fm

Size: px
Start display at page:

Download "fm"

Transcription

1 Korean J. Pl. Taxon. 50(4): (2020) RESEARCH ARTICLE pissn eissn Korean Journal of Plant Taxonomy Floristic study of Byeonsanbando National Park in Korea Hyosun LEEM, Seahee HAN 1, Hyun-Do JANG 2, Yoon-Young KIM 3 and Soonku SO 4 * Forest Restoration Support Division, Baekdudaegan National Arboretum, Bonghwa 26209, Korea 1 National Agrobiodiversity Center, National Academy of Agricultural Science RDA, Jeonju 54875, Korea 2 Plant Resources Division, National Institute of Biological Resources, Incheon 22689, Korea 3 Department of Variety Examination, National Forest Seed & Variety Center, Chungju 27495, Korea 4 Korea National Park Research Institute, Korea National Park Service, Wonju 26441, Korea (Received 6 July 2020; Revised 5 October 2020; Accepted 23 November 2020) ABSTRACT: This study of vascular plants was conducted over a period of 33 days from March to October of 2018 in Byeonsanbando National Park, South Korea. Based on voucher specimens and photographs, 829 taxa in total were recorded, including 141 families, 458 genera, 748 species, 16 subspecies, 59 varieties, and 6 forma. Two endangered taxa were identified, Iris koreana Nakai and Saururus chinensis (Lour.) Baill. Five rare taxa were found, including Abeliophyllum distichum Nakai and Hypodematium glanduloso-pilosum (Tagawa) Ohwi. A total of 17 Korean endemic plants were investigated. Examples include Elsholtzia byeonsanensis M. Kim, Eranthis byunsanensis B. Y. Sun, and Lycoris flavescens M. Kim & S. T. Lee. Of floristic regional indicators (third to fifth degree), 52 taxa were identified. Naturalized plants were identified, which included 79 taxa, and 7 species of ecosystem disturbance plants, such as Ambrosia artemisiifolia L., Lactuca serriola L., and Solidago altissima L. were found. We recorded 39 taxa of the plants vulnerable to climate change. Keywords: Byeonsanbando National Park, flora, endangered and rare plants, endemic plants, naturalized plants 국립공원은자연생태계의보고인국가생물핵심보전지역으로 International Union for Conservation of Nature (IUCN) 의범주와평가기준에따라작성된국가적색목록멸종우려종 (threatened species) 의 56.3% 가분포하는동 식물의핵심서식지라고할수있다 (So et al., 2016). 이중 19 호로지정된변산반도국립공원은산과바다가공존하는반도형공원으로 1988 년도에도립공원에서국립공원으로승격되었다. 전체면적은 km 2 로육상면적은 km 2 (88.8%), 해상면적은 17.2 km 2 (11.2%) 를차지하고있다 (Yuk and Park, 2019). 행정구역상으로는전라북도부안군변산면, 보안면, 상서면, 진서면, 하서면에걸쳐있으며, 경 위도상북위 34 o o 47, 동경 126 o o 44 에위치한다. 변산반도국립공원은최고봉인의상봉 (508 m) 을중심으로북동쪽으로옥녀봉 (354 m), 남동쪽에삼예봉 (354 m), 상여봉 (398 m), 옥녀봉 (432 m), 남쪽에세봉 (402 m), 남서쪽에쌍선봉 (459 m), 갑남산 (408 m), 신선봉 (488 m), 갈마봉 (484 m) 등해발 500 m 이내의낮은구릉성산지가위치한다. 중앙에는부안호가자리하고있으며, 진서면석포리에서발원하는직소천은변산면중계리, 부안호, 대항리를거쳐서해로합류한다. 부안군의최근 30년간연평균기온은 12.6 o C, 연평균최고기온과최저기온은각각 18.0 o C와 8.0 o C, 연평균강수량은 1,250.4 mm로기록되어있다 (Korea Meteorological Administration, 2019). 한반도식물의지리적분포를바탕으로구분된 8개의식물구계중남부아구에속하며 (Lee and Yim, 2002), 한반도기후를바탕으로구분한산림식물대중온대남부에위치한다 (Lim and Lee, 1999). 또한변산반도국립공원내에는도청리의호랑가시나무군락이천연기념물제122호, 격포리의후박나무군락이제123호, 중계리의꽝꽝나무군락은제124호, 미선나무군락은제370 호로각각지정되어있다 (Cultural Heritage Administration, 2000). 변산반도국립공원의식물상연구는 Jeom (1990) 이 119 과 698분류군, Sun et al. (1995) 이 117과 686분류군, Oh (1999) 는 118과 721분류군을보고하였으며, Yang et al. (2009) 은 123과 721분류군에대한구체적목록을제시하 *Author for correspondence: the Korean Society of Plant Taxonomists. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 427

2 428 Hyosun LEEM et al. 였다. 한편 변산반도국립공원 내 특정지역을 대상으로 이 루어진 소규모 식물상 연구에 따르면 소쩍골 주변 135분 류군(Oh et al., 2008), 작은당 일대 105분류군(Oh and Beon, 2009), 하섬 일대 235분류군(Oh et al., 2011a), 노랑붓꽃과 붉노랑상사화 자생지에 관한 연구에서 147분류군(Oh et al., 2011b), 노랑붓꽃 자생지 연구에서 255분류군(Oh, 2017)의 분포를 제시한 바 있다. 본 조사는 국립공원공단에서 실시한 2018년도 제3기 국 립공원 자연자원조사의 일환으로 수행되었으며, 변산반 도 국립공원에 분포하는 식물자원에 대한 보다 면밀한 조 사를 통하여 향후 변산반도국립공원 식물자원의 보전 관 리방안을 수립하기 위한 기초자료로 활용하는 데 그 목적 이 있다. 재료 및 방법 본 조사는 변산반도국립공원 전체를 대상으로 하였으 며, 2018년 3월부터 10월까지 총 33일에 걸쳐 조사를 수행 하였다(Fig. 1, Table 1). 결과의 정확성을 위해 현장에서 관 찰한 모든 식물을 대상으로 검색형질에 유용한 꽃, 열매, 포자 등의 세부형질을 촬영하였으며(Nikon D AF-S 40 mm Macrolens, Tokyo, Japan; Nikon D AF 105 mm Fig. 1. Investigated area and routes of Byeonsanbando National Park. Table 1. Investigation dates and routes of Byeonsanbando National Park. No. Date Mar 2018 Investigation route A: Cheongnim-ri (Cheongnim village) B: Junggye-ri (Naebyeonsan park information center Sebong) C: Jinseo-myeon (Seokpo 2-gil Sinseongol) Apr 2018 A: Seokpo-ri (Maegokjae Sinseonbong Sinseongol) B: Docheong-ri (Horanggasinamu community) C: Gyeokpo-ri (Hubaknamu community) D: Daehang-ri (Bangpoje Eoryonggol) E: Junggye-ri (Buandaem-ro) Apr 2018 A: Byeonsan-myeon (Gamnamsan) B: Byeonsan-myeon (Haseom island) C: Unsan-ri (Unsanje) D: Gusigol (Cheongnim-ri Junggye-ri Buan lake) Jun 2018 A: Byeonsan-myeon (Gosapo beach) B: Junggye-ri (Buandaem-ro) C: Byeonsan-myeon (Namyeochi parking area Wolmyeongam) D: Byeonsan-myeon (Gamnamsan)

3 Flora of vascular plants of Byeonsanbando National Park 429 Table 1. Continued. No. Date Investigation route Jun 2018 A: Junggye-ri (Naebyeonsan park information center Sebong) B: Baengnyeon-ri (Munsuje) C: Byeonsan-myeon (Wolmyeongam) D: Sangseo-myeon (Geoseok bridge) E: Naebyeonsan-ro 736 road F: Byeonsan-ro 30 road G: Byeonsan-myeon (Chaeseokgang) Jul 2018 A: Byeonsan-myeon (Gosapo beach) B: Sangseo-myeon (Gaeamsa temple Ugeumam) C: Mapo-ri (Seongcheon 1 bridge) D: Gyeokpo-ri (Bonghwabong) E: Cheongnim-ri (Soeppulbawi route) Aug 2018 A: Jinseo-myeon (Naesosa temple) B: Cheongnim-ri (Ganeungol reservoir) 8 31 Aug Sep 2018 A: Jinseo-myeon (Seokpo reservoir) B: Gyeokpo-ri (Chaeseokgang Masil-gil Gyeokpohaebyeon-ro) C: Byeonsan-myeon (Unsanje Byeonsan beach) Sep 2018 A: Naesosa temple Gwaneumbong Sebong Naesosa temple B: Daehang-ri (Bangpoje) C: Cheongnim-ri (Cheongnimje Nojeok-gil, Ganeungol reservoir) D: Gamgyo-ri (Gaeamsa temple) Oct 2018 A: Byeonsan-myeon (Gosapohaebyeon) B: Byeonsan-myeon (Jakso bridge Byeonsan bridge Saemangeum bridge) C: Byeonsan-myeon (Byeonsan beach Jongam-gil) Oct 2018 A: Gamgyo-ri (Gaeamje) B: Jiseo-ri C: Gyeokpo port Macrolens), GPS 수신기 (Nikon GP-1 & GP-1A) 를장착하여각식물에대한좌표를획득하였다. 또한, 증거표본을제작하여국립공원연구원표본실 (NP) 에보관하였다. 분류군의동정은 Lee (1996), Lee (2003), Kim and Kim (2011) 등의도감을이용하였고, 양치식물은 Korean Fern Society (2005), Park et al. (2008), Lee and Lee (2015), 벼과와사초과는 Park et al. (2011), Cho et al. (2016) 의문헌을참고하였으며, 몇몇식물에대해서는최근국내외학술지에발표된논문을참고하였다. 식물목록의배열은 Engler 의분류체계를기본으로하되, 양치식물은 Christenhusz et al. (2011) 의분류체계를따랐으며, 학명은국가표준식물목록 (Korea National Arboretum, 2017) 을따랐으나, 일부는국가생물종목록집 (National Institute of Biological Resources, 2019) 을참조하였다. 아울러, 멸종위기야생식물 (Ministry of Environment, 2017), 희귀식물 (National Institute of Biological Resources, 2012), 한반도고유식물 (Chung et al., 2017), 식물구계학적특정식물 (Kim et al., 2018), 귀화식물 (Park, 2009; Lee et al., 2011) 및생태계교란야생식물 (Ministry of Environment, 2019), 기후변화취약산림식물 (Oh et al., 2010; Oh et al., 2013) 과유용자원식물 (Korea Forest Service, 2014) 등을파악하였다. 결과및고찰 관속식물의종조성본연구에서확인된변산반도국립공원일대의관속식물은 141 과 458 속 748 종 16 아종 59 변종 6 품종의총 829 분류군으로조사되었다. 양치식물은 29 분류군 (3.5%), 나자식물은 12 분류군 (1.5%) 이었으며, 피자식물의쌍자엽식물은 600 분류군 (72.3%), 단자엽식물은 188 분류군 (22.7%) 으로확인되었다 (Fig. 2A, Table 2). 이는한반도관속식물 4,498 분류군 (Korea National Arboretum, 2017) 의 18.4% 에해당하였다. 과별종구성에의한다양성은국화과가 97 분류군 (11.7%) 으로가장높은비율을나타냈으며, 벼과 82 분류군 (9.9%), 콩과 45 분류군 (5.4%), 장미과 39 분류군 (4.7%), 사초과 36 분류군 (4.3%), 백합과 24 분류군 (2.9%) 순으로확인되었다 (Fig. 2B). 조사된목록중재배또는식재종으로판단되는식물은개잎갈나무 [Cedrus deodara (Roxb. ex D. Don) G. Don], 골담초 [Caragana sinica (Buc'hoz) Rehder], 두충 (Eucommia ulmoides Oliv.), 모감주나무 (Koelreuteria paniculata Laxm.), 사방오리 (Alnus firma Siebold & Zucc.), 삼나무 [Cryptomeria japonica (Thunb. ex L. f.) D. Don], 앵도나무 (Prunus tomentosa Thunb.), 옻나무 [Toxicodendron vernicifluum (Stokes) F. A. Barkley], 중국

4 430 Hyosun LEEM et al. Fig. 2. The constitution rate of each plant group (A) and the constitution number of Family (B) in Byeonsanbando National Park. Table 2. Summary on the floristics of Byeonsanbando National Park. Taxonomic rank Fam. Gen. Sp. Subsp. Var. For. Total Ratio (%) Pteridophyta Gymnospermae Angiospermae Dicotyledon Monocotyledon Total Fig. 3. Some remarkable taxa in Byeonsanbando National Park (A and E photograph by N. Y. Kim). A. Iris koreana Nakai. B. Calanthe discolor Lindl. C. Eranthis byunsanensis B. Y. Sun. D. Asplenium scolopendrium L. E. Monochasma sheareri (S. Moore) Maxim. ex Franch. & Sav. F. Elsholtzia byeonsanensis M. Kim. G. Pyrrosia hastata (Houtt.) Ching. H. Chloranthus fortunei (A. Gray) Solms. 단풍(Acer buergerianum Miq.), 측백나무[Platycladus orientalis (L.) Franco], 탱자나무[Poncirus trifoliatus (L.) Raf.], 회화나무 (Sophora japonica L.) 등 89분류군으로 전체 분류군 중 10.7% 를 차지하였으며, 자생종과 구분하기 위해 관속식물목록 (Appendix 1)의 국명 뒤에 별표( )로 표시하였다. 멸종위기식물 멸종위기야생생물 II급(Ministry of Environment, 2017)에 해당하는 식물로는 노랑붓꽃(Iris koreana Nakai), 삼백초 [Saururus chinensis (Lour.) Baill.] (식재) 등 2분류군이 확인 되었다(Table 3). 노랑붓꽃(Fig. 3A)은 전라북도 정읍시 입

5 Flora of vascular plants of Byeonsanbando National Park 431 Table 3. The list of endangered plants in Byeonsanbando National Park. No. Family name Scientific name Korean name Criteria 1 Saururaceae Saururus chinensis (Lour.) Baill. 삼백초 ( 식재 ) II 2 Iridaceae Iris koreana Nakai 노랑붓꽃 Table 4. The list of rare plants in Byeonsanbando National Park. No. Family name Scientific name Korean name Criteria 1 Saururaceae Saururus chinensis (Lour.) Baill. 삼백초 ( 식재 ) EN 2 Cupressaceae Juniperus chinensis L. 향나무 ( 식재 ) VU 3 Iridaceae Iris koreana Nakai 노랑붓꽃 4 Oleaceae Abeliophyllum distichum Nakai 미선나무 5 Hypodematiaceae Hypodematium glanduloso-pilosum (Tagawa) Ohwi 금털고사리 NT EN, endangered; VU, vulnerable; NT, near threatened. 암면노령일대에서최초발견된한반도고유식물로서 (Nakai, 1914), 변산반도일대와내장산일대에주로분포하며순창조계산에는극소수의개체가분포하고있다. 조사지역내가장큰군락은도청리 ( 각수암골 ) 일대로서수십개체로이루어진소규모집단이계곡부를따라 100 여곳이상확인되었으며, 감교리일대구릉지대에서는숲가장자리를중심으로수백개체가확인되었다. 대항리 ( 어룡골 ), 중계리 ( 구시골 ), 운산리 ( 운산제 ) 인근에는 10 여개체씩산발적으로분포하고있었다. 이번조사를통해새롭게확인된대항리 ( 어룡골 ) 자생지는사람의출입이잦은곳에위치해있어훼손이우려되며, 도청리와감교리를제외한곳은개체수가감소할가능성이있어별도의관리방안이필요할것으로판단된다. 삼백초는새만금교인근의연못가에식재되어있었으며, 제주도의일부지역에만자생하는것으로알려져있으나약용으로전국곳곳에서재배가이루어지고있다. 한편, 기존조사에서확인되었던멸종위기야생생물 II 급대흥란 (Cymbidium macrorhizon Lindl.) 과매화마름 (Ranunculus kadzusensis Makino) 은이번조사에서는확인되지않았다. 이중대흥란은 2016 년공원구역내리기다소나무인공조림지모니터링중분포를확인하였으나잎이없고토양의유기물을양분으로살아가는부생식물의특성상이번조사에서는확인하지못하였다. 다만탐방로가없고인위적훼손위협이낮은지역이므로지속적으로개체의확인및개체수변화등모니터링을수행할필요가있다. 매화마름은 2001 년전국자연환경조사를통해최초확인되었으나 (Sun and Baek, 2001) 자생지가공원구역밖에위치하고있어지자체에서변산해수욕장관광지조성에따른매화마름자생지파괴를막기위해대체서식지를조성하여 2015 년친환경개발우수사례로소개되었으나불과 1 년만인 2016 년에관리미흡에대한부정적언론보도가있었다. 본조사에서 4 월, 6 월, 10 월 3 회에걸쳐조 사하였으나개체를확인할수없었다. 해당대체서식지는다른지역의매화마름보호구역과는달리숲가장자리에위치하고상층의교목으로인하여그늘져있으며매화마름의생활사에가장중요한것으로알려진경작활동이전무하다. 이로인해습지내부에는큰매자기, 좀개구리밥등에의해완전히피압되어있었다. 법적보호종에대한대체서식지조성시, 해당종의생존에필요한생리생태학적특성, 집단의크기등을면밀히검토해야할것이며인근지역을중심으로신규서식지를발굴하여종의보전을위한노력을지속해야할것이다. 희귀식물환경부에서지정한적색자료집 (National Institute of Biological Resources, 2012) 에따른희귀식물은총 5 분류군이확인되었다 (Table 4). 위기종 (endangered, EN) 에해당하는삼백초 ( 식재 ) 1 분류군, 취약종 (vulnerable, VU) 은노랑붓꽃, 미선나무 (Abeliophyllum distichum Nakai), 향나무 (Juniperus chinensis L.) ( 식재 ) 등 3 분류군, 준위협 (near threatened, NT) 은금털고사리 [Hypodematium glanduloso-pilosum (Tagawa) Ohwi] 1 분류군이각각확인되었다 (Fig. 3A, Table 4). VU 에속하는미선나무는우리나라고유속고유종으로서지난 2017 년멸종위기식물 II 급에서해제되었다. 알려진자생지는경기도 ( 고양 ), 충북 ( 괴산, 영동, 진천 ), 그리고본조사지역인전북 ( 부안 ) 이다 (Lee and Kil, 1991; Kim and Kim, 2008). 본지역에위치하는미선나무자생지는남방한계선에해당되므로식물지리학적으로매우중요하다고할수있다. 자생지내군락은개화 결실상태가양호하였으며, 천연기념물제 370 호로지정되어별도관리가이루어지고있으므로특별한위협요인은없을것으로추정되나, 자연적인군락의확대를기대하기는어려운실정이다. 따라서현재군락의쇠퇴를대비하여해당유전자원을종자및삽목등의형태로확보하여현지외보존이필요하다고판단된다.

6 432 Hyosun LEEM et al. Table 5. The list of endemic plants in Byeonsanbando National Park. No. Family name Scientific name Korean name 1 Amaryllidaceae Lycoris flavescens M. Kim & S. T. Lee 붉노랑상사화 2 Aristolochiaceae Asarum maculatum Nakai 개족도리풀 3 Caprifoliaceae Lonicera subsessilis Rehder 청괴불나무 4 Caprifoliaceae Weigela subsessilis (Nakai) L. H. Bailey 병꽃나무 5 Cyperaceae Carex okamotoi Ohwi 지리대사초 6 Fabaceae Indigofera koreana Ohwi 좀땅비싸리 7 Fabaceae Vicia hirticalycina Nakai 나래완두 8 Iridaceae Iris koreana Nakai 노랑붓꽃 9 Iridaceae Iris rossii var. latifolia J. K. Sim & Y. S. Kim 넓은잎각시붓꽃 10 Lamiaceae Elsholtzia byeonsanensis M. Kim 변산향유 11 Liliaceae Hemerocallis hakuunensis Nakai 백운산원추리 12 Moraceae Broussonetia hanjiana M. Kim 닥나무 13 Oleaceae Abeliophyllum distichum Nakai 미선나무 14 Oleaceae Forsythia koreana (Rehder) Nakai 개나리 ( 식재 ) 15 Ranunculaceae Eranthis byunsanensis B. Y. Sun 변산바람꽃 16 Ranunculaceae Thalictrum actaeifolium Siebold & Zucc. 은꿩의다리 17 Salicaceae Populus tomentiglandulosa T. B. Lee 은사시나무 ( 식재 ) 한반도고유식물한반도고유식물 (Chung et al., 2017) 은개족도리풀 (Asarum maculatum Nakai), 변산바람꽃 (Eranthis byunsanensis B. Y. Sun), 변산향유 (Elsholtzia byeonsanensis M. Kim), 붉노랑상사화 (Lycoris flavescens M. Kim & S. T. Lee) 등 17 분류군이확인되었다 (Table 5). 변산반도에서최초로발견되어신종으로발표된대표적고유식물로는변산바람꽃 (Sun et al., 1993) 과변산향유 (Choi et al., 2012) 가있다. 변산바람꽃 (Fig. 3C) 은청림리 ( 청림마을 ), 중계리 ( 봉래구곡 ), 내변산탐방지원센터 - 세봉에서대규모군락이확인되었으며, 변산반도국립공원의깃대종으로지정되어보호되고있다. 변산향유 (Fig. 3F) 는최근한반도고유종목록에포함된종으로 (National Institute of Biological Resources, 2013), 봉화봉인근의바닷가암벽에서수십개체를확인하였다. 군락내개체수와생육상태는양호한것으로판단되나변산반도가유일한자생지이기때문에적극적인보전계획수립이필요하다. 개족도리풀은전북, 전남, 경남, 제주도등에주로분포하는남방계식물로서 (Flora of Korea Editorial Committee, 2007; Leem and Oh, 2019), 변산반도내소사지구, 도청리, 석포리, 중계리등의계곡부주변및그늘진숲속에서흔하게관찰되었다. 붉노랑상사화는변산반도국립공원의청림리 ( 청림마을 ), 중계리 ( 봉래구곡 ) 에서대규모군락이확인되었으며, 본지역외에경기 ( 강화도 ), 충남 ( 난지도 ), 전북 ( 내장산, 모악산, 선운산 ), 전남 ( 백양산, 불갑산 ), 경남 ( 가야산 ) 에도생육하는것으로알려져 있다 (Kim, 2004; Kim et al., 2017). 식물구계학적특정식물종식물구계학적특정식물 (Kim et al., 2018) 은총 161 분류군으로전체소산식물의 19.4% 에해당하였다 (Fig. 3, Table 6). 등급별로는 V 등급에노랑붓꽃, 미선나무, 삼백초 ( 식재 ), 치자풀 [Monochasma sheareri (S. Moore) Maxim. ex Franch. & Sav.), 털오갈피나무 [Eleutherococcus divaricatus (Siebold & Zucc.) S. Y. Hu] 등 5 분류군, IV 등급에대반하 [Pinellia tripartita (Blume) Schott], 변산향유, 산복사나무 [Prunus davidiana (Carrière) Franch.], 산외 (Schizopepon bryoniifolius Maxim.) 등 9 분류군, III 등급에금난초 [Cephalanthera falcata (Thunb.) Blume], 내장고사리 [Diplazium squamigerum (Mett.) C. Hope], 새우난초 (Calanthe discolor Lindl.), 팥꽃나무 (Daphne genkwa Siebold & Zucc.) 등 38 분류군이확인되었다. II 등급은 34 분류군으로골고사리 (Asplenium scolopendrium L.), 나도수정초 [Monotropastrum humile (D. Don) H. Hara], 부채괴불이끼 [Crepidomanes minutum (Blume) K. Iwats.] 등이해당되며, I 등급은 75 분류군으로나도밤나무 (Meliosma myriantha Siebold & Zucc.), 송악 [Hedera rhombea (Miq.) Siebold & Zucc. ex Bean], 좀딱취 (Ainsliaea apiculata Sch. Bip.), 큰천남성 [Arisaema ringens (Thunb.) Schott], 합다리나무 [Meliosma pinnata (Roxb.) Maxim. var. oldhamii (Miq. ex Maxim.) Beusekom] 등전반적으로남방계식물이주로확인되었다. 이번조사에서새롭게확인된식물구계학적

7 Flora of vascular plants of Byeonsanbando National Park 433 Table 6. The list of the 5 th to 3 rd degree taxa of Korean floristic regional plants in Byeonsanbando National Park. No. Family name Scientific name Korean name Degree 1 Araliaceae Eleutherococcus divaricatus (Siebold & Zucc.) S. Y. Hu 털오갈피나무 V 2 Iridaceae Iris koreana Nakai 노랑붓꽃 3 Oleaceae Abeliophyllum distichum Nakai 미선나무 4 Orobanchaceae Monochasma sheareri (S. Moore) Maxim. ex Franch. & Sav. 치자풀 5 Saururaceae Saururus chinensis (Lour.) Baill. 삼백초 ( 식재 ) 6 Araceae Pinellia tripartita (Blume) Schott 대반하 IV 7 Cucurbitaceae Schizopepon bryoniifolius Maxim. 산외 8 Cupressaceae Platycladus orientalis (L.) Franco 측백나무 ( 식재 ) 9 Fabaceae Wisteria floribunda (Willd.) DC. 등 ( 식재 ) 10 Lamiaceae Elsholtzia byeonsanensis M. Kim 변산향유 11 Lauraceae Cinnamomum camphora (L.) J. Presl 녹나무 ( 식재 ) 12 Oleaceae Osmanthus heterophyllus (G. Don) P. S. Green 구골나무 ( 식재 ) 13 Paeoniaceae Paeonia lactiflora Pall. 작약 ( 식재 ) 14 Rosaceae Prunus davidiana (Carrière) Franch. 산복사나무 15 Aceraceae Acer palmatum Thunb. 단풍나무 Ⅲ 16 Aceraceae Acer triflorum Kom. 복자기 17 Amaryllidaceae Lycoris flavescens M. Kim & S. T. Lee 붉노랑상사화 18 Aquifoliaceae Ilex cornuta Lindl. & Paxton 호랑가시나무 19 Aquifoliaceae Ilex crenata Thunb. 꽝꽝나무 20 Araliaceae Dendropanax trifidus (Thunb.) Makino ex H. Hara 황칠나무 ( 식재 ) 21 Aristolochiaceae Asarum maculatum Nakai 개족도리풀 22 Athyriaceae Diplazium squamigerum (Mett.) C. Hope 내장고사리 23 Convolvulaceae Calystegia pellita (Ledeb.) G. Don 선메꽃 24 Crassulaceae Hylotelephium spectabile (Boreau) H. Ohba 큰꿩의비름 25 Cupressaceae Juniperus chinensis L. 향나무 ( 식재 ) 26 Cyperaceae Carex genkaiensis Ohwi 목포사초 27 Flacourtiaceae Idesia polycarpa Maxim. 이나무 28 Hydrangeaceae Philadelphus schrenkii Rupr. 고광나무 29 Liliaceae Asparagus cochinchinensis (Lour.) Merr. 천문동 30 Meliaceae Melia azedarach L. 멀구슬나무 31 Orchidaceae Calanthe discolor Lindl. 새우난초 32 Orchidaceae Cephalanthera falcata (Thunb.) Blume 금난초 33 Pittosporaceae Pittosporum tobira (Thunb.) W. T. Aiton 돈나무 34 Poaceae Lophatherum sinense Rendle 털조릿대풀 35 Polygonaceae Polygonum bellardii All. 큰옥매듭풀 36 Polypodiaceae Lepisorus onoei (Franch. & Sav.) Ching 애기일엽초 37 Pteridaceae Coniogramme japonica (Thunb.) Diels 가지고비고사리 38 Ranunculaceae Actaea asiatica H. Hara 노루삼 39 Ranunculaceae Clematis fusca var. violacea Maxim. 종덩굴 40 Ranunculaceae Eranthis byunsanensis B. Y. Sun 변산바람꽃

8 434 Hyosun LEEM et al. Table 6. Continued. No. Family name Scientific name Korean name Degree 41 Rosaceae Prunus sargentii Rehder 산벚나무 Ⅲ 42 Rosaceae Rubus hirsutus Thunb. 장딸기 43 Rosaceae Sanguisorba hakusanensis var. coreana H. Hara 산오이풀 44 Rosaceae Spiraea chinensis Maxim. 당조팝나무 45 Rubiaceae Mitchella undulata Siebold & Zucc. 호자덩굴 46 Rutaceae Poncirus trifoliatus (L.) Raf. 탱자나무 ( 식재 ) 47 Sapindaceae Koelreuteria paniculata Laxm. 모감주나무 ( 식재 ) 48 Selaginellaceae Selaginella tamariscina (P. Beauv.) Spring 바위손 49 Thymelaeaceae Daphne genkwa Siebold & Zucc. 팥꽃나무 50 Urticaceae Boehmeria pannosa Nakai & Satake ex Oka 왕모시풀 51 Verbenaceae Callicarpa mollis Siebold & Zucc. 새비나무 52 Violaceae Viola violacea Makino 자주잎제비꽃 특정식물로는갯그령 [Leymus mollis (Trin.) Pilg.], 금털고사리, 모새달 [Phacelurus latifolius (Steud.) Ohwi], 어리연꽃 [Nymphoides indica (L.) Kuntze], 치자풀, 통보리사초 (Carex kobomugi Ohwi), 해국 (Aster spathulifolius Maxim.) 등 47 분류군이었다. 이중팥꽃나무는서 남해안 ( 황해도이남에서부터전남진도, 해남, 청산도등 ) 에분포하는남방계식물로해안가와인접한산기슭이나숲가장자리의척박한곳또는관목림과어우러진초지에산발적으로흩어져생육하는것으로알려져있다 (Kim et al., 2018). 본지역에서는도청리수락폭포인근에서소수의개체를확인하였으나개체수가적고관목림과어우러져관리가잘이루어지고있지않으므로, 추가적인관리방안이필요할것으로보인다. 골고사리 (Fig. 3D) 는 변산일엽 이라고도불리며 (Oh and Lee, 1992), 강원, 전남, 울릉도, 제주도에분포하는것으로알려져있다 (Lee and Lee, 2015). 본지역에서는세봉삼거리인근계곡부에서소수의개체를확인하였으며, 본자생지에대한정밀조사가이루어진다면추가적으로개체를확인할여지는있으나, 개체수가적어향후쇠퇴할가능성이높아보인다. 청문에따르면과거비교적흔하게분포하였으나관상용으로무분별하게채취되었다고하므로현재잔존하는개체에대한별도의보호와더불어지속적인모니터링이필요한실정이다. 부채괴불이끼는한반도남부, 제주도, 속리산, 설악산, 금강산, 주왕산등의그늘지고습한바위나나무에착생하는것으로알려져있으며 (Korean Fern Society, 2005; Jang et al., 2019), 본국립공원지역에서는내변산탐방지원센터에서세봉으로가는계곡부의바위곳곳에서흔하게확인할수있었다. 새우난초 (Fig. 3B) 는갑남산일대의낙엽활엽수림에서 10 여개체, 운산제의소나무림에서 70 개체가량이확인되었다. 한편, V 등급에해당하는치자풀 (Fig. 3E) 은 2000 년대이후야생화동호회원들을통해변산일대에서지속적으로확인되었다. 조사기간인 2018 년도에는확인하지못하였으나 2019 년과 2020 년에도청리 ( 각수암골 ) 에자생하는것이확인되었다. 치자풀은열당과 (Orobanchaceae) 에속하는반기생성식물로서, 최초한국쌍자엽식물지 (Park, 1974) 에기록되었으며, Monochasma japonicum (Maxim.) Makino 를정명으로취급하고 Monochasma sheareri var. japonicum Maxim. 을이명으로표기하였으나해당학명들은현재 M. sheareri 의이명으로처리되고있다 (Yonekura and Kajita, 2003; Tho et al., 2006). 그러나 Tho et al. (2006) 은본종을한국미기록종으로오인하여발표하면서 변산붙살이풀 로신칭함으로서국명의혼란을야기하였다. 본식물의현재까지알려진자생지는변산반도를비롯한진도, 제주도에국한되어있으며, 특정한환경에서만출현하는식물이므로본지역에대한지속적인모니터링과더불어별도의관리대책이수립되어야할것이다. 귀화식물및생태계교란식물조사지역에서확인된귀화식물 (Lee et al., 2011) 은총 79 분류군이었으며, 이중국화과식물이 30 분류군 (37.9%) 으로가장높은비율을차지하였다 (Table 7). 귀화율 (naturalization index: 조사된귀화식물의종수 [79]/ 출현식물의총종수 [829] 100) (Numata, 1975) 은 9.5%, 도시화지수 (urbanization index: 조사된귀화식물의종수 [79]/ 남한의귀화식물총종수 [321] 100) (Yim and Jeon, 1980) 는 24.6% 로산출되어우리나라산림형및도시형국립공원의평균귀화율과평균도시화지수 ( 각각 6.8%, 15.3%) 보다높게나타났으나 (Yu, 2013), 해안형국립공원의평균귀화율과평균도시화지수 ( 각각 9.6%, 25.8%) 와는유사하였다 (Yu,

9 Flora of vascular plants of Byeonsanbando National Park 435 Table 7. The list of naturalized plants and ecosystem disturbance plants of Byeonsanbando National Park. No. Family name Scientific name Korean name 1 Amaranthaceae Amaranthus blitum subsp. oleraceus (L.) Costea 개비름 2 Amaranthaceae Amaranthus retroflexus L. 털비름 3 Amaranthaceae Amaranthus viridis L. 청비름 4 Asteraceae Ambrosia artemisiifolia L. 돼지풀 a 5 Asteraceae Symphyotrichum expansum (Poepp. ex Spreng.) G. L. Nesom 큰비짜루국화 6 Asteraceae Symphyotrichum pilosum (Willd.) G. L. Nesom 미국쑥부쟁이 a 7 Asteraceae Symphyotrichum subulatum (Michx.) G. L. Nesom 비짜루국화 8 Asteraceae Bidens frondosa L. 미국가막사리 9 Asteraceae Bidens pilosa L. 울산도깨비바늘 10 Asteraceae Carduus crispus L. 지느러미엉겅퀴 11 Asteraceae Centaurea cyanus L. 수레국화 12 Asteraceae Conyza canadensis (L.) Cronquist 망초 13 Asteraceae Erigeron floribundus (Kunth) Sch. Bip. 큰망초 14 Asteraceae Coreopsis lanceolata L. 큰금계국 15 Asteraceae Coreopsis tinctoria Nutt. 기생초 16 Asteraceae Cosmos bipinnatus Cav. 코스모스 17 Asteraceae Crassocephalum crepidioides (Benth.) S. Moore 주홍서나물 18 Asteraceae Erechtites hieraciifolius (L.) Raf. ex DC. 붉은서나물 19 Asteraceae Erigeron annuus (L.) Pers. 개망초 20 Asteraceae Erigeron strigosus Muhl. ex Willd. 주걱개망초 21 Asteraceae Galinsoga ciliata (Raf.) S. F. Blake 털별꽃아재비 22 Asteraceae Helianthus tuberosus L. 뚱딴지 23 Asteraceae Hypochaeris radicata L. 서양금혼초 a 24 Asteraceae Lactuca serriola L. 가시상추 a 25 Asteraceae Lapsana communis L. 서양개보리뺑이 26 Asteraceae Rudbeckia bicolor Nutt. 원추천인국 27 Asteraceae Senecio vulgaris L. 개쑥갓 28 Asteraceae Solidago altissima L. 양미역취 a 29 Asteraceae Sonchus asper (L.) Hill 큰방가지똥 30 Asteraceae Tagetes minuta L. 만수국아재비 31 Asteraceae Taraxacum officinale F. H. Wigg. 서양민들레 32 Asteraceae Xanthium orientale L. 큰도꼬마리 33 Asteraceae Xanthium strumarium L. 도꼬마리 34 Brassicaceae Brassica juncea (L.) Czern. 갓 35 Brassicaceae Lepidium virginicum L. 콩다닥냉이 36 Cannabaceae Humulus scandens (Lour.) Merr. 환삼덩굴 ab 37 Caryophyllaceae Cerastium glomeratum Thuill. 유럽점나도나물 38 Chenopodiaceae Atriplex hastata L. 창명아주 39 Chenopodiaceae Chenopodium album L. 흰명아주 40 Chenopodiaceae Chenopodium ficifolium Sm. 좀명아주

10 436 Hyosun LEEM et al. Table 7. Continued. No. Family name Scientific name Korean name 41 Convolvulaceae Cuscuta pentagona Engelm. 미국실새삼 42 Convolvulaceae Ipomoea lacunosa L. 애기나팔꽃 43 Convolvulaceae Ipomoea purpurea (L.) Roth 둥근잎나팔꽃 44 Convolvulaceae Quamoclit angulata (Lam.) Bojer 둥근잎유홍초 45 Euphorbiaceae Euphorbia supina Raf. 애기땅빈대 46 Fabaceae Amorpha fruticosa L. 족제비싸리 47 Fabaceae Medicago minima (L.) Bartal. 좀개자리 48 Fabaceae Medicago polymorpha L. 개자리 49 Fabaceae Medicago sativa L. 자주개자리 50 Fabaceae Robinia pseudoacacia L. 아까시나무 51 Fabaceae Trifolium repens L. 토끼풀 52 Fabaceae Vicia dasycarpa Ten. 각시갈퀴나물 53 Lamiaceae Lamium purpureum L. 자주광대나물 54 Malvaceae Abutilon theophrasti Medik. 어저귀 55 Onagraceae Oenothera biennis L. 달맞이꽃 56 Papaveraceae Papaver rhoeas L. 개양귀비 57 Phytolaccaceae Phytolacca americana L. 미국자리공 58 Plantaginaceae Plantago virginica L. 미국질경이 59 Poaceae Avena fatua L. 메귀리 60 Poaceae Bromus catharticus Vahl 큰이삭풀 61 Poaceae Dactylis glomerata L. 오리새 62 Poaceae Eragrostis curvula (Schrad.) Nees 능수참새그령 63 Poaceae Festuca arundinacea Schreb. 큰김의털 64 Poaceae Vulpia myuros (L.) C. C. Gmel. 들묵새 65 Poaceae Lolium multiflorum Lam. 쥐보리 66 Poaceae Panicum dichotomiflorum Michx. 미국개기장 67 Poaceae Paspalum dilatatum Poir. 큰참새피 68 Polygonaceae Fallopia dentatoalata (F. Schmidt) Holub 큰닭의덩굴 69 Polygonaceae Fallopia dumetorum (L.) Holub 닭의덩굴 70 Polygonaceae Persicaria orientalis (L.) Spach 털여뀌 71 Polygonaceae Rumex acetosella L. 애기수영 a 72 Polygonaceae Rumex crispus L. 소리쟁이 73 Polygonaceae Rumex obtusifolius L. 돌소리쟁이 74 Saururaceae Houttuynia cordata Thunb. 약모밀 75 Scrophulariaceae Lindernia dubia (L.) Pennell 미국외풀 76 Scrophulariaceae Veronica arvensis L. 선개불알풀 77 Scrophulariaceae Veronica hederifolia L. 눈개불알풀 78 Scrophulariaceae Veronica persica Poir. 큰개불알풀 79 Simaroubaceae Ailanthus altissima (Mill.) Swingle 가죽나무 80 Solanaceae Solanum americanum Mill. 미국까마중 a Ecosystem disturbance plant b Wild plant

11 Flora of vascular plants of Byeonsanbando National Park 437 Fig. 4. The distribution map of naturalized plants and ecosystem disturbance plants in Byeonsanbando National Park. 2013). 출현빈도가 높은 곳은 해변로 및 도로 경계부와 주 거지 및 농경지, 임도변, 저지대의 탐방로 주변으로 확인 되었다(Fig. 4). 생태계교란야생식물(Ministry of Environment, 2019)에 해당되는 식물로는 가시상추(Lactuca serriola L.), 돼지풀 (Ambrosia artemisiifolia L.), 미국쑥부쟁이[Symphyotrichum pilosum (Willd.) G. L. Nesom], 서양금혼초(Hypochaeris radicata L.), 양미역취(Solidago altissima L.), 애기수영 (Rumex acetosella L.), 환삼덩굴[Humulus scandens (Lour.) Merr.] 등 7종이 확인되었다(Fig. 4, Table 7). 가시상추는 내 소사 주차장 입구, 변산해수욕장, 새만금교 인근에 비교 적 큰 군락을 이루고 있었고, 돼지풀은 가는골저수지, 청 림제, 내변산로, 새만금교 등 저수지 및 도로변 곳곳에 불 연속적으로 산생하고 있었다. 미국쑥부쟁이는 고사포해 변, 서양금혼초는 채석강(격포리), 애기수영은 내변산로 (중계리)에서 소규모 군락을 확인하였다. 양미역취는 밀 원식물로 도입되어 전라북도 지역에 비교적 넓게 퍼져있 는 생태계교란종으로 공원 구역 곳곳과 인접 지역인 변산 해수욕장 및 보안면 남포리 일대에서 확인되었으며, 특히 보안면(남포리)의 만석동 마을 주변에 큰 군락을 형성하 고 있었다. 따라서 공원 지역을 비롯한 인접 지역의 확산 방지를 위하여 각각의 생육특성 및 생리학적 특성 파악을 통하여 종자산포 이전에 적극적인 방제 조치를 취해야 할 것이다. 유용식물 산림청의 자원식물 구분에 따르면(Korea Forest Service, 2014), 식용 503분류군, 약용 631분류군, 향료용 30분류군, 산업용 326분류군, 관상용 425분류군, 생태복원용 330분 류군, 사료 및 퇴비용 331분류군으로 각각 파악되었으며, 중복된 항목을 제외하면 전체의 95%에 육박하는 784분류 군이 이용 가능한 자원식물로 확인되었다. 또한, 54%에 해당하는 447분류군은 예로부터 사용해 왔던 민속식물 (Chung et al., 2013)에 해당되는 것으로 나타났다. 기후변화 취약식물 기후변화 취약 산림식물(Oh et al., 2010; Oh et al., 2013) 에 해당하는 식물은 39분류군으로 확인되었으며, 그중 목

12 438 Hyosun LEEM et al. 본식물은 35 분류군 (89.7%), 초본식물은 4 분류군 (10.3%) 으로나타났다 (Table 8). 북방계식물은복자기 (Acer triflorum Kom.), 전나무 (Abies holophylla Maxim.) 2 분류군 (5.1%) 만이확인되었으며, 남방계식물은개족도리풀, 나 Table 8. The list of the threatened plants for climate change in Byeonsanbando National Park. No. Family name Scientific name Korean name TP 1 Aceraceae Acer palmatum Thunb. 단풍나무 C 2 Aceraceae Acer pseudosieboldianum (Pax) Kom. 당단풍나무 C 3 Aceraceae Acer triflorum Kom. 복자기 N 4 Aquifoliaceae Ilex cornuta Lindl. & Paxton 호랑가시나무 C 5 Aquifoliaceae Ilex crenata Thunb. 꽝꽝나무 S 6 Araliaceae Dendropanax morbiferus H. Lév. 황칠나무 ( 식재 ) S 7 Aristolochiaceae Asarum maculatum Nakai 개족도리풀 S 8 Aspleniaceae Asplenium scolopendrium L. 골고사리 C 9 Asteraceae Dendranthema boreale (Makino) Ling ex Kitam. 산국 C 10 Betulaceae Carpinus laxiflora (Siebold & Zucc.) Blume 서어나무 C 11 Cornaceae Cornus officinalis Siebold & Zucc. 산수유 C 12 Cupressaceae Juniperus chinensis L. 향나무 ( 식재 ) C 13 Cupressaceae Thuja orientalis L. 측백나무 ( 식재 ) C 14 Ericaceae Rhododendron mucronulatum Turcz. 진달래 C 15 Ericaceae Rhododendron schlippenbachii Maxim. 철쭉 C 16 Euphorbiaceae Mallotus japonicus (Thunb.) Müll. Arg. 예덕나무 S 17 Fabaceae Albizia julibrissin Durazz. 자귀나무 C 18 Fabaceae Robinia pseudoacacia L. 아까시나무 C 19 Fagaceae Quercus mongolica Fisch. ex Ledeb. 신갈나무 C 20 Fagaceae Quercus serrata Thunb. 졸참나무 C 21 Ginkgoaceae Ginkgo biloba L. 은행나무 ( 식재 ) C 22 Lauraceae Cinnamomum camphora (L.) J. Presl 녹나무 ( 식재 ) C 23 Lauraceae Lindera obtusiloba Blume 생강나무 C 24 Lauraceae Machilus thunbergii Siebold & Zucc. 후박나무 C 25 Magnoliaceae Magnolia denudata Desr. 백목련 ( 식재 ) C 26 Malvaceae Hibiscus syriacus L. 무궁화 ( 식재 ) C 27 Oleaceae Abeliophyllum distichum Nakai 미선나무 S 28 Oleaceae Forsythia koreana (Rehder) Nakai 개나리 ( 식재 ) C 29 Oleaceae Osmanthus heterophyllus (G. Don) P. S. Green 구골나무 ( 식재 ) S 30 Pinaceae Abies holophylla Maxim. 전나무 N 31 Pinaceae Pinus densiflora Siebold & Zucc. 소나무 C 32 Pittosporaceae Pittosporum tobira (Thunb.) W. T. Aiton 돈나무 S 33 Ranunculaceae Eranthis byunsanensis B. Y. Sun 변산바람꽃 S 34 Rosaceae Prunus sargentii Rehder 산벚나무 C 35 Sabiaceae Meliosma myriantha Siebold & Zucc. 나도밤나무 S 36 Salicaceae Salix gracilistyla Miq. 갯버들 C 37 Sapindaceae Koelreuteria paniculata Laxmann 모감주나무 ( 식재 ) C 38 Theaceae Camellia japonica L. 동백나무 ( 식재 ) C 39 Verbenaceae Callicarpa mollis Siebold & Zucc. 새비나무 S TP, threatened plants for climate change (C, concern; N, northern race; S, southern race)

13 Flora of vascular plants of Byeonsanbando National Park 439 도밤나무, 돈나무 [Pittosporum tobira (Thunb.) W. T. Aiton], 변산바람꽃, 새비나무 (Callicarpa mollis Siebold & Zucc.), 예덕나무 [Mallotus japonicus (L. f.) Müll.Arg.] 등 10 분류군 (25.6%) 이확인되었다. 이중예덕나무, 나도밤나무와새비나무는조사구역내산림지역에서흔하게출현하였다. 관심식물로는골고사리, 당단풍나무 [Acer pseudosieboldianum (Pax) Kom.], 자귀나무 (Albizia julibrissin Durazz.), 진달래 (Rhododendron mucronulatum Turcz.), 철쭉 (Rhododendron schlippenbachii Maxim.), 호랑가시나무 (Ilex cornuta Lindl. & Paxton), 후박나무 (Machilus thunbergii Siebold & Zucc.) 등 27 분류군 (69.2%) 으로나타났으며, 골고사리를제외한나머지종들은조사지역내에서매우흔하게관찰되었다. 도청리의호랑가시나무군락과격포리의후박나무군락은천연기념물제 122 호와제 123 호로지정하여보호하고있다. 선행연구와의비교본조사결과와변산반도국립공원의선행연구 (Jeom, 1990; Sun et al., 1995; Oh, 1999; Sun and Baek, 2001; Im and Hong, 2006; Oh and Beon, 2009; Oh et al., 2013) 결과를취합하여비교 검토하였다. 취합된목록을국가표준식물목록 (Korea National Arboretum, 2017) 과국가생물종목록 (National Institute of Biological Resources, 2019) 등에준하여정리한결과총 148과 571속 1,127종 5아종 129변종 20 품종의총 1,281분류군으로집계되었다. 기존의식물목록에기록되지않은식물은 67과 151속 168종 3아종 14변종 1품종의 186분류군으로확인되었으며, 이번조사에서새로이확인된분류군은관속식물목록 (Appendix 1) 의일련번호앞에 로표시하였다. 이중이번조사에서처음으로확인된적색자료집식물에는금털고사리, 나도수정초, 모새달, 새박, 새우난초등이관찰되었고, 고유식물로는나래완두 (Vicia hirticalycina Nakai), 넓은잎각시붓꽃 (Iris rossii Baker var. latifolia J. K. Sim & Y. S. Kim), 변산향유등이분포하는것을확인하였다. 그외에도식물구계학적특정식물인갯까치수염 (Lysimachia mauritiana Lam.), 노랑어리연꽃 [Nymphoides peltata (S. G. Gmel.) Kuntze], 부채괴불이끼, 선메꽃 [Calystegia dahurica (Herb.) Choisy], 세뿔석위 [Pyrrosia hastata (Houtt.) Ching], 어리연꽃, 애기일엽초 [Lepisorus onoei (Franch. & Sav.) Ching], 옥녀꽃대 [Chloranthus fortunei (A. Gray) Solms], 치자풀, 큰옥매듭풀 (Polygonum bellardii All.) 등 47분류군이새로발견되었다. 이번조사에서기존문헌에기록되어있지만확인하지못한식물은 92과 279속 385종 1아종 40변종 13품종의 439분류군으로집계되었다. 이중멸종위기식물인매화마름과끈끈이귀개 (Drosera peltata Thunb. var. nipponica (Masam.) Ohwi ex E. Walker) 의경우, 매화마름자생지는대항리바닷가인근의논둑에서발견 (Sun and Baek, 2001) 되었으나현재도로개발로훼손된상태이며, 변산해수욕장에조성된대체서식지에서도식물체를확인할수없었다. 수중종자산 포와더불어끊어진줄기의마디로번식하는매화마름의생존전략으로미루어볼때주변논경작지를상세히조사한다면추가적인자생지를발견할가능성도있을것으로판단된다. 끈끈이귀개도기존의자생지 (Sun and Baek, 2001) 에서는확인할수없었으며, 생육지환경의변화와주변의개발로인해절멸된것으로판단된다. 그외에도환경부적색자료집식물중위기종 (EN) 에해당하는승마 [Actaea heracleifolia (Kom.) J. Compton], 취약종 (VU) 에해당하는산개나리 [Forsythia saxatilis (Nakai) Nakai], 솔잎가래 (Potamogeton pectinatus L.), 꼬마은난초 (Cephalanthera subaphylla Miyabe & Kudô), 애기사철란 [Goodyera repens (L.) R. Br.], 관심대상종 (LC) 에해당하는수정난풀 (Monotropa uniflora L.), 개쓴풀 [Swertia diluta var. tosaensis (Makino) H. Hara], 말나리 (Lilium distichum Nakai ex Kamib.), 왕둥굴레 [Polygonatum robustum (Korsh.) Nakai], 흰제비란 (Platanthera hologlottis Maxim.), NT 에해당하는백작약 [Paeonia japonica (Makino) Miyabe & Takeda], 채고추나물 (Hypericum attenuatum Fisch. ex Choisy), 흑삼릉 [Sparganium stoloniferum (Graebn.) Buch.-Ham. ex Juz.], 큰방울새란 (Pogonia japonica Rchb. f.) 등이기존문헌목록에기록되어있으나, 이번조사에서는확인하지못하였다. 이중왕둥굴레의경우울릉도의제한된지역에서기록이확인된종으로서재확인이필요할것으로판단된다 (Jang, 2002). 실제분포가의심스러운종으로는강원도이북, 태백산, 주왕산등으로기록되어있는노랑갈퀴 (Vicia chosenensis Ohwi), 경기및강원북부지역에자생하는산토끼고사리 [Gymnocarpium jessoense (Koidz.) Koidz.], 북방계식물인이삭바꽃 (Aconitum kusnezoffii Rchb.), 갈매나무 (Rhamnus davurica Pall.), 매자나무 (Berberis koreana Palib.) 등이이에해당한다 (Flora of Korea Editorial Committee 2007; Oh et al., 2016). ORCID: Hyosun LEEM Seahee HAN Hyun-Do JANG Yoon-Young KIM Soonku SO Acknowledgments The authors deeply thank to Mr. N. Y. Kim for providing the information and photographs of plants. This work was supported by a grant from Natural resource survey in Byeonsanbando National Park in 2018 of Korea National Park Research Institute (no NPRI ). Conflict of Interest The authors declare that there are no conflics of interest.

14 440 Hyosun LEEM et al. Literature Cited Cho, Y. H., J. H. Kim and S. H. Park Grasses and Sedges in South Korea. Geobook, Seoul, 527 pp. (in Korean) Choi, C., K. Han, J. Lee, S. So, Y. Hwang and M. Kim A new species of Elsholtzia (Lamiaceae): E. byeonsanensis M. Kim. Korean Journal of Plant Taxonomy 42: (in Korean) Christenhusz, M. J. M., X.-C. Zhang and H. Schneider A linear sequence of extant families and genera of lycophytes and ferns. Phytotaxa 19: Chung, G. Y., K. S. Chang, J.-M. Chung, H. J. Choi, W.-K. Paik and J.-O. Hyun A checklist of endemic plants on the Korean Peninsula. Korean Journal of Plant Taxonomy 47: (in Korean) Chung, J. M., G. W. Park, H. R. Jeong, S. K. So, H. J. Kim, K. Choi, C. H. Lee, C. H. Shin and S. S. Kim Ethnobotany in Korea: The Traditional Knowledge and Use of Indigenous Plants. Korea National Arboretum, Pocheon, 1276 pp. (in Korean) Cultural Heritage Administration Cultural heritage search. Retrieved Dec. 5, 2019, available from Flora of Korea Editorial Committee The Genera of Vascular Plants of Korea. Academy Publishing Co., Seoul, 1482 pp. (in Korean) Im, H.-T. and H. H. Hong The 3rd National Natural Environment Survey. Flora of Mapo Vicinage: Ssangseonbong. National Institute of Environmental Research, Incheon, 12 pp. (in Korean) Jang, C.-G A taxonomic review of Korean Polygonatum (Ruscaceae). Korean Journal of Plant Taxonomy 32: (in Korean) Jang, H.-D., H. Leem, S. Han and S. So Floristic study of Juwangsan National Park in Korea. Korean Journal of Plant Resources 32: (in Korean) Jeom, H. Y Flora of Pyonsan Peninsula in Buan. MS thesis, Wonkwang University, Iksan, Korea, 43 pp. (in Korean) Kim, C. H., M. O. Moon, J. K. Ahn, I. C. Hwang, S. H. Lee, S. S. Choi, J. H. Lee, H. M. Bum, C. G. Kim and J. Y. Cha Floristics Target Species in Korea. National Institute of Ecology, Seocheon, 728 pp. (in Korean) Kim, D.-K. and J.-H. Kim A new natural habitat of Abeliophyllum distichum Nakai. Korean Journal of Plant Taxonomy 38: (in Korean) Kim, J. S. and T. Y. Kim Woody Plants of Korea Peninsula. Dolbegae, Paju, 688 pp. (in Korean) Kim, M A taxonomic review of Korean Lycoris (Amaryllidaceae). Korean Journal of Plant Taxonomy 34: (in Korean) Kim, Y.-Y., H. Leem, S. Han, S.-J. Ji and S. So Conservation measures and distribution of vulnerable species for climate change in Gayasan National Park. Korean Journal of Plant Resources 30: (in Korean) Korea Forest Service The Assessment for Vascular Plant Resources and the Reclassification of Their Usefulness from Korea. Korea Forest Service, Daejeon, Pp (in Korean) Korea Meteorological Administration Climate statistical analysis. Retrieved Dec. 5, 2019, available from Korea National Arboretum Checklist of Vascular Plants in Korea. Korea National Arboretum, Pocheon, 1,000 pp. (in Korean) Korean Fern Society Ferns and Fern Allies of Korea. Geobook, Seoul, 399 pp. (in Korean) Lee, C. S. and K. H. Lee Pteridophytes of Korea: Lycophytes and Ferns. Geobook, Seoul, 471 pp. (in Korean) Lee, T. B Coloured Flora of Korea, Vol. I, II. Hyangmunsa, Seoul, Vol. I, 914 pp, Vol. II, 910 pp. (in Korean) Lee, W. T Coloured Standard Illustrations of Korean Plants. Academy Publishing Co., Seoul, 624 pp. (in Korean) Lee, W. T. and B. S. Kil The investigation on natural growth region of Abeliophyllum distichum Nakai. Korean Journal of Plant Taxonomy 21: 1 8. (in Korean) Lee, W. T. and Y. J. Yim Plant Geography with Special Reference to Korea. Kangwon National University Press, Chuncheon, 412 pp. (in Korean) Lee, Y.-M., S.-H. Park, S.-Y. Jung, S.-H. Oh and J.-C. Yang Study on the current status of naturalized plants in South Korea. Korean Journal of Plant Taxonomy 41: (in Korean) Leem, H. and B.-U. Oh Taxonomy of Korean Asarum (Aristolochiaceae) by the morphological characters. Korean Journal of Plant Resources 32: (in Korean) Lim, K. B. and K. J. Lee An Introduction to Forestry. Hyangmunsa, Seoul, 393 pp. (in Korean) Ministry of Environment Wildlife protection and management. Retrieved Dec. 5, 2019, available from Ministry of Environment Appoint notice of ecosystem disturbance wild plant. Retrieved Dec. 9, 2019, available from National Institute of Biological Resources Red Data Book of Endangered Vascular Plants in Korea. National Institute of Biological Resources, Incheon, 391 pp. (in Korean) National Institute of Biological Resources Endemic Species of Korea. National Institute of Biological Resources, Incheon, 912 pp. (in Korean) National Institute of Biological Resources National list of

15 Flora of vascular plants of Byeonsanbando National Park 441 species of Korea. Retrieved Dec. 5, 2019, available from Nakai, T Plantae novae Coreanae et Japonicae I. The Botanical Magazine Tokyo 28: (in Japanese) Numata, M Naturalized Plants. Dai Nippon Printing Co., Tokyo, 160 pp. (in Japanese) Oh, B.-U., D. G. Jo, S. C. Ko, B. H. Choi, W.-K. Park, G. Y. Chung, Y. M. Lee and C.-G. Jang Target Plants Adaptable to Climate Change in the Korean Peninsula. Korea Forest Service and Korea National Arboretum, Pocheon, 492 pp. (in Korean) Oh, B.-U., S. C. Ko, S. H. Kang, W.-K. Baik, K. O. Yoo, H.-T. Im, C.-G. Jang, G. Y. Chung, B. H. Choi, H. J. Choi, Y. M. Lee, C. H. Shin, K. Choi, J. H. Han, S. H. Park, H. J. Kim, G. S. Chang, J. C. Yang, S. Y. Jeong, C. H. Lee, S. H. Oh and D. G. Jo Distribution Maps of Vascular Plants in Korea. Korea Forest Service and Korea National Arboretum, Pocheon, 809 pp. (in Korean) Oh, H.-K Vascular plants distributed in the Iris koreana of Gaeamsa temple and Soeppulbawi rock areas in special protection zones of Byeonsanbando National Park. Journal of Environmental Impact Assessment 26: (in Korean) Oh, H.-K. and M.-S. Beon Analysis on community and flora of Jakeundang in the Byeonsanbando National Park. Korean Journal of Environment and Ecology 23: (in Korean) Oh, H.-K., Y.-H. Han, J.-H. Lee and M.-S. Soh. 2011a. The flora of Haseom Island, Byeonsanbando National Park. Journal of National Park Research 2: (in Korean) Oh, H. K., Y. H. Han and K. U. Park. 2011b. Vegetation present and vascular plants of habitats Lycoris flavescens M. Y. Kim et S. T. Lee and Iris koreana Nakai, Byeonsanbando. Journal of Agriculture and Life Sciences 42: (in Korean) Oh, H. K., Y. H. Han and K. W. Park Resource Monitering of Byeonsanbando National Park: Habitat Survey of the Specific Plants. Korea National Park Service, Byeonsanbando National Park Office, Buan, 388 pp. (in Korean) Oh, H.-K., S.-K. Park and J.-Y. Yang The flora of the Sojeokgol in Byunsan Peninsula. Journal of the Korean Society of Plant and Environmental Design 4: (in Korean) Oh, J. G Natural Resource Survey in Byeonsanbando National Park: Flora. Korea National Park Research Institute, Namwon. Pp (in Korean) Oh, S. H., Y. M. Lee, J. C. Yang, J. W. Jang, J. G. Byeon, J. E. Yun, B. D. Kim, C. H. Bae, J. S. Sim, C. H. Lee, G. Y. Lee, J. M. Park, C. J. Oh, J. S. Sin and D. S. Kim Manual of Conservation Project of Threatened Plants for Climate Change. Korea National Arboretum, Pocheon, 243 pp. (in Korean) Oh, Y. C. and C. S. Lee Flora of Korean Pteridophyta II. Sungshin Women's University Research Collection of Dissertations 32: (in Korean) Park, M. K Keys to the Herbaceous Plants in Korea (Dicotyledoneae). Jeongeumsa, Seoul. P (in Korean) Park, S. H New Illustrations and Photographs of Naturalized Plants of Korea. Ilchokak, Seoul, 575 pp. (in Korean) Park, S. H., Y. M. Lee, S. Y. Jung, K. S. Chang, W. C. Kang, S. S. Jung, S. H. Oh and J. C. Yang Illustrated Grasses of Korea (Revised and Enlarged Edition). Korean National Arboretum, Pocheon, 600 pp. (in Korean) Park, S. H., Y. M. Lee, J. C. Yang, D. G. Jo, G. H. Lee, C. S. Jang, H. J. Lee, H. J. Choi, S. S. Jung and J. H. Lee Illustrated Pteridophytes of Korea. Korea National Arboretum, Pocheon, 547 pp. (in Korean) So, S., H.-H. Myeong, E.-K. Kim, S. H. Kang, J.-H. Lee and J.-G. Oh Status on the Korean Red List of Threatened Species in Korea National Park. Journal of National Park Research 7: (in Korean) Sun, B. Y. and T. G. Baek The 2nd National Natural Environment Survey: Flora of Mt. Uisangbong (Buan) and Its Vicinage. National Institute of Environmental Research, Incheon. Pp (in Korean) Sun, B. Y., C. H. Kim and T. J. Kim A new species of Eranthis (Ranunculaceae) from Korea: E. byunsanensis. Korean Journal of Plant Taxonomy 23: (in Korean) Sun, B. Y., C. H. Kim and J. S. Suh Flora of Pyonsan Peninsula National Park. Bulletin of the Korean Association for Conservation of Nature 34: (in Korean) Tho, J.-H., K.-H. Tae, J. Lee and J. H. Kim An unrecorded species in Korea: Monochasma sheareri (S. Moore) maxim, ex Franch. Et Sav. (Scrophulariaceae). Journal of Plant Biology 49: Yang, H. S., J. H. Jung and J. S. Kim Natural Resource Survey in Byeonsanbando National Park: Flora. Korea National Park Research Institute, Namwon. Pp (in Korean) Yim, Y. J. and E. S. Jeon Distribution of naturalized plants in the Korean peninsula. Korean Journal of Botany 23: (in Korean) Yu, J Cultural exclusion and negative perception related to naturalized plants derived from academic discussion. Journal of the Korea Society of Environmental Restoration Technology 16: (in Korean) Yuk, K. S. and D. M. Park Natural Resource Survey in Byeonsanbando National Park: The General Status. Korea National Park Research Institute, Wonju. Pp (in Korean) Yonekura, K. and T. Kajita Y List. Retrieved Apr. 25, 2020, available from

16 442 Hyosun LEEM et al. 변산반도국립공원의관속식물상 임효선 한세희 1 장현도 2 김윤영 3 소순구 4 * 국립백두대간수목원산림복원지원실, 1 국립농업과학원농업유전자원센터, 2 국립생물자원관식물자원과, 3 국립산림품종관리센터품종심사과, 4 국립공원공단국립공원연구원 적요 : 변산반도국립공원을대상으로 2018년도 3월부터 10월까지총 33일에걸쳐조사를수행하였다. 증거표본과사진을바탕으로작성한관속식물은 141과 458속 748종 16아종 59변종 6품종의총 829분류군으로기록되었다. 이중멸종위기식물은노랑붓꽃, 삼백초 ( 식재 ) 등 2분류군이확인되었고, 희귀식물은미선나무, 금털고사리등 5분류군이관찰되었다. 한반도고유식물은붉노랑상사화, 변산향유, 변산바람꽃등 17분류군이조사되었고, 식물구계학적특정식물종은 III V등급에해당하는 52분류군이확인되었다. 귀화식물은총 79 분류군으로생태계교란종은돼지풀, 가시상추, 양미역취등 7분류군이확인되었다. 기후변화취약종은총 39 분류군이분포하였고, 북방계 2분류군, 남방계 10분류군, 관심식물은 27분류군으로확인되었다. 기존조사에서는확인되지않았으나, 본조사를통해새롭게밝혀진분류군은 186분류군이었다. 주요어 : 변산반도국립공원, 식물상, 멸종위기및희귀식물, 특산식물, 귀화식물

17 Flora of vascular plants of Byeonsanbando National Park 443 Appendix 1. The list of vascular plants of Byeonsanbando National Park including voucher specimens ( : newly recorded plant in this study, *: planted or cultivated plant) LYCOPODIACEAE 석송과 1. Huperzia serrata (Thunb.) Trevis. 뱀톱 BS_ Lycopodium clavatum L. 석송 BS_ SELAGINELLACEAE 부처손과 3. Selaginella tamariscina (P. Beauv.) Spring 바위손 BS_ EQUISETACEAE 속새과 4. Equisetum arvense L. 쇠뜨기 BS_ OPHIOGLOSSACEAE 고사리삼과 5. Botrychium ternatum (Thunb.) Sw. 고사리삼 BS_ OSMUNDACEAE 고비과 6. Osmunda japonica Thunb. 고비 BS_ HYMENOPHYLLACEAE 처녀이끼과 7. Crepidomanes minutum (Blume) K. Iwats. 부채괴불이끼 BS_ DENNSTAEDTIACEAE 잔고사리과 8. Pteridium aquilinum (L.) Kuhn var. latiusculum (Desv.) Underw. ex A. Heller 고사리 BS_ PTERIDACEAE 봉의꼬리과 9. Coniogramme japonica (Thunb.) Diels 가지고비고사리 BS_ ASPLENIACEAE 꼬리고사리과 10. Asplenium incisum Thunb. 꼬리고사리 BS_ Asplenium scolopendrium L. 골고사리 BS_ Asplenium varians Wall. ex Hook. & Grev. 애기꼬리고사리 BS_ THELYPTERIDACEAE 처녀고사리과 13. Parathelypteris glanduligera (Kunze) Ching 사다리고사리 BS_ Parathelypteris japonica (Baker) Ching 지네고사리 BS_ ATHYRIACEAE 개고사리과 15. Athyrium niponicum (Mett.) Hance 개고사리 BS_ Diplazium squamigerum (Mett.) C. Hope 내장고사리 BS_ HYPODEMATIACEAE 금털고사리과 17. Hypodematium glanduloso-pilosum (Tagawa) Ohwi 금털고사리 BS_ DRYOPTERIDACEAE 관중과 18. Cyrtomium falcatum (L.f.) C. Presl 도깨비쇠고비 BS_ Cyrtomium fortunei J.Sm. 쇠고비 BS_ Dryopteris chinensis (Baker) Koidz. 가는잎족제비고사리 BS_ Dryopteris lacera (Thunb.) Kuntze 비늘고사리 BS_ Dryopteris setosa (Thunb.) Akasawa 산족제비고사리 BS_ Dryopteris uniformis (Makino) Makino 곰비늘고사리 BS_ Polystichum tripteron (Kunze) C. Presl 십자고사리 BS_ DAVALLIACEAE 넉줄고사리과 25. Davallia mariesii T. Moore ex Baker 넉줄고사리 BS_ POLYPODIACEAE 고란초과 26. Lepisorus onoei (Franch. & Sav.) Ching 애기일엽초 BS_ Lepisorus ussuriensis (Regel & Maack) Ching 산일엽초 BS_ Pyrrosia hastata (Houtt.) Ching 세뿔석위 BS_ Pyrrosia linearifolia (Hook.) Ching 우단일엽 BS_ GINKGOACEAE 은행나무과 30. Ginkgo biloba L. 은행나무 * BS_ PINACEAE 소나무과 31. Abies holophylla Maxim. 전나무 BS_ Cedrus deodara (Roxb. ex D. Don) G. Don 개잎갈나무 * BS_ Pinus densiflora Siebold & Zucc. 소나무 BS_ Pinus thunbergii Parl. 곰솔 BS_ CUPRESSACEAE 측백나무과 35. Chamaecyparis obtusa (Siebold & Zucc.) Endl. 편백 * BS_ Cryptomeria japonica (Thunb. ex L.f.) D. Don 삼나무 * BS_ Juniperus chinensis L. 향나무 * BS_ Juniperus rigida Siebold & Zucc. 노간주나무 BS_ Metasequoia glyptostroboides Hu & W. C. Cheng 메타세쿼이아 * BS_ Platycladus orientalis (L.) Franco 측백나무 * BS_ Thuja occidentalis L. 서양측백 * BS_ JUGLANDACEAE 가래나무과 42. Juglans regia L. 호두나무 * BS_ Platycarya strobilacea Siebold & Zucc. 굴피나무 BS_ SALICACEAE 버드나무과 44. Populus alba L. 은백양 * BS_ Populus deltoides Marsh. 미류나무 * BS_ Populus nigra L. 양버들 * BS_ Populus tomentiglandulosa T.B.Lee 은사시나무 * BS_ Salix babylonica L. 수양버들 * BS_ Salix gracilistyla Miq. 갯버들 BS_ Salix pierotii Miq. 버드나무 BS_ Salix pseudolasiogyne H. Lév. 능수버들 * BS_ BETULACEAE 자작나무과 52. Alnus firma Siebold & Zucc. 사방오리 * BS_ Alnus incana (L.) Moench subsp. hirsuta (Turcz. ex Spach) Á. Löve & D. Löve 물오리나무 BS_ Carpinus cordata Blume 까치박달 BS_ Carpinus laxiflora (Siebold & Zucc.) Blume 서어나무 BS_ Carpinus turczaninowii Hance 소사나무 BS_ Corylus heterophylla Fisch. ex Trautv. 난티잎개암나무 BS_ Corylus sieboldiana Blume var. mandshurica (Maxim.) C. K. Schneid. 물개암나무 BS_ FAGACEAE 참나무과 59. Castanea crenata Siebold & Zucc. 밤나무 * BS_ Castanea mollissima Blume 약밤나무 * BS_ Quercus acutissima Carruth. 상수리나무 BS_ Quercus aliena Blume 갈참나무 BS_ Quercus dentata Thunb. 떡갈나무 BS_ Quercus mongolica Fisch. ex Ledeb. 신갈나무 BS_ Quercus serrata Murray 졸참나무 BS_ Quercus variabilis Blume 굴참나무 BS_ ULMACEAE 느릅나무과 67. Celtis biondii Pamp. 폭나무 BS_ Celtis sinensis Pers. 팽나무 BS_ Hemiptelea davidii (Hance) Planch. 시무나무 * BS_ Zelkova serrata (Thunb.) Makino 느티나무 BS_ EUCOMMIACEAE 두충과 71. Eucommia ulmoides Oliv. 두충 * BS_ MORACEAE 뽕나무과 72. Broussonetia kazinoki Siebold ex Siebold & Zucc. 애기닥나무 BS_ Broussonetia papyrifera (L.) L'Hér. ex Vent. 꾸지나무 BS_

18 444 Hyosun LEEM et al. 74. Broussonetia hanjiana M. Kim 닥나무 BS_ Cudrania tricuspidata (Carrière) Bureau ex Lavallée 꾸지뽕나무 BS_ Fatoua villosa (Thunb.) Nakai 뽕모시풀 BS_ Ficus carica L. 무화과나무 * BS_ Morus alba L. 뽕나무 * BS_ Morus australis Poir. 산뽕나무 BS_ CANNABACEAE 삼과 80. Humulus scandens (Lour.) Merr. 환삼덩굴 BS_ URTICACEAE 쐐기풀과 81. Achudemia japonica Maxim. 산물통이 BS_ Boehmeria japonica (L. f.) Miq. 왜모시풀 BS_ Boehmeria nivea (L.) Gaudich. 모시풀 * BS_ Boehmeria pannosa Nakai & Satake ex Oka 왕모시풀 BS_ Boehmeria platanifolia (Franch. & Sav.) C.H.Wright 개모시풀 BS_ Boehmeria spicata (Thunb.) Thunb. 좀깨잎나무 BS_ SANTALACEAE 단향과 87. Thesium chinense Turcz. 제비꿀 BS_ POLYGONACEAE 마디풀과 88. Fagopyrum esculentum Moench 메밀 * BS_ Fallopia dentatoalata (F. Schmidt) Holub 큰닭의덩굴 BS_ Fallopia dumetorum (L.) Holub 닭의덩굴 BS_ Fallopia multiflora (Thunb.) Haraldson 하수오 * BS_ Persicaria dissitiflora (Hemsl.) H. Gross ex T. Mori 가시여뀌 BS_ Persicaria filiformis (Thunb.) Nakai ex T. Mori 이삭여뀌 BS_ Persicaria hydropiper (L.) Delarbre 여뀌 BS_ Persicaria lapathifolia (L.) Delarbre 흰여뀌 BS_ Persicaria longiseta (Bruijn) Kitag. 개여뀌 BS_ Persicaria muricata (Meisn.) Nemoto 넓은잎미꾸리낚시 BS_ Persicaria orientalis (L.) Spach 털여뀌 BS_ Persicaria perfoliata (L.) H. Gross 며느리배꼽 BS_ Persicaria posumbu (Buch. Ham. ex D. Don) H. Gross 장대여뀌 BS_ Persicaria sagittata (L.) H. Gross 미꾸리낚시 BS_ Persicaria senticosa (Meisn.) H. Gross ex Nakai 며느리밑씻개 BS_ Persicaria thunbergii (Siebold & Zucc.) H. Gross 고마리 BS_ Persicaria vulgaris Webb & Moq. 봄여뀌 BS_ Polygonum aviculare L. 마디풀 BS_ Polygonum bellardii All. 큰옥매듭풀 BS_ Rumex acetosella L. 애기수영 BS_ Rumex crispus L. 소리쟁이 BS_ Rumex japonicus Houtt. 참소리쟁이 BS_ Rumex obtusifolius L. 돌소리쟁이 BS_ PHYTOLACCACEAE 자리공과 111. Phytolacca americana L. 미국자리공 BS_ MOLLUGINACEAE 석류풀과 112. Mollugo pentaphylla L. 석류풀 BS_ AIZOACEAE 번행초과 113. Tetragonia tetragonioides (Pall.) Kuntze 번행초 BS_ PORTULACACEAE 쇠비름과 114. Portulaca oleracea L. 쇠비름 BS_ CARYOPHYLLACEAE 석죽과 115. Arenaria serpyllifolia L. 벼룩이자리 BS_ Cerastium glomeratum Thuill. 유럽점나도나물 BS_ Cerastium holosteoides Fr. var. hallaisanense (Nakai) Mizush. 점나도나물 BS_ Dianthus barbatus L. var. asiaticus Nakai 수염패랭이꽃 * BS_ Gypsophila oldhamiana Miq. 대나물 BS_ Pseudostellaria heterophylla (Miq.) Pax 개별꽃 BS_ Sagina maxima A. Gray 큰개미자리 BS_ Silene aprica Turcz. var. oldhamiana (Miq.) C. Y. Wu 갯장구채 BS_ Spergularia marina (L.) Besser 갯개미자리 BS_ Stellaria aquatica (L.) Scop. 쇠별꽃 BS_ Stellaria media (L.) Vill. 별꽃 BS_ Stellaria uliginosa Murray 벼룩나물 BS_ CHENOPODIACEAE 명아주과 127. Atriplex hastata L. 창명아주 BS_ Atriplex subcordata Kitag. 갯는쟁이 BS_ Chenopodium acuminatum Willd. subsp. virgatum (Thunb.) C.H.Blom 버들명아주 BS_ Chenopodium album L. 흰명아주 BS_ Chenopodium album L. var. centrorubrum Makino 명아주 BS_ Chenopodium ficifolium Sm. 좀명아주 BS_ Kochia scoparia (L.) Schrad. var. littorea Makino 갯댑싸리 BS_ Salicornia europaea L. 퉁퉁마디 BS_ Salsola kali L. subsp. ruthenica (Iljin) Soó 나래수송나물 BS_ Salsola komarovii Iljin 수송나물 BS_ Suaeda australis (R.Br.) Moq. 방석나물 BS_ Suaeda glauca (Bunge) Bunge 나문재 BS_ Suaeda japonica Makino 칠면초 BS_ Suaeda maritima (L.) Dumort. 해홍나물 BS_ AMARANTHACEAE 비름과 141. Achyranthes bidentata Blume 털쇠무릎 BS_ Achyranthes bidentata Blume var. japonica Miq. 쇠무릎 BS_ Amaranthus blitum L. subsp. oleraceus (L.) Costea 개비름 BS_ Amaranthus retroflexus L. 털비름 BS_ Amaranthus tricolor L. 비름 BS_ Amaranthus viridis L. 청비름 BS_ MAGNOLIACEAE 목련과 147. Magnolia denudata Desr. 백목련 * BS_ Magnolia grandiflora L. 태산목 * BS_ Magnolia obovata Thunb. 일본목련 * BS_ LAURACEAE 녹나무과 150. Cinnamomum camphora (L.) J. Presl 녹나무 * BS_ Lindera erythrocarpa Makino 비목나무 BS_ Lindera glauca (Siebold & Zucc.) Blume 감태나무 BS_ Lindera obtusiloba Blume 생강나무 BS_ Machilus thunbergii Siebold & Zucc. 후박나무 BS_ RANUNCULACEAE 미나리아재비과 155. Aconitum jaluense Kom. 투구꽃 BS_ Aconitum longecassidatum Nakai 흰진범 BS_ Actaea asiatica H. Hara 노루삼 BS_ Adonis pseudoamurensis W. T. Wang 개복수초 BS_ Anemone raddeana Regel 꿩의바람꽃 BS_ Clematis apiifolia DC. 사위질빵 BS_

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

조경식재학 - 식재재료(2) -

조경식재학 - 식재재료(2) - 조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

조경식물학 - 활엽수 계열(3) -

조경식물학 - 활엽수 계열(3) - 조경식물학 - 활엽수계열 (2) - 1. 서부해당화 음양성 : 양수 서부해당화 Malus prunifolia 성상 : 낙엽활엽소교목 수형 : 구형 번식 : 실생 / 접목 적색의꽃, 적색열매가아름다움 기조, 강조식재 2. 마가목 음양성 : 음수 마가목 Sorbus commixta 수형 : 타원형 이식 : 어려움 전정 : 보통 번식 : 실생 / 접목 / 취목 흰색꽃과적색열매가아름다움

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

7(3)-03.fm

7(3)-03.fm w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

05(김창석)p fm

05(김창석)p fm Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

2011국립공원표지-수정

2011국립공원표지-수정 KOREA NATIONAL PARK SERVICE For the nature as it is, for the future generations Tel : 02-3279-2700, 02-3279-2701 Fax: 02-3278-2785~6 E-mail: webmaster@knps.or.kr www.knps.or.kr About This Reports Contents

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

401.fm

401.fm Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department

More information

차례

차례 차례 표차례 優占度階級 群度階級 그림차례 - 1 - - 2 - - 3 - 표 2. 優占度階級 (Braun-Blanquet, 1964) 5 : 표본구면적의 3/4이상을덮고, 개체수는임의 4 : 1/2-3/4을덮고, 3 : 1/4-1/2을덮고, 2 : 개체수는많으나被度가낮다혹은산재하나被度는높다 ( 단1/10이다 ). + : 被度는낮고散在 r : 고립하여출현하고被度는극히낮다.

More information

옥천 일대의 지형

옥천  일대의  지형 1 사가일대의식물 사가 (356121) 일대의식물 - 방문산 - 손현덕 선은미 * 목포자연사박물관 전남대학교 * 요약 1 조사지역내에자생하는관속식물은총 80과 179속 187종 4아종 42변종 7품종의총 240분류군으로나타났다. 2 이지역내에서식하는식물구계학적특정식물종으로는 Ⅳ등급종백양꽃 1분류군, 광릉골무꽃을비롯한 III 등급종 4분류군, II 등급종층꽃나무

More information

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park 이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo 이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

01-Megascolex(dh)

01-Megascolex(dh) Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute

More information

2_11_24 김준수.hwp

2_11_24 김준수.hwp 농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년

More information

옥천 일대의 지형

옥천  일대의  지형 1 진상일대의식물 진상 (357154) 일대의식물상 - 억불봉 - 김휘 박유철 국립목포대학교 요약 1 진상면 (357154) 지역의억불봉 (1,008m) 일대에대한식물상조사에서총 100과 137 속 332분류군으로나타났다. 2 진상면억불봉에서는환경부지정멸종위기종II급인나도승마 (Kirengeshoma koreana Nakai) 를확인할수있었다. 3 환경부식물구계학적특정식물종

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa 3(1): 21~33, 2017. 6. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Park Oh, Hyun-Kyung* Choi, Yoon-Ho** You, Ju-Han*** ABSTRACT

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

04(오영주)p fm

04(오영주)p fm Weed Turf. Sci. 3(4):276~283 http://dx.doi.org/10.5660/wts.2014.3.4.276 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium

More information

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의 Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,

More information

BMYIHXZUOVDO.xls

BMYIHXZUOVDO.xls 1 좌사일대의식물 좌사일대의식물 - 154.5고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 1 조사지역내에자생하는관속식물은 34목 63 과, 142 속, 139 종, 24 변종, 1 품종, 1잡 종의총 168 분류군으로나타났다. 2 식물구계학적특정식물종 IV등급종은비진도콩 1 분류군, III등급종까마귀쪽나무등 6 분류군, II등급종층꽃나무등 1 분류군,

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

fm

fm Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)

More information

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다 한반도난온대지역전남대학교내한약자원및상록활엽식물 함동호 1, 김원호 1, 이지윤 1, 이준성 1, 한은경 2, 조원범 2, 이정현 2* 1. 전남대학교과학영재교육원 2. 전남대학교사범대학생물교육과 The medicinal and evergreen broad leaved plants in Chonnam national university on warm-temperate

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

R hwp

R hwp 목적기초연구 1 * Anticomplement Activities of Korean Indigeneous Plants No. Plant name Srientific name Family Activity(IC50) 98112 해변싸리 Lespedeza martrima 콩과 12.2 96019 지리산오갈피 Acanthopamax chiisanensis

More information

02(이인용)p fm

02(이인용)p fm Weed Turf. Sci. 4(2):85~94 http://dx.doi.org/10.5660/wts.2015.4.2.85 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National

More information

<30322E20BABBB9AEC0FCC3BC2E687770>

<30322E20BABBB9AEC0FCC3BC2E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 목명과명출현종추자 (336021) 도엽특이사항영문한글영문한글학명국명 E1 E2 E5 E6 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella involvens 바위손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium virginianum 늦고사리삼 식물구계학적등급 (Ⅰ)

More information

완료_eri hwp

완료_eri hwp Ecology and Resilient Infrastructure (2015) 2(1): 080-092 http://dx.doi.org/10.17820/eri.2015.2.1.080 http://www.kseie.or.kr/ Online ISSN: 2288-8527 ORIGINAL ARTICLE 외래식물에의한대학교정생태계의교란 Disturbance of Campus

More information

fm

fm Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.

More information

옥천 일대의 지형

옥천  일대의  지형 1 덕곡일대의식물 덕곡 (358014) 일대의식물 - 문수봉 - 김휘 곽지훈 국립목포대학교 요약 1 덕곡면문수봉조사지역에자생하는관속식물은 66 과 155 속 192 분류군으로나타났다 2 덕곡면문수봉에서는환경부지정멸종위기종은확인할수없었다. 특정식물종 5 급은확인되지않았다. 식물구계학적 3 환경부식물구계학적특정식물종 4급으로는선포아풀이있었고 3등급으로는물박달나무다수개체가확인되었다.

More information

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바 도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE

More information

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>

<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770> 훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor

More information

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,

More information

03 .이인용( ).fm

03 .이인용( ).fm Weed Turf. Sci. 5(3):126~135 http://dx.doi.org/10.5660/wts.2016.5.3.126 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both

More information

외떡잎식물 Monocotyledoneae

외떡잎식물 Monocotyledoneae 외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Korean J. Plant Res. 27(2):133-154(2014) http://dx.doi.org/10.7732/kjpr.2014.27.2.133 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 여서도의관속식물상 김선유 1, 윤종학 2, 김진석 1, 김중현 1 * 1 국립생물자원관식물자원과,

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

BTXHINECYMSR.hwp

BTXHINECYMSR.hwp 1 광주 이천소권역일대의식생 광주 이천소권역일대의식생 - 무갑산 양자산 천덕봉 국수봉 - 양금철 신진호 공주대학교건설환경공학부 1. 서론 식생조사는국가의전반적인식생현황을파악하여생태학적으로보전가치가있는식생 자원을찾는데그목적이있다. 생태학적으로보전가치가있는식생자원이라함은희귀 성, 대표성, 전형성을포함하는것으로서자연식생, 극지의입지에남아있는유존식생, 식 생발달에오랜시간이걸리는식생유형을말한다.

More information

A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea

A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Journal of Asia-Pacific Biodiversity Vol. 6, No. 2 281-310, 2013 http://dx.doi.org/10.7229/jkn.2013.6.2.281 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk

More information

03. 이인용2(65-70).fm

03. 이인용2(65-70).fm Weed Turf. Sci. 5(2):65~70 http://dx.doi.org/10.5660/wts.2016.5.2.65 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both formerly

More information

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:

More information

04. 이채영(71-81).fm

04. 이채영(71-81).fm Weed Turf. Sci. 5(2):71~81 http://dx.doi.org/10.5660/wts.2016.5.2.71 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환

년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환 년연구과제요약문 과제명광주광역시자연환경조사연구 -4 차년도 연구기간 2018.5. - 2018.12 사업비 47.5백만원성과산출부분정책반영 ( ), 조사연구 (0), 기술개발 ( ), 기타 ( ) 연구목적및목표 본연구는광주광역시의자연환경의현황을파악하고, 연차적으로자연환경이변화되는과정을추적하고해석하여광주광역시의각자연환경인자별자연환경지표 ( 기준 ) 를미래지향적으로설정하며,

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

fm

fm Korean J. Pl. Taxon. 48(4): 331 356 (2018) https://doi.org/10.11110/kjpt.2018.48.4.331 RESEARCH ARTICLE pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy Floristic study of Jogyesan Mt.

More information

<B8F1C2F72E666D>

<B8F1C2F72E666D> Korean J. Pl. Taxon. 44(2): 136-163 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.2.136 ISSN 1225-8318 Korean Journal of Plant Taxonomy Floristic study of Golji stream watershed in Gangwon province, Korea

More information

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770> 사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교

More information

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit 농업생명과학연구 47(5) pp.83-94 Journal of Agriculture & Life Science 47(5) pp.83-94 울릉도섬현삼의새로운자생지보고및현지내 외보전전략 김수승 1 강기호 2 강신구 1 신현탁 3 조경호 2 김윤영 2 이명섭 2 양병훈 1* 1 산림청, 2 기청산식물원, 3 국립수목원 접수일 (2013 년 7 월 8 일 ), 수정일

More information

101.fm

101.fm Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 김영동 - 태백 목명과명출현종태백 (378164) 도엽특이사항영문한글영문한글학명국명 E8 E9 Lycopodiales 석송문 Lycopodiaceae 석송과 Huperzia selago 좀다람쥐꼬리 식물구계학적등급 (Ⅳ) Lycopodiales 석송문 Lycopodiaceae 석송과 Lycopodium

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

pdf

pdf Invasive Alien Plant Impact on Forest Invasive Alien Plant Impact on Forest 2 Invasive Alien Plant Impact on Forest 4 5 6 7 Contents 4 7 10 10 12 14 21 272 276 278 22 37 39 49 55 61 63 73 77 101 103 107

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

hwp

hwp 습지유형분류및기능평가의배경 / 목적 이론적고찰 습지의개념및정의습지지표습지의생성및발달 습지의유형및특성습지의기능, 이용습지의관리및복원 물영아리오름습지의유형분류기능평가 유형분류기능평가 HGM 습지분류체계 람사습지분류체계 습지분류의재구성 물영아리오름습지유형분류 기능평가모델구축 평가변수 / 지표설정 현장조사 물영아리오름습지평가항목별평가 관리전략기본방향설정 *

More information

(056 김진숙).fm

(056 김진숙).fm 생약학회지 Kor. J. Pharmacogn. 44(4) : 372 378 (2013) 한국약용식물의최종당화산물생성저해활성검색 (XI) 최소진 1 김영숙 1 송유진 1 김주환 2 김진숙 1 * 1 한국한의학연구원한약연구본부한의신약개발그룹, 2 가천대학교생명과학과 Screening of Korean Herbal Medicines with Inhibitory Activity

More information

신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화

신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화 신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화 국명 학명 과명 가래 가래과 고추 가지과 흰독말풀 가지과 독말풀 가지과 사리풀 가지과 구기자나무지골피 가지과 담배 가지과 페츄니아 가지과 꽈리 가지과 미치광이 가지과 배풍등백모등 가지과 가지 가지과 까마중 가지과 토마토 가지과 페츄니아 가지과 갈매나무 갈매나무과 털갈매나무 갈매나무과

More information

<342EB1E8BCBAB9CE2D2E666D>

<342EB1E8BCBAB9CE2D2E666D> 韓藥作誌 (Korean J. Medicinal Crop Sci.) 2(4) : 268 275 (203) ISSN(Print) 225-9306 ISSN(Online) 2288-086 http://www.medicinalcrop.org http://dx.doi.org/0.7783/kjmcs.203.2.4.268 봉화군청옥산에분포하는대한민국약전수재약용식물의분포특성

More information

[00]_목차.hwp

[00]_목차.hwp Korean J. Plant Res. 27(5):518-533(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.518 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 장창석 1, 양선규 1, 장현도 1, 이로영 2, 박민수 3, 김기홍 1, 오병운

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

17(2)-08.fm

17(2)-08.fm ª Ÿ (Korean J. Medicinal Crop Sci.) 17(2) : 125 132 (2009) ù k p ¼ÁÁÁkÁÁÁ½y w ww Ecological Characteristics of the Asparagus cochinchinensis (Lour.) Merr. Population in South Korea Byung Kil Choo, Yunui

More information

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil,

58 Journal of Agriculture & Life Science 46(4) Ⅰ. 서론곰솔 (Pinus thunbergii Parl.) 은바닷가와해풍의 영향이미치는곳에서자생하고있으며, 분포범위는북위 에서 까지분포하고있다 (Kim & Kil, 농업생명과학연구 46(4) pp.57-68 Journal of Agriculture & Life Science 46(4) pp.57-68 경상북도동해안곰솔림의군집구조 천광일 1 정성철 1* 윤호중 1 변준기 2 주성현 3 1 국립산림과학원산림보전부, 2 국립수목원, 3 경북대학교임학과 접수일 년 월 일 수정일 년 월 일 게재확정일 년 월 일 Community

More information

특허청구의 범위 청구항 1 수세미오이, 라벤더, 양파, 천마, 야콘, 곰보배추, 꾸지뽕, 작약, 바질, 사위질빵, 엄나무, 쑥부쟁이, 두릅, 싸리나무, 왕고들빼기, 자리공, 쇠뜨기, 산초나무, 참취, 닭의장풀, 돌나물, 피마자, 적치커리, 고수, 비트 및 레몬밤의 산야

특허청구의 범위 청구항 1 수세미오이, 라벤더, 양파, 천마, 야콘, 곰보배추, 꾸지뽕, 작약, 바질, 사위질빵, 엄나무, 쑥부쟁이, 두릅, 싸리나무, 왕고들빼기, 자리공, 쇠뜨기, 산초나무, 참취, 닭의장풀, 돌나물, 피마자, 적치커리, 고수, 비트 및 레몬밤의 산야 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) C12N 9/00 (2006.01) C12P 21/04 (2006.01) A23L 1/305 (2006.01) (21) 출원번호 10-2013-0027290 (22) 출원일자 2013년03월14일 심사청구일자 전체 청구항 수 : 총 5 항 2013년03월14일 (11)

More information

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다

12 Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1 다 (Kim et al., 2012). 여러가지생물종이어우러져구성된생물군집은종간상호작용이다양할것이므로종다양성이높은군집은구조적으로복잡할것이다 한국농림기상학회지, 제 16 권제 1 호 (2014) (pissn 1229-5671, eissn 2288-1859) Korean Journal of Agricultural and Forest Meteorology, Vol. 16, No. 1, (2014), pp. 11~21 DOI: 10.5532/KJAFM.2014.16.1.11 c Author(s) 2014.

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

소비형태보고서.PDF

소비형태보고서.PDF A0063-65610-57-0109 A Study on the Consumption Pattern and Pricing Structure of Major Oriental Medicines in Korea 2001. 5 : . 2001. 5. : : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : (

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum Programs The 201 EABCN symposium will be held on

More information

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최 제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다. 2017 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최담선 연 구 원 : 김민숙 연 구 원 : 김민지 협동연구기관명 : ( 재 ) 남원시화장품산업지원센터

More information

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체.

< 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 연구보고 발 간 등 록 번 연구보고 호 11-01 11-1400377-000436-01 11 01 제주지역 산림유전자원의 수집 및 보존연구 제주지역 산림유전자원의 수집 및 보존연구 김찬수 김수영 변광옥 국립산림과학원 국립산림과학원 KOREA FOREST RESERCH INSTITUTE < 표지설명 > 한라산에자생하는왕벚나무와이나무의염색체. 제주지역산림유전자원의

More information

<30302E20B8F1C2F72E666D>

<30302E20B8F1C2F72E666D> Korean J. Pl. Taxon. 44(3): 222-232 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.3.222 ISSN 1225-8318 Korean Journal of Plant Taxonomy Flora of Sumeunmulbaengdui wetland in Jeju-do, Korea Sung Chul Ko*,

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

옥천 일대의 지형

옥천  일대의  지형 1 임실 장수소권역일대의식생 임실 장수소권역일대의식생 - 내동산 - 성낙필 이윤택 하늘나무생태연구소 요약 1 본조사권역은관촌 (357061), 평장 (357062), 임실 (357063), 신창 (357064), 반암 (357073) 도엽의내동산 (887m) 평가단위로구성되며출현식물군락의유형은신갈나무군락 (Qm), 졸참나무군락 (Qs), 굴참나무군락 (Qv),

More information

<30332D3039C1F6C7FCB0E6B0FC2E687770>

<30332D3039C1F6C7FCB0E6B0FC2E687770> 합천 의령지역의지형경관 김성환 권혜영 ( 서울대학교지리학과 지리교육과 ) 요 약 조사지역은자굴산 (897m), 옥녀봉 (385m), 허굴산 (681.8m), 국사봉 (687m), 337고지 (337m) 일대를중심으로하는지역이다. 이지역은행정구역상으로경상남도의서북부에해당하는합천군의남부와산청군의북부, 그리고의령군의북부에해당한다. 조사지역은서북쪽의허굴산 ( 허굴산,

More information

유기억.fm

유기억.fm 54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

11.hwp

11.hwp 23(3): 281 291, 2000 Korean J. Ecol. 금강송림의식생구조에관한정량적분석 윤충원 홍성천 적요 :,,,. 1) CCA,,,.,.,,. 2),,,,,.,. 3) 0.6622, 0.7,. 4), 0.6. 5).,. 검색어 :,, CCA,,,, 서론 1950 (classification) (ordination) (GreigSmith 1983),.

More information