김영철.hwp

Size: px
Start display at page:

Download "김영철.hwp"

Transcription

1 폐암억제유전자 RRM1 의단일염기다형성검사를위한 PCR-RFLP 법과 Real-Time PCR 법의유용성비교 1 전남대학교의과대학의과학연구소, 2 내과학교실정주연 1, 김미란 1, 손준광 2, 정종필 2, 오인재 2, 김규식 2, 김영철 2 Comparison of PCR-RFLP and Real-Time PCR for Allelotyping of Single Nucleotide Polymorphisms of RRM1, a Lung Cancer Suppressor Gene Ju-Yeon Jeong, M.S. 1, Mi-Ran Kim, M.S. 1, Jun-Gwang Son, M.D. 2, Jong-Pil Jung, M.D. 2, In-Jae Oh, M.D. 2, Kyu-Sik Kim, M.D. 2, Young-Chul Kim, M.D. 2 1 Medical Science Laboratory, 2 Department of Internal Medicine, Chonnam National University Medical School, Hwasun, Korea Background: Single nucleotide polymorphisms (SNPs), which consist of a substitution of a single nucleotide pair, are the most abundant form of genetic variations occurring with a frequency of approximately 1 per 1000 base pairs. SNPs by themselves do not cause disease but can predispose humans to disease, modify the extent or severity of the disease or influence the drug response and treatment efficacy. Single nucleotide polymorphisms (SNPs), particularly those within the regulatory regions of the genes often influence the expression levels and can modify the disease. Studies examining the associations between SNP and the disease outcome have provided valuable insight into the disease etiology and potential therapeutic intervention. Traditionally, the genotyping of SNPs has been carried out using polymerase chain reaction-restriction fragment length polymorphism(pcr-rflp), which is a low throughput technique not amenable for use in large-scale SNP studies. Recently, TaqMan real-time PCR chemistry was adapted for use in allelic discrimination assays. This study validated the accuracy and utility of real-time PCR technology for SNPs genotyping Methods: The SNPs in promoter sequence (-37 and -524) of lung cancer suppressor gene, RRM1 (ribonucleotide reductase M1 subunit) with the genomic DNA samples of 89 subjects were genotyped using both real-time PCR and PCR-RFLP. Results: The discordance rates were 2.2% (2 mismatches) in -37 and 16.3% (15 mismatches) in Auto-direct sequencing of all the mismatched samples(17 cases) were in accord with the genotypes read by real-time PCR. In addition, 138 genomic DNAs were genotyped using real-time PCR in a duplicate manner (two separated assays). Ninety-eight percent of the samples showed concordance between the two assays. Conclusion: Real-time PCR allelic discrimination assays are amenable to high-throughput genotyping and overcome many of the problematic features associated with PCR-RFLP. (Tuberc Respir Dis 2007; 62: ) Key word : SNP, PCR-RFLP, Real-time PCR, RRM1. 서 단일염기다형성 (single nucleotide polymorphism, SNP) 은염색체가갖고있는염기서열중개인편차를나타내는염기변이를말한다 1. SNP는일반적으로한 론 Address for correspondence: Young-Chul Kim, M.D. Lung and Esophageal Cancer Clinic, Chonnam National University Medical School and Hwasun Hospital, 160 Ilsim-ri, Hwasun-gun, Jeonnam, , Korea. Phone: , FAX: kyc0923@jnu.ac.kr Received: Feb Accepted: May 염기쌍 (single base-pair variation) 의차이로관찰되고, DNA에존재하는다형성중에서가장흔하게존재한다. 사람의유전자는대략 1,000개의염기마다 1 개의염기다형성이나타나는데질병에대한감수성과치료제에대한효과가달라지는등의개인편차가있는것은 SNP의차이때문이라고추정된다 2-4. SNP는암 5, 심장병 6, 고혈압 7 등과같은다양한질병과도관련되며, 이는아미노산을생성하는 3개의염기중의하나가달라져결국기능이다른단백질이생성됨으로써치명적인질병으로까지연결되는것이다. 이러한이유때문에최근질병과관련된 SNP 연구도활발하게진행되고있다

2 Tuberculosis and Respiratory Diseases Vol. 62. No.5, May SNP 연구는큰집단을대상으로수행되므로적은비용으로정확하게, 그리고대용량 (hight throughput) 으로할수있는시스템이요구된다. SNP를검색하기위한일반적인방법으로서기존에는제한효소절단양상으로 SNP 형태를추정하는 polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) 9-11 방법이많이시행되어왔으나이는시간적소비와비특이적 PCR산물의오염가능성이있는단점이있다. 이에반해 real-time PCR(RT- PCR, TaqMan probe assay) 방법은유전자증폭을시행한후모니터에보여지는형광물질곡선을통해바로유전자다형성조합을예측할수있고 1회유전자증폭반응으로 72-96개샘플의결과를한번에확인할수있어보다빠르고정확하게 SNP를검색할수있는방법이라할수있겠다. 그러나이는고가의장비와특수하게고안한 oligonucleotide를사용해야한다는부담감으로아직까지는고전적인방법인 PCR- RFLP법이보통사용되고있다. 따라서저자들은본연구를통해폐암환자 227명의말초혈액백혈구로부터얻은 genomic DNA를대상으로하여, promotor부위에다형성이존재하는것으로알려져있는 RRM1(ribonucleotide reductase M1) 15 유전자의 -37, -524부위의 SNP 양상을 PCR- RFLP법과 RT-PCR법을동시에시행, 결과를비교분석해봄으로써유전자다형성을보다쉽고정확하게검사할수있는방법으로서 RT-PCR 방법의효용성을검증하여보고자하였다연구재료및방법 1. 연구재료전남대학교병원호흡기내과에내원한폐암환자들로부터동의하에채취된 227명의말초혈액을이용하여연구를수행하였다. 2. 연구방법 1) 말초혈액에서 Genomic DNA 추출 말초혈액 4 ml를 7.5% EDTA가포함된 vacutainer(becton Dickinson, Plymouth, UK) 에채취하여 15 ml polypropylen tube에옮겨담고 RBC lysis buffer(150 mm NH 4 Cl, 20 mm Tris ph 8.0) 를넣은후 37 진탕수조에서 20분간반응시켰다. 이후상온 3,500 rpm에서 20분간원심분리하여침전물만취하는과정을 2회반복하였다. 이렇게얻은침전물에 TEN buffer(10mm Tris, 10mM EDTA, 150mM NaCl) 1 ml를가하여잘혼합한다음, 3500 rpm에서 10분간원심분리하고, 침전물만다시얻어 TEN buffer 375 μl, 10% SDS 25μl, proteinase-k 10 mg/ml 10 μl를넣고 37 진탕수조에서 16시간이상반응시켰다. Eppendorf tube에반응물을옮기고 5M NaCl 160 μl를첨가하여잘혼합한다음 13,000 rpm 으로 15 분간원심분리시켰다. 다음으로상층액만을취하여다른 eppendorf tube에옮겨담고 2배부피의 100% alcohol을넣어잘흔든후, DNA 침전물을얻었다. 얻어진침전물을다른 eppendorf tube에옮겨담고, 70% ethanol 400 μl를가한후가볍게흔들어준다음 13,000 rpm에서 5분간원심분리하여상층액을버리고 37 heat block에서 5분간건조시킨후 TE buffer(10mm Tris, 1mM EDTA) 300 μl를첨가하여 37 에서 16시간이상용해시켰다. NanoDrop 으로 DNA 농도를측정하고 PCR 용으로 5 ng/ μl농도를만들어냉동보관한후중합효소연쇄반응 (polymerase chain reaction, PCR) 을시행하였다. 2) PCR - RFLP (1) 중합효소연쇄반응에의한유전자좌증폭 (PCR) Promoter 부위에다형성염기가존재한다고보고되어져있는 RRM1 유전자의염기서열을 GeneBank ( 로부터얻은후, 다형성을보이는염기서열위치 -37(Genebank accession number AF107045의 1038 위치 ) 부위를포함하는 primer와 -524(Genebank accession number AF 의 551 위치 ) 부위를포함하는 primer를 primer ㅡ3 프로그램으로각각디자인하여주문제작하고중합효소연쇄반응 (PCR) 에이용하였다. Primer의염기서열은 Table 1과같다. 유전자증폭은 Perkin Elmer

3 JY Jeong et al: PCR-RFLP and real time PCR for SNP analysis Table 1. Primer sequences for PCR-RFLP of -37 and -524 SNP* of RRM1 gene SNP Primer Sequence - 37 F : 5 ㅡ GGTCT TGCCC AGACT CAACA ㅡ 3 R : 5 ㅡ CTGCT CAGGG GAAAG AACTG ㅡ F : 5 ㅡ ATACC CTGTC TCTGC CACCA ㅡ 3 R : 5 ㅡ CTTTT AGATC GGCCA GAGGA ㅡ 3 F: Forward; R: Reverse. *SNP: single nucleotide polymorphism, RRM1: ribonucleotide reductase M1. thermal cycler(norwalk, CT) 를이용해시행하였으며, 반응성분은 1U의 Taq DNA polymerase(super BIO Co. Ltd) 와함께 40 ng의 genomic DNA, 800 um 의 dntp, 200 nm 각각의 primer, 1.5 mm MgCl 2, 50 mm KCl으로하여총반응액을 20 μl로하였다. 두쌍의 primer 모두각각 94 에서 5분간 denature 시킨후 94 에서 30초, 55 에서 30초, 72 에서 1분간반응하는온도순환을 35회반복하고마지막으로 72 에서 10분간유지후 4 로냉각시켰다. PCR 과정이 끝난후, 증폭산물은 2% agarose gel 내에서전기영동을시행하여증폭여부를확인하였다. (2) 제한효소처리 (Enzyme digestion) 중합효소연쇄반응에의해증폭되는염기구조를 의제한효소 search program에입력한후 -37과 -524부위를한번씩만절단하는제한효소를찾았다. RRM1-37번째염기는 C/A 다형성을보이는위치로써이는제한효소 Bbs I 으로구분될수있는데이효소는 GAAGACNN(NNNN) 염기배열을읽어서절단한다. 또한 -524의경우는 T/C 다형성을보이는위치로써이는제한효소 Apo I 으로구분될수있는데, 이효소는 (A or G) + AATTY + (C or T) 염기배열을읽어서절단한다. RRM1-37유전자는 10 μl의 PCR 증폭산물에 10U Bbs I 제한효소를첨가하여 3 7 에서 16시간이상반응시켰으며, -524유전자는 10U Apo I 제한효소를 10 μl의 PCR 증폭산물에첨가하여 50 에서 2시간이상반응시켰다. 제한효소반응후 2% agarose gel 내에서전기영동을시행하여제한효소에의해분절된 DNA의크기를확인함으로써다 Figure 1. Allelotyping of RRM1 by restriction enzyme digestion. (A) RRM1-37 C/A polymorphism. Restriction enzyme Bbs I cuts when -37 base is A. Homozygous A allelle type (lane 3 from left shows complete digestion into 156 bp bands. Homozygous C allele type (lane 4 and 7) have original 217 bp bands only without digestion. The primer dimers are seen in all the lanes that are barely distinguishable from 61 bp bands in lanes with CA or AA. (B) RRM1-524 T/C polymorphism. Restriction enzyme Apo I cuts when -524 base is T. Homozygous T allelotype (lane 2, 5 and 6 from left) shows complete digestion into 70 bp bands. Homozygous C allele type (lane 3 and 4) have original 176 bp bands only without digestion. 408

4 Tuberculosis and Respiratory Diseases Vol. 62. No.5, May Table 2. Primer and probe sequences for real-time PCR of -37 and -524 SNP of RRM1 gene SNP Substitution Oligo Sequence5'->3' (fluorophore/quencher) -37 C A Probe- C (6-FAM)-TGTGAAGCCTACCCCG-(3BHQ)* Probe- A Primer- F Primer- R (HEX)-TCTGTGAAGACTACCCC -(3BHQ) CTTGCCCAGACTCAACAT CCAGACAGCACTTTCTTCAG -524 T C Probe- T (6-FAM)-AGAGAATTTTAAGCAGG-(3BHQ) *BHQ: black hole quencher. Probe- C Primer- F Primer- R (HEX)-AGAGGATTTTAAGCAGG-(3BHQ) TCCATCCTACCTCCACAAGG CGATGGCGTTTGGATTTTAT 형성의종류에의한유전자형을결정하였다 (Figure 1). 3) 실시간유전자증폭 (Real-time PCR) Gene bank( 로부터얻은 -37, -524의염기서열을 proligo(paris, France) 에의뢰해, 유전자증폭 (RT-PCR) 에필요한 primer 와각각의 allele를인식할수있는 primer사이의 SNP를포함한 TaqMan probes를디자인, 제작하고 RT-PCR에의해각각의 polymorphism을확인하였다. RT-PCR에이용한 primer와 probe는 Table 2와같다. 유전자증폭반응액의조성은 genomic DNA 10 ng에 0.5U Taq polymerase 와 10x buffer 1 μl, dntp 200 um, 5pM Primer 각각 0.5 μl씩, 2pM probe 0.1 μl씩첨가, 총반응액을 10 μl로하였다. 95 에서 5분간 denature시킨후 95 에서 10초, 64 에서 30초간반응하는온도순환조건을 40회반복하였고, Roter-Gene 3000TM multiplex system(corbett Research) 를이용해수행하였으며, 결과분석은이에상응하는분석프로그램 (Roter-Gene software 6.0) 으로자동분석하였다 (Figure 2). 4) 염기서열분석 (Auto-direct sequencing) 증폭된 PCR 증폭산물을 Gene All PCR Purification kit(general Biosystem, Seoul, Korea) 를사용하여정제한다음염기서열분석에이용하였다. Forword primer 1.6 pmol/ μl 1μl, Big Dye Terminator (ABI-version 3.1) 1 μl, 정제된 PCR 증폭산물 1 μl, 5x sequencing buffer 2 μl, 멸균수 5 μl로총반응액 10 μl가되도록한후 95 10초, 50 5초, 60 4분으로구성된순환조건을 25회반응시킨후에탄올침전과정을통하여반응물만을정제하였다. 정제된반응물을건조시키고 formamide에녹인후 ABI Prism 3100 Genetic Analyzer(PE Biosystems, Foster City, CA, USA) 로염기서열을분석하였다 (Figure 3). 5) 통계 RRM1유전자의다형성은각각의위치에서 allele들의빈도가 Hardy-Weinberg equilibrium 16 을따르는지 chi-square 검증으로확인하였다. 결과 1. PCR-RFLP 89예의 genomic DNA를이용 RRM1-37과 -524유전자를각각 PCR 증폭하였다. -37의증폭산물크기는 217 bp, -524의크기는 176 bp이었다. RRM1-37번째염기는 C/A 다형성을보이는위치이다. 전기영동에의해원하는크기로증폭되었는지확인한후, 남은 PCR 증폭산물에 10 U Bbs I을처리하고반응시킨결과, -37위치에 C를가지고있는검체는절단되지않고 217 bp가그대로관찰되었으며, A를가지고있는검체는 bp로절단된형태 409

5 JY Jeong et al: PCR-RFLP and real time PCR for SNP analysis A. Allelic 2 Homozygous Heterozygous Allelic 1 Homozygous B. Figure 2. Allelotyping of RRM1 by real-time PCR (TaqMan probe assay) Allelic discrimination of genotyping by auto analysis software 6.0 program of Roter-Gene after RRM1 amplication. (A) genotype analysis result (B) scatter graph analysis result. 의증폭산물이 2% agarose gel상에서확인되었다 (Figure 1A). 또한 -524의경우는 T/C 다형성을보이는위치로써 PCR 증폭산물에 10U Apo I을처리한후반응시킨결과 T 를가지고있는검체는 176 bp가효소에의해절단되어 70 bp bp 크기단편이관찰되었고 C를가지고있는검체는절단되지않은 176 bp band가 2% agarose gel상에서확인되었다 (Figure 1B). 대상환자 89명에대하여 RRM1 의유전자다형성을 PCR- RFLP 방법으로검색하여본결과 -37번째염기는 CC ( 42 ), CA ( 39 ), AA ( 8 ) 이었고, -524 번째염기는 TT ( 45 ), TC ( 28 ), CC ( 16 ) 이었다. 410

6 Tuberculosis and Respiratory Diseases Vol. 62. No.5, May Real-time PCR SNP를확인하는데있어 PCR-RFLP 방법으로확인한결과와 RT-PCR 방법을통해확인한결과가어느정도일치도를보이는지비교분석해보기위해앞서 PCR-RFLP을시행했던동일 DNA샘플 89예를대상으로 RT-PCR을시행하였다. 이는유전자증폭이끝남과동시에별도의처리과정없이모니터상에서바로결과를확인할수있었다. 샘플이가지고있는 Table 3. Comparison of allele frequency at -37 and -524 region of RRM1 gene between PCR-RFLP and RT-PCR. The results from RT-PCR were validated using Hardy-Weinberg equilibrium SNP CC CA AA PCR-RFLP (n=89) Real-time PCR (n=89) Expected frequency Error rate* = 2 / 89 ( 2.24%) X 2 =0.03, p > TT TC CC Error rate = 15 / 89 ( 16.85%) X 2 =0.09, p > 0.05 *Errors / Total genotypes, Mismatched results of two samples were changed to CC CA, CA CC. SNP조합형이 homo wild type이라면 FAM 형광곡선만관찰되어지고 homo mutant type이라면 HEX 형광곡선만, hetero type경우에는 FAM, HEX 형광곡선이모두관찰되었다. 각각의샘플에대한형광물질이나타내는곡선의양상을통해자동분석프로그램의 genotype analysis 또는 scatter graph analysis로 SNP 조합형을확인하고 PCR-RFLP 결과와비교분석하였다 (Table 3)(Figure 2). 89예를대상으로 RT-PCR을통해유전자다형성을조사하여본결과 -37염기위치에서는 CC ( 42 ), CA ( 39 ), AA ( 8 ) 이었고, -524는 TT ( 42 ), TC ( 37 ), CC ( 10 ) 이었다. 3. PCR-RFLP: RT-PCR 의결과비교단일염기다형성을확인하는데있어 PCR-RFLP법을통해확인한결과와 RT-PCR법을통해확인한결과가동일한결과를보이는지살펴보기위해동일대상 89예를대상으로 PCR-RFLP와 RT-PCR을각각시행한후확인된결과를비교해보았다. 대상 DNA 89예중 RRM1-37에서는 2예 (2.17%), -524에서는 15 예 (16.26%) 가다른양상을보였다 (Table 3). -37에서보였던불일치양상은 CA가 CC로, CC가 CA로관찰되었고, -524에서는 CC CA가 8예, CA AA 5예, Figure 3. Allelotyping of RRM1 gene by auto-direct sequencing. 411

7 JY Jeong et al: PCR-RFLP and real time PCR for SNP analysis CC AA, AA CC가각각 1예씩확인되었다. 4. 염기서열분석결과 PCR-RFLP법에의한결과와 RT-PCR법에의한결과가일치하지않은 17예를대상으로정확한유전자형확인을위해자동염기서열분석을시행하였다 (Figure 3). 결과 -37에서불일치했었던 2예와 -524에서의 15예모두 RT-PCR법에서확인되었던 allele type과일치하였다. PCR-RFLP법에서보인불일치결과들은많은경우가제한효소의불완전한절단에의해서생긴결과였고일부샘플들은 templete의부분적인오염이있었던것으로사료되어진다. 이로써 SNP양상을확인하는방법으로써, PCR-RFLP 결과보다는 RT-PCR 결과가보다신뢰성있음을확인할수있었다. 예에서만다른양상을보여 98% 이상의높은일치율이관찰되었다 (Table 4). -37에서보였던불일치결과는 CC CA, CA CC 로관찰되었으며, -524에서는 TC TT 1예와 TT TC 2예가관찰되었다. 정확도를한번더검증하기위해불일치결과를보였던샘플 5예와일치결과를보였던 10예를무작위로선정하여직접염기서열을실시하여보았다. 결과불일치샘플들의경우는두번째시행한결과와모두일치하였고일치샘플들은모두이전검사와동일한결과를확인할수있었다 (10/10=100%). RT-PCR에서보인오차율의원인은유전자증폭과정에서의차이는없었으나영상분석과정에서생긴오류였음을확인할수있었다. 따라서증폭곡선을이용한판독이명확하지않는경우는추가적인검증이필요하다하겠다. 6. 통계 5. 반복된 RT-PCR 의일치율 앞선실험에서 RT-PCR법이거의 100% 에가까운정확도를보였던결과를기반으로해서추가샘플 138 예는 RT-PCR에의해 allele type을확인하였다. 1차, 대상 DNA 138예에대한결과를확인하고동일샘플을대상으로 RT-PCR법을재반복시행하여결과를비교하여본결과, 138예중 -37은 2예에서, -524는 3 Table 4. Comparison of allele frequency at -37 and -524 region of RRM1 gene in duplicated RT-PCR experiments. The results from RT-PCR were validated using hardy-weinberg equilibrium. SNP RT-PCR-1st (n=138) RT-PCR-2nd (n=138) Expected frequency - 37 CC CA AA Error rate* = 2 / 138 ( 1.4%) X 2 =0.17, p > TT TC CC Error rate = 3 / 138 ( 2.1%) X 2 =0.09, p > 0.05 *Errors / Total genotypes, Mismatched results of two samples were CC CA and CA CC, Mismatched results of three samples were TC TT, TT TC and TT TC. PCR-RFLP와 RT-PCR 에의해확인되었던결과를 Hardy-Weinberg 법칙에적용시켜보니 -37, -524 모두 p>0.05이상의값을보여예상되는 allele의빈도와검사결과가일치함을알수있었다 (Table 3, 4). 고찰 Single nucleotide polymorphism(snp) 이란우리말로단일염기변이또는단일염기다형성이라고표현할수있는데 1, 최근이를이용한질병유전체접근방법이큰관심의대상이되고있다. 이는 mutation과는다른의미를가지는것으로 1000 염기마다한번꼴로일어나는가장일반적인형태의염기서열변이의유형을말한다. SNP의유전학적정의로는집단내에서가장적은빈도를보이는 single base allele의빈도가최소 1% 이상관찰되는염기다형성 (polymorphism) 이라고할수있다. 인간의유전체에는수백만개의 SNP가존재한다. 즉, 각개인이갖고있는유전자전체는약 30억개의염기로구성되어있는데이중에서매 1000개염기마다하나의단일염기다형성을보이고있다. 같은질병이라고해도질병방생의감수성이나치료에대한효과등개인편차가있는것은모두이러 412

8 Tuberculosis and Respiratory Diseases Vol. 62. No.5, May 한 SNP 차이때문이다 2-4, SNP는 2, 3, 4개의대립인자를가질수있다. 하지만사람의경우거의모든 SNP는 {C,T} 혹은 {C,G} 와같은 bi-allelic polymorphism만을보이고있어서 bi-allelic polymorphism 의하나로간주되고있다. 3개의염기는한개의아미노산을만들고몇개의아미노산이결합해단백질을만들게되는데, 염기에변이가생기게되면, 변이된염기가변형된아미노산을만들게되므로단백질기능의변화가생기며, 질병에쉽게노출될수가있다. 이와같이 SNP가특정질병에대한개인적특이성이나, 약물에대한의학적반응도에있어서개인적차이를나타내는것과관련하여, 유전적변이를찾아내는중요한자료가될수있다. SNP로인하여, 가까운장래에암 5 이나, 심혈관질환 6, 자가면역증 20, 천식 21, 고혈압 7 등과같은복합적인질병에대한유전적인기전을확인할수있게될가능성도크다. 또한, 최근에는약물투여에대한부작용이나효과가유전자의조절과밀접한관계가있다는것이알려지면서, DNA 염기서열정보를이용하여특정의약품이환자에게효과가있는지, 아니면부작용으로고통을받을지, 심지어는적정한투여량을결정할수있는지에대하여알수있을것이라는가능성또한많은연구자들에게새로운관심을불러일으키고있다 이러한것이가능하기위해서는 SNP 분석을적은비용으로정확하게그리고대용량으로분석할수있는방법이필요하다. 주요 SNP 연구를위한방법으로기존에는 PCR-RFLP 9-11 법을많이시행해왔었다. 그러나최근에는대량의검체를신속하게검사하기위해 OLA genotyping 22 방법, Mass spectrometry 23 를이용하는방법, DNA microarray genotyping 24, DASH 방법 25, pyrosequencing 26 방법, RT-PCR 방법등여러가지새로운기술들이많이개발되어시행되어지고있다. 이들중, 본연구에서는기존부터여러실험실에서많이수행해왔던 PCR-RFLP(polymerase chain reaction-restriction fragment length polymorphism) 법과최근에사용증가추세를보이고있는 RT-PCR(TaqMan probe assay) 법을비교하였다. 동일샘플을대상으로두방법을각각시행한후확인되 어진결과를비교해봄으로써정확성과유용성을살펴보았다. 염기서열분석은직접해독하는 direct sequencing 방법이가장정확하지만이는다소복잡하고시간이많이걸리는방법이기에최종확인을위한방법으로만사용을하였다. PCR-RFLP방법은개체마다차이를보일수있는 polymorphic한 restriction site를특정제한효소로절단한후전기영동상에서관찰되어지는절편의양상으로 allele type을확인하는방법이다. 반면 RT-PCR 법은 5' nuclease assays 원리를이용하여형광물질이나타내는곡선을통해별도의전기영동과정을거치지않고한번에정확한 genotyping을하는방법이다. RT-PCR은 mrna을볼수있을뿐만아니라 DNA를증폭하면서실시간으로 SNP 양상을확인할수있는방법도제공한다. SNP에따라각기다른색을발광하도록제작된 TaqMan probe는 SNP를포함한 target 의고유염기서열이므로 allele type에따라 specific하게결합한다. 각각의샘플이가지고있는 SNP 조합양상에따라특정 probe만이 PCR에반응을하고, 이후형성된고유의형광값을정량하여 allele type을구별하게된다. 하나의 SNP를 genotyping하기위해서는각기다른 fluorescent dye을가지고있는두종류의 probe가필요하다. 각 probe의 5 끝에는 reporter fluorescent dye가있고다른한끝에는 quencher dye가있어 PCR 반응이없으면 quencher dye에의해형광이억제되고 PCR이진행될때에만 reporter fluorescent dye가 probe로부터분리되면서, quencher dye로부터멀어지게됨으로써고유의형광값을내게되어, 이를정량하여 allele type을구별하게된다. 환자말초혈액으로부터얻은 genomic DNA 89예를대상으로폐암억제유전자인 RRM1(ribonucleotide reductase M1) 의 -37, -524부위에존재하는 SNP 양상을 PCR-RFLP와 RT-PCR을동시에시행하여결과를비교분석하여본결과 19.1% 다른결과값을얻었고이를대상으로직접염기서열분석을통해확인한결과서로상이한결과를보였던검체들은모두 RT-PCR법에의해확인되었던유전자형인것을확인할수있었다. PCR-RFLP법의오차율이다소높게 413

9 JY Jeong et al: PCR-RFLP and real time PCR for SNP analysis 관찰되어진이유는아마도제한효소처리단계에서 enzyme 의첨가량부족, 또는반응시간이충분치않았거나온도조건의부적합, 보관과정에서의 enzyme 의 activity감소등의원인으로 PCR 증폭산물이불완전하게절단되어 allele type이잘못판단되어진것으로사료되어진다. 또한제한효소절단에의해생성된 100 bp이하크기의작은단편들은 primer dimer 와비슷한위치에존재하고있어서명확하게구별하기가어려웠다. 본연구에서는 RT-PCR법이비교적정확성을보인결과를근거로해서추가대상 138예를 RT-PCR법을통해 2회반복시행한후결과를비교해본결과역시 98% 이상의높은정확도를확인할수있었다. 이와같은결과를고려해볼때, SNP( 단일염기다형성 ) 를확인하는데있어 RT-PCR법은 98% 이상의높은정확도를확인할수있었으며, in-tube assay 방식으로샘플의오염을최소화할수있었고 72well based system(corbett Research) 을이용함으로다량의 SNP 분석을정확하고빠르게진행할수있었다. 게다가결과가연구자가보기쉬운그래프형식으로출력되므로쉽게분석이가능한장점도있었다. RT-PCR법은빠르고간편하고정확하게판독이가능한장점이있지만, 제작된 probe를이용하여실험조건을맞추는초기에세밀한조절이필요하다. Primer의 annealing temperature 만잘잡아주면되는 PCR과달리 RT-PCR은 primer와 probe 모두가만족할수있는온도조건을잡아주어야하는점과두형광의신호가중복되지않게농도를잘조절해서 PCR 조건을결정해야하는까다로움도있다. 만약제작된 probe로적절한조건이잘잡히지않아다시 probe 제작을요하는상황이된다면 probe 제작비용의중복투자를감수해야한다는부담도있다. 여러 SNP를동시에검사하는복합검사는많게는 6 개의 SNP까지한번반응으로확인할수있다고한다. 그러나현실적으로는모두만족할만한 annealing temperature 를설정하는것이쉽지않으므로보통 2 개정도의 SNP까지는동시에검색할수있다고판단된다. 비용효과면에서두가지방법을비교할필요도있 겠는데, RT-PCR과 PCR-RFLP를업체에의뢰하지않고, 본교실의실험실에서시행한것이므로정확한비용의비교는어려웠다. 또한단순한시약및 probe 제작비뿐만아니라실험자의노동력, 투자해야하는시간을모두감안하여야하므로비용효과를비교하기는어려웠다. 그러나검체의수가많아질수록 RT-PCR이더유리할것임은알수있었다. RT-PCR은 probe를필요한양만큼제작하여실험조건을잡은후에는추가적으로필요한시약이나투자해야하는시간과노동력이적은반면에 PCR-RFLP는초기투자비용은낮지만검체의수가많아질수록막대한시간과노동력그리고제한효소등의비용이지속적으로발생되기때문이다. 따라서연구용으로소수의검체만을검사하는경우에는 PCR-RFLP가비용효과면에서유리하지만많은임상검체들의검사에사용되게된다면 RT-PCR이비용효과면에서유리하다고판단된다. 요약연구배경 : 단일염기다형성 (Single nucleotide polymorphism, SNP) 은인간의유전자서열 1000염기에 1 개빈도로발견되어인간은대략 300만개의유전자다형성을가지고있다. 이유전자다형성의조합결과로인간의개체간특성들이결정되는것으로이해되고있다. 이러한다형성들의조합양상에따라특이질환에대한유전자감수성또한달라지게되므로최근에는많은질환들과유전자다형성들과의상관관계를보는연구들도활발하게진행되고있다. 이러한 SNP 분석은큰집단을대상으로진행되어지므로적은비용으로정확하게그리고대용량으로분석할수있는방법이필요하다. 방법 : 대상환자 89명의 genomic DNA를가지고서 promotor상에위치한 -37과 -524 염기부위에서유전자다형성을보이는것으로보고되어져있는 RRM1 (ribonucleotide reductase M1) 유전자를대상으로 PCR-RFLP(polymerase chain reaction-restriction fragment length polymorphism) 와 real-time PCR(RT- PCR, TaqMan probe assay) 을동시에시행한후각 414

10 Tuberculosis and Respiratory Diseases Vol. 62. No.5, May 각의결과를비교분석하였다. 결과 : 대상 DNA 89예중 -37에서는 2예 (2.17%), -524에서는 15예 (16.26%) 가서로다른양상을보였다. 결과차이를보인샘플 17예를대상으로직접염기서열분석을시행하여본결과, 17예모두 RT-PCR 에서확인되었던결과와일치함을확인할수있었다. 추가샘플 138예를대상으로 RT-PCR을 2회연속실행하여 genotyping을해본결과 98% 이상의높은일치율을보였으며, 그중 10예를무작위로골라직접염기서열분석을시행하여본결과, 역시 100% 일치, 높은정확도를보였고이는 in-tube assay 방식으로샘플의오염을최소화할수있었으며 72 well based system(corbett Research) 을이용함으로 1회유전자증폭반응을통해많은검체를한번에확인할수있어매우빠른검사방법이었다. 결론 : 큰집단을대상으로다량의 SNP를분석하기위한실험방법으로는 RT-PCR이신속하면서도정확한결과를얻을수있는방법으로사료된다. 참고문헌 1. Shastry BS. SNP alleles in human disease and evolution. J Hum Genet 2002;47: Syvanen AC. Accessing genetic variation: genotyping single nucleotide polymorphisms. Nat Rev Genet 2001;12: Brookes AJ. The essence of SNPs. Gene 1999; 234: Collins FS, Brooks LD, Chakravarti A. A DNA polymorphism discovery resource for research on human genetic variation. Genome Res 1998;8: Knudson AG. Hereditary predisposition to cancer. Ann N Y Acad Sci 1997;833: Ohnishi Y, Tanaka T, Yamada R, Suematsu K, Minami M, Fujii K, et al. Identification of 187 single nucleotide polymorphisms(snps)among 41 candidate genes for ischemic heart disease in the Japanese population. Hum Genet 2000;106: Kamide K, Kokubo Y, Yang J, Matayoshi T, Inamoto N, Takiuchi S, et al. Association of genetic polymorphisms of ACADSB and COMT with human hypertension. J Hypertens 2006;25: Risch N, Merikangas K. The future of genetic studies of complex human diseases. Science 1996;273: Sousa MC, Morais JB, Machado JE, Poiares-DA-Silva J. Genotyping of Giardia lamblia Human Isolates from Portugal by PCR-RFLP and Sequencing. J Eukaryot Microbiol 2006;53: Hatzaki A, Razi E, Anagnostopoulou K, Iliadis K, Kodaxis A, Papaioannou D, et al. A modified mutagenic PCR-RFLP method for K-ras codon 12 and 13 mutations detection in NSCLC patients. Mol Cell Probes 2001;15: Bravo-Villalta HV, Yamamoto K, Nakamura K, Baya A, Horiuchi R. A novel intronic mutation that may affect genotyping result of CYP2C8 by PCR-RFLP is strongly associated with CYP2C8*3 in a South American population. J Hum Genet 2006;52: Ruiz-Ponte C, Carracedo A, Barros F. Duplication and deletion analysis by fluorescent real-time PCR-based genotyping. Clin Chim Acta 2006;363: Gibson NJ. The use of real-time PCR methods in DNA sequence variation analysis. Clin Chim Acta 2006;363: Joneson VJ, Yucesoy B, Luster MI. Genotyping of single nucleotide polymorphisms in cytokine genes using real-time PCR allelic discrimination technology. Cytokine 2004;27: Bepler G, Zheng Z, Gautam A, Sharma S, Cantor A, Sharma A, et al. Ribonucleotide reductase M1 gene promoter activity, polymorphisms, population frequencies, and clinical relevance. Lung cancer 2005;47: Ueda T, Ugawa S, Ishida Y, Shibata Y, Murakami S, Shimada S. Identification of coding single nucleotide polymorphisms in human taste recepter genes involving bitter tasting. Biochem Biophys Res Commun 2001;285: Shi MM. Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and disease genes. Am J Pharmacogenomics 2002; 2: Abraham J, Earl HM, Pharoah PD, Caldas C. Pharmacogenetics of cancer chemotherapy. Biochim Biophys Acta 2006;1766: Shi MM, Bleavins MR, de la iglesia FA. Technologies for detecting genetic polymorphisms in pharmacogenomics. Mol Diagn 1999;4: Lazarus R, Vercelli D, Palmer LJ, Klimecki WJ, Silverman EK, Richter B, et al. Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev 2002;190: Palmer LJ, Cookson WO. Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma. Respir Res 2001;2: Iannone MA, Taylor JD, Chen J, Li MS, Rivers P, 415

11 JY Jeong et al: PCR-RFLP and real time PCR for SNP analysis Slentz-Kesler KA, et al. Multiplexed single nucleotide polymorphism genatyping by oligonucleotide ligation and flow cytometry. Cytometry 2000;39: Blievernicht JK, Schaeffeler E, Klein K, Eichelbaum M, Schwab M, Zanqer UM. MALDI-TOF mass spectrometry for multiplex genotyping of CYP2B6 single nucleotide polymorphisms. Clin Chem 2007;53: Podder M, Welch WJ, Zamar RH, Tebbutt SJ. Dynamic variable selection in SNP genotype autocalling from APEX microarray data. BMC Bioinformatics 2006;7: Jobs M, Howell WM, Stromqvist L, Mayr T, Brookes AJ. DASH-2: flexible, low-cost, and high throughput SNP genotyping by dynamic allele-specific hybridization on membrane arrays. Genome Res 2003;13: Shen GO, Luo A, Wang OK. High-throughput single nucleotide polymorphisms genotyping: TaqMan assay and pyrosequencing assay. Methods Mol Med 2006;128:

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

노영남

노영남 Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

44-3대지.08류주현c

44-3대지.08류주현c A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

Chapter 11 Rate of Reaction

Chapter 11 Rate of Reaction Chapter 11 Rate of Reaction 11 11.1 ? Rate Law Kinetics : 11 11.2 CO(g) + NO 2 (g) CO 2 (g) + NO(g) E a =134 kj CO(g) + NO 2 (g) H = -226 kj CO 2 (g) + NO(g) 11 11.3 N 2 O 5 (g) 2NO 2 (g) + 1/2 O 2 (g)

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

50(2)-04.fm

50(2)-04.fm 2006, Vol. 50, No. 2 Printed in the Republic of Korea RFLP 와 DHPLC 를이용한베체트병환자에서 Interleukin-6 유전자다형성의분석 Áû xá Á Á * w w yw» w (2005. 12. 26 ) Analysis of Interleukin-6 Gene Polymorphisms in Behcet s Disease

More information

Rheu-suppl hwp

Rheu-suppl hwp Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>

<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1> Outline 2012. 1. 30 CS4HS 생물정보학 생물정보학및암정보의학 맟춤의학과생물정보학 김선 서울대학교컴퓨터공학부생물정보연구소생물정보학협동과정 유전체학, 후생유전체학을이용한암연구와맟춤의학 1 2 Central Dogma in Biology PART1. 생물정보학 http://en.wikipedia.org/wiki/central_dogma_of_molecular_biology

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) + 20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time

More information

Print

Print 2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of

More information

Jkcs022(89-113).hwp

Jkcs022(89-113).hwp 대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

Chapter 4. Bacteria (the first microbes)

Chapter 4. Bacteria (the first microbes) - DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

00약제부봄호c03逞풚

00약제부봄호c03逞풚 경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품

More information

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770> 원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of

More information

29(2)-04(임시근).fm

29(2)-04(임시근).fm Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

Genomics and Nursing Practice

Genomics and Nursing Practice 약물유전체학 Pharmacogenomics Kangwon National Univ School of Medicine Hee Jae Lee PhD A : 안녕? 어떻게지내? B : 응, 난요즘혈압이조절이안돼. A : 그래? 난네가고혈압인줄몰랐다. 괜찮니? B : 그리오래되지않았어. 한반개월정도. 우리아버지가혈압이높으셨거든. 형이랑누나들도혈압이높은것같아. A

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월 지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

untitled

untitled 대한수혈학회지:제21권 제2호, 2010 유전자 검사로 확인된 A 1 B weak 형 환자 1예 조치현ㆍ유병준ㆍ윤승규ㆍ최계령ㆍ최재열ㆍ김장수ㆍ임채승ㆍ김영기ㆍ이갑노 고려대학교 의과대학 진단검사의학교실 Using Genotyping to Identify an A 1 B weak Blood Group Chi-Hyun Cho, Byong-Joon Yoo, Seung-Gyu

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology

More information

미래의학 - 맞춤형의학 유전자가위

미래의학 - 맞춤형의학 유전자가위 미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information

160106_STEPI_Insight_179호(정기철,김석관_외)rp.hwp

160106_STEPI_Insight_179호(정기철,김석관_외)rp.hwp 2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 정기철 김석관 김승현 이명화 목 차 < 요 약 > Ⅰ. 개인 유전체 기반 맞춤 의료 7 Ⅱ. 맞 춤 의료 기 술 현 황과 시 사 점 10 Ⅲ. 맞춤 의료 조직 및 비즈니스모델 현황과 시사점 16 Ⅳ.

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

08김현휘_ok.hwp

08김현휘_ok.hwp (Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel

More information

untitled

untitled Korean J Hematol Vol. 43, No. 1, March, 2008 Original Article 직접염기서열분석법을이용한한국인 Lewis 혈액형군의유전자분석 강원대학교의과대학내과학교실, 1 진단검사의학교실, 2 경원대학교가천바이오나노연구원, 3 고려대학교의과대학진단검사의학교실, 4 ( 주 ) 대한임상의학센터, 5 강원대학교의과학연구소 송서영ㆍ안성수

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

슬라이드 1

슬라이드 1 유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide

연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide 연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여

泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여 權 近 의 五 經 인식 - 經 學 과 經 世 論 의 연결을 중심으로 - 姜 文 植 * 1. 머리말 2. 經 學 과 經 世 論 연결의 이론적 기반 3. 五 經 淺 見 錄 의 經 典 해석과 經 世 論 4. 맺음말 요약문 권근( 權 近 )은 체용론( 體 用 論 )에 입각하여 오경( 五 經 ) 간의 관계 및 각 경서의 근본 성격을 규정하였다. 체용론에서 용( 用 )

More information

(079-088)Kjbt015.hwp

(079-088)Kjbt015.hwp 대한수혈학회지:제18권 제2호, 2007 다중 단일염기 시발체 확장반응을 이용한 ABO 유전자형 검사 현정원 1 장호은 2 허세란 2 송상훈 1 박경운 1,2 송정한 1,2 한규섭 1 = Abstract = 서울대학교 의과대학 검사의학교실 1, 분당서울대학교병원 진단검사의학과 2 ABO Genotyping using a Multiplex Single-base

More information

대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의

대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의 대한진단검사의학회지제 26 권제 5 호 2006 Korean J Lab Med 2006;26:374-9 원저 수혈의학 한국인에서 8 가지 ABO 대립유전자의빈도분석 송상훈 1 장호은 2 유광철 2 이현정 2 박경운 1,2 송정한 1,2 한규섭 1 서울대학교의과대학검사의학교실 1, 분당서울대학교병원진단검사의학과 2 Analysis for Eight ABO Alleles

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

<4D F736F F F696E74202D20C7D0BFACBBEAB9DAC1D8BFF8>

<4D F736F F F696E74202D20C7D0BFACBBEAB9DAC1D8BFF8> Surface Chemistry for Biochip and Bioanalysis 2007.05.11 박준원포항공과대학교 Biochip 의탄생 Light-directed, spatially addressable parallel chemical synthesis Fodor, S. P. et al. Science 251(4995), 767-73, 1991 US

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information