RESEARCH ARTICLE DNA 바코드분석을통한개자및운대자감별 노푸름 여상민 김욱진 양선규 박인규 문병철 * 한국한의학연구원한약연구부 Authentication of Brassicae Seme
|
|
- 순재 천
- 2 years ago
- Views:
Transcription
1 RESEARCH ARTICLE 노푸름 여상민 김욱진 양선규 박인규 문병철 * 한국한의학연구원한약연구부 Authentication of Brassicae Semen and Brassicae Campestris Semen by DNA Barcode Analysis Pureum Noh, Sang Min Yeo, Wook Jin Kim, Sungyu Yang, In Kyu Park, and Byeong Cheol Moon * Herbal Medicine Research Division, Korea Institute of Oriental Medicine, Daejeon 34054, Korea *Corresponding author: bcmoon@kiom.re.kr Received: April 4, 2018 Revised: May 10, 2018 Accepted: May 16, 2018 OPEN ACCESS HORTICULTURAL SCIENCE and TECHNOLOGY 36(6): , 2018 URL: pissn : eissn : This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyrightc2018 Korean Society for Horticultural Science. Abstract Brassica juncea and Brassica napus are economically important crops used for oilseed and forage who s seed is also used for herbal medicines, namely Brassicae Semen and Brassicae Campestris Semen, respectively. Morphological discrimination of these two herbal medicines is difficult because the seeds of the Brassica species have similar shapes. Since the descriptions of the different Brassicae Semen in the Korean and Chinese pharmacopoeia can be confused, it is necessary to develop an accurate method for identification of the different species. Therefore, DNA barcodes of six Brassica species, B. juncea, B. napus, B. nigra, B. oleracea, B. rapa, and Sinapis alba, collected from various locations and markets, were analyzed to develop a molecular marker for distinguishing Brassicae Semen and Brassicae Campestris Semen. Nucleotide sequence comparison and phylogenetic analysis of internal transcribed spacer (ITS) regions based on the amphidiploid types and U's triangle provide useful genetic information for the identification of these two herbal medicines and Brassica species. However, the sequences of the chloroplast maturase K (matk) gene showed species-specific insertions and deletions or substitutions only for B. nigra, B. oleracea, and S. alba but not for B. juncea, B. napus, and B. rapa. The use of genome-specific marker nucleotides in ITS regions provide an objective and accurate method for authentication of Brassica species and valuable information for further molecular marker development. Additional key words: Brassica species, internal transcribed spacer (ITS), maturase K (matk), molecular marker, molecular phylogenetics 본연구는한국한의학연구원주요사업 기원검증체계구축을통한한약자원국내생산기반기술개발 과제 (K17403) 의지원에의해수행되었습니다. 본연구수행에필요한연구시료종자를분양해주신국립농업과학원농업유전자원센터 (National Agrobiodiversity Center) 와기원식물표본을제공해주신한국한의학연구원한약표준표본관 (Index Herbariorum code KIOM) 에감사드립니다. 서언배추과식물은 338속, 약 3,709여종으로전세계에분포하고있으며, 경제적가치가매우높은작물에속한다 (Warwick and Sauder, 2005; Al-Shehbaz et al., 2006; Warwick et al., 2006). 그중갓 (Brassica juncea (L.) Czern.) 은배추 (B. rapa L., AA genome, 2n=2x=20) 와흑갓 (B. nigra (L.) K.Koch, BB genome, 2n=2x=16) 의자연교잡및염색체배가로생성된복이배체 (amphidiploid) 작물로 AABB Horticultural Science and Technology 885
2 genome(2n=4x=36) 을가지고있으며, 유채 (B. napus L.) 는배추와양배추 (B. oleracea L., CC genome, 2n=2x=18) 의자연교잡및염색체배가로생성된복이배체작물로 AACC genome(2n=4x=38) 을가지고있다 (Nagaharu, 1935; Johnston et al., 2005). 갓과유채각각의종자는개자 ( 芥子 ), 운대자 ( 蕓薹子 ) 라는한약재로사용된다. 우리나라대한민국약전외한약 ( 생약 ) 규격집 (Korea Food & Drug Administration, 2012) 에서개자는십자화과 (Cruciferae = Brassicaceae) 의갓또는그변종의잘익은씨로규정하고있으며, 운대자는유채의잘익은씨로규정하고있다. 반면, 중국약전 (China Pharmacopoeia Committee, 2010) 에서는십자화과식물백개 ( 白芥, 백겨자 ; Sinapis alba L.) 또는갓의잘익은씨를말린것으로전자를흔히 백개자 ( 白芥子 ) 라고부르며, 후자를흔히 황개자 ( 黃芥子 ) 라고부른다 (Korea Institute of Oriental Medicine, 2017). 하지만이들의종자가형태적으로유사하여유통되고있는한약재개자와운대자의정확한구별이어렵다. 또한같은속의배추, 양배추, 중국에서정품한약재개자로이용하는백겨자, 그리고흑개자 ( 黑芥子 ) 라는명으로이용되는흑갓의종자도이와같은이유로형태구별이매우어렵다. 국내에서는일반농가에서다양한갓품종이식용목적으로재배되고있는데, 농지단위가작고, 좁은지역에다양한근연종배추과작물을재배하는한국의농업특성상, 화분을통한유전자이동이비교적빈번하고, 이에따라근연종과의교잡에의한교잡종의발생가능성이더높을것으로예상되고있다 (Lim et al., 2015). 실제로배추속종자는종간, 종내잡종에의해중간형질이많이관찰되어외부형태적형질에기초하여종을동정하는데어려움이많기때문에객관적이고정확한동정법이필요한현실이다. DNA barcode는 DNA의짧은표준범위로부터염기서열을얻어종간비교를통하여빠르고정확한종동정을가능하게해주는 DNA 상의특정유전자또는특정부위로서, Hebert et al. (2003) 에의해처음용어가고안된이후로생물학전범위에서활발하게사용되고있다 (Lee et al., 2015). 식물에서주로사용되는범용성 DNA barcode 부위는핵내 45S ribosomal RNA gene(rdna) 에존재하는 internal transcribed spacer(its) 부위와엽록체 genome에존재하는 matk, rbcl, psba-trnh 등이있는데, 국제생물바코드컨소시엄 (CBOL, Consortium for Barcode of Life) 에서는고등식물의 core DNA barcode로엽록체의 matk와 rbcl조합의이용을권고하였다 (CBOL Plant Working Group, 2009). 약용식물분야에서도오동정으로인한약재의오용을막기위해형태적으로종감별이어려운종들과그근연종들에대하여 DNA barcode 분석및 barcode 데이터베이스구축의중요성이대두되어, 최근이를통해약재로사용되는기원식물의종을동정하고계통분류학적근연관계를분석하는연구가활발하게진행되고있다 (Zhang et al., 2015; Kim et al., 2016; Moon et al., 2016). 배추과에속하는배추와양배추, 유채는산업적이용가치가높아다양한산업분야에서이용되고있으며, 이에따라 DNA barcode 및유전체연구가활발히진행중이다 (Cheng et al., 2014). 하지만갓에대한연구는최근에시작되어유전자와유전체에대한연구가상대적으로미비하여 (Yang et al., 2016a), 갓의계통유연관계및유전적다양성에대한분석은 ITS 영역, SSR(simple sequence repeat), RAPD(random amplified polymorphic DNA) 및 AFLP(amplified fragment length polymorphism) marker를이용한소수의연구만이진행되었다 (Srivastava et al., 2001; Kwon et al., 2007; Khan et al., 2008; Ramchiary et al., 2011; Chen et al., 2013; Yang et al., 2016b). 따라서본연구에서는개자와운대자로사용되는갓과유채와함께이들과혼 오용되거나혼 오용우려가있는배추과식물인흑갓, 양배추, 배추, 백겨자 6종을대상으로, 핵내 ITS 부위와엽록체의 matk 유전자의 DNA barcode 부위로서의적합성을확인하고종감별을위한 marker nucleotide를발굴함으로써, DNA 바코드를이용한정확한종감별법을제시하고자한다. 재료및방법 분석용연구재료 본연구에사용한갓 (B. juncea), 유채 (B. napus), 흑갓 (B. nigra), 백겨자 (Sinapis alba) 시료는국립농업과학원유전자원센 886 Horticultural Science and Technology
3 터 (National Agrobiodiversity Center) 에서분양받은종자를파종하여약 3개월동안생장상에서키운식물체와국내자생지에서수집하여 -70 C 초저온냉동고에보관되어있던시료를이용하였다 (Table 1). 분양받은시료와수집된시료는본초학, 생약학, 식물분류학등의전문가로구성된분류 동정자문회의의동정을거쳐그종을최종확증하였다. 국립농업과학원유전자원센터에서분양받은시료는분양당시의자원번호를표기하였으며, 종자를제외한시료의증거표본은건조식물표본으로제작하여한국한의학연구원한약표준표본관 (Index Herbariorum code KIOM) 에표본번호를부여하여보관하였다 (Table 1). 배추 (B. rapa) 와양배추 (B. oleracea) 시료는동부팜흥농, 경신종묘주식회사, 성우종묘, 아시아종묘, 제일종묘농산에서구입한종자를사용하였다 (Table 1). 분석에이용된재료의식물명과학명은 The Plant List( 를기준으로정리하였다. DNA 추출 -70 C에보관중인기원식물생체시료와유통되고있는품종종자 100 mg을 Lysing Matrix A TM tube(mp Biomedicals, USA) 에담아 Precellys TM Grinder(Bertin Technologies, France) 를이용하여 5,500rpm으로 30초동안곱게마쇄한후, DNeasy Plant Mini Kit(QIAGEN, USA) 을이용하여제작자가제공한 protocol에따라추출정제하였다. 정제된 DNA의순도와질을확인하기위하여 1.5% agarose gel에서전기영동한후, EcoDye Nucleic Acid Staining Solution(BIOFACT, Korea) 로염색하여 UV light 상에서 DNA band를확인하였으며, UV spectrophotometer(nanodrop DN-1000, Nanodrop, USA) 를이 Table 1. Information of the 22 plant and seed samples used in this study No. Sample Name Scientific name Location of collection or manufacturer NAC z Voucher number 1 Brassica juncea-j1 Pyeongchang, Gangwon IT KIOM Brassica juncea-j2 Iho, Jeju IT KIOM Brassica juncea (L.) 3 Brassica juncea-j3 Unknown, Canada IT KIOM Czern.. 4 Brassica juncea-j4 Jeonmin, Yuseong, Daejeon - KIOM Brassica juncea-j5 Gwanpyeong, Yuseong, Daejeon - KIOM Brassica napus-na1 Unknown, Canada IT KIOM Brassica napus-na2 Brassica napus L. Gwanpyeong, Yuseong, Daejeon - KIOM Brassica napus-na3 Gwanpyeong, Yuseong, Daejeon - KIOM Brassica nigra-ni1 Unknown, India IT119376, KIOM Brassica nigra (L.) 10 Brassica nigra-ni2 Unknown, Afghanistan IT KIOM K.Koch 11 Brassica nigra-ni3 Unknown, Netherlands IT KIOM Brassica oleracea-o1 Asia Seed Co., LTD., Korea - KIOM_SEED_95 13 Brassica oleracea-o2 Asia Seed Co., LTD., Korea - KIOM_SEED_94 Brassica oleracea L. 14 Brassica oleracea-o3 Jeil Seed Co., Korea - KIOM_SEED_93 15 Brassica oleracea-o4 Sungwoo Seeds, Korea - KIOM_SEED_92 16 Brassica rapa-r1 FarmHannong, Korea - KIOM_SEED_ Brassica rapa-r2 Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_99 18 Brassica rapa-r3 Brassica rapa L. Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_98 19 Brassica rapa-r4 Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_97 20 Brassica rapa-r5 Sungwoo Seeds, Korea - KIOM_SEED_96 21 Sinapis alba-s1 Unknown, Sweden IT KIOM Sinapis alba L. 22 Sinapis alba-s2 Unknown, Germany IT KIOM z Accession number of National Agrobiodiversity Center. Horticultural Science and Technology 887
4 용하여흡광도를측정한뒤, 최종 20mg L -1 로희석하여분석에이용하였다. DNA barcode 부위의증폭 ITS 부위의증폭을위하여약 20ng의 genomic DNA와각 10pmole의정방향의 ITS1과역방향의 ITS4 primer를이용하였으며 (Table 2), 18S rrna와 26S rrna의염기서열을제외한 ITS1+5.8S rrna+its2 구간을각시료의 ITS 부위로정의하였다. 엽록체 genome에존재하는 matk 유전자의증폭을위하여 matk-af 와 matk-8r의 primer set을이용하였는데 (Järvinen et al., 2004), 증폭이원활하지못한문제가있어 NCBI GenBank 에등록된흑갓 (NCBI accession no. AB ) 과갓 (NCBI accession no. AB ) 의염기서열을비교하여 primer(brassica-matk-f2, Brassica-matK-R1) 를제작하여증폭에사용하였다 (Table 2). 반응조건은 ITS 부위와 matk 유전자에서모두 95 C에서 2분간 pre-denaturation 한후, 95 C에서 1분간 denaturation, 53 C에서 40초간 annealing, 72 C에서 2분간 extension을총 35회반복수행하고마지막으로 72 C에서 5분동안 final-extension하여해당부위를증폭하였다. 염기서열분석각시료당전체 40µL의증폭산물을 EcoDye Nucleic Acid Staining Solution(BIOFACT, Korea) 으로염색한 1.5% agarose gel 상에서 100 bp DNA ladder(solgent, Korea) 와함께전기영동하여증폭여부를확인한후, 정확하게증폭된증폭산물을 agarose gel로부터회수하여 Gel Extraction Kit(QIAGEN, USA) 를이용하여정제하였다. 정제된증폭산물을 pgem-t Easy Vector Systems(Promega, USA) 에삽입하고, 증폭산물이삽입된 vector를 JM109 competent cell(rbc, USA) 에형질전환한뒤, 100mg L -1 ampicillin, 40mg L -1 X-gal, 그리고 0.5mM IPTG가첨가된 LB agar 배지에도말하여약 18시간배양하였다. 갓과유채의경우, 각각 AABB, AACC genome 을가지므로두가지 type의염기서열이존재할수있기때문에, 두가지 type 의염기서열모두를얻기위하여각시료별로 5개이상의 white colony를취하여분석에사용하였다. 그리고 pgem-t Easy vector의 T7과 SP6 primer를이용한 colony PCR을통해예상된크기로증폭된것을확인한 clone을 sequencing 하였다. Sequencing 후, 두가지염기서열 type이관찰되지않은경우는 white colony 5개를추가적으로분석하였다. 염기서열의정확성과신뢰성을확립하기위한가이드라인에따라 (Nilsson et al., 2012), 4개의 clone으로부터얻은각각의염기서열정보를비교분석하고 PCR 증폭과정에서의오류를판별한후, NCBI GenBank BLAST 검색을통해키메라유무를판별하고종을확인하는과정을거쳐각시료의최종 ITS 및 matk 바코드염기서열을확정하였다. 계통유연관계분석및종판별용 marker nucleotide 탐색 22개체의시료로부터확보한 ITS와 matk 유전자최종염기서열, 그리고각부위별로 NCBI GenBank 에서참조가되는염기서열을추가하여분석에이용하였다 (Table 3). 이들염기서열을각 DNA barcode 종류별로 MEGA version 7(Kumar et al., Table 2. Primers used in this study Barcode region Primer Primer sequences (5' - 3') Reference ITS1 TCCGTAGGTGAACCTGCGG ITS White et al., 1990 ITS4 TCCTCCGCTTATTGATATGC matk-af CTATATCCACTTATCTTTCAGGAG Järvinen et al., 2004 matk-8r AAAGTTCTAGCACAAGAAAGTCGA matk Brassica-matK-F2 ACCTTATTTTGACTGTATCGCAC - Brassica-matK-R1 AACCCCATTATTCATGATTGAC 888 Horticultural Science and Technology
5 2016) 프로그램의 ClustalW 정렬법을이용하여정렬하고, 동프로그램에서 intra- 및 inter-specific distance 를계산하였다. ITS 와 matk의 GC 비율은 DnaSP version (Librado and Rozas, 2009) 프로그램을사용하여계산하였다. ITS 부위의경우, 갓과유채의 genome이각각 AABB, AACC로, 두가지 type의염기서열이모두검출되기때문에, 이러한경우에는 1차적으로 AA 염기서열과 BB 또는 CC 염기서열을하나의시료에서얻은두가지 type으로보고각염기서열을독립된데이터로분석하였고, 2차적으로는하나의시료에서얻은두가지 type의염기서열을 AA 염기서열의마지막염기뒤에 BB 염기서열또는 CC 염기서열의첫번째염기가위치하도록수평직선상으로배치하여유합된데이터로계통유연관계분석을수행하였다. 이경우에나머지이배체종 ( 배추, 양배추, 흑갓, 백겨자 ) 의 ITS 염기서열은해당종의염기서열의 copy를위와같은방법으로수평직선상으로배치하였다. 분석대상시료의계통유연관계분석을위하여 MEGA version 7 프로그램을이용하여각부위별로 model test를수행하였고, ITS 부위는 K2+G(Kimura-2-parameter + Gamma), matk 유전자는 T92(Tamura 3-parameter) 의 best fit model이도출되었다. 동프로그램상에서각부위염기서열의 best fit model을적용한 Maximum Likelihood 계통추론방법으로 1,000회 bootstrapping을통하여계통수를도출하였고, 이를기반으로분기군형성유무와분기군간의근연관계를비교 분석하였다. 도출된계통수는 PowerPoint 2013(Microsoft, USA) 에서편집하였다. ITS 부위와 matk 유전자의염기서열을유합한 combined data의적합성을판단하기위하여 PAUP version 4.0 (Swofford, 2002) 에서 Incongruence Length Difference(ILD) test(farris et al., 1994) 를수행하였다. 정렬된 matk와 ITS 염기서열의종내개체별비교와종별비교를통해종특이성을갖는염기 (marker nucleotide) 의삽입 (Insertions), 결실 (Deletions) 및치환 (Substitutions) 을정렬된위치별로분석하여정리하였으며, 이를토대로 marker nucleotide를탐색하였다. Table 3. GenBank accession numbers used in the marker nucleotide analyses and the phylogenetic analyses DNA Barcode region Species Genome (-type z ) GenBank accession number B. juncea AABB-A DQ003681, GQ B. juncea AABB-B DQ003674, DQ B. napus AACC-A JQ085860, DQ B. napus AACC-C DQ003668, DQ ITS B. nigra BB DQ003644, DQ340645, EF601911, GQ B. oleracea CC AY833603, DQ003652, KM B. rapa AA DQ340644, KF704394, KM538956, JN S. alba - AF128106, FJ Arabidopsis thaliana - X52320 B. juncea AABB AB354274, LC B. napus AACC KJ872515, KM454973, LC064393, AB B. nigra BB KT878383, NC matk B. oleracea CC AB354271, LC B. rapa AA AB354276, LC S. alba - AB354277, LC Arabidopsis thaliana - AP000423, NC z Sequence type corresponding to the amphidiploid species. Horticultural Science and Technology 889
6 결과및고찰 ITS 및 matk 부위의특성각시료로부터추출한 gdna를주형으로하여 ITS1과 ITS4 primer 조합과 matk-af 와 matk-8r primer조합으로증폭한결과, 약 600 bp 크기의 ITS 증폭산물은확인되었으나약 1250 bp 크기의 matk 유전자의증폭은확인되지않았다. Hollingsworth et al. (2011) 과 Ghahramanzadeh et al. (2013) 에서 matk 유전자의변이율이높아 matk 유전자증폭시에 universal primer로는증폭이어려운경우가많음을보고하였는데, 본연구에서도 matk universal primer가 Brassica속에서는적합하지않았던것으로판단된다. 이러한이유로본연구에서제작한 Brassica-matK-F2 와 Brassica-matK-R1 primer 조합으로 matk 부위를증폭하였으며, 그결과약 1.5 kb의 matk 유전자절편을증폭할수있었다. 각시료로부터증폭된 ITS 염기서열을분석한결과, 갓과유채는두가지 type의염기서열이나타났으며, 갓은 608 bp와 622 bp로구성되었고, 유채는 608 bp의서로다른두가지 type의염기서열로구성되었다. 흑갓은 622 bp, 배추와양배추는 608 bp, 백겨자는 617 bp로구성되어있음을확인하였다. 갓과유채에서획득된서로다른 type의염기서열이 sequencing 오류인지확인하기위해 NCBI GenBank BLAST 검색을수행하였고, 각각갓과유채와일치하는염기서열이존재하는것을확인하였다. 증폭산물의 G+C 비율은전체적으로 % 로나타났다. 본연구를통해새로제작한 primer 조합을이용하여증폭된 matk 유전자염기서열을분석한결과, 모든증폭산물은 1509 bp로구성되어있었고, G+C 비율은 % 로확인되어 6종모두바코드부위의 DNA 구조와물리적특성은큰차이를보이지않았다 (Table 4). 종내변이율을분석한결과, ITS 부위에서가장높은종내변이율을보였으며, 갓, 유채, 흑갓, 양배추, 배추, 백겨자의 6종에대한종내평균변이율은각각 0.030, 0.026, 0.002, 0.000, 0.000, 0.002으로나타났다 (Table 4). 갓과유채에서높은종내변이율이나타난것은갓과유채가복이배체식물로두가지 type의염기서열이존재하기때문인것으로판단된다 (Table 4 and 5). matk의경우유채에서종내평균변이율이 0.001로나타났지만, 나머지 6종은종내변이가보이지않았다. matk에서유채의종내변이율이 0.001로나타난것은유채의 AA genome 상에서 822 bp에서 T A, 889 bp에서 C A, 1132 bp에서 A C로바뀌는 3개의염기치환이있는두가지 type의염기서열이존재하기때문인것으로판단된다 (Table 6). 종간변이율은 ITS에서백겨자가 0.068로가장높았으며, 그다음으로양배추 0.050, 흑갓 0.047, 배추 0.040, 유채 0.040, 그리고갓 순서였다. matk 유전자의종간변이율도백겨자가 0.025로가장높았으며, 그다음으로흑갓 0.024, 양배추 0.010, 배추 0.009, 갓 0.009, Table 4. Characteristics and variation of the ITS and matk region DNA Barcode region ITS matk Species Length (bp) G+C (%) Intra-specific distance Inter-specific distance GenBank accession number B. juncea 608, , ± ± MG MG B. napus 608, , ± ± MG MG B. nigra ± ± MG MG B. oleracea ± ± MG MG B. rapa ± ± MG MG S. alba ± ± MG MG B. juncea ± ± MG MG B. napus ± ± MG MG B. nigra ± ± MG MG B. oleracea ± ± MG MG B. rapa ± ± MG MG S. alba ± ± MG MG Horticultural Science and Technology
7 Table 5. Summary of marker nucleotides obtained from the comparison of ITS sequences. Sequence positions indicate the number of aligned ITS region nucleotide positions of all species. The marker nucleotides on each position are shaded Sequence position Brassica juncea C G T G A T A T A C G T - C C - A C C T T C G C G A T/C G C A GCCGATT C G C T T C C G C C C C Brassica napus C G T G A T A T A C G T - C C - A C C T T A G C G T T G T A GCTGATT T A C - C C - G C A C C Brassica nigra C G C G A T/C G C A GCCGATT C G C T T C C G C C C C Brassica oleracea A G C G T T G T A GCTGATT T A C - C C - G C A C C Brassica rapa C G T G A T A T A C G T - C C - A C C T T Sinapis alba T A C A A T G T T GCTGATT C G C - C A A G T C C C Sequence position Brassica juncea G C C A G ACTT C A T A G A A A A A C A C T T G T T A A GACTT ACTT A G C A G A T C A A C A T T T Brassica napus G C C A G ACTT C A T A G A A A A A C A C T T G C C A T A A A A C A A C G C T T Brassica nigra G T T A A GACTT ACTT A G C A G A T C A A C A T T T Brassica oleracea G C C A T A A A A C A A C G C T T Brassica rapa G C C A G ACTT C A T A G A A A A A C A C T T Sinapis alba A C C G T ACTT C A/G T G T T A C G G T A C T/G G Sequence position Brassica juncea C A G G A G A C C A - T A T C T A A C C A A T T A G G G G G C C A - C A G A T C T C C A A/G C Brassica napus C A G G A G A C C A - T A T C T A A C C A A T C A G C G T A T C A - C A T C A C T T C G A T Brassica nigra T A G G G G G C C A - C A G A T C T C C A A/G C Brassica oleracea C A G C G T A T C A - C A T C A C T T C G A T Brassica rapa C A G G A G A C C A - T A T C T A A C C A A T Sinapis alba C T G/C G G G A C T T T G T A C T T T C T A A T 그리고유채 순서였다. 획득된염기서열은 NCBI GenBank 에업로드하였으며각각의 accession number를 Table 4에표기하였다. 배추속식물의종간유연관계분석 ITS 부위의계통유연관계분석결과 (Fig. 1), 독립적인분기군을형성한백겨자와 Brassica속에속하는 5종으로크게분기되었다. Brassica속은 genome type에따라분기군을형성하였는데, 배추, 그리고갓과유채에서분리된 AA genome이하나의분기군을형성하였고 (Group 1), 흑갓과갓의 BB genome이하나의분기군을형성하였으며 (Group 3), 유채와양배추의 CC genome이또하나의분기군을형성하여 (Group 2) 총 3개의 group으로나뉘었다. 그중, AA와 CC genome이 BB genome보다는더가까운유연관계에있는것으로나타났다. 이는핵 DNA의 CHS(chalcone synthase) 유전자를이용하여분석한타연구결과와일치한다 (Chen et al., 2016). 그러나종별로분기군이형성되지않고각 genome type 별로분기군이형성되었기때문에 Brassica속의종동정에는적합하지않은것으로판단된다. Horticultural Science and Technology 891
8 Table 6. Summary of marker nucleotides obtained from the comparison of matk gene sequences. Sequence positions indicate the number of aligned matk region nucleotide positions of all species. The marker nucleotides on each position are shaded Sequence position Brassica juncea T T T C G T A T A T T C Brassica napus T T T C G T A T A T/A T C/A Brassica rapa T T T C G T A T A T T C Brassica oleracea C T T C G T A T A T T A Brassica nigra T G G C A C C T A A T A Sinapis alba T T T G G T G C T A A A Sequence position Brassica juncea C A A A C C A T C G C Brassica napus C A A A C C A/C T C G C Brassica rapa C A A A C C A T C G C Brassica oleracea C T T A C C A T C G C Brassica nigra C A A C C C A T C A T Sinapis alba A A A T T T A G A G C ITS 부위의두가지 type 및 copy를수평직선상에배치하여분석한결과 (Fig. 2), 총 6개의 group으로분기군이형성되었다. 각분기군 (Group 1-6) 은각각단일종만으로이루어져있었으며, 그중백겨자는기저에서분지되어독립적인분기군을형성하면서 Brassica속의종들과구분되는형태를보였다. 또한, Brassica 속에서는크게두개의 clade로나뉘었는데, 첫번째 clade는배추, 유채, 양배추로구성되었고, 두번째 clade는흑갓과갓으로구성되었다. AA genome과 CC genome이 BB genome보다가까운계통유연관계를보이는것은 ITS의두가지 type 부위를수평배치하지않고각각의 sequence로작성한계통수 (Fig. 1) 에서의결과와일치하였다. 그리고, 갓과유채는각각 AABB, AACC genome 을가지고있으며 AA genome을배추와공유함에도불구하고갓, 유채, 배추는분기군을형성하지않고서로 paraphyly 관계에있는양상을보였다. 반면에 BB genome을공유하는갓과흑갓이분기군을형성하고 CC genome을공유하는유채와양배추가분기군을형성하면서, BB genome간, CC genome간의관계가 AA genome간의관계보다는좀더강한유연관계에있는것으로보인다 (Fig. 2). matk 부위의계통유연관계분석결과 (Fig. 3), 백겨자를포함하여크게두개의 clade로나뉘었다. 첫번째 clade는배추, 유채, 갓, 양배추로구성되어있었는데, 그중배추, 유채, 갓은구분되지않고하나의분기군 (Group 1) 을형성하였으며양배추만이독립적인분기군 (Group 2) 을형성하였다. 그리고유채중일부는다른분기군 (Group 3) 을형성하는결과를보였다. 두번째 clade는흑갓과백겨자로구성되어있었다. 이러한결과는 Li et al. (2017) 이보고한 Brassica속식물의전체엽록체 genome 분석결과, Lü et al. (2008) 이보고한 Raphanus 및 Brassica 속식물의 trnk/matk 염기서열을이용한 Neighbor-joining tree 분석결과, 그리고 Arias and Pires(2012) 가보고한 chloroplast genome 상의 intergenic Regions(rpl32-trnL, atpi-atph, psbd-trnt, ycf6-psbm) 의분석결과와유사한양상을나타낸다. 따라서배추과식물의 chloroplast genome을이용하여유연관계를분석한여러논문에서보고된바와같이배추, 양배추, 갓, 유채가하나의 lineage를이루고, 흑갓, 백겨자가다른 lineage를이루어진화했기때문에 chloroplast genome 상에서갓, 유채, 배추 3종은같은분기군을형성하는것으로판단된다. 또한, 이결과로써엽록체유전자로는배추, 유채, 갓의뚜렷한구분이어렵다는것을확인하였다. 갓, 유채, 흑갓, 양배추, 배추와백겨자 6종의종간유연관계분석을위하여 ITS와 matk 염기서열을유합한 combined data의적합성을판단하고자 ILD test를수행하였다. 그결과, p-value 가 0.03으로 ITS와 matk 부위가 homogeneous한관계에있다는귀무가설을기각하므로 combined data로서적합하지못한것으로판단되었다. 따라서 ITS와 matk 부위는유합하여분석하지않았다. 892 Horticultural Science and Technology
9 Fig. 1. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the ITS sequences of the Brassica species. The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. Horticultural Science and Technology 893
10 Fig. 2. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the Brassica ITS sequences arranged horizontally (the ITS sequence of the second genome type was situated right behind the final base of that of the first genome type). The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. 종합적으로, ITS를단순분석한것과 matk 유전자로는분기군의양상에서 Brassica 속종들의정확한종별 grouping이어려웠으나, ITS 부위의두가지 type 및 copy를수평배치하여분석했던경우에서 Brassica 5종과백겨자의정확한종별 grouping 이가능하였다. 이로써 Brassica 5종과백겨자의정확한종동정과종별 grouping을위해서는 ITS 부위의두가지 type 및 copy 를수평배치하여분석하는것이가장바람직한방법임을확인하였다. 894 Horticultural Science and Technology
11 Fig. 3. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the chloroplast matk sequences of the Brassica species. The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. Horticultural Science and Technology 895
12 종감별용 marker nucleotide 발굴우리나라와중국약전의개자기원식물의차이와흑갓의혼 오용방지를위한종감별용 marker로활용할수있는 nucleotide 발굴을위해, 본연구에서분석한개자및운대자를포함하는 6종 22개시료로부터증폭한 ITS, matk 염기서열과 NCBI GenBank 의기보고된갓, 유채, 흑갓, 양배추, 배추, 백겨자의 ITS, matk 염기서열을확보하여종내비교와종간비교를통해종특이적인염기서열을분석하였다. ITS 부위의염기서열분석결과 (Table 5), 백겨자종특이적인염기삽입이 532 위치에서확인되었으며, 염기치환이 26개존재하였다. 배추속식물인나머지 5종은종특이적인염기서열이존재하지않았으며, 총 3가지 type의염기서열이존재하였다. 배추 (AA genome), 흑갓 (BB genome), 양배추 (CC genome) 의염기서열을각각 A type, B type, C type으로확정한후갓 (AABB genome) 과유채 (AACC genome) 를분석한결과, 갓은 A와 B type, 유채는 A와 C type의염기서열이존재하였다. 각 type 별특이적인삽입 / 결실은 A type이 66-72위치, B type이 88, 위치, C type이 , 128, 129위치에있었으며, 염기치환은 A type이 12개, B type이 17개, C type이 13개존재하였다 (Table 6). 종특이적인염기치환은아니지만 Brassica속의복이배체종에서두가지 type의염기의조합으로종을동정할수있는 marker nucleotide를탐색한결과, 갓과유채에서각각 15개, 13개의 marker nucleotide가확인되었다. 또한, 이배체종들에서도흑갓 15개, 양배추 13개, 배추 11개의 marker nucleotide가확인되었다. 즉, ITS 부위염기서열의해당위치의염기조합정보를이용하면 Brassica속을종단위에서동정할수있다는결과를얻었다. 본연구결과와는다르게 Yang et al.(2016b) 이보고한갓품종구분을위한 ITS 분석결과에서는배추의 ITS 서열과유사한 10품종과흑갓의 ITS 서열과유사한 5품종을구분하였다. 이연구결과에서는복이배체식물의두가지 genome type 중한가지의염기서열만이나타나있는데, sequencing sample 의수가적어각 genome이가진모든 ITS 염기서열이확인되지않은것인지여부를추가적으로확인해볼필요가있다고생각된다. 이와관련하여배추속복이배체식물인갓, 유채, 그리고에티오피아겨자 (Brassica carinata) 의 DNA 염기서열분석시에는두가지 type의염기서열이모두관찰될수있기때문에 cloning 이필수적이며, cloning 후에 PCR 증폭산물이삽입된 white colony를취할때에도충분한수 (7개-10개이상 ) 를취하여분석에사용하는것이두가지 type의염기서열을모두얻기에바람직한방법으로사료된다. 종감별을위한 matk 유전자의염기서열분석결과 (Table 6), 종특이적인삽입 / 결실은없으며백겨자, 흑갓, 양배추에서염기치환이각각 11개, 8개, 3개존재하였다. 이염기치환부위를 marker nucleotide로하여백겨자, 흑갓, 양배추의종감별에사용할수는있으나, 배추와갓그리고일부유채의경우염기서열상에차이가없어, 기보고된중국패모 (Fritillaria thunbergii) 와달리 matk 유전자염기서열만으로는종감별이어려울것으로판단된다 (Moon et al., 2018). 이것은갓 (AABB genome) 과유채 (AACC genome) 의경우모계유전을하는 chloroplast genome의특성상같은모계, 즉 AA genome의유전자를획득하여진화된것으로판단되며기존에보고된다른연구결과와일치하였다 (Li et al., 2017). matk는엽록체에존재하는유전자로분자계통학적연구에서는상당히높은변이율을보이나 PCR 증폭률이낮은어려움이있어 rbcl과결합하여사용하길추천하고있다 (CBOL Plant Working Group, 2009). 기존의몇몇연구에서분류군에따라이들두조합만으로는종변별력이떨어지는문제점과 matk의 PCR 증폭의어려움을보고하며추가적으로다른 DNA barcode 부위의필요성을제기하였다 (Hollingsworth et al., 2011; Ghahramanzadeh et al., 2013). 본연구에서도 matk의단일바코드를이용한배추과의종감별은어려운것으로판단되어, NCBI Genbank의 rbcl 유전자의염기서열을확인하였으나 matk 유전자분석결과와같이갓, 배추, 유채를감별할수있는변이가나타나지않았다 ( 분석결과첨부안함 ). 따라서 Brassica속식물의종을감별하는데있어 matk +rbcl 조합의 DNA barcode는적절치않은것으로생각된다. 종의합성 은우장춘박사가배추와양배추의교배를통해기존에존재하는유채를인공적으로합성하여종은달라도속이같으면새로운식물을만들수있다는것을최초로증명한것으로흔히 우장춘의삼각형 (U s triangle) 이라불린다 (Nagaharu, 1935). 896 Horticultural Science and Technology
13 이 우장춘의삼각형 에따르면배추속에는이배체식물인배추 (AA genome), 흑갓 (BB genome), 양배추 (CC genome) 가있으며, 자연교잡에의해생성된복이배체식물인갓 (AABB genome), 유채 (AACC genome), 에티오피아겨자 (BBCC genome) 가있다. 복이배체식물인갓과유채의경우자연교잡에의해서로다른 genome에서얻어진 ITS 염기서열이존재하며 AA genome인배추, BB genome인흑갓, CC genome인양배추의 3가지염기서열 type을비교해본결과우장춘의삼각형을따르는결과를얻었다. 따라서 ITS 부위는배추속식물의우장춘의삼각형을설명할수있는 DNA barcode 로, 복이배체종의 ITS 부위에서얻어지는두가지 type의염기서열을함께분석한다면, chloroplast matk 유전자보다정확하게배추속식물의종동정이가능하기때문에, 약재로유통되는갓과유채의종자인개자와운대자를감별하는데효과적으로이용할수있을것으로판단된다. 초록배추속 (Brassica) 에속하는갓과유채는유지및사료작물등다방면으로이용되며그종자는개자와운대자라는한약재로사용되는경제적으로중요한작물이다. 배추속식물의종자는형태적으로유사하여개자와운대자의경우형태적종감별에어려움이있다. 또한우리나라대한약전과중국약전에서개자에대한규정에차이가있어이로인하여개자와백개자가혼용될우려가있기때문에정확한동정방법이필요한현실이다. 본연구는국내 외다양한지역에서수집되거나현재유통되고있는갓 (B. juncea), 유채 (B. napus), 흑갓 (B. nigra), 양배추 (B. oleracea), 배추 (B. rapa), 그리고백겨자 (Sinapis alba) 를분석하여개자및운대자의종을구별할수있는유전자마커를개발하기위해수행하였다. 우장춘의삼각형 에따라복이배체 type을확인할수있는 ITS 부위의염기서열비교와계통분석을통하여 ITS 부위가두약재의감별및배추속의종동정에유용한유전적정보를제공한다는것을확인하였다. 하지만 matk 유전자의경우에는흑갓, 양배추, 백겨자 3종을구분할수있는염기치환은존재하였으나, 갓, 유채, 배추에서는종특이적인염기삽입 / 결실및치환이나타나지않았다. 따라서 ITS 부위의각 genome 특이적인 marker nucleotide를이용하여개자및운대자의객관적이고정확한종동정이가능하며, 향후분자마커개발에유용한정보로활용할수있을것으로기대된다. 추가주요어 : 배추속, Internal transcribed spacer(its), Maturase K(matK), 분자마커, 분자계통분류 Literature Cited Al-Shehbaz IA, Beilstein MA, Kellogg EA (2006) Systematics and phylogeny of the Brassicaceae (Cruciferae): an overview. Plant Syst Evol 259: doi: /s z Arias T, Pires JC (2012) A fully resolved chloroplast phylogeny of the brassica crops and wild relatives (Brassicaceae: Brassiceae): Novel clades and potential taxonomic implications. Taxon 61: CBOL Plant Working Group (2009) A DNA barcode for land plants. Proc Natl Acad Sci 106: doi: /pnas Chen F, Liu H, Yao Q, Fang P (2016) Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene. Genet Mol Res: GMR 15. doi: /gmr Chen S, Wan Z, Nelson MN, Chauhan JS, Redden R, Burton WA, Lin P, Salisbury PA, Fu T, et al (2013) Evidence from genome-wide simple sequence repeat markers for a polyphyletic origin and secondary centers of genetic diversity of Brassica juncea in China and India. J Hered 104: doi: /jhered/est015 Cheng F, Wu J, Wang X (2014) Genome triplication drove the diversification of Brassica plants. Hortic Res 1: doi: /hortres Farris JS, Källersjö M, Kluge AG, Bult C (1994) Testing significance of incongruence. Cladistics 10: doi: /j tb00181.x Ghahramanzadeh R, Esselink G, Kodde L, Duistermaat H, Valkenburg J, Marashi S, Smulders M, Wiel C (2013) Efficient distinction of invasive aquatic plant species from non invasive related species using DNA barcoding. Mol Ecol Res 13: doi: / Hebert PD, Ratnasingham S, de Waard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B Biol Sci 270:S96-S99. doi: /rsbl Hollingsworth PM, Graham SW, Little DP (2011) Choosing and using a plant DNA barcode. PLoS One 6:e doi: /journal.pone Horticultural Science and Technology 897
14 Järvinen P, Palmé A, Morales LO, Lännenpää M, Keinänen M, Sopanen T, Lascoux M (2004) Phylogenetic relationships of Betula species (Betulaceae) based on nuclear ADH and chloroplast matk sequences. Am J Bot 91: doi: /ajb Johnston JS, Pepper AE, Hall AE, Chen ZJ, Hodnett G, Drabek J, Lopez R, Price HJ (2005) Evolution of genome size in Brassicaceae. Ann Bot 95: doi: /aob/mci016 Khan MA, Rabbani MA, Munir M, Ajmal SK, Malik MA (2008) Assessment of genetic variation within Indian mustard (Brassica juncea) germplasm using random amplified polymorphic DNA markers. J Integr Plant Biol 50: doi: /j x Kim W, Ji Y, Choi G, Kang Y, Yang S, Moon B (2016) Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rdna-its, matk, and rbcl DNA barcode sequences. Genet Mol Res: GMR 15. doi: /gmr Korea Food and Drug Administration (2012) The Korean Herbal Pharmacophoeia 4th edition. 1st supplement, Partial amendment, 2016, The Korea Food and Drug Administration, Seoul, Korea, pp 8-9 Korea Institute of Oriental Medicine (2018) Defining dictionary for medicinal herbs [Korean, Hanyak Giwon Sajeon ]. Published on the Internet; Accessed 7 February 2018 Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33: doi: /molbev/msw054 Kwon S, Lim K, Lim M, Park J, Kim J, Kim J, Lee S, Park B, Jin Y (2007) Molecular genetics of Brassicaceae based on AFLP display. Korean J Hortic Sci Technol 25:75-81 Lee J, Kim CS, Lee IY (2015) Molecular identification of Pooideae, Poaceae in Korea. Weed Turf Sci 4: doi: /wts Li P, Zhang S, Li F, Zhang S, Zhang H, Wang X, Sun R, Bonnema G, Borm TJ (2017) A phylogenetic analysis of chloroplast genomes elucidates the relationships of the six economically important Brassica species comprising the Triangle of U. Front Plant Sci 8:111. doi: /fpls Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: doi: /bioinformatics/btp187 Lim Y, Yook MJ, Zhang CJ, Nah G, Park S, Kim DS (2015) Dormancy associated weedy risk of the F1 hybrid resulted from gene flow from oilseed rape to mustard. Weed Turf Sci 4: doi: /wts Lü N, Yamane K, Ohnishi O (2008) Genetic diversity of cultivated and wild radish and phylogenetic relationships among Raphanus and Brassica species revealed by the analysis of trnk/matk sequence. Breed Sci 58: doi: /jsbbs Moon B, Kim W, Ji Y, Lee Y, Kang Y, Choi G (2016) Molecular identification of the traditional herbal medicines, Arisaematis Rhizoma and Pinelliae Tuber, and common adulterants via universal DNA barcode sequences. Genet Mol Res 15(1):gmr doi: / gmr Moon B, Park I, Kim W, Yang S, Kang Y (2018) The complete chloroplast genome sequence of Fritillaria thunbergii Miq., an important medicinal plant, and identification of DNA markers to authenticate Fritillariae Bulbus. Hortic. Environ. Biotechnol 59: doi: /s Nagaharu U (1935) Genome analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn J Bot 7: Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JA, Bergsten J, et al (2012) Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. MycoKeys 4:37. doi: / mycokeys Ramchiary N, Nguyen VD, Li X, Hong CP, Dhandapani V, Choi SR, Yu G, Piao ZY, Lim YP (2011) Genic microsatellite markers in Brassica rapa: development, characterization, mapping, and their utility in other cultivated and wild Brassica relatives. DNA Res 18: doi: /dnares/dsr017 Srivastava A, Gupta V, Pental D, Pradhan A (2001) AFLP-based genetic diversity assessment amongst agronomically important natural and some newly synthesized lines of Brassica juncea. Theor Appl Genet 102: doi: /s Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0. Sinauer Associates, Sunderland, Massachusetts, USA Warwick SI, Francis A, Al-Shehbaz IA (2006) Brassicaceae: species checklist and database on CD-Rom. Plant Syst Evol 259: doi: /s Warwick SI, Sauder CA (2005) Phylogeny of tribe Brassiceae (Brassicaceae) based on chloroplast restriction site polymorphisms and nuclear ribosomal internal transcribed spacer and chloroplast trn L intron sequences. Can J Bot 83: doi: /b White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. Academic Press, Inc., NY, USA, pp doi: /b Yang J, Liu D, Wang X, Ji C, Cheng F, Liu B, Hu Z, Chen S, Pental D, et al (2016a) The genome sequence of allopolyploid Brassica juncea and analysis of differential homoeolog gene expression influencing selection. Nat Genet 48: doi: /ng.3657 Yang K, Yi G, Arif Hasan Khan R, Jeong N, Lee Y, Park J, Kim H, Chung M, Nou I (2016b) Development of molecular markers for varietal identification of Brassica juncea on the basis of the polymorphic sequence of ITS regions and MITE families. Korean J Hortic Sci Technol 34: Zhang Z-L, Song M-F, Guan Y-H, Li H-T, Niu Y-F, Zhang L-X, Ma X-J (2015) DNA barcoding in medicinal plants: testing the potential of a proposed barcoding marker for identification of Uncaria species from China. Biochem Syst Ecol 60:8-14. doi: /j.bse Horticultural Science and Technology
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information작약(芍藥) 유전자 감별을 위한 psbA-trnH 부위 염기서열 분석 및 Marker Nucleotide 발굴
韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2015;3(2):73-80. pissn 2288-5161 / eissn 2288-5293 작약( 芍藥 ) 유전자감별을위한 psba-trnh 부위염기서열분석및 Marker Nucleotide * 김욱진, 지윤의, 문병철 발굴 한국한의학연구원 K-herb연구단 Identification of Marker
More information韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2014;2(2): pissn / eissn psba-trnh DNA 바코드분석을통한후박및토후박감별 문병철 * 한국한의학연구원한약자원그룹 Molecular Aut
韓藥情報硏究會誌 (Korean Herb. Med. Inf.) 2014;2(2):67-75. pissn 2288-5161 / eissn 2288-5293 psba-trnh DNA 바코드분석을통한후박및토후박감별 문병철 * 한국한의학연구원한약자원그룹 Molecular Authentication of Magnoliae Cortex and Its Adulterant
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information08. 이정란( ).fm
Weed Turf. Sci. 4(3):225~229 http://dx.doi.org/10.5660/wts.2015.4.3.225 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationMicrosoft Word - eco1201.doc
분지론의 과거, 현재, 미래 Past, present and future of the Cladistics 최 세 웅 목포대학교 환경교육학과 1. 서론 2. 본론 2-1. 과거 - 계통학의 역사 및 분지론의 탄생 2-2. 현재 - 분지론 2-3. 미래 및 결론 3. 참고문헌 1 1. 서론 우리나라에서는 매년 여름 비무장지대를 중심으로 말라리아가 말썽을
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.381-404 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.381 A study on Characteristics of Action Learning by Analyzing Learners Experiences
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationDBPIA-NURIMEDIA
논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information28 Research in Plant Disease Vol. 21 No 년 4월에 전라북도농업기술원의 노지 시험연구포장에 정식한 콜라비(품종 아삭콜)에서 처음으로 시들음병이 발생 하였다. 이병주에서 병원균을 순수분리하여 균주를 확보하 였다. 균학적 특성 및
식물병연구 Note Open Access Res. Plant Dis. 21(1) : 27-31(2015) http://dx.doi.org/10.5423/rpd.2015.21.1.027 Fusarium oxysporum First Report of Fusarium Wilt Caused by Fusarium oxysporum on Kohlrabi in Korea
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information<B3EDB9AEC1FD5F3235C1FD2E687770>
경상북도 자연태음악의 소박집합, 장단유형, 전단후장 경상북도 자연태음악의 소박집합, 장단유형, 전단후장 - 전통 동요 및 부녀요를 중심으로 - 이 보 형 1) * 한국의 자연태 음악 특성 가운데 보편적인 특성은 대충 밝혀졌지만 소박집합에 의한 장단주기 박자유형, 장단유형, 같은 층위 전후 구성성분의 시가( 時 價 )형태 등 은 밝혀지지 않았으므로
More informationÀ±½Â¿í Ãâ·Â
Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information<BABBB9AE2E687770>
253 단소산조 퉁소산조 피리산조 형성시기 재검토 49) 이진원* Ⅰ. 머리말 Ⅱ. 기존 연구성과 검토 Ⅲ. 단소산조 퉁소산조 피리산조 형성시기 검토 Ⅳ. 단소산조 퉁소산조 피리산조 형성시기 재검토의 의의 Ⅴ. 맺음말 Ⅰ. 머릿말 우리나라의 대표적인 종취관악기(縱吹管樂器)에는 무황악기(無簧樂器)인 퉁소 단소가 있 고, 유황악기(有簧樂器)로 피리와 쇄납 등이
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More information학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More informationA
2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information표현의 자유
49 정보 인권과 민주주의를 위한 입법 과제 장여경* 오병일* 정민경* 1) 목 차 I. 문제 제기 1. 정보화 정책의 주요 문제점과 과제 2. 대안으로서 정보인권 II. 표현의 자유 1. 개념 2. 입법 과제 III. 프라이버시권 1. 개념 2. 입법 과제 IV. 정보문화향유권 1. 개념 2. 입법 과제 V. 정보접근권과 인터넷 망중립성 1. 개념 2. 입법
More informationMain Title
2003 5140001 IMD WCY IMD 2003 (, 54 ), Competitiveness Valuation International, Inc. Korea Partner of IMD WCY jeong@cvikorea.net page 1 2003, Jin-Ho Jeong, CVI, Korea Partner of IMD +41-25-618-0251 Fax
More informationHigh Resolution Disparity Map Generation Using TOF Depth Camera In this paper, we propose a high-resolution disparity map generation method using a lo
High Resolution Disparity Map Generation Using TOF Depth Camera In this paper, we propose a high-resolution disparity map generation method using a low-resolution Time-Of- Flight (TOF) depth camera and
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information식물병연구 Res. Plant Dis. 25(1): (2019) Note Open Access Plasmodiophora brassicae Ocurrence of Clubroot Cau
식물병연구 Res. Plant Dis. 25(1): 33-37 (2019) Note Open Access https://doi.org/10.5423/rpd.2019.25.1.33 Plasmodiophora brassicae Ocurrence of Clubroot Caused by Plasmodiophora brassicae on Kohlrabi in Korea
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More information02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More information42(3) 표2-영문( ).fm
Korean J. Pl. Taxon. 43(1): 46-55 (2013) http://dx.doi.org/10.11110/kjpt.2013.43.1.46 ISSN 1225-8318 Korean Journal of Plant Taxonomy Taxonomic position of Taxus cuspidata var. latifolia endemic to Ulleung
More information300 구보학보 12집. 1),,.,,, TV,,.,,,,,,..,...,....,... (recall). 2) 1) 양웅, 김충현, 김태원, 광고표현 수사법에 따른 이해와 선호 효과: 브랜드 인지도와 의미고정의 영향을 중심으로, 광고학연구 18권 2호, 2007 여름
동화 텍스트를 활용한 패러디 광고 스토리텔링 연구 55) 주 지 영* 차례 1. 서론 2. 인물의 성격 변화에 의한 의미화 전략 3. 시공간 변화에 의한 의미화 전략 4. 서사의 변개에 의한 의미화 전략 5. 창조적인 스토리텔링을 위하여 6. 결론 1. 서론...., * 서울여자대학교 초빙강의교수 300 구보학보 12집. 1),,.,,, TV,,.,,,,,,..,...,....,...
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information03권동희(17-26)ok
Geographical Analysis of National Monument Topography* Kwon, Dong-Hi 1) Abstract : As of January 2010, 59 topography have been designated as national monuments. From the geographical point of view, these
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information<C7A5C1F620BEE7BDC4>
연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information<B9D9C0CCBFC0BBFDB8EDB0F8C7D02DB1E2C3CABBFDB9B0C1A4BAB8C7D DC3D6C1BE2D2D2D2D2D2D2D2D2D2D2D2D2D2D2E687770>
110 PRIME 산업연계교육활성화선도대학사업 그림 7.5. 계통수를뉴윅형식으로표현하기. 그림 7.6. 가지의길이또는절의통계적지지도를포함한계통수와이에대한기본적뉴윅형식. 그림 7.6 의계통수에서제시된기본적뉴윅형식에절의길이에대한정보 ( 붉은색숫자 ) 를추가하려면다음과같이나타낼수있다. (((A:1,B:1):1,C:2):2,(D:1,E:1):3) 또한부트스트랩값 (bootstrap
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More information11¹Ú´ö±Ô
A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationPress Arbitration Commission 62
제 2 부 언론관련판결 사례 제1장 명예훼손 사례 제2장 재산권 침해 사례 제3장 기타 인격권 침해 사례 제4장 형사 사례 제5장 헌법재판소 결정 사례 편집자 주 - 사건관계인의 인격권을 보호하기 위해 필요한 경우 사건관계인의 이름, 소속회사, 주 소, 차량번호 등을 비실명 익명처리하고 필요한 경우 최소한의 범위내에서 판결문의 일부를 수정 또는 삭제함을 알려드립니다.
More information