하는시도가늘어나고있다.

29 I. 서론 23 다 ) 은나노섬유아토피성피부염환자가점차늘어남에따라섬유에은나노기술을적용하는기술의연구가진행되고있다. 은의항균, 살균, 탈취효과및정전기방지, 전자파차단효과를활용하기위해원사나원면에나노를적용한기능성섬유를생산하고있으며, 속옷, 양말, 신발, 스포츠의류등에은나노를함유한기능성의류제품들이생산되고있다. 라 ) 기타생활용품밴드, 치약, 비누, 티슈, 냅킨, 화장품및생활용품의약품, 의료기, 위생용품등다양한영역에은나노기술이적용되고있다. (2) 은나노제품의국내시장규모가 ) 국내은나노원료시장관세청의수출입현황을참고하여국내은나노원료의시장을살펴보면, 은나노응용제품의원료로쓰이는은나노용액의수출입현황이 2001 년 140kg, 2002 년 230kg 정도소량수입되던것이 2004 년에이르러서는 1kg 으로급격히감소하였고, 2002년에 10kg정도수출되던것이 2003년 370kg, 2004년 6013kg으로 20 배가량증가한것으로나타났다. ( 표 2, 그림 8) 표 2. 관세청, 품목별수출입 ( 단위 : kg) 2002 년 2003 년 2004 년 2005 년 2006 년 수입 수출 ,272

30 24 나노물질의유해성평가및근로자건강장해예방대책 관세청, 은나노용액수출입현황 ( 단위 : kg) 2006 년 , 년 수출수입 년 그림 8. 은나노용액수출입현황 ( 관세청 ) 나 ) 국내은나노제품시장현재국내에시판중인은나노기술적용제품중냉장고와드럼세탁기등이소비자들이쉽게인식하여받아들이면서가장큰규모의시장이형성되었다. 많은종류의드럼세탁기에는은나노향균기능이탑재되어있으며, 양문형냉장고에도은나노기능이탑재되어있는것이많다. 전체세탁기의연간규모는 2002 년 125 만대에서 2003년 130만대, 2004년 132 만대의규모로소폭상승한데반해드럼세탁기의규모는 2002 년 20 만대에서 2003년 45만대, 2004년 65만대의규모로상승폭이큰것으로나타났다. ( 표 3, 그림 9) 현재양문형냉장고와세탁기, 에어컨, 공기청정기, 정수기, 스팀청소기등의가전제품에는은나노기술이적용되어시판중에있으며, 소비자로부터큰호응을얻고있다. 또한김치냉장고에은나노기능을접목시킨다면새로운시장형성과꾸준히늘고있는수출에도영향이있을것으로전망된다. 휴대용전화기의 LCD 판과폴더형의연결선에은나노기술을적용하여항균및전자파차단

31 I. 서론 25 기능으로시판중에있으며 LCD 모니터또한상용화되어있다. 향후자동차카바나에어필터에은나노기술의접목이확실시되며현재시판중인치약에도은나노가함유된제품의점유율이높아질것이라전망된다. 표 3. 통계청광공업동태조사 ( 단위 : 천대 ) 생산량 수출량 생산량 수출량 생산량 수출량 생산량 수출량 양문형냉장고 2,435 1,344 2,111 1,231 2,229 1,426 2,739 1,798 김치냉장고 2, , , , 세탁기 4,183 2,676 4,977 3,504 5,226 3,790 5,665 4,173 룸에어컨 6,466 5,585 5,722 5,278 5,804 5,285 3,529 2,542 정수기 휴대용전화기 107,031 92, , , , , , ,593 자동차용카바 12, , , , 치약 35,800 t 3,298 t 33,818 t 3,014 t 34,341 t 2,043 t 32,286 t 958 t 칫솔 108,628 2, ,523 6, ,029 8, ,888 11,862 운동화 22,295 11,252 15,502 4,887 13,792 2,987 10,985 2,596 다 ) 국내특허출원현황특허청조사에의한연도별은나노기술의특허출원동향을보면 2002 이전에는은용액제조분야에은나노기술의연구활동이활발히이루어졌으며, 부분적으로은나노섬유에대한연구가진행되었음을알수있다 년부터가전제품이나건축자재에은나노기술을접목시키기위한연구활동이진행되었으며, 삼성전자등가전업체들이은나노기술을적용하기시작했다. ( 표 4, 그림 10)

32 26 나노물질의유해성평가및근로자건강장해예방대책 은나노기술적용제품의국내시장규모 250, , , ,000 50,000 0 생산량수출량생산량수출량생산량수출량생산량수출량 양문형냉장고 김치냉장고 세탁기 룸에어컨 정수기 휴대용전화기 자동차용카바 치약 칫솔 운동화 그림 9. 은나노기술적용제품의국내시장규모 ( 통계청 ) 그림 10. 연도별은나노기술출원동향 ( 특허청자료 )

33 I. 서론 27 표 4. 특허청국내특허출원현황 연도 종류 은나노가전은나노섬유은나노건축자재은용액제조 2000 년 이전 년 년 8(9.8%) 17(20.7%) 4(4.9%) 22(26.8%) 2003 년 29(33.3%) 20(23.0%) 10(11.5%) 4(4.6%) 2004 년 11(16.4%) 15(22.4%) 4(6.0%) 5(7.5%) () 는 당해 년도 은나노 기술 관련 전체 출원 건수 대비 백분율 2) 국외사용현황 2006년세계나노재료시장의규모는 140억달러를넘어섰고, 2008년엔 214 억달러에이를것으로예상되고있다. 나노재료에는카본블랙고무분산체, 촉매변환기재료및은나노분체재료등이포함되며, 현재세계나노기술시장매출액의약 97.5% 를차지하고있다. 이중에서전자재료, 자성재료, 광전자에대한응용이약 74.2% 를차지하며, 그밖에바이오의약품, 제약및화장품등이 16%, 에너지, 촉매제및구조재료등이 9.8% 를점유하고있다. Nanotechnology Consumer Products Inventory 에따르면현재가장많이사용되고있는나노소재는탄소이며, 은나노물질이탄소나노물질에뒤이어두번째로많이쓰이고있는것으로조사되었다. ( 그림 11) 나노분체는현재나노재료시장의가장큰부분을차지하고있다. 그러나, 탄소나노튜브가가장성장이빠른나노재료이며, 그다음이나노복합재료이다 년고분자나노복합재료의전세계시장규모는 2.11 억달러에이를것으로전망된다.

34 28 나노물질의유해성평가및근로자건강장해예방대책 한편 2008 년에는나노재료의세계나노기술시장점유율이 74.7% 로하락할것으로예상되며, 나노장비는 12 억달러, 나노소자는시장점유율 21% 로 60 억달러에이를것으로전망된다. 현재열가소성및열경화성나노복합재료의생산량은서로비슷한수준이다. 2008년에는열가소성재료가시장생산량의 77% 를차지할것으로전망되는데, 그이유는이런종류의제품이부가가치가높고, 또고가제품에응용이가능하기때문이다. 그림 11. 나노물질의종류별사용현황 (Maynard, 2006)

35 I. 서론 나노물질이인체에미치는영향및위해성 1) 나노물질이인체에미치는긍정적인영향 (1) 의료 및 보건 가 ) 암의 진단 암이 발생한 후 종양이 지속적으로 커질 수 있는 것은 암 덩어리 주변으로 새 로운 혈관들이 생겨 암 세포에 지속적으로 영양을 공급하기 때문이다. 이렇게 생기는 신생혈관은 정상 조직의 혈관에 비해 혈관벽에 구멍들이 많으며, 이러한 물리적 특성을 이용하여 나노 물질을 암의 진단과 치료에 활용하게 된다. ( 그림 12) 암 주변에 생기는 신생혈관에 잘 들어갈 수 있는 물리적 특성을 가진 나노 물질을 자기공명장치로 영상을 얻으면, 현재의 영상장비로 진단할 수 없는 초기 단계의 암도 진단할 수 있게 된다. 이러한 나노 물질의 물리적 특성뿐만이 아니 라 암 세포에 친화성을 가진 각종 화학약물을 나노 물질 내에 실어서 보다 더 암 세포에 선택적으로 축척하게 하는 기법들도 개발 중에 있다. ( 그림 13) 이러한 진단 기법은 초기 암의 진단뿐만이 아니라 치료 전 후에서 암의 미세 전이를 보다 쉽게 진단하게 되어 치료의 방향을 결정하는데 많은 도움을 줄 수 있다. 나 ) 암의 치료 나노 물질을 암 세포에 선택적으로 침투시켜 진단하는 기법은 바로 치료 과정 으로 연결될 수 있다. 암 세포에 선택적으로 침투하는 나노 물질 내에 항암제나 광감작제를 실어 보내면 정상 세포에는 영향을 최소화하면서 암 세포만을 선택 적으로 파괴하는 새로운 개념의 항암 치료나 광역학치료가 가능하게 된다. 또한, 수술 중 암세포에 침착시킨 나노물질들을 형광 장치 등을 이용하여 암 의 경계를 직접 볼 수 있게 하여 수술의 정확도를 높일 수도 있다. ( 그림 14)

36 30 나노물질의유해성평가및근로자건강장해예방대책 그림 12. 나노물질을이용한암의진단및치료 그림 13. 나노물질을이용한약물전달시스템

37 I. 서론 31 그림 14. 나노물질을이용한암의조영 다 ) 약물의변화치료의목적에맞게제조한나노소재를이용한약제는혈액- 뇌장벽, 혈액- 폐포장벽등을잘통과하게할수있어기존의약제가침투하기어려운곳에도효과적으로약제를전달하여치료효과를높일수있다. 항암제는암세포에선택적으로침투하게하고, 항생제는표적세균을잘찾아가게하는새로운개념의약제개발이가능하게된다. ( 그림 15) 약제의투여경로역시상당히많은주사제가경구용약제로변환이가능할것이며, 흡입형, 연고형등의약제가더욱발전하리라생각한다. 라 ) 원격진료 IT 기술과의연계를통하여혈당치를실시간으로의료기관에전송, 관리하는등각종원격의료의폭이넓어질것으로예측된다. 마 ) 인공보형물나노소재를활용한각종생체용보형물의개발이활발해질것으로예측된다. 인공심장판막, 인공뼈, 치아보형물등의표면을사용될조건에맞게나노물질로표면가공하면생체적합성과내구성을보다증가시킬수있다. 이분야

38 32 나노물질의유해성평가및근로자건강장해예방대책 의발전은폴리머기술, 약제전달기술과의융합을통하여재생의학의발전에큰 기여를하리라예측한다. 그림 15. 표적지향적나노의약품의제조 바 ) 인공장기, 혈액혈관질환의진단조직공학기법을이용한인공장기및인공혈액제재의개발에도역시나노소재의활용도가높아질것으로판단된다. 사 ) 의료기기의개발나노크기의주사침을이용한인슐린주사기등다양한형태의의료기기개발에활용될수있다.

39 I. 서론 33 2) 나노물질이인체에미치는독성 (1) 안전성측면에서본나노물질의특성나노물질은나노미터크기의범주에서조작 분석하고이를제어함으로써새롭거나개선된물리적, 화학적, 생물학적특성을나타내는소재, 소자또는시스템을말하며, 이를만들어내는과학기술을나노기술이라하고, 이를이용하여새로운기능, 뛰어난특성을이끌어내는기술을나노소재기술이라고한다. 최근나노 ( 소재 ) 기술이미래의기술로각광받고, 다양한분야에서나노물질을이용한제품이개발되고이를활용하려는시도는나노물질이갖고있는고유한물리화학적특성중크기, 모양, 표면화학적성질등에기인한다. 하지만나노물질의이와같은성질은나노물질의인체영향이기존물질의그것과전혀다른새로운형태로나타나게하며, 이런점들은지금까지의독성학적이론을벗어난새로운개념의정립을요구하고있다. 나노물질의독성은다음의몇가지면에서기존의독성학적개념과일치하지않는부분이있다. 첫째, 기존의용량-반응관계와달리서로다른크기의나노입자의독성은용량보다표면적에더큰영향을받는다. 예를들어생쥐에게서로다른크기의 TiO 2 입자를주었을때염증유발효과는같은용량을주더라도입자의크기에따라독성이다르게나타나며, 입자의크기에관계없이표면적이같으면같은정도의독성이나타난다. (Oberdorster, 2005) 일반적으로입자가나노사이즈로되면질량대비표면적이급격히증가하며, 화학반응에서의촉매역할을수행하기좋은환경을제공한다. 따라서나노입자의독성을평가할때에는중량뿐아니라표면적도고려해야한다. 둘째, 같은나노물질이라도뇌- 혈액관문을통과할수있는능력은표면전하에큰영향을받는다. 즉, 같은종류, 같은크기의나노물질도표면전하에따라신

40 34 나노물질의유해성평가및근로자건강장해예방대책 경계에미치는영향은다르게나타난다. (Lockman, 2004) 셋째, 나노물질의독성은크기뿐아니라그모양에도영향을받는다. 예를들면단층탄소나노튜브 (SWCNT; 1 4 nm), ultrafine carbon black (UfCB; 14.3 nm), SiO 2 (2.14 μm) 에의한폐의염증및섬유화는입자의크기와형태의영향을받는다. (Shevdova, 2005) 현재까지나노물질의독성및위해성에관한연구보고수준은아직초보적인수준이고지금까지많이연구된미세입자들은나노입자보다크기가수십 수천배크며실제나노기술로만들어진물질은이러한미세입자단일성분으로구성된것이아니기때문에나노물질의독성을기존의독성학적개념으로이해하기는상당히어렵다. 따라서나노기술의발달로나노독성학이란새로운영역이만들어졌으며이분야의연구는새로운패러다임의정립이필요한분야이다. 본보고서에서다루고자하는궁극적인내용은나노소재에의한인체건강영향이이지만건강영향을평가하기위해서는나노물질의위해성평가 (risk assessment) 가선행되어야하고, 위해성평가를위해서는나노물질의유해성 (hazard) 과노출 (exposure) 에관한정보가충분히제공되어야하는데아직이에대한충분한데이터가축적되어있지않다. 따라서본보고서에서는나노물질이사람에게노출될수있는경로에따른흡수의특성을살펴보고, 흡수되었을때발생할수있는독성을중심으로기술하고자한다. (2) 나노물질의호흡기를통한흡수에따른건강영향 -호흡기독성가 ) 호흡기노출에따른나노물질의흡수나노물질이독성학적측면에서중요한가장큰이유는나노물질의미세한입자크기와이에따른표면적의증가이다. 호흡기를통한독성발현에서가장중요한요인중하나는흡입된입자의폐포도달가능성인데, 그림 16 에서보듯이 1nm 입자는 90% 가코와상기도부위 (nasopharyngeal region) 에, 10% 가기도및

41 I. 서론 35 기관지부위 (tracheabronchial region) 에침착되며폐포에는전혀도달하지못하는반면, 5nm 의입자는세부분에고루 ( 약 30% 씩 ) 분포하고, 20nm 정도되면폐포에 50% 정도도달할수있어크기를기준으로보면가장큰독성을유발할수있는조건이다. 그림 16. 입자상물질의호흡기노출시크기에따른예상침착부위 (ICON, 2004) 일반적으로폐포에도달된입자상물질은폐포대식세포에의해처리되고이는다시호흡기의점막과섬모에의한기계적배출기전 (mucociliary escalation) 에의해체외로배출된다. 입자의폐포에서의반감기는흰쥐에서 70 일사람에서 700일정도되는데얼마나빨리처리되는가는대식세포가입자상물질을얼마나잘감지하여그곳으로이동하는가에달려있어보통입자침착후 6 12 시간정도면대식세포에의해처리되기시작한다. 대식세포가입자를처리하는속도는입자의크기에비례한다. 그림 17 에서보는바와같이입자가작을수록폐포대식세포에의해감지되어처리되는효율은떨어지고반대로폐의상피세포나간질액에흡수되는비율은높아진다.

42 36 나노물질의유해성평가및근로자건강장해예방대책 그림 17. 흡입된입자상물질의크기별대식세포처리효율 (A) 및폐잔존비율 (B) (Oberdorster et al, 2005) 나 ) 나노물질에의한산화스트레스및염증반응유발폐로흡수된나노물질에의해산화스트레스와염증반응이유발되는것은많은연구에서보고되고있다. 무독하다고알려진 polystyrene (64nm) 은동물실험과세포실험모두에서호흡기염증과관련된다양한지표를변화시켰고염증유발의원인으로알려진활성산소종의생성을증가시켰다. 특히폐에서염증세포의증가는투여한 polystyrene 의표면적에비례하였다. (Brown, 2001) 나노입자가염증발현유전자의전사에미치는영향은 ( 그림 18) 에나타난바와같다. 나노입자는산화스트레스를유발하고그결과지방과산화물이나산화형글루타치온을생성한다. 이와같이세포내의산화환원평형이산화쪽으로변화하게되면다양한반응이일어나게되는데그중하나는염증반응의중요한조절물질인 NF-kB 의활성화와이에의해조절되는많은염증관련단백질 (TNFα, IL-8, IL-2, IL-6, GM-CSF, ICAM-1, E-selectin 등 ) 의합성이다.

43 I. 서론 37 그림 18. 나노물질에노출된세포에서산화스트레스및염증반응의유발 (Donaldson et al. 2002) 다 ) 나노물질에 의한 호흡기 독성 흰쥐에서 미세한 나노 입자가 같은 화학물질로 된 보다 큰 입자에 비해 호흡 기 독성을 증가시킨다는 여러 연구결과가 보고된 바 있다. 입자의 크기와 표면 적이 미치는 영향을 고려하여 수행한 몇 가지의 연구결과를 종합해보면 다음과 같다 (Tsuji, 2006) nano quartz particle (50nm) 는 fine quartz particle (400nm) 에 비해 호흡기 독성이 훨씬 강하다. 즉, 같은 용량을 투여했을 때 나타나는 호흡기 독성은 입자의 크기에 반비례한다. nano-sized TiO 2 (250nm 30nm), fine-sized TiO 2 (300nm), TiO 2 nanoscale dot particle (10nm) 의 호흡기 독성에는 큰 차이가 없다. 즉, 입자의 크기가 독성을 결정하는 단독 요인은 아니다. alumina 와 amorphous silica 를 처리한 TiO 2 는 그렇지 않은 TiO 2 에 비해 호 흡기 독성이 증가한다. 즉, 노출표면의 처치는 입자의 독성을 변화시킬 수 있다.

44 38 나노물질의유해성평가및근로자건강장해예방대책 따라서 나노물질은 다음의 다양한 요인에 서로 다른 정도의 호흡기 독성을 유 발한다. - 입자의 수와 크기 분배 - 표적장기로의 분포 - 입자의 표면 처치 - 나노 입자의 응집되는 정도 - 입자의 표면 극성 - 입자 형태와 전자적인 잠재성 - 입자 형성 방법 (3) 나노물질의 호흡기를 통한 흡수에 따른 건강영향 - 신경 독성 가 ) 나노물질의 호흡기 흡수를 통한 신경계로의 이동 1940년 초 Bodian 과 Howe 는 30nm polio virus 를 침팬지와 레서스원숭이 에 비강흡입시키는 연구를 하였다. 이 연구를 통해 후각신경과 후각망울이 코를 통해 흡입된 나노입자들이 신경계로 유입되는 경로임을 밝혔다. (Howe, 1940) Oberdörster 는 Rat을 13 C 입자 (36nm) 가 포화된 챔버에 넣어 6시간 동안 노출시켰다. 그리고 폐, 후각망울, 소뇌를 채취하여 13 C analysis 를 수행하였 다. 그 결과 흡입 후 1일 째에 후각망울에서 13 C가 유의적으로 증가했으며 다른 장기들과 달리 7일 째까지 지속적으로 증가했다. (Oberdorster, 2004) Rat에게 Mn oxide (3 8nm) 에 6hr/days, 5days/week 로 노출, 흡입시켜 6 일째 12 일 째 폐와 뇌조직을 분리하여 분석한 결과 후각망울에서 가장 높았 으며 뇌의 여러 조직에 축적되는 것을 확인하였다. ( 그림 19, Edler, 2006)

45 I. 서론 39 그림 19. MnO2 aerosols (3 8 nm) 을흡입시킨후폐, 후각망울및뇌의각조직에서 Fe과 Mn 농도 (Edler, 2006) 나 ) 나노물질의신경계이동에있어서입자크기의중요성호흡기를통해나노물질이신경계로유입되는정도는입자의크기에따라다르며, 입자가큰경우에는앞에서서술한경로에따라유입되지않음이밝혀졌다. 이는이전의연구들에서전자현미경을통해후각신경을관찰한결과신경돌기 (axon) 의직경이 nm 에불과하기때문이다. ( 그림 20) 다 ) 나노물질의신경독성나노입자가신경계에어떤영향을미치는지에대한연구는아직까지는많이이루어져있지않으나점차나노입자의독성학이주목을받으면서최근나노입자의신경독성에대한발표들도나오고있다. Campbell 은대기오염으로인한입자들에대한노출의증가가흰쥐의뇌에어떤영향을미치는지면역에대한지표들의증가를가지고연구를하였다. 흰쥐를초미세입자와미세입자에노출시켰을때뇌에서의 NF-κB, TNF-α, IL-1 등염증관련지표가모두증가하는것을확인하였다. ( 그림 21)

46 40 나노물질의유해성평가및근로자건강장해예방대책 그림 20. 작은크기의 MnO 2 (1.6 μm) 와큰크기의 MnO 2 (18 μm) 를흡입한후조직에서 Mn 농도 (OB: olfactory bulb, CX: cortex, CB: cerebellum, BS: brain stem, DC: diencephalon, and BG: basal ganglia) (Elder et al.2006) 그림 21. 초미세입자에노출시킨쥐의뇌에서 NF-kB (A),TNF-α (B) 및 IL-1 (C) 의변화 ] (Campbell et al. 2005)

47 I. 서론 41 라 ) 나노물질의신경독성분자지표개발연구동향 ( 가 ) 나노물질에의한신경계독성. 다양한나노입자가신경세포내기관들과유전자의작용에독성을나타낸다는보고들이있다 2006년 Saber M. Hussain 은 manganese 및 Ag 나노입자들이 in vitro 상에서 neuron cell 과상호작용을통해 dopamin 을고갈시키며 10 배이상의활성산소종을생성시켜나노입자가암을유발시킬수있는가능성을시사했다. ( 그림 22, 23, 24 Saber et al., 2006) 그림 22. mitochondrial function 에미치는나노입자의영향 (Saber et al., 2006) 그림 23. 신경전달물질의분비에미치는나노입자의영향 (Saber et al., 2006)

48 42 나노물질의유해성평가및근로자건강장해예방대책 그림 23. 신경전달물질의분비에미치는나노입자의영향 (continued) 그림 24. 활성산소종형성에미치는나노입자의영향 (Saber et al., 2006) ( 나 ) TiO 2 나노입자에 노출된 brain microglia 세포에서 활성산소종 형성. Thomas C. Long (2006) 은 산화적 스트레스성 손상에 민감한 뇌를 표적으 로 나노크기의 titanium dioxide 가 뇌에서 활성산소종을 짧은 시간에 지속적 으로 생성시키고, 뇌세포에 즉각적인 oxidative burst response 를 일으킬 뿐

49 I. 서론 43 아니라, 미토콘드리아에너지형성기능을방해한다고보고했다. ( 그림 25, 26) 그림 25. TiO 2 노출후시간에따른뇌세포 (microglia) 의 mitochondria 에미치는영향 (Thomas C. Long,2006) 그림 26. TiO2 나노입자노출후 H2O2및 O2- 생성 (Thomas C. Long, 2006) (4) 나노물질의피부를통한흡수에따른건강영향가 ) 물질투과의장벽으로피부의역할피부는인체에서가장큰장기이면서외부물질에가장먼저노출되는경로이기도하다. 피부는표피와진피로나누어지며표피는다시각질층, 유극층, 기저층으로구성되어있다. 이들은물질투과에대한보호역할을하므로일반적인상

50 44 나노물질의유해성평가및근로자건강장해예방대책 황에서피부는외부물질에노출되었을때튼튼한장벽의역할을한다. 나노물질의경우, 경피흡수를위한약물전달체에응용되고있으며, 피부보호를위한제품에 zinc oxide 나 titanium oxide 등이포함되어사용되고있기때문에, 나노물질에대한피부노출은상당한중요성을가진다고할수있다. 나 ) 나노물질의피부투과 Tinkle (2003) 등은 beryllium 이흡수되는경로로써피부를가정하고공초점현미경을통해 μm 입자를관찰하였다. 피부를비튼상황에서 Be 입자는각질층을통과하여표피혹은진피까지도달한다. 그림 27. FITC- 포합된 dextran bead (red) 의공초점현미경사진. (A) 1μm bead 는 30 분간접촉후각질층 -표피경계에서관찰. (B) 1μm bead 는 60 분간접촉후표피와진피에서도관찰 ( 황색화살표는 beads 의 cluster). (C) 0.5μm bead 는 30 분간접촉후표피에서관찰. (D) 4μm bead 는피부표면에서관찰. (E) 각질층이손상받은경우 0.5μm bead는직접통과. (Tinkle et al, 2003)

51 I. 서론 45 진피에도달한입자가전신순환계로이행하는가하는실험도진행되었는데, Oberdorster 등은석면섬유가임파절로흡수되어전신순환계로이행하는것을관찰하였다. 피부가손상받은경우에는각질층이보호장벽으로작용할수없으므로위에서언급한입자보다훨씬큰입자들까지도피부를통해서흡수될수있다. ( 그림 27) 다 ) 나노물질의피부독성 ( 가 ) titanium oxide에의한피부의독성 anatase TiO 2 (20nm; m 2 /g; 그림 28A) 와 rutile TiO 2 (3.2nm; 112 m 2 /g; 그림 28C) 를비교해보면 rutile TiO 2 는 anatase TiO 2 에비해입자크기가작지만응집력이강해밀집되고큰형태를띠어표면적은거의비슷하다. anatase TiO 2 와 rutile TiO 2 가인간의피부섬유아세포에미치는독성을비교해본결과 anatase TiO 2 는 rutile TiO 2 에비해 100 배정도강한세포독성이나타났고이는 anatase TiO 2 의활성산소종생성과밀접한관계가있음이확인되었다.(Sayes, 2006) 그림 28. TiO 2 의전자현미경사진. anatase (A), anatase/rutile (60/40) (B), rutile TiO 2 (C) (Sayes, 2006)

52 46 나노물질의유해성평가및근로자건강장해예방대책 ( 나 ) 탄소나노입자에의한피부의세포독성탄소나노튜브와같은나노입자는넓은표면적을가지며, 높은전기전도도와강도를갖는다. multi-wall carbon nano-onions (MWCNO) 와 multi-wall carbon nanotubes (MWCNT) 를인간의피부섬유아세포에노출시켜나노물질의독성기전을연구해본결과탄소나노입자는농도의존적이지는않지만명백히세포생존율에영향을미치고동일한실험계에서염증반응에관여하는유전자의발현을변화시켰다. (Ding, 2005) MWCNT 와 MWCNO 사이의독성차이를살펴보면, MWCNT 가세포에더큰영향을주는것으로생각된다. 이러한결과를종합해볼때, 탄소나노입자의세포독성은나노물질자체의구조와노출양등이모두중요한인자로서작용한다고생각할수있다. ( 다 ) 탄소나노입자에의한피부의염증유발 MWCNT 를인간의케라틴형성세포에처리하여 cytokine 의분비와노출시간에따른독성변화를연구하였다. 이실험에서나노입자는노출시간에비례하여자극의지표인 IL-8 이증가하는경향을보이고, 용량의존적으로세포의생존율이감소하고있음이확인되어탄소나노입자가피부자극을일으킨다고추론할수있다. 노출시간에의존적으로독성이증가한다는것은 MWCNT 가축적효과를나타낸다고생각할수있다. (Monteiro-Riviere, 2005) (5) 나노물질의경구흡수에따른건강영향가 ) 나노물질의경구노출경로나노물질이경구로노출될수있는경로는크게두가지로, 첫째는호흡기로노출된나노물질이인후부나기관지에걸려기계적으로배설되면서다시소화기계로다시유입될수있고, 둘째는나노물질을함유한음식, 물을섭취하거나나노물질을이용한화장품, 의약품혹은약물전달체를복용하는것이다.

53 I. 서론 47 나 ) 나노물질의경구흡수 아직나노물질의경구투여에따른독성을시험한연구결과는많지않으나대 부분의경우나노물질이소화기를통과하여빠르게배설된다고알려져있다. PEG 와알부민으로수용화한플러린 (fullerene) 을경구로투여한경우 98% 는 48 시간이내에변으로배설되고나머지만뇨로배설되는것으로보아아주소량만이흡수됨을알수있다. ( 참고로같은물질을정맥주사한경우 1 주일후 73 80% 가간에축적되었다.) (Yamago, 1995) 토마토 lectin 을결합시킨 polystyrene 나노입자 (500nm) 을경구투여한경우 23% 가전신으로흡수되었다. (Hussain, 1997) polystyrene 나노입자를이용하여입자크기별흡수를비교해본결과크기가작을수록위장관흡수가증가하였다 (3μm, 0%; 1μm, 0.8%; 100nm, 5.8%; 50nm, 6.6%) (Jani, 1990) 이상의결과를종합해보면나노물질의위장관흡수는입자의표면화학적특 성, 용해도, 입자크기에의해결정되는것을알수있다. (6) 나노물질의생체내이식을통한접촉에따른건강영향나노소재를활용한각종생체용보형물의개발이활발해질것으로예측된다. 인공심장판막, 인공뼈, 치아보형물등의표면을사용될조건에맞게나노물질로표면가공하면생체적합성과내구성을보다증가시킬수있으나이에따른부작용은아직체계적으로연구된바가없다. 따라서나노물질의생체내이식을통한독성발현에관한많은연구가필요하다.

54 48 나노물질의유해성평가및근로자건강장해예방대책 4. 나노물질에대한노출 나노입자의사용이증가함에따라, 작업장에서의노출및일반인에서의노출또한증가하고있다. 일반시민에서의노출은나노물질을함유한제품으로부터의노출되며, 나노물질을사용한선크림이나의복으로부터의노출을대표적으로들수있다. 작업적노출은나노물질을가공, 포장등나노물질을취급하는공정전반에서일어난다. 그예로는나노물질생산챔버의청소시누출, 여과장치의잔유물질누출, 스프레이건조시손실, 공장이나운송중누출사고, 재해등을들수있다. 작업장에서의나노물질생산은대부분밀폐된시스템에서이루어지기때문에, 노출가능성이적고, 포장, 운송, 청소때더노출가능성이높으며, 일반적인나노물질노출에비해고농도로노출될가능성이있다. 표 5 은일반시민과작업장에서의노출발생원, 노출집단, 노출경로등을나타내고있다. ( 윤충식, 2007) Aitken et al 에따르면대학, 연구소나회사에서노출근로자에대한정보를파악할수없는등나노물질에노출되는사람에대한현황에대해서는아직연구결과가부족하여파악되지않고있으며, 국내에서또한나노환경노출에대한기본적조사나작업장에서근로자의노출영향에관한연구가되어있지않다. (Aitken et al, 2007) 현재작업환경에서은에대한노출기준으로 ACGIH(American Conference of Govenmental Industrial Hygienists) TLV : 0.1mg/m 3 가있으나, 나노물질에대한노출기준이없기때문에근로자에서의위험성을제대로파악하기가어렵다. 근로자의경우나노물질이포함된공기및생산과정에서나노물질에상시로노출되기때문에위험성이일반인에비해크다고볼수있다. 현재나노물질에따라서나노물질에대한작업장노출기준을마련하는것이시급하다.

55 I. 서론 49 표 5. 일반시민과근로자에서의나노물질노출원및노출경로 (Aitken et al, 2007) 일반 시민의 노출 가능성 제품 형태 누출 또는 노출발생원 노출집단 노출경로 소비자가 피부에 바름 소비자 피부흡수 소비자에의한방출나노물질함유선크림 ( 예, 비눗물세척후상수도유입 ) 일반 시민 섭취 선크림용기폐기 ( 잔유물의소각또는매립 ) 일반 시민 흡입 또는 섭취 차량배출물을줄이기위연소배출물의공기중배출 ( 그후한나노촉매첨가물에침전 ) 일반 시민 흡입 또는 섭취 페인트, 코팅재 마모, 폐기 소비자, 피부흡수, 흡입일반시민또는섭취 의복 의복착용, 세척, 폐기 소비자, 일반시민 피부흡수 전자제품사용최종단계또는재활용시방출소비자, 피부흡수, 흡입일반시민또는섭취 스포츠용품사용최종단계또는재활용시방출소비자, 피부흡수, 흡입일반시민또는섭취 근로자의직업적노출가능성합성공정입자의형성노출원또는근로자작업노출경로 가스상공기중 양압의반응기에서직접노출흡입반응기내백필터에서의제품회수흡입, 피부 건조분말의가공, 포장 장비의청소 / 유지관리 피부, 흡입 ( 반응기진공청소 ) 콜로이드 / 마모 액체, suspension 액체 suspension 이스프레이건조되어부말화될때 / 건조분말의가흡입, 피부공, 포장건조분말의가공, 포장흡입, 피부장비의청소 / 유지관리피부

56 50 나노물질의유해성평가및근로자건강장해예방대책 5. 흡입독성시험의개요 1) 흡입독성시험 (1) 개요흡입독성시험은기체, 휘발성물질, 증기및에어로솔상태의물질을포함하고있는공기를흡입함으로써기관지및폐등을포함하는호흡기계등인체에미칠수있는영향을평가하기위한시험법이다사용되는시험물질로는부탄프로판, SO 2, NO 2, 오존등과같은기체, 톨루엔등휘발성이강한유기용매, 분사용살충제및농약등에어로솔물질이해당한다. 그리고투여횟수에따라단회투여흡입독성시험과반복투여흡입독성시험으로나뉘어서시행한다. 흡입독성실험장비는시험물질이정하여진시간동안일정하게분사될수있도록조절하는장치와시험물질의공기중분산을막을수있도록특별히고안된장비 ( 흡입챔버, inhalational exposure chamber) 를사용하여야한다. (2) 실험동물에투여하는방법시험에사용되는동물로는실험목적및시험물질의특성에따라마우스, 랫드, 기니픽, 토끼, 개, 원숭이등을선정하여사용한다. 시험에사용되는물질이기체인경우는그대로공기와함께분사하여시험하고, 휘발성유기용매인경우는시험물질을기화시킬수있는장비인 heated air vaporization apparatus (HAVA) 또는 heated liquid vaporization apparatus (HLVA) 를이용하여액체상태의물질을기화시켜실험용챔버내로분사하여사용한다. 액체에어로솔은 atomizer 를이용하여실험용챔버내로분사하고고체에어로솔은입자생성기 (particulate generator) 또는 fluid bed generation system에서

57 I. 서론 51 입자를만들어서실험용챔버내로분사하여사용한다. 실험동물이차지하는 용적은실험용챔버전체용적의 5% 이내가되어야한다. (3) 단회투여흡입독성시험가 ) 개요단회투여흡입독성시험은시험약물을 1회투여시나타나는독성현상을평가하는시험법으로동물수는각군당 10 마리 ( 암 수각각 5마리 ) 이상으로하고, 시험당시임신하였거나임신경력이있는암컷은사용하지않아야한다. 검체투여군에최소한 3가지이상의농도를사용하며각농도는예비시험을통해결정하나가장높은농도는 LC50 값보다는높지만 100% 치사를나타내지않는농도를선택하고. 중간농도는 LC50 값보다는낮고전혀치사를가져오지않는농도보다도높은농도를선택한다. 이때시험대조군은비투여대조군또는용매투여대조군을선정한다. 나 ) 시험물질투여방법흡입챔버 (inhalational exposure chamber) 는시험동물이시험물질에노출되는정도에따라전신이노출되는전신흡입챔버 (whole body exposure chamber) 와코부위만노출되도록고안된비강흡입챔버 (nose only exposure chamber) 로구분되어진다. 선정된농도의시험물질을공기와섞어챔버안에주입시키고, 이때챔버내의공기유통은시간당 회정도가되도록공기주입속도를조절한다. 또한산소의비율은 19%, 온도는 22±3, 30 70% 로유지하여야한다. 투여시간은챔버안의시험물질농도가균일하게된후 4 6 시간으로단회투여한다. 투여기간동안챔버내공기의주입속도, 온도, 습도를매 30 분마다기록하고공기중시험물질의실제농도는가능하면연속적으로측정하되최소한시작과끝, 그리고중간에측정하고, 분무제의경우입자크기의분포를시작과끝, 그리고중간에각각측정하여야한다.

58 52 나노물질의유해성평가및근로자건강장해예방대책 다 ) 측정및관찰관찰기간은 14 일로하고동물을사육하면서다음과같은시험및관찰을한다. 체중은시험직전과시험종료시측정하고시험기간중에는일주일간격으로측정한다. 일반적독성증세로서피부, 모피, 안구, 점막, 호흡기계, 순환계, 자율신경계및중추신경계운동및행동양식, 진전, 경련, 타액분비, 설사, 기면, 수면과혼수상태등을사육상자옆에서매일관찰한다. 증세가나타날경우증세, 발병시간, 정도, 지속시간을기록한다. 관찰기간중사망한동물은부검하기위해냉동시키고, 쇠약한동물은따로격리한다. 사망동물및관찰기간이끝난생존동물에대하여는부검및육안적관찰을실시하고생존동물중이상이발견된장기 조직에대하여는필요시병리조직학적검사를실시한다. 관찰된시험결과는 LC50 값과이의 95% 신뢰도범위로써표현하며일반독성증세및병리조직학적시험결과를기록한다. (4) 반복투여흡입독성시험가 ) 개론및방법반복투여독성시험은시험물질을반복하여장기간투여함으로써시험물질의영향을평가하는시험법으로, 동물은마우스, 랫드, 기니픽, 토끼, 개중 1종이상으로하며각군당 20 마리 ( 암 수각각 10 마리 ) 이상으로하고, 개의경우는 8마리 ( 암 수각각4마리 ) 이상으로한다. 시험물질의투여농도는최소한세가지이상의농도를사용하고가장높은농도는시험기간동안 LC10 값이하의치사율을일으키는농도를취하고가장낮은농도는전혀독성증세를나타내지않으나실제사용농도보다높은농도를취한다. 대조군은비투여군및필요한경우용매투여군을둘수있으며, 용매투여군의농도는투여군중에서가장높은농도의용매농도를실시한다. 시험물질투여방법은단회투여흡입독성시험과동일하며시험기간은하루6 시간씩주당5일로써90 일간투여를원칙으로하고

59 I. 서론 53 시험목적에따라 2 주간또는 28 일간투여할수도있다. 나 ) 측정및관찰시험하는기간동안매일시험동물의임상관찰결과를기록하여야하며, 매주마다는시험동물의체중및사료섭취량의변화를기록하여최종적인평가시활용한다. 시험종료시시험결과판정은반복투여독성시험평가방법을반영하여작성될수있으며, 의약품등의독성시험기준 에언급된결과판정으로도가능하다. 혈액검사는헤마토크리트치, 적혈구수, 백혈구수, 백혈구백분율, 혈액응고시간, 혈소판수등을측정한다. 혈액생화학적검사로는칼슘, 인, 염소, 나트륨, 혈당, 트란스아미나제 (AST, ALT), γ-gt, 요소질소, 알부민, 크레아티닌, 빌리루빈, 혈청단백, 오르니틴디카복실라제를측정하고그외필요에따라독성효과를평가하는데있어지표가될수있는지질, 산, 염기도, 메트헤모글로빈, 콜린에스터라제활성등을측정한다. 사망동물및관찰기간이끝난생존동물에대해서는부검즉시간, 신장, 부신, 고환 ( 난소 ), 폐의장기무게를측정하고최대용량군과대조군에대하여는상기장기및상부호흡기계 ( 기관, 비인두조직 ), 림프절, 타액선, 골및골수, 흉선, 심장, 갑상선, 부갑상선, 식도, 위, 십이지장, 소장, 대장, 간 ( 담낭 ), 췌장, 비장, 심장, 부신, 광, 고환 ( 난소 ), 자궁, 뇌, 뇌하수체, 동맥, 말초신경및병변이관찰된기타장기 조직에대해서병리조직학적검사를실시하지만육안소견으로보아그필요성이인정되지않는다고판단되는경우에는그일부를생략할수있다.

60 54 나노물질의유해성평가및근로자건강장해예방대책 II. 연구내용및방법 1. 연구내용 1) 국내외사용되는나노물질의특성및현황조사 2) 문헌검색및선행연구를통한특정크기및농도의은나노입자의후각망울을통한신경계흡수확인 3) Nose-only Exposure 장치를이용해은나노입자 (GMD :22 nm, 1.91 x 10 7 particles/cm 3 ) 를 C57BL/6 마우스에단회및 2주간반복노출 4) 표적장기 ( 대뇌, 소뇌, 혈액, 간, 심장, 폐, 신장, 비장, 정소 ) 적출후 ICP-MS 를이용한은나노입자의장기분포분석 5) 유전자칩을이용하여은나노물질노출에의해특이적으로변화되는유전체분석 6) 은나노물질에의해발현이변화되는유전자정보의통합분석및검증 7) 생체지표로응용하기위해혈액중유전자발현분석 8) 근로자건강장해예방대책 - 정책제안 2. 연구방법 1) 은나노물질의제조및특성분석은나노물질은 ceremic heater 방식을사용하여생성하였다. (Jung et al, 2006) Scanning Electron Microscope (JEOL, Tokyo, Japan) 및 Scanning Mobility Particle Sizer (TSI, USA) 을사용하여, 생성된은나노입자의크기를분석하였으며, 크기는 geometric mean diameter(gmd), 농도는 particles/cm 3 로나타내

61 II. 연구내용및방법 55 었다. GMD 22.18nm, 1.91 x 10 7 particles/cm 3 의은나노입자를실험동물에흡 입시켰다. 은나노물질의생성및특성분석흡입노출은모두서울대학교수의 과대학독성학연구실에서수행되었다. 2) 실험동물및흡입노출실험동물로는무균상태의 C57BL/6 수컷 5주령을사용하였으며, 12 시간 light/dark cycle 장치가설치되고, 정제수와표준사료가충분히공급되는환경에서사육하였다. 실험전, 실험동물을 1주일간실험환경에서적응시켰으며, 모든동물실험은서울대학교실험동물자원관리원의기준에따라시행되었다. 은나노입자의노출은서울대학교수의과대학흡입독성실의 Nose-only exposure Chamber 를이용하였으며, 흡입챔버내의온도 23 ± 2 C, 상대습도 50 ± 20% 의사육환경에서군별로각 7마리씩을단회노출, 2주반복노출하였다. 단회노출은 6시간동안 1회노출하였으며, 2주반복노츨은국립독성연구원의의약품등의독성시험기준해설서에따라 6h/d, 5d/week 의조건으로노출하였다. (1) 은나노물질의단회노출은나노물질을 6시간동안 1회노출시킨실험구성은다음과같다. Group 1은무처치군 (Untreated control) 으로, 실험기간동안위에서언급된사육조건에서사육되었으며, group 2, 3은 vehicle( 공기 ) 을투여한그룹으로 group 2는은나노물질노출종료후 2시간이지나서장기를적출하였고, group 3은 24 시간이지나서장기를적출하였다. group 4, 5는은나노물질을노출시킨그룹으로 group 4는노출종료후 2시간, group 5는 24시간이지나서장기를적출하였다. 모든실험에서각그룹당 3마리의동물을사용하였다. ( 표 6)

62 56 나노물질의유해성평가및근로자건강장해예방대책 표 6. 은나노물질단회노출실험구성 그룹 처리방법 group 1 (UT) untreated control group 2 (V2h) vehicle (sacrificed after 2h) group 3 (V24h) vehicle (sacrificed after 24h) group 4 (AgNP 2h) Ag nanoparticle treated (sacrificed after 2h) group 5 (AgNP 24h) Ag nanoparticle treated (sacrificed after 24h) (2) 은나노물질 2 주반복노출 은나노물질을 6h/d, 5d/week 의조건으로 2 주간노출시킨실험구성은다음과 같다. Group 1 은무처치군 (Untreated control) 으로, 실험기간동안위에서언급 된사육조건에서사육하였다. group 2 는 vehicle( 공기 ) 을투여한그룹, group 3, 4 는은나노물질을노출시킨그룹으로 group 3 은노출종료후 18 시간이지나서 장기를적출하였으며, group 4 는은나노물질노출종료후 2 주간회복시킨후 장기를적출하였다. 모든실험에서각그룹당 3 마리의동물을사용하였다 ( 표 7) 표 7. 은나노물질반복노출실험구성 그룹 처리방법 group 1 (UT) untreated control group 2 (V2w) vehicle group 3 (AgNP 2w) Ag nanoparticle treated group 4 (AgNP 2r) Ag nanoparticle treated & recovered (3) 장기적출및보관장기는크게유전자분석용과분포측정용으로나누어보관하였다. 유전자분석용은적출후 RNA later TM (Ambion, Austin, TX) 에보관해 RNA 분해를최대한억제하고자하였으며, RNA later TM (Ambion, Austin, TX) 에담근조직은

63 II. 연구내용및방법 57 4 C 에서하루동안보관후, -70 C 로옮겨서보관하였다. 분포측정용은장기적 출후, 동결건조하여보관하였다. 3) 흡입노출시킨은나노물질의장기분포 대뇌, 소뇌, 폐, 심장, 간, 정소, 비장, 신장, 혈액의 장기 동결 건조시킨 후, 70% 질산 (Sigma, USA) 으로 분해 후, 1% 질산으로 희석하였다. 은 농도 측정은 서울대학교 공동 기기원에 의뢰하여 ICP-MS(Perkin-Elmer Sciex, USA) 이용해 측정하였다. 4) 유전자발현분석 (1) RNA의추출및 Quality Control 조직에서 RNA 분리는 Easy-Blue total RNA extraction kit (Intron Biotech, Sungnam, Korea) 를사용하였다. 분리한 RNA 는 Qiagen RNeasy Mini Kits (Qiagen, Basel, Switzerland) 를사용하여정제하고, NanoDrop Spectrophotometer (Nanodrop Technologies, Wilmington, USA) 를사용해순도를, Agilent 2100 Bioanalyzer (Ambion, Austin, TX) 를이용하여순도를확인하였다.. (2) Biotin-labeled crna 제조분리된 RNA 를 GeneChip Expression 3'-Amplification One-Cycle cdna Synthesis Kit(Affymetrix, Santa Clara, California,USA) 를이용하여 cdna 를합성하였다. 다음 GeneChip Expression 3'-Amplification Reagents for IVT Labeling(Affymetrix, Santa Clara, California,USA) 을이용하여 biotin-labeled crna 를합성하였다. 합성된 biotin-labeled crna 는 NanoDrop

64 58 나노물질의유해성평가및근로자건강장해예방대책 Spectrophotometer (Nanodrop Technologies, Wilmington, USA) 를이용하여순 도를확인하였다. (3) 핵산혼성화반응마이크로어레이칩은 GeneChip Mouse Genome array(affymetrix, Santa Clara, California,USA) 를사용하였다. 위에서합성된 crna 를 fragmentation 후 Hybridization Oven 640 (Affymetrix, Santa Clara, California,USA) 과 Fluidics Station 450(Affymetrix, Santa Clara, California,USA) 을이용하여 hybridization 및 washing, staining 과정을수행하였다. 얻어진데이터는 Affymetrix Microarray Suite vesion 4.0 을이용하여분석하였다. (4) 마이크로어레이 데이터 분석 chip간 편차를 보정하기 위해 RMA(Robust Multiarray) 방식을 사용하 여 normalization 한 후, ANOVA 및 t-test를 사용하여 분석하였다. 단 회노출실험은 two-way ANOVA, 반복노출실험은 one-way ANOVA를 사용하였다. Hierarchical clustering은 Complete Linkage Method를 이용하여 분석하였으며, Ontology 분석은 Panther database 유전정보를 바탕으로 분석하였다. (5) 마이크로어레이결과의검증 Realtime PCR 실험을통해마이크로어레이데이터의정확도를검증하였다. RNA 로부터 SuperscriptTM III First-Strand Synthesis System(Invitrogen, Carlsbad, CA) 을이용하여 cdna 를합성한후 SYBR Green Master mix 를첨가하고, The LightCycler 2.0 Instrument(Roche Diagnostics, USA) 를사용하여증폭시킨후 Lightcycler Software 4(Roche Diagnostics, USA) 를사용하여분석하였다.

65 III. 연구결과 59 III. 연구결과 1. 은나노입자크기분석 1) 나노입자크기분석흡입노출챔버내에존재하는은나노입자의실질적인모양과크기를알기위해, SEM(Scanning electron microscope) 사진을통해분석하였고 ( 그림 29), 농도및크기분포를얻기위해 SMPS(Scanning Mobility Particle Sizer) 를이용하여분석하였다. ( 그림 30) 나노입자는약 5 80 nm 사이에고르게분포되어있으며, 평균크기는 nm 였다. 그림 29. SEM 사진을통한은나노입자의크기분석

66 60 나노물질의유해성평가및근로자건강장해예방대책 그림 30. 은나노입자의크기분포도 2) 노출시간별나노입자크기변화노출시간동안챔버내은나노입자의농도변화및크기변화분포를알아보기위해, SMPS(Scanning Mobility Particle Sizer) 를사용해 15 분간격으로나노입자의농도와크기를측정하였다. 나노입자의농도는 1.72 x x 10 7 (mean : 1.91 x 10 7 particles/cm 3 ) 였고, 나노입자의크기는 (mean : nm) 로, 실험결과시간별나노입자의농도및크기가일정하게유지되었음을확인하였다. ( 표 8, 그림 31)

67 III. 연구결과 61 표 8. 나노입자의시간별농도및크기분석 Time(min) particles / cm 3 Geo. Mean ± Geo. std dev (nm) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 1.71 MEAN ± 1.72

68 62 나노물질의유해성평가및근로자건강장해예방대책 Number Concentration dn / Cm 3 ( X 10 7 ) Silver Nanoparticles Time (min) 그림 31. 은나노입자의시간별농도분포 2. 은나노물질단회노출에따른유전자발현분석 은나노물질을 6시간동안 1회노출시킨실험구성은다음과같다. Group 1은무처치군으로, 실험기간동안위에서언급된사육조건에서사육되었으며, group 2,3 은 vehicle( 공기 ) 을투여한그룹으로 group 2는은나노물질노출종료후 2 시간이지나서장기를적출하였고, group 3은 24 시간이지나서장기를적출하였다. group 4, 5는은나노물질을노출시킨그룹으로 group 4는노출종료후 2시간, group 5는 24 시간이지나서장기를적출하였다. 모든실험에서각그룹당 3마리의동물을사용하였다. ( 표 6)

69 III. 연구결과 63 1) 마이크로어레이실험을위한 RNA 분석마이크로어레이분석을위해조직에서추출한 RNA 는표 9의조건에부합되는지확인한후실험에사용하였다. 그림 32 는 RNA 분석을위한 Bioanalyzer 로분석한예이다. 표 9. 마이크로어레이분석에적합한 RNA 의기준 항목 범위 18s/28s 비 /280 nm 흡광도 비 /230 nm 흡광도 비 그림 32. RNA 분석을위한 Bioanalyzer 분석예

70 64 나노물질의유해성평가및근로자건강장해예방대책 2) 마이크로어레이결과 (1) 통계처리및분석 RMA(Robust Multi-array Average) 방법을통해 normalization 한후데이터를분석하였다. 그림 33, 34 은 histogram 과 boxplot 을통한 intensity 분포도로 raw data( 왼쪽 ) 과 normalizaed data( 오른쪽 ) 비교결과데이터간의편차가개선되었음을알수있다. 그림 33. 표준화를통한실험군간편차개선 -- Histogram (raw: 왼쪽, normalization : 오른쪽 ) 그림 34. 표준화를통한실험군간편차개선 -- box plot (raw: 왼쪽, normalization : 오른쪽 )

71 III. 연구결과 65 (2) 은나노물질단회흡입노출에의해발현이변화하는유전자 Two-way ANOVA 및 t-test 를사용하여통계분석하였다. ( 그림 35) Twoway ANOVA 를사용하여분석한결과, 유의성있는유전자 (p<0.05) 를 1,865 개를얻었으며, 증가혹은감소의변화량이 1.5 배이상인유전자 109 개를확인하였다.( 표 10) 그림 35. 은나노물질단회노출시험및통계분석흐름도

72 66 나노물질의유해성평가및근로자건강장해예방대책 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 NCBI Ref gene symbol Description fold change Amino acid metabolism NM_ Qpct Glutaminyl-peptide cyclotransferase-like NM_ Slc7a3 solute carrier family 7 (cationic amino acid transporter, y system), member 3 Apoptosis NM_ Prkcb1 protein kinase C, beta NM_ Sncg synuclein, gamma Blood circulation and gas exchange NM_ Calca calcitonin/calcitonin-related polypeptide, alpha Carbohydrate metabolism NM_ Ext1 exostoses (multiple) NM_ St8sia6 ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase Cell adhesion NM_ Garnl3 GTPase activating RANGAP domain-like NM_ Pcdh18 protocadherin

73 III. 연구결과 67 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Cell cycle NM_ Dusp1 dual specificity phosphatase NM_ Mphosph9 M-phase phosphoprotein NM_ Rps6ka6 ribosomal protein S6 kinase polypeptide Cell structure and motiltiy NM_ F07Rik RIKEN cdna F07 gene 0.78 NM_ B15Rik RIKEN cdna B15 gene 1.02 NM_ Ccbe1 collagen and calcium binding EGF domains XM_ Kalrn kalirin, RhoGEF kinase 0.79 NM_ Tmod1 Tropomodulin Cell proliferation and differentiation NM_ Ga17 dendritic cell protein GA NM_ Mef2c myocyte enhancer factor 2C 0.70 NM_ Prkce protein kinase C, epsilon 0.93 Coenzyme and prosthetic group metabolism NM_ Pcbd1 pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1

74 68 나노물질의유해성평가및근로자건강장해예방대책 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Developmental process NM_ Bcl11a B-cell CLL/lymphoma 11A (zinc finger protein) 0.65 NM_ D18Ertd653e DNA segment, Chr 18, ERATO Doi 653, expressed 0.87 NM_ Dlgap2 discs, large (Drosophila) homolog-associated protein NM_ Gbx2 gastrulation brain homeobox NM_ Hlf hepatic leukemia factor 0.65 NM_ Hunk /// LOC hormonally upregulated Neu-associated kinase /// similar to hormonally upregulated Neu-associated kinase NM_ Nnat neuronatin NM_ Ntrk2 neurotrophic tyrosine kinase, receptor, type NM_ Ppp3cb protein phosphatase 3, catalytic subunit, beta isoform NM_ Ptk2b PTK2 protein tyrosine kinase 2 beta 0.74 NM_ Zfhx4 zinc finger homeodomain

75 III. 연구결과 69 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Electron transport NM_ Txnl1 thioredoxin-like Homeostasis NM_ Atp2b2 ATPase, Ca++ transporting, plasma membrane NM_ Calb2 calbindin NM_ Cbln1 cerebellin 1 precursor protein NM_ Fstl5 follistatin-like Immunity and defense NM_ Ctla2a cytotoxic T lymphocyte-associated protein 2 alpha NM_ Ctla2a ///Ctla2b cytotoxic T lymphocyte-associated protein 2 alpha /// cytotoxic T lymphocyte-associated protein 2 beta NM_ Defb1 defensin beta NM_ Gstm6 glutathione S-transferase, mu NM_ Itpr1 inositol 1,4,5-triphosphate receptor NM_ Sod1 superoxide dismutase 1, soluble 0.69 NM_ Tacr3 tachykinin receptor

76 70 나노물질의유해성평가및근로자건강장해예방대책 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Intracellular protein traffic NM_ Rin1 Ras and Rab interactor NM_ Tmed10 transmembrane emp24-like trafficking protein 10 (yeast) NM_ Unc13a unc-13 homolog A (C. elegans) 0.59 NM_ Unc13c unc-13 homolog C (C. elegans) Lipid, fatty acid and steroid metabolism NM_ Gpx3 glutathione peroxidase NM_ Pla2g4e phospholipase A2, group IVE 0.66 NM_ Slc27a2 solute carrier family 27 (fatty acid transporter), member NM_ Sult1a1 sulfotransferase family 1A, phenol-preferring, member Miscellaneous NM_ Hcrt hypocretin Neuronalactivities NM_ Itpr1 inositol 1,4,5-triphosphate receptor NM_ Rit2 Ras-like without CAAX

77 III. 연구결과 71 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Non-vertebrate process NM_ Ngb neuroglobin Nucleoside, nucleotide and nucleic acid metabolism NM_ Adcy9 adenylate cyclase NM_ Aff3 AF4/FMR2 family, member NM_ Cited1 Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 NM_ Cklf chemokine-like factor NM_ Cugbp1 CUG triplet repeat, RNA binding protein NM_ Klf7 Kruppel-like factor 7 (ubiquitous) 0.68 NM_ Pde4d phosphodiesterase 4D, camp specific 0.63 NM_ Per2 period homolog 2 (Drosophila) 0.71 NM_ Satb2 special AT-rich sequence binding protein NM_ Tsc22d3 TSC22 domain family NM_ Zbtb16 zinc finger and BTB domain containing

78 72 나노물질의유해성평가및근로자건강장해예방대책 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Oncogenesis NM_ Btg2 B-cell translocation gene 2, anti-proliferative 0.99 NM_ Runx2 runt related transcription factor Other metabolism NM_ Vat1 vesicle amine transport protein 1 homolog (T californica) NM_ Xbp1 X-box binding protein Phosphate metabolism NM_ Calca calcitonin/calcitonin-related polypeptide, alpha Protein metabolism and modification NM_ J19Rik RIKEN cdna J19 gene NM_ L11Rik RIKEN cdna L11 gene NM_ Agt angiotensinogen (serpin peptidase inhibitor, clade A, member 8) NM_ B230396O12Rik RIKEN cdna B230396O12 gene NM_ Hspa1b heat shock protein 1B NM_ Hspb1 heat shock protein

79 III. 연구결과 73 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change NM_ Itih3 inter-alpha trypsin inhibitor, heavy chain NM_ P4ha1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline hydroxylase), alpha 1 polypeptide NM_ Prkcb1 protein kinase C, beta NM_ Prkce protein kinase C, epsilon 0.61 NM_ Prmt8 protein arginine N-methyltransferase NM_ Snf1lk2 SNF1-like kinase NM_ Usp29 ubiquitin specific peptidase Sensory perception NM_ Chrna6 cholinergic receptor, nicotinic, alpha polypeptide NM_ Foxp1 forkhead box P NM_ Oprm1 opioid receptor, mu NM_ Tacr3 tachykinin receptor

80 74 나노물질의유해성평가및근로자건강장해예방대책 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Signal transduction NM_ E04Rik RIKEN cdna E04 gene NM_ Cart cartilage homeo protein NM_ Diras2 DIRAS family, GTP-binding RAS-like NM_ Gpr64 G protein-coupled receptor NM_ Igsf1 immunoglobulin superfamily, member NM_ Kcnh1 potassium voltage-gated channel, subfamily H (eag-related), 0.75 member 1 NM_ Per3 period homolog 3 (Drosophila) 0.75 NM_ Sfrp2 secreted frizzled-related protein NM_ Sfrp5 secreted frizzled-related sequence protein NM_ Stard8 START domain containing NM_ Ucn urocortin -0.59

81 III. 연구결과 75 표 10. 단회노출시 two-way ANOVA 분석결과유전자변화량이 1.5 배이상인유전자 (continued) NCBI Ref gene symbol Description fold change Transport NM_ Atp6v0d1 ATPase, H+ transporting, lysosomal V0 subunit D NM_ Gle1l GLE1 RNA export mediator-like (yeast 0.84 NM_ Kcnb1 potassium voltage gated channel, Shab-related subfamily, member NM_ Ngb neuroglobin NM_ Slc10a4 solute carrier family 10 (sodium/bile acid cotransporter family), member 4 fold change 는 log2 값으로표시하였다

82 76 나노물질의유해성평가및근로자건강장해예방대책 2 시간군 (V2h, AgNP 2h) 두그룹을 t-test 한결과, 유의한유전자가발견되 지않으며, 24 시간군 (V24h, AgNp 24h) 두그룹을비교했을때 4 개의유전자를 얻었으며이유전자들은모두 1.5 배이상변화하였다. (data are not shown) 3) Realtime PCR 를이용한마이크로어레이결과의검증 마이크로어레이결과 1.5 배이상변화한유전자중무작위로선택하여 realtime PCR 을하였으며, 선택한유전자의 primer 의염기서열은표 11 에나타내었다. 모두 11 개의유전자를 PCR 로확인한결과 Calb2, Cbln1, Ctla2a, Defb1, Mgst1, Ngb, Sncg, Tacr3 8개의유전자에서는마이크로어레이와 PCR 에서의변화값이모두증가하였으며, Dusp1 에서는마이크로어레이와 PCR 에서의변화값이모두감소하였다. Klf7, Sod1 2개유전자에서는마이크로어레이와 PCR 의증감이반대값을보여일치하지않아, 약 72.73% 의유전자를 PCR 한값이마이크로어레이결과와일치하였다. ( 그림 36, 표 12) 표 11. 단회노출실험에서 realtime PCR에사용된 primer 의염기서열 gene forward primer(5' - 3') reverse primer (5' - 3') Calb2 5' AGAGAAGATGAAGGAGTT 3' 5' TAGTATGGTCTGGGTGTA 3' Cbln1 5' AACGCAGCACTTTCATCG 3' 5' GGTCGCCTTTCTCCATCT 3' ctla2a 5' CTTCAGTGCTGTCTTCCT 3' 5' CTTTCCCAAATCTTCATA 3' Defb1 5' CTTTCTCCTGGTGATGAT 3' 5' GGTTCCCTGTAGTTTGGT 3' dusp1 5' GATGCTGGAGGGAGAGTG 3' 5' GGATGGAAACAGGGAAGT 3' klf7 5' CAGCCGCCATCTGGTCAA 3' 5' ACGCCACTCGCATCCTTCC 3' Mgst1 5' CCAGAGGATAACCAACAAG 3' 5' TGAGGAAGGGGAGTCAAGTA 3' Ngb 5' CCTGCTGCCTCTCTTCCA 3' 5' GCTGAGCCTCACTCCCAC 3' Sncg 5' AGGTGTTGTGGGTGCTGT 3' 5' CCTCTTGCTCTTTGGCTT 3' Sod1 5' TTCGAGCAGAAGGCAAGC 3' 5' TCCCAATCACTCCACAGG 3' Tacr3 5' CGTCACCAACTATTTCCT 3' 5' GCCATATACCTGTCCACT 3'

83 III. 연구결과 77 그림 36. 마이크로어레이와 realtime PCR 에서의유전자변화비교 표 12. 단회노출실험시대뇌에서마이크로어레이결과와 realtime PCR 결과비교 microarray PCR (SEM n=3) Calb ± ± 0.59 Cbln ± ± 0.10 Ctla2a ± ± 0.31 Defb ± ± 0.32 Dusp ± ± 0.39 Klf ± ± 0.26 Mgst ± ± 0.40 Ngb ± ± 0.32 Sncg ± ± 0.28 Sod ± ± 0.48 Tacr ± ± 0.51 fold change 는 log 2 값으로표시하였다

84 78 나노물질의유해성평가및근로자건강장해예방대책 4) 단회노출실험의클러스터분석단회노출실험에서 two-way ANOVA 로분석된데이터를 Complete Linkage 법을사용하여 Hierarchical Clustering 하였다. Clustering 결과노출후 2시간후와 24 시간후유전자발현변화가차이를나타냄을알수있다. 그림 37. 은나노물질단회노출시유전자발현 Hierarrhical Clustering

85 III. 연구결과 79 5) 단회노출실험의온톨로지분석 Two-way ANOVA 결과유의성있는 (p<0.05) 유전자를대상으로 PANTHER 데이터베이스를이용하여 Ontology 분석을하였다. 은나노물질에의해유도된유전자변화는여러생물학적변화와관련이있다. signal transduction 에가장많은영향을미쳤으며, cell cycle, cell proliferation and differentiation, developmental processes 등세포생장관련유전자및 nucleoside, nucleotide and nucleic acid metabolism, lipid, fatty acid and steroid metabolism, protein metabolism and modification 등지질및단백질대사관련유전자에영향을미쳤다. 또한 intracellular protein traffic, transport 등물질수송이나 cell structure and motility 등세포구조, immunity and defense 등면역기능에도영향을미치는것으로나타났다. ( 그림 38) 그림 38. 단회노출실험결과의온톨로지분석

86 80 나노물질의유해성평가및근로자건강장해예방대책 3. 은나노물질반복노출에따른유전자발현분석 은나노물질을 6h/d, 5d/week 의조건으로 2주간노출시킨실험구성은다음과같다. Group 1은무처치군 (Untreated control) 으로, 실험기간동안위에서언급된사육조건에서사육하였다. group 2는 vehicle( 공기 ) 을투여한그룹, group 3, 4는은나노물질을노출시킨그룹으로 group 3은노출종료후 18 시간이지나서장기를적출하였으며, group 4는은나노물질노출종료후 2주간회복시켰다. ( 표 7) 1) 마이크로어레이실험을위한 RNA 분석 은나노물질을반복노출실험에서역시, 단회노출실험과같은방법으로 RNA 을하였다. 모든샘플은아래표와같은기준을만족하였다. ( 표 9) 2) 마이크로어레이결과 (1) 통계처리및분석 RMA(Robust Multi-array Average) 방법을통해 normalization 한후데이터를하였다. 그림 39, 40 은 histogram 과 boxplot 을통한 intensity 분포도로 raw data( 왼쪽 ) 과 normalizaed data( 오른쪽 ) 비교결과데이터간의편차가개선되었음을알수있다.

87 III. 연구결과 81 그림 39. 표준화를통한실험군간편차개선 -- Histogram (raw: 왼쪽, normalization : 오른쪽 ) 그림 40. 표준화를통한실험군간편차개선 -- Box plot (raw: 왼쪽, normalization : 오른쪽 ) (2) 은나노물질반복흡입노출에의해발현변화하는유전자 one-way ANOVA 및 t-test 을진행하였다. one-way ANOVA로한결과유의성있는유전자 (p<0.05) 를대뇌에서 106 개얻었고, 이중 1.5 배이상변화한유전자가없었다. 같은분석을소뇌에서한결과유의성있는유전자 (p<0.05) 를 2,486개찾았고, 이들유전자를 1.5 배로 cut-off 한결과 25 개유전자가확인되었다. ( 그림 41, 42) ( 표 13)

88 82 나노물질의유해성평가및근로자건강장해예방대책 그림 41. 은나노물질반복노출시험및통계흐름도 ( 대뇌 ) 그림 42. 은나노물질반복노출시험및통계흐름도 ( 소뇌 ) t-test 분석결과, 유의성있는유전자 (P<0.05) 를대뇌에서 47 개를찾았고, 그중 22 개유전자가 1.5 배이상변화하였다. ( 표 14) 같은분석을소뇌에서한결과유의성있는유전자 (P<0.05) 를 22 개찾았으며, 그중 13 개의유전자가 1.5 배이상변화하였다. ( 표 15, 그림 41, 42)

89 III. 연구결과 83 표 13. 반복노출실험의 one-way ANOVA 결과소뇌에서의변화량이 1.5 배이상인유전자 NCBI Ref Seq Gene symbol Description Fold change Apoptosis XM_ A230083H22Rik RIKEN cdna A230083H22 gene Carbohydrate metabolism NM_ Mecr mitochondrial trans-2-enoyl-coa reductase Cell cycle NM_ Mll3 myeloid/lymphoid or mixed-lineage leukemia NM_ Sept.11 Septin Immunity and defense NM_ Dusp16 dual specificity phosphatase NM_ Nktr natural killer tumor recognition sequence Lipid, fatty acid and steroid metabolism NM_ Abcd2 ATP-binding cassette, sub-family D (ALD), member XM_ Etnk1 Ethanolamine kinase NM_ Plcb4 phospholipase C, beta Neuronal activities NM_ Htr2c 5-hydroxytryptamine (serotonin) receptor 2C 0.67

90 84 나노물질의유해성평가및근로자건강장해예방대책 표 13. 반복노출실험의 one-way ANOVA 결과소뇌에서의변화량이 1.5 배이상인유전자 (continued) NCBI Ref Seq Gene symbol Description Fold change Nucleoside, nucleotide and nucleic acid metabolism NM_ Papola poly (A) polymerase alpha NM_ Pde1c phosphodiesterase 1C NM_ Sfpq splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) NM_ Tra2a transformer 2 alpha homolog (Drosophila) Oncogenesis NM_ Araf v-raf murine sarcoma 3611 viral oncogene homolog Other metabolism NM_ Upf2 UPF2 regulator of nonsense transcripts homolog (yeast) Protein metabolism and modification NM_ Farsa phenylalanyl-trna synthetase, alpha subunit XM_ Ptar1 protein prenyltransferase alpha subunit repeat containing NM_ Pcsk2 proprotein convertase subtilisin/kexin type

91 III. 연구결과 85 표 13. 반복노출실험의 one-way ANOVA 결과소뇌에서의변화량이 1.5 배이상인유전자 (continued) NCBI Ref Seq Gene symbol Description Fold change Signal transduction NM_ Ptpn22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) NM_ Kitl kit ligand NM_ Rora RAR-related orphan receptor alpha NM_ Plxnc1 plexin C NM_ Il1rap interleukin 1 receptor accessory protein 0.62 Transport NM_ Kcnc3 potassium voltage gated channel, Shaw-related subfamily, member 3 fold change 는 log2 값으로표시하였다

92 86 나노물질의유해성평가및근로자건강장해예방대책 표 14. 반복노출실험의 t-test 결과대뇌에서의변화량이 1.5 배이상인유전자 NCBI Ref Gene symbol Description Fold change Amino acid metabolism NM_ Arg2 arginase type II Carbohydrate metabolism NM_ Kl klotho 2.09 Cell proliferation and differentiation NM_ Gh growth hormone 3.03 Cell communication NM_ Nts neurotensin Cell structure and motility NM_ Cldn2 claudin NM_ Klhl1 kelch-like 1 (Drosophila) Coenzyme and prosthetic group metabolism NM_ Folr1 folate receptor 1 (adult) 2.22 Developmental processes NM_ Prlr prolactin receptor 1.17

93 III. 연구결과 87 표 14. 반복노출실험의 t-test 결과대뇌에서의변화량이 1.5 배이상인유전자 (continued) NCBI Ref Gene symbol Description Fold change Coenzyme and prosthetic group metabolism NM_ Pbx3 pre B-cell leukemia transcription factor NM_ Pou3f4 POU domain, class 3, transcription factor Homeostasis NM_ Clic6 chloride intracellular channel Immunity and defense NM_ F5 coagulation factor V 1.61 NM_ Ifit1 interferon-induced protein with tetratricopeptide repeats Muscle contraction NM_ Kcnma1 potassium large conductance calcium-activated channel, subfamily M, alpha member Oncogenesis NM_ Mme membrane metallo endopeptidase -0.69

94 88 나노물질의유해성평가및근로자건강장해예방대책 표 14. 반복노출실험의 t-test 결과대뇌에서의변화량이 1.5 배이상인유전자 (continued) NCBI Ref Gene symbol Description Fold change Neuronal activities NM_ Htr1d 5-hydroxytryptamine (serotonin) receptor 1D NM_ Kcna5 potassium member 5 voltage-gated channel, shaker-related subfamily, NM_ Ttr transthyretin 3.95 protein metabolism and modification NM_ Serpina9 serine (or cysteine) peptidase inhibitor, clade A (alpha antiproteinase, antitrypsin), member 9 Signal Transduction NM_ Ptprd protein tyrosine phosphatase, receptor type, D 0.60 Transport NM_ Kcne2 potassium voltage-gated channel, Isk-related subfamily, gene NM_ Slc10a4 solute carrier family 10 (sodium/bile acid cotransporter family), member 4

95 III. 연구결과 89 표 15. 반복노출실험의 t-test 결과소뇌에서의변화량이 1.5 배이상인유전자 NCBI Ref Gene symbol Description Fold change Apoptosis XM_ A230083H22Rik RIKEN cdna A230083H22 gene Cell cylce NM_ septin Cell proliferation and differentiation NM_ Gh growth hormone 5.46 Developmental processes NM_ Rabep1 rabaptin, RAB GTPase binding effector protein NM_ Sema7a sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A Immunity and defense NM_ H2-T24 histocompatibility 2, T region locus

96 90 나노물질의유해성평가및근로자건강장해예방대책 표 15. 반복노출실험의 t-test 결과소뇌에서의변화량이 1.5 배이상인유전자 (continued) Lipid, fatty acid and steroid metabolism XM_ Etnk1 Ethanolamine kinase Neuronal activities NM_ Pomc1 pro-opiomelanocortin-alpha 1.76 Nucleoside, nucleotide and nucleic acid metabolism NM_ Pde1c phosphodiesterase 1C NM_ Tra2a transformer 2 alpha homolog (Drosophila) NM_ Sfpq splicing factor proline/glutamine rich (polypyrimidine tract Oncogenesis NM_ Fus fusion, binding protein associated) (human) derived from t(12;16) malignant liposarcoma Protein metabolism and modification NM_ Dusp5 dual specificity phosphatase fold change 는 log2 값으로표시하였다

97 III. 연구결과 91 3) Realtime PCR 을이용한마이크로어레이결과확인 얻어진유전자리스트에서무작위로유전자를선택하였으며, 선택한유전자의 primer 의염기서열을표 16 에나타내었다. 그림 43. 표 17 는대뇌에서 realtime PCR 로검증한결과를마이크로어레이에서얻은데이터값과비교한결과이며, PCR 결과 13 개유전자에서모두마이크로어레이와 PCR 결과와일치하였다. 마이크로어레이결과가신뢰성있게재현됨을확인할수있었다. 표 16. 반복노출실험에서 realtime PCR 에사용한 primer 의염기서열 gene forward primer(5' -3') reverse primer (5' -3') Clic6 5' ACATCACCCTCTTCGTCA 3' 5' CCGTAGTAGGTTCTTTTC 3' Dusp5 5' GCCTACAGACCAGCCTATG 3' 5' CTCCTTCTTCCCTGACACA 3' F5 5' GGAACTCCGTGGTAAAGC 3' 5' GCCCAGATTAGCACGATT 3' Folr1 5' TGCCAAACACCACAAAGAA 3' 5' GGCTCCCACAGGACACTCG 3' Fus 5' ACAACAATACCATCTTCG 3' 5' TGCATTCATTTCTCCAAG 3' Gh 5' CTTGTCCAGTCTGTTTTC 3' 5' ACTTGTCATAGGTTTGCT 3' Htr1d 5' CTGTGTGACATCTGGGTG 3' 5' TGAAAAAGAGAGGGGAGC 3' Ifit1 5' GCAGTCGTAGCCTATCGC 3' 5' GCTTGTAGCAGAGCCCTT 3' Kcna5 5' TTCGCAGAGGCAGACAAT 3' 5' CAGACAGAGGGCATACAG 3' Ki 5' AAAGGCAAAATATCCATCG 3' 5' AGCCAGTCCCTCATCACAC 3' Nts 5' TGGTGTGCCTGACTCTCC 3' 5' ATGTCTCCTGCTTCCTCG 3' Pbx3 5' CTCCGAGAACAGAGTAGA 3' 5' CTGAGGTGTGAGTAAAAA 3' Prlr 5' CAGTGGCTTTGAAGGGTTA 3' 5' GGGGTGTTATTTTGGGGAT 3' Rabep1 5' AGTGGTTACCGCTTAGTG 3' 5' GAGGCTGTCGTTGTCTTT 3' Sema7a 5' AGGAATACAACGGGAAGAT 3' 5' TTGGAGACAGACAACGAAC 3' Serpina9 5' ATGGACTACAGGGGAGAT 3' 5' GCAATGATAGAAGACGGG 3' Sfpq 5' TCGGTTGTTTGTGGGGAA 3' 5' TGGGCGAGGAGTCGTTGT 3' Slc10a4 5' CACTCTCATTCCTATTGG 3' 5' ACGTTCTGACTTCCTGTT 3' Ttr 5' CGCTGGACTGGTATTTGTG 3' 5' TGGGATGCTACTGCTTTGG 3'

98 92 나노물질의유해성평가및근로자건강장해예방대책 그림 43. 반복노출실험시대뇌에서마이크로어레이결과와 realtime PCR 결과비교

99 III. 연구결과 93 표 17. 반복노출실험시대뇌에서마이크로어레이결과와 realtime PCR 결과비교 microarray PCR(SEM n=3) Arg ± ± 0.59 Clic ± ± 0.51 F ± ± 0.26 Folr ± ± 0.62 Gh 3.03 ± ± 0.66 Htrd ± ± 0.27 Ifit ± ± 0.48 Kcna ± ± 0.20 Ki 2.09 ± ± 0.35 Nts ± ± 0.04 Pbx ± ± 0.25 Prlr 1.17 ± ± 0.42 Serpina ± ± 0.26 Slc10a ± ± 0.78 Ttr 3.95± ± 0.15 fold change 는 log2 값이며, mean ± SEM 으로표시하였다. 표 18 과그림 44 는마이크로어레이데이터를 t-test 로분석하여유의미하게나온 (p<0.05) 유전자중발현정도와방향성에따라선택하여 realtime PCR 한결과이다. 이중 Gh, Sema7a, Dusp5, Sfpq, Rabep1, Fus 등모두 6개의유전자를 realtime PCR 로분석한결과, 6개모두마이크로어레이와 PCR 결과가같은양상을보여두결과가 100% 일치하여마이크로어레이결과가신뢰성있게재현됨을알수있다.

100 94 나노물질의유해성평가및근로자건강장해예방대책 그림 44. 반복노출실험시소뇌에서마이크로어레이결과와 realtime PCR 결과비교 표 18. 반복노출실험시소뇌에서마이크로어레이결과와 realtime PCR 결과비교 microarray PCR(SEM n=3) Gh 5.46 ± ± 2.51 Dusp ± ± 0.12 Fus ± ± 0.26 Rabep ± ± 0.01 Sema7a ± ± 0.05 Sfpq ± ± 0.15 fold change 는 log2 값이며, mean ± SEM 으로표시하였다.

101 III. 연구결과 95 4) 은나노물질반복노출실험의클러스터분석 2주간노출군에서 one-way ANOVA 로통계분석된데이터를 Complete Linkage 법으로 Hierarchical Clustering 하였다. 2주노출데이터에서대뇌와소뇌의유전자발현비교결과대뇌, 소뇌모두에서 Gh의경우유의적으로큰폭으로증가하였고, 이외의대부분의유전자에서대뇌와소뇌의증가감소방향이같았지만, 발현정도의차이를보였다. 그림 45. 은나노물질반복노출시유전자발현 Hierarrhical Clustering

102 96 나노물질의유해성평가및근로자건강장해예방대책 5) 은나노물질반복노출실험의온톨로지분석 PANTHER 데이터베이스를이용하여 one-way ANOVA 결과유의성있는 (p<0.05) 유전자를대상으로 Ontology 분석을하였다. 그결과은나노물질은 cell cycle, cell proliferation and differentiation, developmental processes 등세포생장관련유전자에영향을미치며, nucleoside, nucleotide and nucleic acid metabolism, lipid, fatty acid and steroid metabolism, protein metabolism and modification, other metabolism 등지질및단백질대사관련유전자에영향을미치는것으로나타났다. 또한 intracellular protein traffic, transport 등물질수송이나 signal transduction 등신호전달, cell structure and motility 등세포구조, immunity and defense 등면역기능에도영향을미치는것으로나타났다. 또한단회노출시와는다르게반복노출에서는 cell adhesion, intracellular protein traffic, neuronal activities, oncogenesis 관련유전자의발현이변화된것으로나타났다. ( 표 19, 그림 46) 그림 46. 은나노물질반복노출실험결과의온톨로지분석

103 III. 연구결과 97 표 19. 은나노물질반복노출실험결과의온톨로지분석 Function number of genes biological process unclassified 948 cell adhesion 102 cell cycle 167 cell proliferation and differentiation 154 cell structure and motility 176 developmental processes 355 immunity and defense 165 intracellular protein traffic 206 lipid, fatty acid and steroid metabolism 124 neuronal activities 120 nucleoside, nucleotide and nucleic acid metabolism 589 oncogenesis 100 other metabolism 124 protein metabolism and modification 551 signal transduction 546 transport 222

104 98 나노물질의유해성평가및근로자건강장해예방대책 6) 은나노물질의장기분포 C57BL/6 mouse 의조직을채취하여동결건조및전처리후, ICP-MS를사용하여조직중의 Ag 농도를측정하였다. 측정은 V2w (vehicle control), 은나노물질을 2주간처리한 AgNp 2w 군, 은나노물질 2주간처리후 2주간회복시킨 AgNp 2w recover 군에서측정하였다. 각그룹당 3마리씩측정하여통계처리하였다은나노물질이 inhalation 되어 AgNp 2w 군에서폐에고농도로분포됨을볼수있고, 2주시간이지남에따라 blood, kidney, testis 등다른장기들로 translocation 됨을알수있다. ( 표 20) 표 20. 반복노출실험에서의은나노물질의조직분포 V2w AgNp 2w AgNp 2w recover 대뇌 ± ± ± 혈액 4.09 ± ± ± 소뇌 ± ± ± 심장 ± ± ± 신장 3.95 ± ± ± 간 ± ± ± 7.11 폐 7.25 ± ± ± 5.23 비장 ± ± ± 정소 ± ± ±

105 III. 연구결과 생체지표개발을위한혈액에서의유전자분석 은나노물질의노출및위해성평가에활용할수있는생체지표를개발하기위하여혈액에서의유전자발현을분석하였다. 2주간반복노출한동물의뇌에서발현이유의성있게변화한유전자들을대상으로하였다. 총 10 개의유전자를분석한결과 Arg2, Iifit1, Rabep1 등 3종의혈중유전자발현역시유의미하게변화하는것으로나타났다. 특히 Iifit1, Rabep1 의경우 2주간의회복기간후의유전자발현이정상으로돌아와나노물질의노출상태를민감하게반영하는지표로사료되며, Arg2의경우시간이지남에도발현감소가유지되어은나노물질노출후에도노출정도를측정할수있는지표로생각된다. Sema7a 의경우유전자발현이큰폭으로감소하였지만유의성은없었다. ( 표 21, 그림 47) 그림 47. 반복노출실험에서은나노물질노출시간에따른혈액에서의유전자발현변화

106 100 나노물질의유해성평가및근로자건강장해예방대책 그림 47. 반복노출실험에서은나노물질노출시간에따른혈액에서의유전자발현변화 (continued) 표 21. 마이크로어레이와뇌및혈액에서의 PCR 결과비교 microarray brain PCR blood blood PCR-treat PCR-recover Arg ± ± ± 0.27* ± 0.43* Dusp ± ± ± ± 0.22 F ± ± ± ± 0.08 Folr ± ± ± ± 0.35 Gh 3.03 ± ± ± ± 0.53 Ifit ± ± ± 0.17* ± 0.40 Pbx ± ± ± ± 0.49 Rabep ± ± ± 0.27* ± 0.58 Sema7a ± ± ± ± 0.40 Sfpq ± ± ± ± 0.30 ( 혈액에서의 control 과 treat, control 과 recover 군간 t-test 를하였으며, p<0.05 인값을 * 로표시하였고, fold change 는 log 2 값이며, mean ± SEM으로표시하였다.)

107 IV. 고찰 101 IV. 고찰 1. 연구결과의활용 나노기술의발달및보급에따라작업장에서근로자에대한나노물질의노출이증가하고있지만이의규제및관리를위한과학적근거는매우부족하다. 또한기존의작업장노출기준은용량기준으로설정되어있기때문에나노입자의위험성에근거한규제를위해서는위해성평가요소기술에대한해결책을제시할수있는기술개발이시급하다. 본연구는나노입자노출및영향에대해민감하게변화하는유전자지표들을발굴하여이를나노물질노출에대한바이오마커로활용할수있는가능성을제시하였다. 나노물질의효율적규제및관리를위해서는위해성평가가선행되어야하지만아직은이를위한요소기술들의개발및보급이충분하지못해어려움을겪고있다. 위해성평가의요소기술에는유해성확인 (hazard identification), 용량반응평가 (dose-response assessment), 노출평가 (exposure assessment) 등이있으나나노물질의경우아직유해성확인단계이고용량반응평가및노출평가를위한기반기술은절대적으로부족한실정이다. 은나노물질의경우기존의금속물질의양을측정하는장비 ( 예 ICP-MS) 로노출정도를측정할수있었지만, 본연구결과에따르면 ICP-MS에의한측정결과는편차가크며, 은원소의측정한계치는 100ppt 수준이나, 실제로 ppb 농도이하에서는검출이용이하지않으므로작업장에서의노출에따른은나노물질의화학적분석으로는정확한노출정보를얻기어렵다. 따라서은나노물질노출정도를민감하게나타낼수있는지표가필요하며, 본연구에서는유전자를지표물질로사용할수있음을제시하고자하였다. 이러한유전자변화는노출평가에이용될수있을뿐아니라, 향후

108 102 나노물질의유해성평가및근로자건강장해예방대책 추가적인연구가수행될경우은나노물질에대한건강영향을평가할수있는지표로활용될수도있을것이다. 연구결과혈액에서의유전자발현이뇌에서의결과와일치하는유전자를얻을수있었으며, 이러한유전자를이용하여향후은나노물질에노출된근로자의혈액으로부터노출및건강영향을평가하고자할때기초자료로쓰일수있을것으로사료된다. ( 그림 48) 그림 48. 은나노물질노출된근로자위해성평가개요

109 IV. 고찰 근로자건강장해예방을위한대책 - 정책제안 1) National Institute for Occupational Safety and Health (NIOSH) 의 Nanotechnology Research Center (NTRC) National Science Foundation 에서는 2015 년까지나노기술이전세계경제에 1 조달러정도의영향을미치고 2백만명의고용을창출할것으로예측하고있다. 하지만아직나노물질을안전하게다룰수있는방법에대해서는완전히이해하고있지못해이지식격차를매우는것이전세계적으로시급한과제이다. 나노물질은지금까지지구상에존재했던다른화학물질혹은입자상물질과달리고유한물리화학적특성을갖고있기때문에현재까지의지식수준으로는사람에게노출되었을때어떤종류의유해성이어느정도유발될것인지에대한예측이불가능하다. 현재나노물질에대한노출평가의어려움, 입자크기분포및조성에대한시험의어려움, 위해성평가를위한민감하고선택적인생체지표의부재등과같이곳곳에아직해결되지않은문제들이존재하고있어역학조사및위해성평가가제대로이루어질수없는상황이다. 미국의 NIOSH 에서는나노물질을다루는작업과관련된질병및손상을예방하는데선도적인역할을하고있으며 2004년 Nanotechnology Research Center (NTRC) 를설립하여이분야연구발전을주도하고있다. NIOSH 나노기술연구의목적은기관간에나노기술연구결과를공유할수있는도구를만들고, 새로운기술개발및연구를촉진할수있는가이드라인을만드는데있다. 이를위해근로자의나노물질노출및노출에따른영향, 나노기술의제어를위한짜임새있고, 다차원적이며, 시의적절한연구를수행하고있다. 본보고서에서는 NIOSH 의 NTRC 에서설정한연구방향과우선순위등을소개함으로써향후한국산업안전보건연구원이연구정책을수립하는데참고자료를제공하고자한다.

110 104 나노물질의유해성평가및근로자건강장해예방대책 2) NTRC의 4대목표 NTRC 에서는 아래와 같은 4가지의 목표를 설정하여 이 분야의 연구방향을 설정하고 있다. 1. 나노입자나 나노물질로 인해 잠재적으로 발생할 수 있는 작업관련 상해 및 질병에 관한 이해 2. 나노기술 제품을 응용하여 작업관련상해 및 질병을 방지하기 위한 연구수 행 3. 권고 및 중재를 통한 건강한 작업장의 유지 및 증진 4. 나노기술의 국내외적 협력을 통해 전 세계적으로 작업장 내에서의 안전과 건강 향상 이러한목표를달성하기위해중장기적인전략을세우고있으며, 각목표에대한특성은다음과같다. 목표 1 : 나노입자나나노물질로인해잠재적으로발생할수있는작업 중일어날수있는질병및손상에관한이해 이목표를달성하기위해연구자들은나노입자의상대적인독성및건강에미치는영향을확인하여야한다. 위험을평가하는데중요한것은작업장내공기중에서나노입자를측정하는능력이다. 따라서노출평가를위한유효한방법을개발하기위한연구가수행되어야한다. 나노물질에노출된근로자의수가적고짧은기간노출되기때문에건강에미치는영향을평가하기는어려움이있다. 또한위해성, 용량반응성, 위해성평가정보를제공하기위해서는예측가능한동물모델이필요하다. 연구를통해얻은정보및지식은나노물질의안전한취급방법에대한권고및기준의근간을이룰것이다.

111 IV. 고찰 105 목표 2 : 나노기술제품을응용함으로써작업중일어날수있는질병및 손상을방지하기위한연구를수행 나노기술은잠재적으로연구현장및작업장에서의질병및손상을방지하는데유용하다. 그러나이러한응용분야는아직더연구되고개발되어야한다. 가공된나노물질은먼지및때타지않는옷, 소음흡수물질, 방화물질, 배기가스배출감소촉매제, 오염물질제거등에사용될수있고, 나노기술기반센서와통신장비는응급상황및근로자상해위험을줄이는데도움이될수있다. 나노물질의작은크기와무선기술이결합하면입을수있는센서및실시간위험감지시스템을개발할수있을것이다. 나노기술에기반한연료전지, lab-on-chip 분석기, opto-electornic device 는안전하고, 건강하고효율적인작업환경을이루는데활용될수있을것이다. NIOSH 는작업장에서의안전증진을위해잠재적인나노기술응용을촉진하기위한로드맵을개발하고있다. 산업계, 학계, 노동계가서로제휴하여이기술이실험실환경에적합한지, 그리고나아가현장에적용가능한지를평가하는데초점을맞추어야한다. 목표 3 : 중재및권고를통한건강한작업장의유지및증진 나노기술발전의치명적인문제은나노물질을안전하게다루는데에대한가이드라인이부족하다는것이다. 이러한문제를해결하기위해 NIOSH 는두가지방향으로접근을하고있다. 첫째, 현재적용가능한최상의기술, 지식, 전문적판단에대한평가를기반으로한가이드라인을개발하는것이고, 둘째, 공학적제어 (engineering control), 보호장구, 작업장에서의노출한계및관리에대한연구결과를해석하는것이다. NIOSH 에서만들어진정보는널리배포될것이고교육프로그램과작업장에서의안전및건강관리시스템과결합되도록

112 106 나노물질의유해성평가및근로자건강장해예방대책 노력할것이다. 목표 4 : 나노기술의국내외적협력을통해전세계적으로작업장내에서 의안전과건강향상 나노기술의성장및이용은전세계적인반응을필요로하는국제적인현상이다. 국제적영향이노동시장, 자본투자, 기술연구에미치는영향은이미잘알려져있으며, 나노기술개발에도영향을미치게될것이다. NIOSH 는작업장에서의안전을증진시키기위해국제적인기관과협력한역사가있다. 국내외제휴를통해, 적절한연구수요및접근방법을알아내고연구결과를확산시킬수있을것이다. 여기에는정보의발전및배포와작업장에서의건강및안전교육이포함될것이다. 이상의전략적계획은연구 (research), 지도 (guidance) 및기준 (practice) 에근거해수립되었다. 나노기술이성장하고발전하며다양한방면에이용됨에따라근로자의안전과건강에대한새로운많은문제가제기될것이다. 이를해결하기위해서는역동적인기획전략이요구된다. 이기획은새로운과학적정보가얻어지고, 의문이제기되고이해당사자및파트너의우려가제기됨에따라점점더진화할것이다. 이와같은역동적인접근방법을통해 NIOSH 는도전을예측하고나노물질의안전한사용을위한유용한정보와지식을제공할것이다. NIOSH NTRC 의 operational model 은그림 49 같다.

113 그림 49. NIOSH NTRC 의 operational model IV. 고찰 107

114 108 나노물질의유해성평가및근로자건강장해예방대책 3) NTRC 10대중점과제 NTRC 는 지식격차가 존재하는 분야의 연구를 수행하고, 전략을 수립하고, 제 안을 수립하기 위하여 다음의 10 가지 중점과제를 선정하여 수행하고 있다 ( 그림 50). Toxicity and internal dose Risk assessment Epidemiology and surveillance Exposure assessment Measurement methods Engineering controls and PPE Fire and explosion safety Recommendations and guidance Communication and education Application 그림 50. NTRC 의 10 대중점과제

115 IV. 고찰 109 (1) Toxicity and Internal Dose 가 ) 배경화석연료의연소, 용접과정이나디젤엔진에서생성되는나노입자에대한부차적인노출로인한독성에대해서는많은연구결과가있으나직경 100 nm 이하의 engineered nanoparticle 에대해서는덜알려져있다. Engineered nanoparticle 의특수한성질이산업안전위해성을유발하는지에대해서는아직확실하지않다. 이러한불확실성은잠재적노출경로, 체내나노물질의이동, 생체시스템과나노물질간의상호작용에대한정보의차이로인해발생한다. 나노크기나호흡성분진의동물과인간에의노출에대한선행된연구결과로부터비슷한산업나노물질노출로인한가능한유해작용에대한예비적인정보를예측할수있다. NTRC 는 다음의 과제를 해결하기 위해서 연구를 수행하고 있다. 입자의 표면적은 질량보다 노출측정에 있어서 적절한 것인가? 폐 내 나노입자의 높은 축적은 기실에서 세포, 조직, 혈관으로의 나노입자의 이동과 제거에 영향을 주는가? 나노입자는 혈류에 존재하면서 다른 장기로 이동할 수 있는가? 어떤 기전으로 나노입자가 활성산소를 생성시키는가? 만약 나노입자가 피부를 투과한다면 작업자에게 부작용을 일으킬 수 있는 가? 나노입자의 형태, 지속성, 화학적 조성이 나노입자의 생물학적 활성에 어떤 영향을 미치는가? 결합되어 있던 나노입자들이 체액 내에서 분리되어 더 작고 강력한 구조를 형성하는가? 나노입자에 대한 in vitro assay 를 통해 in vivo 반응도 예측할 수 있는가?

116 110 나노물질의유해성평가및근로자건강장해예방대책 나 ) NTRC의 "Toxicology and Internal Dose" 프로젝트 NTRC 는 나노물질이 산업안전위해성을 유발하는지에 대한 의문에 중점을 두 고 포괄적인 연구계획을 수립하였다. 최근에 여러 프로젝트들이 진행 중이며 일 차적으로 나노입자의 흡입과 피부노출에 의한 영향을 연구하고 있다. 프로젝트 는 다음과 같다. 나노입자의 기관 내 주입, 인두부내 흡입, 폐내 노출 후에 폐에서의 나노물 질 침착 및 제거 표지된 나노입자를 이용한 나노입자의 기도에서 조직과 혈액으로의 이행 관 찰 방법 다양한 조성과 형태의 나노입자에 대한 폐 노출 후 폐 손상, 산화적 스트레 스, 염증, 섬유화 측정 다양한 조성과 형태의 나노입자에 대한 폐 노출로 인한 심혈관계 영향 평가 나노입자가 어떻게 폐에서 뇌 조직으로 이행하는지와 그 결과 신경계에 대 한 영향 측정방법 생물학적 활성에 있어 표면적의 역할 측정 결합되어 있던 나노입자를 분리하는데 있어서 폐 lining fluid 의 능력 측정 in vitro 에서 측정한 산화제 생성능으로 in vivo 반응을 예측할 수 있는지 측 정 다양한 조성과 형태의 나노입자의 피부 노출에 대한 영향 측정 다 ) 성과 NTRC 의 Toxicity and Internal Dose team 은지난몇년간나노물질의노출에대한이해를위한상당한성과를이루었다. 팀이이룬성과는다음과같다. in vitro 와 in vivo 노출을위한나노입자의개선된산포방법을개발 배양한피부세포를통한 SWCNTs 또는산화금속나노물질의 in vitro 영향측정

117 IV. 고찰 111 SWCNTs 노출로 인한 폐 손상 영향 측정 실험동물을 이용해 폐 내에서 표지된 SWCNTs 침착과 이동 경로 추적 일정한 크기와 농도의 에어로졸 상태의 초미세 TiO 2 입자 및 SWCNTs 제 조방법 실험동물에 SWNCTs 와 TiO 2 나노입자의 폐 노출 후 심혈관 반응 측정 라 ) 추가연구의필요성과향후계획 NTRC 는나노물질의노출에따른잠재적유해성에대해많은연구결과를얻었지만아래와같은분야의연구가필요하다. 흡입된 나노입자가 폐에 미치는 특성과 심각성 측정 입자가 흡입된 후 체내 다른 부분 ( 심장이나 뇌 등 ) 으로 이동할 수 있는지 여 부 나노입자 노출이 면역체계에 어떤 영향을 미치는지 측정 나노입자 특유의 물리화학적 성질이 이러한 입자에 노출되었을 때 신체반응 에 어떠한 영향을 미치는지 측정 (2) Risk assessment 가 ) 배경산업안전의관점에서위해성평가는유해물질에노출되는작업자에대한안전과건강에대한잠재적위험성의과학적평가로설명될수있다. 위해성평가시반드시유해물질존재여부와작업자가쉽게유해물질에노출되는정도에대해결정해야한다. 위해성은유해물질이존재할때만그리고작업자가그물질에노출될때만발생한다. 정량적이고정성적인위해성평가방법이위해성사정에사용되어왔다. 정량적인위해성평가방법은노출량과반응 (reaction) 사이의관계즉, 용

118 112 나노물질의유해성평가및근로자건강장해예방대책 량-반응관계에대한적절한데이터가존재할때사용된다. 정량적인방법은유해건강영향을일으키기쉬운 ( 또는쉽지않은 ) 노출농도를추정하는데유용하다. 추정치는 (1) 작업자에대한건강및안전위해성특성의기술 (2) 위해성관리결정을위한기반조성 (3) 공학적조절방법과산업안전및건강을위한조치들의효율성평가등에이용된다. 적절한용량반응관계데이터가존재하지않을때는상대적인또는유해성우선순위접근과같은정성적인위해성평가방법이사용된다. 적절한위해성평가모델과방법을개발하기위해 risk assessor 는위해성과불확실성을추정하기위한유용한데이터를제공할실험을설계하기위해 experimental scientist 와긴밀히협조한다. 이들은또한효과적인위해성감소전략을수립하기위해필요한분석을제공하는 risk manager 들과도함께일한다 ( 그림 51). 그림 51. 위해성평가에서 research, assessor, manager 의협력관계

119 IV. 고찰 113 나 ) NTRC의 "Risk Assessment" 프로젝트산업위해성평가의목표는작업자들의안전과건강에유해성을야기하는작업환경조건을예측하는것에있다. 위해성을감소시키거나제거하기위해적절한예방수단을개발하기위해서 risk manager 들은이러한정보를이용한다. 나노테크놀로지와같은새로운산업분야에서는산업적인나노입자노출위험성평가를위한사람에대한데이터는아직존재하지않다. 그러므로 NTRC 는용량- 반응관계를추정하고나노입자를생산하거나사용하는작업자에대한위해성평가를위해기존에존재하는동물데이터를통해사람에대해과학적으로외삽하여추정하고있다. 이위해성에대한향상된이해와나노입자노출위해성평가를위해개선된과학적모델과방법을제공하기위해 NTRC risk assessment 팀은현재다음세가지분야에연구노력을집중하고있다. 흡입된나노입자의거동과체내다른장기로이행증가가능성을설명하기위해현재사용되는설치류폐노출모델의확장 내재용량과생물학적반응사이의관계에대해설명하기위한모델연구 다수의타당성있는용량- 반응모델로부터위해성추정을통합하기위한최고수준의통계적방법개발 NTRC 는 또한 나노입자 노출에 대한 정량적 / 정성적 위해성 평가 연구를 수행 중이다. 현재 이용 가능한 정보에는 (i) 흡입성 분진입자와 섬유에 대한 독성학 적 / 역학적 연구, (ii) 나노입자에 대한 in vitro 및 in vivo 독성 연구결과 등이 있다.

120 114 나노물질의유해성평가및근로자건강장해예방대책 다 ) 성과 미세, 초미세 입자에 대한 선행 연구결과를 이용해 정량적인 위해성 평가 수 행 산업 안전 연구 주제 완수에 필요한 과학적 정보 획득과 데이터 격차를 메 우기 위해 외부 연구원과 협력 관계로 발전 학술지에 연구 논문 게재 학회에서 연구 성과 발표 특히, 미세, 초미세 TiO2 입자의정량적위해성평가는 NIOSH Current Intelligence Bulletin 에서 recommended exposure limits (RELs) 의근거로이용되었다. 폐의선량측정모델과나노입자연구를위한강화된적응성제공을위한폐에서의입자침착모델의변형이완료되었다. 라 ) 추가연구의필요성과향후계획 NTRC risk assessor 들은다음 2가지방법으로나노입자관련연구시행 초기위해성관리전략의모형을개발하기위해선행된데이터를이용해위해성평가방법의적용 탄소나노튜브와같은비구형나노입자에대한노출시산업안전에관한데이터격차를메우기위해생물수학적모델링을통한접근 이러한연구가 engineered nanoparticles 에노출된작업자에대한안전및산업유해성추정을위한과학적인근거를제공해줄수있을것이다. 또한나노입자를생산하거나사용하는작업자들을보호하기위한작업장통제나다른위해성관리전략수립에있어서기초적인가이드라인을제공할수있을것이다.

121 IV. 고찰 115 (3) Epidemiology and Surveillance 가 ) 배경 engineered nanomaterial 에대한노출과그반응에대한사람에대한연구는현재불가능하다. 나노물질에대한지식과이해에대한격차는역학조사가이루어지기전에이격차를감소시켜야한다. 예를들어노출평가법의개선은어느작업자집단이나노물질에노출되기쉬운지를규명해줄수있을것이다. 작업자들에대한건강영향에대한연구결과는나노물질과관련된위해성에대한유용한정보를제공할것이다. 이러한조사가효율적으로확립될때까지다른에어로졸 ( 큰흡입성물질 ) 에노출된사람에대한조사가공기중나노물질노출에대한위해성추정에이용될수있다. 역학연구문헌으로부터얻은작업장에서의공기중흡입성나노입자, 섬유, 공기오염물질에대한노출로인한데이터로부터나노물질노출시유해성을가늠할수있다. 그러나이러한데이터를나노물질에대한작업장노출에적용시키는것에는아래와같은몇가지문제가존재한다. 관찰된 건강영향을 일으키는 입자 크기 (100 nm 이하 ) 의 상대적인 중요성 결 정 나노입자가 체내에서 이동 가능 여부와 나노입자에 직접 노출된 장기 외의 다른 장기에도 잠재적으로 영향을 미치는지 여부 측정 나 ) NTRC의 "Epidemiology and Surveillance" 프로젝트나노물질에대한작업장에서의노출에대한잠재적영향에대한정보가부족하기때문에나노기술분야에종사하는근로자들에대한산업안전조사가필요하다. NTRC 는나노물질을다루는작업장에대한산업안전조사의이행에관하여고용주와근로자를위해기준을제공함으로써이러한데이터부족에대한청원을제기하고있다.

122 116 나노물질의유해성평가및근로자건강장해예방대책 나노물질을생산, 사용하는모든작업장에서는정성적인위해성결정을위한수요조사 (needs assessment) 가이행되어져야만한다. NTRC 에서제공하는권고안은이러한수요조사와존재하는유해성적용, 의학적조사방법에대한접근을위한 framework 로이루어져있다. 이것은새로착수되는프로그램의산업안전조사프로그램과방법개선에참고가될것이다. 나노기술이발전할수록이런권고안과 framework 는개정되어야할것이다. ( 그림 52) 그림 52. 근로자노출에관한나노기술관리방향 다 ) 추가연구의필요성과향후계획적절한나노물질노출결정방법과입자크기분포 / 조성에대한평가방법등과같은나노물질노출평가방법개선의필요성이인식되고있다. 개선된노출평가방법은일련의과정에있어서중요한첫과정을포함하며나노물질에노출됐을것으로생각되는작업자의코호트를확인하는것과도밀접하게연관되어있을것이다. 이러한지식격차는역학조사가시행되기전에해결되어야한다. 게다가독성과건강영향조사는의학적조사프로그램을통해설명될건강문제확인을

123 IV. 고찰 117 위해필요하다. (4) Engineering Controls and Personal Protective Equipment 가 ) 배경현재는나노물질노출기준이부족하기때문에공학적조절의효율성과필요성을평가할수있는대안이요구되어진다. 성공적인나노기술의성장은새로운노출통제설비와같은생산과개발비용에달려있다. 산업적노출의최소화는나노물질의알려지지않은독성조절에있어가장신중한접근법이다. 이러한접근은덜유해한물질로의대체, 유해한작업과정생략, 자동화를통한작업자노출회피, 유해물질로의접근차단등을포함한다. 나노물질노출로인한위험성에대한이해가향상될수록이러한통제는더분명해질것이다. 나노물질에대한공학적조절을통해노출을줄이는것이불가능할경우는방독면, 위생복, 장갑과같은개인보호장구 (PPE) 를고려해볼만하다. PPE 의사용은유해물질에대한전문적인평가와판단을바탕으로해야하며나노물질이작은크기와특이성으로인해큰입자들보다 PPE 를더잘통과할수있다는점을고려해야한다. 나 ) NTRC의 Engineering Controls and Personal Protective Equipment 프로젝트 - 공학적조절 NTRC 는나노입자의작업적노출을통제하기위해다양한접근을하고있다. 그일환으로표준화된공학적조절방법의철저한분석을통해나노물질의조절이큰입자노출의조절과어떤차이가있는지연구하고있다. 연구자들은나노물질을다루는여러시설들에서의작업적노출에대한가능성과공학적조절의이용을평가하고있다. 그리고적용된공학적조절의평가를기업과함께실행하고있으며안전작업기준을위한임시권고안도제공하고있다.

124 118 나노물질의유해성평가및근로자건강장해예방대책 - 방독면 and other PPE 직경 20 nm 이상의입자에대한공기여과장치의효율에대한과학적정보는이용가능하다. 그러나더작은입자에대한정보는거의없다. 더작은입자에대한지식과이해를증진시키기위해 NIOSH 는 2005 년에 University of Minnesota의 Center for Filtration Research에연구비를지원하였다. 이연구의목적은 3~20 nm 크기나노입자의유리섬유, 일렉트릿, 나노섬유등여러필터들에대한투과성을측정하는것이다. 이연구에서시험한필터매질은 3 nm 크기의나노입자를효과적으로걸러낼수있었다. 이크기의입자가더큰입자들보다효율적으로필터를통과하는지에대한증거는없었다. NTRC 는 NIOSH 로부터승인된방독면을이용해이결과를검증하고방독면을정확히착용하지않았을때노출정도를평가할계획을수립중이다. 또한 NTRC 는방어복과전체적인 PPE 방어효과를혁신적으로측정할나노입자투과성측정방법을개발하고있다. NTRC 는임상실험과실험실에서사용할에어로졸샘플에대한견본을개발했다. 다 ) 성과 - 공학적조절 2005 년 12 월 NTRC 는탄소나노물질을혼합합성하는연구시설에대한포괄적이평가를수행했다. NTRC 는많은공기및표면의샘플을수집했으며과제중심의샘플링의일환으로 realtime aerosol 기구를작동시켰다. 공학적조절과작업기준을관찰했으며정량적으로평가하였다. 2006년 3월 NTRC 는나노크기의금속산화물의제조업체에서연구를수행했다. 연구목적은나노물질의작업적노출의가능성확립과공학적조절과안전작업기준의평가였다. 이를통해어느부분의개선이노출을저감시킬수있는지에대한보고서가작성되었다.

125 IV. 고찰 년 6월 NTRC 는양자점 (Quantum dots) 을생산하고작은디스플레이로집약하는제조업체에대한스크리닝조사를수행하였다. 적용된공정타입, 노출통제방법, 노출측정데이터에대한정보를수집하였다. 또한시료에대한시험결과에대한보고서를작성하여회사에제공하였고노출통제와작업기준에관해개선할부분에대한제안을하였다.( safenano/) - 방독면및기타 PPE 마스크와여과법조사에대한결과를보고하였다. 라 ) 추가연구의필요성과향후계획 NTRC 는좀더깊이있는현장조사와나노기술산업에의작업기준및노출조절의효과에대한연구에집중할것이다. 나노입자수집방법개발을위해, 측정방법을개발하는연구자들과협력할것이다. NTRC 는방독면및다른 PPE 를투과하는나노입자에대한연구를지속할것이며, 연구결과는나노물질에노출된작업자들을보호하기위한기준이나방법을수립하기위해이용될것이다. (5) Measurement Methods 가 ) 배경나노산업으로인해야기되는잠재적인작업장건강위해성을예상하고, 인식, 평가, 제어하기위해서는올바른측정법이필요하다. 전체와흡입성먼지의농도를측정하는것과같은전통적인측정법은나노물질특유의물리화학적, 생물학적성질때문에적합하지않을수있다. NTRC 의과학자들은나노물질을측정하는데적합한방법을확인하고검증하는연구를계속하고있다. 이분야는나노계측학 (nanometrology) 이라고알려져있다. NTRC 의 Measurement Medthods Team 은세가지목표를갖고있다.

126 120 나노물질의유해성평가및근로자건강장해예방대책 전체와 흡입성 먼지의 농도를 측정하는데 사용하는 방법이 동일하게 나노물 질을 측정하는데 사용할 수 있는지에 대한 평가 작업장공기 중 나노물질 측정의 정확성을 평가할 수 있는 방법의 개발 및 시험 sampling 기계를 비교하고 검증하는 시험 및 평가시스템의 구축 나 ) NTRC의 Measurement Methods 프로젝트 Measurement Methods Team 은작업장에서나노물질을측정하는적절한방법에대한지식기반을세우는데집중하고있으며다음의연구를진행하고있다. 나노물질을생산하는제어된실험실환경을수립하고크기와모양 ( 구조와형태 ) 을측정하는기계효율성의평가 실시간으로대기중나노입자에어로졸을모니터하는기계의평가 에어로졸의표면적을측정하는혁신적인방법을연구하고다른모양과크기의나노입자에대한비교할만한결과를제공하는가를연구 2.5 와 0.1 μm이하 TiO 2 입자의작업자노출을측정하는다른측정법의평가 나노에어로졸의크기분포, 표면적, 농도를측정하는직독식측정기개발 이밖에 NTRC 의 Measurement Methods Team 은작업장에서나노물질의노출을특성화하고노출을감소하는데사용하는제어법의효율성을평가하는 Field Research Team의활동을지원하고있다. 위의연구과제들은작업장에서나노물질노출의특성과그정도를이해하고나노물질이어떻게생성되고분산되는지설명하는데도움을줄것이며, 적절한건강보호전략을수립하는데도움을주고국가와국제적인기준을수립하는데필요한정보를제공할것이다.

127 IV. 고찰 121 다 ) 성과 2004와 2006년사이에 NTRC Measurement Methods team은측정도구와방법의특성화, 실행, 평가에있어다음과같은중요한성과를이루어냈다. 실험실기반의나노물질특성을알아내는방법을개발 제어된실험실환경에서의혁신적인나노계측기기의평가 나노산업작업정에서의측정법을시험 NIST 와공동연구로나노입자의대조물질을개발 과학적인전문가의감수를받은논문, 발표, 매체를통한연구업적의확산 개인적인접촉과 NIOSH Nanotechnology 웹페이지를통한전문가조언과이해당사자들에대한자문 표준에어로졸 sampler 개발 라 ) 추가연구의필요성과향후계획 NTRC 가나노입자를특성화할수있는능력을강화하고, 연구결과가국내외적컨센서스를이룰수있도록하며 NTRC measurement project 를통해개발된현장과실험실에서의연구계획을확장하는계획을갖고있다. (6) Exposure Assessment 가 ) 배경노출평가는나노물질이산업안전이나건강위해성을갖고있는지결정하는데중요한요소이다. 따라서나노물질에노출되는경로, 노출량, 노출의빈도를알기위해작업장에서의노출평가를수행하는것이필요하다. 작업장노출데이터가없이작업환경을특성화하거나나노물질을방출하는출처를알거나작업자가받을수있는나노물질의노출량을평가하는것은어렵다. 게다가노출데이터는위해성관리와관련된정책결정, 작업자노출감소를위한공학적조절및작

128 122 나노물질의유해성평가및근로자건강장해예방대책 업지침의 효율성평가에 유용하다. NTRC Exposure Assessment team 은 여러종류의 나노물질을 생산하고 다루 는 산업에서 나노물질의 작업자노출을 평가하기 시작했다. 노출을 특성화하기 위해 크기, 모양, 구조, 화학적특성을 규정하는 방법을 포함하여 여러가지 노출 평가방법을 사용하고 있다. 이 정보는 시설을 직접 다니며 평가하여 얻은 것이 다. 개별적인 호흡이 이루어지는 공간에서 개개 작업자의 노출을 sampler 로 정확 히 측정하였다. 불행하게도 현재 나노물질 노출을 감지할 수 있는 많은 기계들 이 작업자에게 부착하여 샘플을 수집하기엔 매우 큰 편이다. 따라서 작업자의 나노물질 노출의 정도를 측정하기 위해 일반적인 공간에서의 샘플도 수집하였 다. 나 ) NTRC의 Exposure Assessment 프로젝트 NTRC 는현재나노물질의다양한생산자와최종사용자에서정성적, 정량적노출평가조사를수행하고있다. 다 ) 성과 Exposure Assessment team 은나노물질에대한작업장에서의노출을특성화하기위해네곳의노출평가조사를완료하였다. 플라스틱물질을강화시키기위해탄소나노섬유를첨가하는대학의연구소 TiO 2 제조공장 퀀텀도트를다루는연구실 여과율증가를위해셀룰로오스에나일론나노섬유를적용하는필터제조공장

129 IV. 고찰 123 라 ) 추가연구의필요성과향후계획 NTRC 는소형의입자크기, 농도를측정하는기기를사용하여다양한나노산업공장에서현장노출평가를하려고계획중이며나노물질의노출을일으키는공정과업무들을조사할계획이다. 초기조사를완수하면 NTRC 는입자크기분포와표면적, 다양한크기범위에서의질량을측정할수있는더정밀한기계를사용하여노출특성화연구를추가로진행할것이다. 세부조사에서얻어진측정치는 NTRC 가나노물질에대한노출량을결정하고건강에영향을주는정도를평가할수있게해줄것으로기대된다. NTRC 는개인으로부터 sampling 하는기기, 즉작업장노출의건강영향에기여하는입자크기, 모양, 표면적, 농도, 전하와기타특성을측정할수있는기기를개발하기위해공동연구를계속진행할것이다. 작은크기의 sampling 기기를개발하고입증하면작업장의노출평가와작업자에게주는건강영향을이해하는데도움이될것이다. (7) Fire and Explosion Safety 가 ) 배경나노산업은상대적으로새로운분야이기때문에나노물질과관련된유해성에대해잘알려져있지않다. 그러나나노크기입자의특성은분진폭발의위험성을내재하고있으며큰표면적과작은크기때문에대기중에노출되었을때자발적으로인화할수있다. 더구체적인연구결과가나올때까지 NTRC 는 100 nm 보다작은입자를포함하여폭발가능성을평가하는연구를진행할것이다. 매년약 20 건의분진폭발이일어나고재산피해, 작업자의상해, 죽음을일으킨다. 분진폭발은매우빠르게일어나며격렬하다. 폭발동안표면의분진이재분산되고연속적인폭발을일으킬수있다. 나노물질을기체상태로생산하거나가루, 슬러리, 서스펜션, 또는용액으로서나노물질을사용하는경우대기중으

130 124 나노물질의유해성평가및근로자건강장해예방대책 로나노입자를방출할수있으며폭발의위험을갖고있다. 현재나노물질과관련하여우선시되는안전문제는폭발과화재이다. 나 ) 화재와 폭발 나노물질은 입자의 크기가 작아지면 폭발의 위험성이 커지기 때문에 화재와 폭발에 대한 안전문제를 갖고 있다. 입자크기가 수십 마이크론 정도이면 폭발위 험은 안정수준에 이른다. 그러나 어떤 나노물질은 나노크기에서 반응의 진행을 위해 열을 생성하도록 고안되기도 한다. 이것 역시 화재위험성을 갖고 있는 나 노물질이다. 나노물질의 운반, 취급, 공정 중 정전기적으로 전하를 띠는 성질은 특히 나노 파우더를 다룰 때 폭발위험성을 갖게 한다. 전하를 띠는 경향은 입자표면적이 증가함에 따라 커지는 것으로 보인다. 그 결과 표면적이 커서 전하를 잘 띠게 되고 대기 중에 분산되면 스스로 점화하게 되는 것이다. 나노입자와 나노구조로 된 다공성의 물질은 수년간 반응속도를 증가시키거나 액체나 기체에서 일어나는 반응에 필요한 온도를 감소시키는 촉매로 사용해왔 다. 조성과 구조에 따라 어떤 나노물질은 촉매작용을 시작하여 화학적 조성만으 로는 일어날 수 없는 화재와 폭발 가능성을 증가시킬 수도 있다. 다 ) NTRC의 Safety 프로젝트 NTRC 는 작업장에서 대기 중 나노물질에 의한 화재의 위험이나 폭발성에 대 한 연구는 시작하지 않았지만 관련문헌을 참고하여 연구방법의 개발을 시작하 고 있다. 라 ) 성과대기중나노물질의화재와폭발위험성을예측하는자료가없어 NTRC 는 Approaches to Safe Nanotechnology: An Information Exchange with NIOSH

131 IV. 고찰 125 라는이름으로잠정조치를출간했다. ( nanotech /safenano/) 마 ) 추가연구의필요성과향후계획 NTRC 는나노산업의화재와폭발안정에관한추가연구가필요한여러영역을다음과같이정의했다. 나노물질의화학적, 물리적특성과반응성에대한이해 화재나폭발을일으킬수있는유력한나노물질의정의 가연성의나노물질이비슷한조성및양의거친물질보다화재와폭발위험성이더큰정도에대한이해 촉매작용을시작할수있고화재와폭발가능성을증가시키는나노물질의화학적, 물리적특성의이해 (8) Recommendations and Guidance 가 ) 배경 NIOSH 는 (i) 작업자의안전과건강을보호하는연구와권고사항을만드는것을계속해야하며, (ii) 작업자와고용주들에게어떻게작업장의건강유해성을제어할것인지가이드를제시해야한다. 또한 NIOSH 는연구결과를작업장에서과학적으로합당하고실용적인권고사항으로바꾸는데노력하고있다. 국내외연구자들은나노산업작업자와고용주에게알맞은과학적권고사항을개발하는것이연구최우선순위에있다는것을확인하였다. 이권고사항들은나노물질의노출과관련된위험을이해하는데도움을주고이런위험을없애는가이드를제공할것이다. NTRC 는나노물질의노출로부터안전과건강을보호받을수있도록하는것을목표로삼고있다.

132 126 나노물질의유해성평가및근로자건강장해예방대책 이용 가능한 최고의 과학적 정보를 기반으로 하여, 나노물질의 사용과 생산 중 작업장의 안전과 건강을 위한 임시 권고사항의 작성 과학적인 연구 ( 현장 및 실험실 연구 ) 를 통해 경험에 근거한 권고사항의 검 증 권고사항의 확산 및 개선을 위한 피드백을 요청하기 위한 고용주, 작업자, 정부, 학계와 공동협력관계 유지 정기적인 업데이트와 새로운 연구결과에 따라 임시권고사항의 수정 현재 사용하는 나노물질의 분류, 독성정보, 권고사항에 관한 MSDS 의 평가 직업적 노출한계에 대한 권고 사항의 평가 및 업데이트 나 ) NTRC의 Recommendations and Guidance 프로젝트 NTRC 는고용주, 작업자, 전문가에게권고사항을제공하기위한프로젝트를여러개진행하고있다. 첫번째프로젝트는 Approaches to Safe Nanotechnology: An Information Exchange with NIOSH 라는이름으로문서화되어있다. 2005년 10 월에만들어졌고 2006년 7월에업데이트되었다. 이문서는현재진행하고있는 NTRC 의나노물질노출에의한건강위해성평가와노출을최소화하는방법을서술하고있으며계속업데이트될예정이다. NTRC 는또한 Nanotechnology Environmental and Health Implications(NEHI) 의 (i) 기계사용법, 계측학, 분석법 (ii) 나노물질과인체건강 (iii) 나노물질과환경 (iv) 건강과환경감독 (v) 위해성관리법등 5가지분야에참여하고있다. 다 ) 성과 NTRC 는나노물질의안전한취급에대한임시권고사항을만들어연구결과를 발간하고있다.

133 IV. 고찰 127 NIOSH 와함께 Approaches to Safe Nanotechnology: An Information Exchange 라는제목으로임시가이드라인개발및배포 TIO 2 나노입자의작업장노출한계설정 (Current Intelligence Bulletion) 국내외연구자, 제조자, 산업지도자와의 partnership 수립 국내외 working group 및 expert panel 에참석하여권고사항과가이드라인을배포하고전문적조언제공 전문가의감수를받은학회지를통해연구결과와권고사항배포 라 ) 추가연구의 필요성과 향후 계획 현재, 나노물질의 직업적 노출에 대한 유효한 결과는 적다. 나노물질에 대한 지식과 이해의 격차를 메우기 위해 이 팀에서는 NTRC 는 Nanotechnology Field Research Team 을 만들어 나노물질의 생산, 사용 공장의 현장조사를 수행하였 다. NTRC 는 경험적 결과를 수집하고 완벽하고 정확한 위해성에 대한 접근을 하 기 위해 현장조사를 수행할 것이다. 그러나 산업안전과 건강영향을 더 잘 이해 하기 위해서는 다음과 같은 추가연구가 필요하다. 전반적인나노물질공정의특성이해 나노물질에의노출을최소화하기위한실무작업기준 공학적조절과 PPE( 개인보호장비 ) 제작 나노물질과관련된유해성에관한작업자교육 나노물질의노출을측정하기위한분석기기와방법의평가 나노물질노출의정량적, 정성적측정법 NTRC 는나노물질에노출된작업자의건강감독에관한가이드라인도만들고있다. 여기서는의학적, 생물학적모니터링, 건강기록검토와노출기록의효율성에대해언급하고있다. (

134 128 나노물질의유해성평가및근로자건강장해예방대책 (9) Communication and Education 가 ) 배경 Communication 과 education 은 NTRC 연구프로그램에있어서통합적인요소이며, NIOSH research-to-practice(r2p) program 과밀접한연관이있다. 따라서 Communication 과 education 은지식격차가있는단계, 개발단계에서의 10 가지핵심적인주제중하나이다. NTRC 는관련있고응용가능한안전및건강관련정보를다양한청중들이이용할수있게하기위해서다음의목표를설정하였다. 연구의 필요성을 알아내고 연구결과를 공유하기 위한 파트너쉽 형성 청중들에게 적절한 과학적 정보 제공을 위한 의사소통 기구 개발 각 청중들에게 적절한 방법을 사용하여 연구결과를 확산 작업장에서 나노물질 노출을 줄이기 위한 효과적인 의사소통 및 교육기구 개발 나노기술 의사소통 및 교육에 관심이 있는 전문가들간의 국제적인 협력 NTRC 는피고용인, 근로자, 건강및안전성전문가, 연구자, 국회의원, 언론을포함한다양한청중과의의사소통을하고있다. 그러므로각청중들이 (1) 적절하고유용한방법으로정보를제공받고 (2) 나노기술작업장에서안전과건강을증진시킬수있는능력을갖는것이중요하다.

135 IV. 고찰 129 그림 53. 나노기술작업장에서의안전및건강을위한중점분야 나 ) NTRC 의 Communication and Education 프로젝트 작업장에서의나노물질노출과나노기술의잠재적영향에대한지식과이해를증진시키기위해, NTRC 는다음과같은일을하고있다. NIOSH 홈페이지에 나노기술연구에 관해 심도 있게 다룬 웹페이지 제작 및 유지 나노기술에 대한 전반적인 정보 및 NTRC 연구프로그램을 담은 책자의 제 작 및 배포 나노입자에 대한 자료를 포함하는 온라인 정보기반 구축 나노기술에 관한 국제학회 지원 작업장에서의 나노물질 노출에 대한 가이드라인 및 권고를 설정하는 자료

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

02 나 해결되지 않아 고심하던 중 미생물도 생명체이므로 약육강식하는 동물의 세 계와 같이 개구리 같은 약자와 호랑이 같은 강자가 있다는 자연의 섭리가 생각났 다. 그렇다면 호랑이 같은 미생물이 어디에 있을까? 라는 의문에 답이 나왔다. 살균력이 매우 강력한 옻나무와

02 나 해결되지 않아 고심하던 중 미생물도 생명체이므로 약육강식하는 동물의 세 계와 같이 개구리 같은 약자와 호랑이 같은 강자가 있다는 자연의 섭리가 생각났 다. 그렇다면 호랑이 같은 미생물이 어디에 있을까? 라는 의문에 답이 나왔다. 살균력이 매우 강력한 옻나무와 01 안내말씀(책 내용 요약) 양생( 養 生 )의학을 알면 회춘한다 좌측 사진을 보면 1945년생인 필자가 2001년 대통령상을 수상할 당시 14번의 창업에 따른 흥망으로 얼굴은 70대였고 귀에 소리가 들리는 이명과 극심한 만성 피로에 고지혈증 수치 600에 심근경색으로 사경을 넘나들던 환자였다. 2015년 4월의 얼굴은 50대 후반으로 보는 사람이 많다.

More information

신규투자사업에 대한 타당성조사(최종보고서)_v10_클린아이공시.hwp

신규투자사업에 대한 타당성조사(최종보고서)_v10_클린아이공시.hwp 신규투자사업에 대한 타당성 조사 (요약본) 2015. 4. 지방공기업평가원 제주관광공사가부족한쇼핑인프라를보완하고, 수익을제주관광진흥에재투자하여 관광산업활성화와관광마케팅재원확보 라는양대목적달성에기여하고공기업으로서사회적책임을다하고자시내면세점사업에투자하려는의사결정에대한타당도는전반적으로볼때 긍정 으로평가할수있음 역할및필요성 대내 외환경 정책및법률 경제성기대효과

More information

XXXXXX XXXXXX

XXXXXX XXXXXX KEI 2004 RE-13 연구보고서 실내공기질 관리제도 발전방안에 관한 연구 공성용 이희선 XXXXXX XXXXXX 제1장 서 론 1 2 실내공기질 관리제도 발전방안에 관한 연구 제2장 실내공기질과 건강 3 4 실내공기질 관리제도 발전방안에 관한 연구 제2장 실내공기질과 건강 5 6 실내공기질 관리제도 발전방안에 관한 연구 제2장 실내공기질과

More information

존경하는 독자 여러분!! 질병에서 해방운동(21세기 3 1운동)에 동참하면 박근혜 정부 임기이내 의료보험 1/3만 납부해도 환자분담금 없는 국민행복시대를 자손에게 물려준다. Korea OECD 회원국 중 환자증가율 의료증가율 암발생율 암사망율 40~50대 사망율 불임율

존경하는 독자 여러분!! 질병에서 해방운동(21세기 3 1운동)에 동참하면 박근혜 정부 임기이내 의료보험 1/3만 납부해도 환자분담금 없는 국민행복시대를 자손에게 물려준다. Korea OECD 회원국 중 환자증가율 의료증가율 암발생율 암사망율 40~50대 사망율 불임율 질병공화국 질병해방 21세기 3 1운동 Ⅲ 저자 근본의학자 박세준 OECD 회원국 의료비 증가율 및 환자증가율 통계 근본의학방송 www.ghtv.or.kr 방송안내 근본의학강의 : 항생의학의 정반대인 양생의학 강좌 병원임상사례 : 근본의학 병원임상사례 체험사례 : 병원불치병을 스스로 치료한 체험사례 청인미생물박물관 : 세균의 세계를 TV에서 동물의 세계를 보듯이

More information

- 2 -

- 2 - 터키 / 공통 가이드라인명 GMP Kılavuzu GMP 가이드라인 제정일 상위법 Ÿ Ÿ 제정배경 범위 주요내용 Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ Ÿ 의약품제조시, 제조허가증, 의약품의용도및판매허가요구사항, 안정성, 품질및품질부적합으로인한피해로환자가발생하지않도록제조하기위함임. 화학합성의약품, 생물의약품, 방사성의약품, 임상시험용의약품, 무균의약품, 사람혈액및혈장의약품,

More information

ⅰ ⅱ ⅲ ⅳ ⅴ 1 Ⅰ. 서론 2 Ⅰ. 서론 3 4 1) 공공기관미술품구입실태조사 Ⅰ. 서론 5 2) 새예술정책미술은행 (Art Bank) 제도분석 3) 국내외사례조사를통한쟁점과시사점유추 4) 경기도내공공기관의미술품구입정책수립및활용방안을위 한단기및장기전략수립 6 7 Ⅱ. 경기도지역공공기관의미술품구입실태 및현황 1) 실태조사의목적 ž 2) 표본조사기관의범위

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

암센터뉴스레터1

암센터뉴스레터1 CANCER HOSPITAL News News Letter For Yonsei University Gangnam Severance Hospital http://gs.iseverance.com 2012.06.21 2012.08.16 2012.09.19 2012.10.04 2012.10.25 CONTENTS 2012.07.27 2012.10.06 2012.11.06

More information

(지도6)_(5단원 156~185)

(지도6)_(5단원 156~185) 1 _ 2_ 3_ 4_ 01 158 159 참고 자료 160 161 162 163 02 164 165 참고 자료 166 167 168 169 활 동 지 03 170 171 172 173 활동의 결과이다. 신경 세포와 신경 세포 간에 화학 물질을 방출하여 전기 신호를 전달해 주는 시냅스 활동은 우리 뇌가 새로운 경험을 할 때마다 변한다. 기분 나쁜 경험을 하면

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï

½Ç°ú¸Ó¸®¸»¸ñÂ÷ÆDZÇ(1-5)¿Ï 실과056-094 2013.1.9 7:22 PM 페이지67 MDPREP_RipControl 2007 개정 5학년 검정 지도서 각론 알짜 정리 67 영양소 힘을 내는 일(탄수화물/지방/단백질) 몸의 조직 구성(지방/단백질/무기질/물) 몸의 기능 조절(단백질/무기질/비타민/물) 식품 구성 자전거의 식품과 영양소 식품군 곡류 탄수화물 우리가 활동하는데 필요한 힘을

More information

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분 세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------

More information

C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 최근히트상품 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략

C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 최근히트상품 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략 Global Market Report 16-035 2016 브라질소비시장, 이런상품을주목하라! C O N T E N T S 목 차 요약 / 3 Ⅰ. 브라질소비시장동향및특성 4 5 1. 경제현황 2. 소비시장의특성 Ⅱ. 브라질소비시장히트상품분석 11 20 1. 최근히트상품 2. 2016 년소비시장, 이런상품을주목하라! Ⅲ. 우리기업의 4P 진출전략 27 30

More information

<B3EDB4DC28B1E8BCAEC7F6292E687770>

<B3EDB4DC28B1E8BCAEC7F6292E687770> 1) 초고를읽고소중한조언을주신여러분들게감사드린다. 소중한조언들에도불구하고이글이포함하는오류는전적으로저자개인의것임을밝혀둔다. 2) 대표적인학자가 Asia's Next Giant: South Korea and Late Industrialization, 1990 을저술한 MIT 의 A. Amsden 교수이다. - 1 - - 2 - 3) 계량방법론은회귀분석 (regression)

More information

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770>

<5BB0EDB3ADB5B55D32303131B3E2B4EBBAF12DB0ED312D312DC1DFB0A32DC0B6C7D5B0FAC7D02D28312E28322920BAF2B9F0B0FA20BFF8C0DAC0C720C7FCBCBA2D3031292D3135B9AEC7D72E687770> 고1 융합 과학 2011년도 1학기 중간고사 대비 다음 글을 읽고 물음에 답하시오. 1 빅뱅 우주론에서 수소와 헬륨 의 형성에 대한 설명으로 옳은 것을 보기에서 모두 고른 것은? 4 서술형 다음 그림은 수소와 헬륨의 동위 원 소의 을 모형으로 나타낸 것이. 우주에서 생성된 수소와 헬륨 의 질량비 는 약 3:1 이. (+)전하를 띠는 양성자와 전기적 중성인 중성자

More information

Jkafm093.hwp

Jkafm093.hwp 가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은

More information

전기 회로 과목의 성취기준 및 성취수준

전기 회로 과목의 성취기준 및 성취수준 ( 과 학 ) 과목의 성취기준 및 성취수준 1. 교과의 개요 (1) 성격 과학 에서는 물리, 화학, 생명과학, 지구과학의 기본 개념들이 적절하게 균형을 이루면서 자연스럽게 융합되도 록 구성한 학생들이 과학에 대한 흥미를 느끼고 자연을 통합적으로 이해하는 데 필요하다면 어려운 과학 개념 일지라도 적절한 수준에서 소개한 과학 을 통하여 학생들이 심화된 물리, 화학,

More information

13È£³»Áö-1

13È£³»Áö-1 한국보건산업진흥원 소식지 NEWS VOL.13 2008 09+10 주요환경변화에 따른 경쟁력 약화 예상 제약사의 환경변화인식도 및 경영전략 조사 제약기업의 사업전환에 필요한 법률정보 제7차 EU Framework Programme Health 지원정책 BIO 2008을 통해 본 세계바이오산업 동향 및 전망 식품안전사고 대응 및 예방 방안 게시 시판 판 게 고객과

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 11 곡선과곡면 01 Spline 곡선 02 Spline 곡면 03 Subdivision 곡면 C n 연속성 C 0 연속성 C 1 연속성 2 C 2 연속성 01 Spline 곡선 1. Cardinal Spline Curve 2. Hermite Spline Curve 3. Bezier Spline Curve 4. Catmull-Rom Spline Curve 5.

More information

2013_1_14_GM작물실용화사업단_소식지_내지_인쇄_앙코르130.indd

2013_1_14_GM작물실용화사업단_소식지_내지_인쇄_앙코르130.indd GM작물실용화사업단 인식조사 및 실용화 방향 설정 GM작물 인식조사 및 실용화 방향 설정 한국사회과학데이터센터 김욱 박사 1. 조사목적 GM 작물 관련 인식조사는 사회과학자들을 바탕으로 하여 국내 다양한 이해관계자들의 GM 작물 관련 인식 추이를 지속적이고, 체계적으로 모니터링하여 인식이 어떻게 변화하고 있는가를 탐구하기 위한 것입니다. 2. 조사설계 2.1.

More information

차 례 4

차 례 4 제 50 회전국과학전람회 2004. 07. 20 차 례 4 - 1 - 표 2. 천체의화각 표 1. 초점거리와화각 - 2 - 그림 1. 목성의표면구조 - 3 - 그림 2. 목성위성의상호현상 - 4 - π 공전속도 원궤도의반지름 π 그림 3. 케플러회전 - 5 - 표 3. 목성의궤도자료 표 4. 목성의물리자료 표 5. 4 대위성의궤도자료및물리자료 - 6 - 그림

More information

untitled

untitled 발행일: 06.03.2014 개정 번호 1.0 항 1. 화학제품과 회사에 관한 정보 1.1 REACH 등록 번호 이 제품은 혼합물임. REACH 등록번호는 3항을 참조할 것. 1.2 제품의 권고 용도와 사용상의 제한 확인된 용도 식품 및 의약품 산업용 용도에 관한 추가 정보는 Merck Chemical 포탈 (www,.merckchemicals.com)을 참고하십시오.

More information

<352831292E5FBBEABEF7C1DFBAD0B7F9BAB02C5FC1B6C1F7C7FCC5C25FB9D75FB5BFBAB05FBBE7BEF7C3BCBCF65FA1A4C1BEBBE7C0DABCF62E786C73>

<352831292E5FBBEABEF7C1DFBAD0B7F9BAB02C5FC1B6C1F7C7FCC5C25FB9D75FB5BFBAB05FBBE7BEF7C3BCBCF65FA1A4C1BEBBE7C0DABCF62E786C73> 5. 산업중분류, 조직형태 및 동별 사업체수, 종사자수 단위 : 개, 명 금정구 서1동 서2동 서3동 Geumjeong-gu Seo 1(il)-dong Seo 2(i)-dong Seo 3(sam)-dong TT전 산 업 17 763 74 873 537 1 493 859 2 482 495 1 506 15 519 35 740 520 978 815 1 666 462

More information

3LGÈ�ÇÐÁ¦2±â/2001±â³»Áö-8-30

3LGÈ�ÇÐÁ¦2±â/2001±â³»Áö-8-30 회 사 연 혁 1947. 1. 락희화학공업사 창립(화장품 제조업에 착수) 1951. 11. 부산광역시 부산진구 부전동으로 이전 (국내최초 합성수지 성형제품 생산개시) 1954. 6. 부산 연지공장 건설(합성수지 가공시설 증설) 1959. 3. 럭키유지공업사 설립 1962. 8. 1966. 1. 1966. 3. 1969. 10. 락희비니루공업(주) 설립 주식회사

More information

FGUYPYUYJJHU.hwp

FGUYPYUYJJHU.hwp 차아황산 나트륨 () CASNO:7775-14-6 OECD SIDS 위해성평가 결과 요약서 CAS No. 7775-14-6 화학물질명 차아황산나트륨() 구조식 인체건강영향 차아황산나트륨 () 은 생리적 상태에서 불안정하고, 산성이 증가함에 따라 분 - 2- 해율도 증가한다. 습기가 있을 경우 아황산 수소(HSO 3 ), 아황산염 (SO 3 ) 및 황화수소 (HSO

More information

사용설명서 의료용 진동기 사용설명서는 언제나 볼 수 있는 장소에 보관하세요. 사용전 안전을 위한 주의사항 을 반드시 읽고 사용하세요. 사용설명서에 제품보증서가 포함되어 있습니다. 본 제품은 가정용 의료용 진동기이므로 상업용 또는 산업용 등으로는 사용을 금합니다. BM-1000HB www.lge.co.kr V V V V 3 4 V V C 5 6 주의 설 치

More information

.............hwp

.............hwp 지방 벤처기업 활성화 방안 (IT, BT, NT를 중심으로) 머 리 말 제Ⅰ장 서론 제Ⅱ장 지방 경제와 벤처기업 제Ⅲ장 지방 벤처기업의 현황 및 문제점 제Ⅳ장 중앙정부의 지방 벤처기업 육성시책 제Ⅴ장 지방자치단체의 벤처기업 육성시책 제Ⅵ장 지방 벤처기업 육성의 정책 과제 - 표 차 례 - - 도 차 례 - 지방 벤처기업 활성화 방안 요약 지방

More information

(72) 발명자 김창욱 경기 용인시 기흥구 공세로 150-20, (공세동) 박준석 경기 용인시 기흥구 공세로 150-20, (공세동) - 2 -

(72) 발명자 김창욱 경기 용인시 기흥구 공세로 150-20, (공세동) 박준석 경기 용인시 기흥구 공세로 150-20, (공세동) - 2 - (19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2014-0034606 (43) 공개일자 2014년03월20일 (51) 국제특허분류(Int. Cl.) H01M 4/525 (2010.01) H01M 4/505 (2010.01) H01M 4/48 (2010.01) H01M 4/131 (2010.01) (21) 출원번호 10-2012-0101151

More information

untitled

untitled - 685 - - 686 - - 687 - - 688 - - 689 - - 690 - - 691 - - 692 - - 693 - 실험군 대조군 - 694 - - 695 - - 696 - 개 자연살해세포활성 실험군 대조군 실험군 - 697 - - 698 - 자연살해세포활성 실험군 군 대조군 - 699 - - 700 - - 701 - - 702 - - 703 -

More information

001HKT노안리플렛A4(20)

001HKT노안리플렛A4(20) 커스텀뷰 노안 수술 돋보기안경 없이 먼 곳과 가까운 곳 모두 OK! 젊은 눈으로 즐기는 아름다운 중년과 활기찬 노년 40대 이후 중 장년층도 돋보기안경 없이 신문과 글을 읽고, 레포츠와 자유로운 일상생활을 만끽할 수 있습니다. 미국 최고 안과의료기관인 마이애미의 바스컴 팔머 아이 인스티튜트(Bascom Palmer Eye Institute) 의료진과 협력하여

More information

Chapter 4. LISTS

Chapter 4. LISTS C 언어에서리스트구현 리스트의생성 struct node { int data; struct node *link; ; struct node *ptr = NULL; ptr = (struct node *) malloc(sizeof(struct node)); Self-referential structure NULL: defined in stdio.h(k&r C) or

More information

..1,2,3,4-........

..1,2,3,4-........ 2011 Spring Vol.09 Contents 2011 Spring Vol.09 Issue 04 06 09 12 15 16 Story Cafe 18 Special Theme Theme 01 Theme 02 Theme 03 24 26 28 32 36 38 40 41 42 44 48 49 50 Issue 04 05 2011 SPRING NEWS Issue

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

_report.hwp

_report.hwp 해외출장복명서 ( 일본기타큐슈, 교토, 오사카 ) 2009. 9 녹색국토 도시연구본부이승욱 - 차례 - 1. 해외출장개요 1 2. 주요내용및시사점 2 1. 기타큐슈무라사키강 2 2. 교토카모강 14 3. 오사카요도강 16 3. 방문기관및안내자 1. 목적 2. 출장일정및출장지 - 1 - 1. 기타큐슈무라사키강 < 무라사키강전경 > - 2 - < 무라사키강하류에입지한산업단지전경

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 RecurDyn 의 Co-simulation 와 하드웨어인터페이스적용 2016.11.16 User day 김진수, 서준원 펑션베이솔루션그룹 Index 1. Co-simulation 이란? Interface 방식 Co-simulation 개념 2. RecurDyn 과 Co-simulation 이가능한분야별소프트웨어 Dynamics과 Control 1) RecurDyn

More information

.....hwp

.....hwp 미국노동법제의이해 PRIMER ON AMERICAN LABOR LAW, third edition by William B. Gould IV Copyright 1993 by Massachusetts Institute of Technology All rights reserved. Korean translation copyright 2003 by Korea Labor

More information

(72) 발명자 정종수 서울특별시 서대문구 모래내로 319, 101동 405호 (홍은동, 진흥아파트) 김정환 서울특별시 구로구 구로동로21길 7 (구로동) - 2 -

(72) 발명자 정종수 서울특별시 서대문구 모래내로 319, 101동 405호 (홍은동, 진흥아파트) 김정환 서울특별시 구로구 구로동로21길 7 (구로동) - 2 - (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) B01J 23/34 (2006.01) B01J 37/02 (2006.01) B01J 37/08 (2006.01) B01D 53/86 (2006.01) (21) 출원번호 10-2010-0098306 (22) 출원일자 2010년10월08일 심사청구일자 2010년10월08일

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

<5B30345F435220205DBBFDBBEAC0DAC3A5C0D3C0E7C8B0BFEB28BFA9C1D8C8A3292E687770>

<5B30345F435220205DBBFDBBEAC0DAC3A5C0D3C0E7C8B0BFEB28BFA9C1D8C8A3292E687770> 3-10%성장, 가중치(.5,.3,.2) 재활용율 % 3년평균 의무율(%) 가중치 의무율(%) 83 78 % 73 68 63 58 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 연도 3-10%성장, 가중치(.5,.3,.2) 기존식의무량 3년평균의무량 가중치의무량 115 105 톤 95 85 75 65 2006 2007

More information

슬라이드 1

슬라이드 1 강력한성능! 인터넷 / 업무용데스크탑 PC NX-H Series Desktop PC NX1- H700/H800/H900 NX2- H700/H800/H900 NX1-H Series 사양 Series 제품설명 ( 모델명 ) NX1-H Series, 슬림타입 기본형모델중보급형모델고급형모델 NX1-H800:112SN NX1-H800:324SN NX1-H800:534MS

More information

11+12¿ùÈ£-ÃÖÁ¾

11+12¿ùÈ£-ÃÖÁ¾ Korea Institute of Industrial Technology 2007:11+12 2007:11+12 Korea Institute of Industrial Technology Theme Contents 04 Biz & Tech 14 People & Tech 30 Fun & Tech 44 06 2007 : 11+12 07 08 2007 : 11+12

More information

.....6.ok.

.....6.ok. Ⅳ 성은 인간이 태어난 직후부터 시작되어 죽는 순간까지 계속되므로 성과 건강은 불가분의 관계이다. 청소년기에 형성된 성가치관은 평생의 성생활에 영향을 미치며 사회 성문화의 토대가 된다. 그러므로 성과 건강 단원에서는 생명의 소중함과 피임의 중요성을 알아보고, 성매매와 성폭력의 폐해, 인공임신 중절 수술의 부작용 등을 알아봄으로써 학생 스스로 잘못된 성문화를

More information

i-movix 특징 l 안정성 l 뛰어난화질 l 차별화된편의성

i-movix 특징 l 안정성 l 뛰어난화질 l 차별화된편의성 i-movix 소개 2005 년설립 ( 벨기에, 몽스 ), 방송카메라제작 2005년 Sprintcam Live System 개발 2007년 Sprintcam Live V2 2009년 Sprintcam Live V3 HD 2009년 Sprintcam Vvs HD 2011년 Super Slow Motion X10 2013년 Extreme + Super Slow

More information

Microsoft Word - Report_합본__도시광산.doc

Microsoft Word - Report_합본__도시광산.doc EUGENE Small-Cap 212년 스몰캡 Idea (13) 211. 11.1 Urban Mining 광부가 됩시다 자원의 무기화 지난 9월, 우리 정부(지식경제부)는 도시광산 활성화 포럼 을 개최. 도시광산은 폐가 전제품, 산업폐기물에 축적된 금속자원을 회수, 재활용할 광물을 얻는 것 희토류 생산의 96%를 차지하는 중국은 올해 11월부터 희토류 세율을

More information

»¶¥ı_0124

»¶¥ı_0124 For Better Chemically Yours Tel 02) 833-2521 Fax 02) 844-2521 2 395-67 402 To21 Co., Ltd. 402 Lotte Tower, 395-67, Shindaebang-2-dong, Dongjak-ku, Seoul, 156-711, Korea http://www.to21.co.kr Chemical Management

More information

Normal.dot

Normal.dot 1장: 화학제품과 회사에 관한 정보 1.1 제품명 상품명 : 1.2 제품의 권고 용도와 사용상의 제한 물질/혼합물의 용도 피해야 하는 용도 : 특정 용도: 사출 및 압출에 의한 완제품 제조 : 장난감/장난감 부품(사용금지), 의료기기, 음식 또는 음용수와 접촉될 수 있는 장소에서는 사용하지 말것. 1.3 공급자 정보 회사명 : 한국솔베이 (주) 서울 강남구

More information

<312E20C0AFC0CFC4B3B5E55F5352444320C0FCC0DAB1E2C6C720B1B8B8C5BBE7BEE7BCAD2E687770>

<312E20C0AFC0CFC4B3B5E55F5352444320C0FCC0DAB1E2C6C720B1B8B8C5BBE7BEE7BCAD2E687770> 페이지 2 / 6 첨부 1. 공급품 목록 및 납기일정 번호 품명 모델명/사양 Vendor 단위 수량 납기 비고 1 (샘플기판) 6Layer, FR-4, 1.6T, 1온스, 2 (샘플기판) 3 (샘플기판) 4 (샘플기판) 5 (샘플기판) FRONT PANEL BOARD 3종 1. 샘플기판은 Board 별 성능시험용 2. 샘플 기판 후 Board 별 육안점검 및

More information

도 3 은 본 발명에 따른 제거수단을 보인 사시도 도 4 는 본 발명에 따른 제거수단의 해파필터와 카본필터의 구성을 보인 개략단면도 <도면의 주요부분에 대한 부호의 설명> (1) : 케이싱 (1a) : 천연음이온 도료 (2) : 제거수단 (3) : UV살균장치 (4)

도 3 은 본 발명에 따른 제거수단을 보인 사시도 도 4 는 본 발명에 따른 제거수단의 해파필터와 카본필터의 구성을 보인 개략단면도 <도면의 주요부분에 대한 부호의 설명> (1) : 케이싱 (1a) : 천연음이온 도료 (2) : 제거수단 (3) : UV살균장치 (4) (51) Int. Cl. 7 A61L 9/20 (19)대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 (11) 등록번호 (24) 등록일자 2005년05월25일 10-0491080 2005년05월13일 (21) 출원번호 10-2004-0022173 (65) 공개번호 10-2004-0037034 (22) 출원일자 2004년03월31일 (43)

More information

09³»Áö

09³»Áö CONTENTS 06 10 11 14 21 26 32 37 43 47 53 60 임금피크제 소개 1. 임금피크제 개요 2. 임금피크제 유형 3. 임금피크제 도입절차 Ⅰ 1 6 7 3) 임금피크제 도입효과 임금피크제를 도입하면 ① 중고령층의 고용안정성 증대 연공급 임금체계 하에서 연봉과 공헌도의 상관관계 생산성 하락에 맞추어 임금을 조정함으로써 기업은 해고의

More information

..........

.......... 통권 제101호(2007년 10월호) 특허가족 건강길라잡이(비만 시리즈4) 특허가족 건강길라잡이 (비만 시리즈 4) 변리사 김 일 성 킴스국제특허법률사무소 2. 비만과 영양소 4. 무기질(Minerals) 무기질은 단백질, 당질, 지질들과 달리 에너지를 낼 수 없고, 비타민류와 달리 조리과정에서 파괴되지 않는다. 그러나 물에 용해되므로 조리 중의 용액을 버리

More information

ICT EXPERT INTERVIEW ITS/ ICT? 차량과 인프라 간 통신(V2I) Nomadic 단말 통신(V2P) 차량 간 통신(V2V) IVN IVN [ 1] ITS/ ICT TTA Journal Vol.160 l 9

ICT EXPERT INTERVIEW ITS/ ICT? 차량과 인프라 간 통신(V2I) Nomadic 단말 통신(V2P) 차량 간 통신(V2V) IVN IVN [ 1] ITS/ ICT TTA Journal Vol.160 l 9 오늘날 자동차와 도로는 ICT 기술과 융합되어 눈부시게 발전하고 있습니다. 자동차는 ICT 기술과 접목되어 스마트 자동차로 변화하며 안전하고 편리하며 CO 2 방출을 줄이는 방향으로 기술개발을 추진하고 있으며 2020년경에는 자율 주행 서비스가 도입될 것으로 전망하고 있습니다. 또한, 도로도 ICT 기술과 접목되어 스마트 도로로 변화하며 안전하고 편리하며 연료

More information

May leaflet_final.pdf

May leaflet_final.pdf 2012.5.7 ~ 6.2 [19-22week // for 4weeks] Love Gift-Giving, Love Tupperware 5week 19 - week 22 / May 683,000 777,400 614,700 94,400 871_ May Flower Set(16) 210,000 441_ 37,600 326_ 28,800 308_ 46,400 02

More information

Cisco FirePOWER 호환성 가이드

Cisco FirePOWER 호환성 가이드 Cisco 호환성가이드 Cisco 호환성 이문서에서는 Cisco 소프트웨어와하드웨어의호환성및요건을다룹니다. 추가 릴리스또는제품정보는다음을참조하십시오. 설명서로드맵 : http://www.cisco.com/c/en/us/td/docs/security/firesight/ roadmap/firesight-roadmap.html Cisco ASA 호환성가이드 : http://www.cisco.com/c/en/us/td/docs/security/asa/compatibility/

More information

120~151역사지도서3

120~151역사지도서3 III 배운내용 단원내용 배울내용 120 121 1 2 122 3 4 123 5 6 124 7 8 9 125 1 헌병경찰을앞세운무단통치를실시하다 126 1. 2. 127 문화통치를내세워우리민족을분열시키다 1920 년대일제가실시한문화 통치의본질은무엇일까? ( 백개 ) ( 천명 ) 30 20 25 15 20 15 10 10 5 5 0 0 1918 1920 ( 년

More information

2 0 1 2 3 2012 1 2 Part I. 1-1 1-2 1-3 1-4 1-5 1-6 1-7 1-8 Part II. 2-1 2-2 2-3 2-4 2-5 2-6 2-7 2-8 2-9 2-10 2-11 2-12 2-13 2-14 2-15 2-16 2-17 2-18 2-19 2-20 2-21 2-22 2-23 2-24 2-25 2-26 2-27 2-28

More information

<C0FCB9AEB1E2BCFA20BFDCB1B9C0CEB7C220B3EBB5BFBDC3C0E520BAD0BCAE2E687770>

<C0FCB9AEB1E2BCFA20BFDCB1B9C0CEB7C220B3EBB5BFBDC3C0E520BAD0BCAE2E687770> 전문기술외국인력노동시장분석 요약 i ii 전문기술외국인력노동시장분석 요약 iii iv 전문기술외국인력노동시장분석 요약 v vi 전문기술외국인력노동시장분석 요약 vii viii 전문기술외국인력노동시장분석 요약 ix x 전문기술외국인력노동시장분석 요약 xi xii 전문기술외국인력노동시장분석 요약 xiii xiv 전문기술외국인력노동시장분석 제 1 장서론

More information

Microsoft Word - FunctionCall

Microsoft Word - FunctionCall Function all Mechanism /* Simple Program */ #define get_int() IN KEYOARD #define put_int(val) LD A val \ OUT MONITOR int add_two(int a, int b) { int tmp; tmp = a+b; return tmp; } local auto variable stack

More information

최종보고서_경기과학기술진흥원 김진규_ hwp

최종보고서_경기과학기술진흥원 김진규_ hwp 곰취를이용한혈행개선용건강기능식품개발 - 1 - - 2 - - 3 - μ μ μ μ - 4 - SUMMARY μ - 5 - μ μ γ α - 6 - μ μ μ μ μ μ - 7 - CONTENTS - 8 - - 9 - 제 1 장 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - 제 2 장 국내외기술개발현황 - 14 - - 15 - - 16 -

More information

3 Contents 8p 10p 14p 20p 34p 36p 40p 46P 48p 50p 54p 58p 생명다양성재단 영물이라는 타이틀에 정 없어 보이는 고양이, 날카롭게 느껴지시나요? 얼음이 따뜻함에 녹듯이, 사람에게 경계심 많은 길고양이도 곁을 내어주면 얼음 녹듯이 당신을 바라봅니다. 길 위에 사는 생명체라 하여 함부로 대하지 말아주세요. 싫으면 외면해주세요.

More information

1 2 자료조사 및 디자인 개인별 주제에 대한 발표 소재 선정 자료조사 및 디자인 조사한 자료에 대한 발표 작업지시서 작성 3 4 작업지시서 작성 작업지시서에 따른 일정 확인 작업지시서에 따른 공정 방법 확인 갑피 패턴 작성 복사본, 기본본, 작업본 만들기 5 재단 소

1 2 자료조사 및 디자인 개인별 주제에 대한 발표 소재 선정 자료조사 및 디자인 조사한 자료에 대한 발표 작업지시서 작성 3 4 작업지시서 작성 작업지시서에 따른 일정 확인 작업지시서에 따른 공정 방법 확인 갑피 패턴 작성 복사본, 기본본, 작업본 만들기 5 재단 소 2013학년도 2학기 교수코드 : 1997002 E-Mail : ygkim@osan.ac.kr 김영길 제화패션산업과 계열(학과) 전공명 이수구분 학 년 과목코드 과 목 명 수강반 학점 시수 제화패션산업과 공통전공 전필 2 1330040 Capstone Design 1 1 2 학습내용 Capstone Design에 사용되는 소재를 체계적으로 이해하여 발을 편하게

More information

수의대소식지5호(10)

수의대소식지5호(10) College of Veterinary Medicine, Seoul National University Newsletter September 2014 No. 5 Tel. 02-880-1231 http://vet.snu.ac.kr CONTENTS 1 7 17 2 9 3 10 No. 5, 2014. 9 2 College of Veterinary Medicine,

More information

공용심폐소생술00

공용심폐소생술00 iii iv v vi vii ix x xi Part I 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Part II 18 19 제 1부 심정지의 이해와 심폐소생술 지침의 주요내용 20 21 22 23 24 25 26 27 28 29 제 2부 심폐소생술과 관련된 윤리 30 31 32 33 34 35 제 3부 기본 소생술 제1장 제2장

More information

È޴ϵåA4±â¼Û

È޴ϵåA4±â¼Û July 2006 Vol. 01 CONTENTS 02 Special Theme 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. Beautiful Huneed People 03 04 Special Destiny Interesting Story 05 06 Huneed News Huneed

More information

1

1 1 2 3 4 5 6 b b t P A S M T U s 7 m P P 8 t P A S M T U s 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Chapter 1 29 1 2 3 4 18 17 16 15 5 6 7 8 9 14 13 12 11 10 1 2 3 4 5 9 10 11 12 13 14 15

More information

表紙(化学)

表紙(化学) 수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu

More information

outline_표준연3파트.indd

outline_표준연3파트.indd 단위를 알면 세상이 보인다 μg W ng C mol GHz J ns cm MV m/s Gy W MHz mv ms ma Ω A Hz lx m 2 /s Bq rad Mg A/m km/s km C m/s 2 m 3 /s Pa g cd/m 2 m N/m Wb μa T m 3 pm nm mg MW K m 2 rad/s F sr V/m V S cd J/K mm lm H

More information

<C0CCBCF8BFE42DB1B3C1A4BFCFB7E12DB1E8B9CCBCB12DC0DBBCBAC0DAB0CBC1F5BFCFB7E12DB8D3B8AEB8BBB3BBBACEC0DAB0CBC1F52E687770>

<C0CCBCF8BFE42DB1B3C1A4BFCFB7E12DB1E8B9CCBCB12DC0DBBCBAC0DAB0CBC1F5BFCFB7E12DB8D3B8AEB8BBB3BBBACEC0DAB0CBC1F52E687770> 사회복지용 지능로봇 기술동향 머 리 말 목 차 제1장 서 론 1 제2장 기술의 특징 3 제3장 사회복지용 지능 로봇산업의 기술 수요 전망 11 제4장 사회복지용 지능 로봇의 기술 동향 32 제5장 결론 및 정책 제언 103 참고문헌 109 표 목차 그림 목차 제1장 서 론 1. 목적 및 필요성 2. 분석내용 및 범위 제2장 기술의 특징 1. 지능형 로봇기술의

More information

\\g1w1725.austin.hp.com\hse\docs\atn\kor_ghs\korean\013022_Q4209A.pdf

\\g1w1725.austin.hp.com\hse\docs\atn\kor_ghs\korean\013022_Q4209A.pdf 물질안전보건자료 1. 화학제품과 회사에 관한 정보 가. 제품명 HP ElectroInk Coca Cola Red Calibration Cartridge for use with 6000 series Q4209A 나. 제품의 권고용도와 사용상의 제한 제품의 권고 용도 HP Indigo Digital Presses WS6000(와)과 함께 사용하는 HP 제품. 회사

More information

물질안전보건자료(MSDS)

물질안전보건자료(MSDS) BUNA SE 1502 Page 1 of 9 물질안전보건자료(MSDS) 1. 화학제품과 회사에 관한 정보 가. 제품명 : BUNA SE 1502 나. 제품의 권고 용도와 사용상의 제한 : 고무제품 제조용 다. 제조자 : ㅇ LANXESS Deutschland GmbH, Industrial & Environmental Affairs ㅇ 주소 : 51369 Leverkusen,

More information

YXYYRXQGLWMZ.hwp

YXYYRXQGLWMZ.hwp 알켄, C 10-13 (Alkenes,C 10-13 ) CAS NO: 85535-87-1 OECD SIDS 위해성평가 결과 요약서 CAS No. 85535-87-1 화학물질명 알켄, C 10-13 (Alkenes, C 10-13 ) 구조식 Category/Analogue Rationale 이 보고서는 다음의 물질들에 대한 카테고리 접근을 이용한 SIDS-level

More information

* Factory class for query and DML clause creation * tiwe * */ public class JPAQueryFactory implements JPQLQueryFactory private f

* Factory class for query and DML clause creation * tiwe * */ public class JPAQueryFactory implements JPQLQueryFactory private f JPA 에서 QueryDSL 사용하기위해 JPAQuery 인스턴스생성방법 http://ojc.asia, http://ojcedu.com 1. JPAQuery 를직접생성하기 JPAQuery 인스턴스생성하기 QueryDSL의 JPAQuery API를사용하려면 JPAQuery 인스턴스를생성하면된다. // entitymanager는 JPA의 EntityManage

More information

2저널(11월호).ok 2013.11.7 6:36 PM 페이지25 DK 이 높을 뿐 아니라, 아이들이 학업을 포기하고 물을 구하러 가를 획기적으로 절감할 수 있다. 본 사업은 한국남동발전 다닐 정도로 식수난이 심각한 만큼 이를 돕기 위해 나선 것 이 타당성 검토(Fea

2저널(11월호).ok 2013.11.7 6:36 PM 페이지25 DK 이 높을 뿐 아니라, 아이들이 학업을 포기하고 물을 구하러 가를 획기적으로 절감할 수 있다. 본 사업은 한국남동발전 다닐 정도로 식수난이 심각한 만큼 이를 돕기 위해 나선 것 이 타당성 검토(Fea 24 2저널(11월호).ok 2013.11.7 6:36 PM 페이지25 DK 이 높을 뿐 아니라, 아이들이 학업을 포기하고 물을 구하러 가를 획기적으로 절감할 수 있다. 본 사업은 한국남동발전 다닐 정도로 식수난이 심각한 만큼 이를 돕기 위해 나선 것 이 타당성 검토(Feasibility Study) 등을 수행하여 인니전력 이다. 공사(PLN)를 비롯한 인니

More information

Microsoft PowerPoint - ch02-1.ppt

Microsoft PowerPoint - ch02-1.ppt 2. Coodinte Sstems nd Tnsfomtion 20 20 2.2 Ctesin Coodintes (,, ) () (b) Figue 1.1 () Unit vectos,, nd, (b) components of long,, nd. 직각좌표계에서각변수 (,, ) 들의범위 < < < < < < (2.1) 직각좌표계에서임의의벡터 는,, 가그림 1.1 에서와같이,,

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

% Rectangular Value 입력 t = -50 : 1 : 50; % 시간영역 for i = 1 : 101 if abs ( t ( i ) ) < 10 x ( i ) = 1; else x ( i ) = 0; % 화면을 2 열 1 행으로나눈후 % 2 열 1 행에 R

% Rectangular Value 입력 t = -50 : 1 : 50; % 시간영역 for i = 1 : 101 if abs ( t ( i ) ) < 10 x ( i ) = 1; else x ( i ) = 0; % 화면을 2 열 1 행으로나눈후 % 2 열 1 행에 R % sin 그래프계산및출력 t = -50 : 1 : 50; T = 10; f = 1/T; Nsin = sin ( ( 2 * pi * f * t ) ) % 시간영역 % 주기 % 주파수 % sin(2πft) % F(sin) 계산 Fsin = fftshift ( fft ( Nsin ) ); % 화면을 2 열 1 행으로나눈후 % 2 열 1 행에 Sin 그래프출력 subplot

More information

성인지통계

성인지통계 2015 광주 성인지 통계 브리프 - 안전 및 환경 Safety and Environment - 광주여성 사회안전에 대한 불안감 2012년 46.8% 2014년 59.1% 전반적 사회안전도 는 여성과 남성 모두 전국 최하위 사회안전에 대한 인식 - 2014년 광주여성의 사회안전에 대한 인식을 살펴보면, 범죄위험 으로부터 불안하 다고 인식하는 비율이 76.2%로

More information

12È£ÇÕ´ë.PDF

12È£ÇÕ´ë.PDF 01 02 03 04 05 2012 06 07 08 09 10 11 12 Vol.12 PHOTO ESSAY 04 CONTENTS Vol.12 01 02 03 04 05 06 07 08 09 10 11 12 08 20 28 34 38 42 47 PHOTO ESSAY 02 special Prologue 04 special feature 08 issue 10 focus1

More information

<C1A4C3A5BAB8B0EDBCAD2E687770>

<C1A4C3A5BAB8B0EDBCAD2E687770> Korea Environment Institute 공업용수 Chelate Resin Exchanger 생산공장 Micro Filter

More information

\\fscl03\authoring\msdgen_docs\archives\msds_ko\korean\93317102.pdf

\\fscl03\authoring\msdgen_docs\archives\msds_ko\korean\93317102.pdf 물질안전보건자료 1. 화학제품과 회사에 관한 정보 가. 제품명 제품 번호 Gibson Assembly Site-Directed Mutagenesis Kit GA2100 나. 제품의 권고용도와 사용상의 제한 제품의 권고 용도 연구 용도에 한함. 제조자/수입자/유통업자 정보 회사명 Synthetic Genomics, Inc. 주소 11099 North Torrey

More information

CR2006-41.hwp

CR2006-41.hwp 연구책임자 가나다 순 머 리 말 2006년 12월 한국교육학술정보원 원장 - i - - ii - - iii - 평가 영역 1. 교육계획 2. 수업 3. 인적자원 4. 물적자원 5. 경영과 행정 6. 교육성과 평가 부문 부문 배점 비율(%) 점수(점) 영역 배점 1.1 교육목표 3 15 45점 1.2 교육과정 6 30 (9%) 2.1 수업설계 6 30 2.2

More information

ad-200200004.hwp

ad-200200004.hwp 탈성매매를 위한 사회복귀지원 프로그램 연구 여 성 부 목 차 Ⅰ. 서론 Ⅱ. 이론적 배경 및 선행연구결과 정리 Ⅲ. 여성복지상담소 실태조사 결과 Ⅳ. 선도보호시설의 운영 및 프로그램 현황 조사 결과 Ⅴ. 결론 참고문헌 부 록 표 목 차 그 림 목 차 부 표 목 차 Ⅰ. 서 론 . 서론 1. 연구의 목적 및 필요성 탈성매매를 위한 사회복귀지원 프로그램 연구

More information

(00-1) Journal of Life.hwp

(00-1) Journal of Life.hwp Journal of Life Science 2014 Vol. 24. No. 4. 386~392 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2014.24.4.386 산사 는장미과 의열 매로단맛과신맛이나고우리나라및중국 일본에자생하고 있는붉은색의열매로예로부터항비만

More information

Agarose NA, 100 g 성분명 이명 CAS번호 % Agarose Agarose gel beads; Sepharose 9012366 100 공급자의 현재 지식범위 내에서, 또한 적용가능한 농도내에서 건강이나 환경에 대한 유해물로 분류되어 이 항에 보고되어야 하는

Agarose NA, 100 g 성분명 이명 CAS번호 % Agarose Agarose gel beads; Sepharose 9012366 100 공급자의 현재 지식범위 내에서, 또한 적용가능한 농도내에서 건강이나 환경에 대한 유해물로 분류되어 이 항에 보고되어야 하는 GE Healthcare 물질안전보건자료 한국 (작성항목 및 기재사항(제10조제1항 관련)) 1. 화학제품과 회사에 관한 정보 제품명 주문번호 알려진 사용방법 Use in laboratories 권장되지 않는 사용방법 확인된 바 없음. Agarose NA, 100 g 90 제조자 공급자 GE Healthcare UK Ltd Amersham Place Little

More information

Windows Server 2012

Windows Server  2012 Windows Server 2012 Shared Nothing Live Migration Shared Nothing Live Migration 은 SMB Live Migration 방식과다른점은 VM 데이터파일의위치입니다. Shared Nothing Live Migration 방식은 Hyper-V 호스트의로컬디스크에 VM 데이터파일이위치합니다. 반면에, SMB

More information

4-Ç×°ø¿ìÁÖÀ̾߱â¨ç(30-39)

4-Ç×°ø¿ìÁÖÀ̾߱â¨ç(30-39) 항공우주 이야기 항공기에 숨어 있는 과학 및 비밀장치 항공기에는 비행 중에 발생하는 현상을 효율적으로 이용하기 위해 과 학이 스며들어 있다. 특별히 관심을 갖고 관찰하지 않으면 쉽게 발견할 수 없지만, 유심히 살펴보면 객실 창문에 아주 작은 구멍이 있고, 주 날 개를 보면 뒷전(trailing edge) 부분이 꺾어져 있다. 또 비행기 전체 형 상을 보면 수직꼬리날개가

More information

1976. 03_ 김철수 내과, 김란희 산부인과 개원 1980. 06_ 양지병원 (6개과 33실 51병상) 개원 1998. 06_ 신관 별관 증축 종합병원 기틀 마련 2006. 05_ 첨단 의료정보 인프라 구축 전자 차트(OCS/EMR) 의료영상 시스템(PACS) 전자

1976. 03_ 김철수 내과, 김란희 산부인과 개원 1980. 06_ 양지병원 (6개과 33실 51병상) 개원 1998. 06_ 신관 별관 증축 종합병원 기틀 마련 2006. 05_ 첨단 의료정보 인프라 구축 전자 차트(OCS/EMR) 의료영상 시스템(PACS) 전자 1976. 03_ 김철수 내과, 김란희 산부인과 개원 1980. 06_ 양지병원 (6개과 33실 51병상) 개원 1998. 06_ 신관 별관 증축 종합병원 기틀 마련 2006. 05_ 첨단 의료정보 인프라 구축 전자 차트(OCS/EMR) 의료영상 시스템(PACS) 전자결제 등 병원 디지털화 2007. 01_ 종합병원 승격 다수의 상급 종합병원과 협력체결 2007.

More information

에너지절약_수정

에너지절약_수정 Contents 산업훈장 포장 국무총리표창 삼성토탈주식회사 09 SK하이닉스(주) 93 (주)이건창호 15 한국전자통신연구원 100 현대중공업(주) 20 KT 106 두산중공업 주식회사 24 (사)전국주부교실 대구지사부 111 한국전력공사 30 (주)부-스타 36 [단체] (주)터보맥스 115 [단체] 강원도청 119 [단체] 현대오일뱅크(주) 124 [단체]

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

**09콘텐츠산업백서_1 2

**09콘텐츠산업백서_1 2 2009 2 0 0 9 M I N I S T R Y O F C U L T U R E, S P O R T S A N D T O U R I S M 2009 M I N I S T R Y O F C U L T U R E, S P O R T S A N D T O U R I S M 2009 발간사 현재 우리 콘텐츠산업은 첨단 매체의 등장과 신기술의 개발, 미디어 환경의

More information

4-Ç×°ø¿ìÁÖÀ̾߱â¨è(51-74)

4-Ç×°ø¿ìÁÖÀ̾߱â¨è(51-74) 4-항공우주이야기②(51-74) 14.11.6 10:58 AM 페이지51 DK 항공우주 이야기 미국에서 최고로 유명한 항공우주박물관 미국의 항공박물관 및 국립항공우주국(NASA)의 방문자센터(Visitor Center)는 미국 전역에 퍼져있어 어떤 지역을 방문해도 방문지 근처에서 항 공우주관련 박물관을 관람할 수 있다. 미국을 방문할 때 도착한 지역 근처의

More information

STRIP LIGHT LED SOLUTION

STRIP LIGHT LED SOLUTION STRIP LIGHT LED SOLUTION www.b2system.co.kr STRIP LIGHT LED SOLUTION INDOOR INDOOR MODULE White 7-type RGB 2-type AL. PROFILE CLEARMILKY DIFFUSER BRACKET Fixed type BRACKET tilted type OUTDOOR IP67 IP66

More information

(연합뉴스) 마이더스

(연합뉴스) 마이더스 106 Midas 2011 06 브라질은 2014년 월드컵과 2016년 올림픽 개최, 고속철도 건설, 2007년 발견된 대형 심해유전 개발에 대비한 사회간접자본 확충 움직임이 활발하다. 리오데자네이로에 건설 중인 월드컵 경기장. EPA_ 연합뉴스 수요 파급효과가 큰 SOC 시설 확충 움직임이 활발해 우 입 쿼터 할당 등의 수입 규제 강화에도 적극적이다. 리

More information

A20045008.hwp

A20045008.hwp 指 導 敎 授 金 奎 虎 이 論 文 을 理 學 碩 士 學 位 請 求 論 文 으로 提 出 함 List of Figures List of Tables - i - - ii - List of Figures - iii - - iv - List of Tables - v - 국문 초록 충남지역 출토 백제시대 유리구슬의 고고화학적 분석 고찰 송 유 나 공주대학교 대학원

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

01업체광고1407

01업체광고1407 072~87기획-수은4 2014.7.3 7:23 PM 기획특집 페이지74 MAC01 [수출입은행 보고서] 국내 물산업 해외진출 전략 [그림 4] 사우디아라비아 운영시장 현황 및 전망 [그림 5] 사우디아라비아 담수화 시장 현황 및 전망 포함한 상수원 개발 부분이 10억 달러로 장 대비 성장률은 떨어질 전망이다. 운 장 중 하나이다. 극심한 물 부족 문제를 상수

More information

<C3D6C1BEBAB8B0EDBCAD2E687770>

<C3D6C1BEBAB8B0EDBCAD2E687770> Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)

More information