3-오정석( ).hwp
|
|
- 유정 방
- 2 years ago
- Views:
Transcription
1 한국생물공학회지제 23 권제 6 호 Korean J. Biotechnol. Bioeng. Vol. 23, No. 6, (2008) 대장균의 UDP-glucose regeneration 시스템을이용한이당류합성에관한연구 오정석조지아공대화학생명공학과 ( 접수 : , 게재승인 : ) Disaccharide Synthesis using E. coli UDP-glucose regeneration system Jeong Seok Oh School of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, Georgia (Received : , Accepted : ) UDP-glucose regeneration system using metabolic engineeringis unique and efficient strategy for oligosaccharide synthesis. To exploit the efficient UDP-glucose regeneration system, we introduced four enzymes, which would be important in partitioning the flux of UDP regenerationsuch as UDP-glucose pyrophosphorylase, UDP-Kinase gene, UDP-galactose 4-epimerase, and ß-1, 4-galactasyltrasnsferase, into E. coli AD202. To determine the optimal expression level for UDP-regeneration, LacNAc concentration was compared depending on IPTG concentration. 0.5 mm IPTG induction showed the higher oligosaccharides synthesis. Using metabolic engineering under optimal IPTG induction, LacNAc synthesis of AD202/pQNGLU increased until 16 h and showed the 1.34 mm. This concentration is 10 times higher than that of control strain at same reaction time. Lactose of AD202/pQNGLU showed the maximum synthesis of 0.39 mm at 16 h and showed the 2.6 times higher than that of control strain. Key Words : Metabolic engineering UDP-glucose regeneration; Oligosaccharide synthesis; E. coli whole-cell biocatalytic synthesis 1) 서론 올리고당은 antibody 나 protein 의 cofactor 로서, 박테리아와바이러스 receptor 와같은다양한종류의생화학적인합성에중요한역할을해왔고 (1, 2), 이를산업적으로합성하기위해서화학적또는생촉매적합성방법이고안되었다. 화학적인합성방법은여러단계의 protection 과 deprotection 을거치기때문에생산성과합성수율이낮아산업화를하기에는비효율적이다 (3). 반면에효소나 whole-cell 시스템을이용하는생촉매방법은화학적인방법에비해서단계가단순화되어산업적으로더실용적이고, 효과적인방법으로인식되고있다 (4, 5, 6, 7). 대사공학은유전자재조합기술과분자생물학및화학공학적기술을이용하여새로운대사회로를도입하거나기존의대사회로를제거, 증폭, 변경시켜세포나균주의대사특성을원하는방향으로바꾸는일련의기술이다 (8). 대사공학을사용한 whole-cell Corresponding Author : School of Chemical and Biomolecular Engineering, Georgia Institute of Technology, Atlanta, Georgia Tel : , Fax : ojseok@gmail.com 시스템은올리고당합성에있어서큰장점을가지고있다 (9, 10, 11, 12). whole-cell 시스템을이용한효율적인올리고당합성방법에사용되는제한인자는 NAD 나 NADH 와달리 multi-pathway 에의해서공급되는인자이다. 따라서원활한 cofactor 공급시스템개발이필요하게되었다. 가장잘알려진대장균시스템 (13, 14) 은자연적으로 UDP-glucose regeneration 시스템을가지고있다 (15). 하지만자연적인대장균의 UDP-glucose regeneration 효율은높지않기때문에 regeneration 효율을높이기위해서대사공학적인접근이필요하다 (16). 본논문에서는올리고당합성능력을향상시키기위해서대사공학적인방법을사용하여 UDP-glucose regeneration 효율을증가시켜연구를수행하였다. 재료및방법 균주및배양조건 Biology reagents 들은 Qiagen, Invitrogen, Promega, 그리고 BioRad 에서구입하였고, 시약들은 Sigma-Aldrich 와 Fisher 에서구입하여사용하였다. 사용한 bacterial strains 과 plasmid 는 Table 1 에정리해놓았다배양조건은다음과같다. LB 배지를사용하여 30, 250 rpm 474
2 Oh, J. S., Disaccharide Synthesis using E. coli UDP-glucose regeneration system 475 에서 OD 600nm 가 될때까지배양을수행한후 IPTG 를첨가하고, 충분한양의효소를발현시키기위해서 5 시간더배양하였다. 5 시간배양후 centrifuge 를통해서 cells 을수집하고 PBS buffer 로세척한후 reaction buffer {1M Tris-HCl (7.5) 20 mm K 2HPO 4, 2 mm MnCl 24H 2O, 200 mm glucose, 5 g/l MgSO 47H 2O, 50 mm GluNAc} 로 resuspend 시켜 30, 250 rpm 에서 LacNAc 합성배양을수행하였다. Table 1. Bacterial strains and plasmid used in this work Strain/plasmid Description Source/reference Bacterial strains: E. coli JM109 F trad36 proa+b+laciq (lacz)m15/ (lac -proab) glnv44 e14- gyra96reca1 rela1 [20] enda1 thi hsdr17 E. coli AD202 ompt::kan Dr. Wakarchuk [17] Plasmids: pgem-t Easy vector amp r Promega pqe80l Commercial expressional vector containing T5 promoter and laci q Qiagen pmuel pqe80l containing pgm, galu and gale: lgtb fustion gene Mao et al. pt-ndk pgem-t easy vector containing ndk gene This study pqu pqe80l containing galu gene This study pqnu pqe80l containing ndk and galu gene This study pqnglu pqe80l containing ndk, gale: lgtb fustion and galu gene This study 플라스미드제작발현시킬 gene 들은 ribosome binding site 와 stop cordon 를가지고, 하나의 promoter 하에서발현이될수있도록플라스미드를제작하였다. E. coli UDP-glucose pyrophosphorylase gene (galu) 은 JM109 genomic DNA 에서 forward primer (ATATCTGCAGTGCGATACAGAAATATGAACAC, PstI) 와 reverser primer (TACTAAGC TTGATTGCTCAACGCCG, HindIII) 를사용하여증폭시켰다. 증폭된 galu gene (1 kb) 은 pqe80l 벡터에삽입이되어 pqu 벡터가되었다. E. coli UDP-kinase gene (ndk) 은 JM109 genomic DNA 에서 forward primer (5 -ATATAGATCTATGGCTATTGAACGTACTTTTTCC-3, BglII) 와 reverse primer (5 -TAGGATCC TTATTAACGGGTGCGC, BamHI ) 를사용하여증폭되었다. 증폭된 ndk (428 bp) gene 은 pgem-t Easy vector 에삽입이되어 pt-ndk 벡터가되었고. pt-ndk 벡터를 restriction 효소 BglII 와 SacI 으로처리한후 BglII 과 BamHI-SacI 을가진 ndk gene 얻었다. 이 ndk gene 를 pqu 벡터에삽입하여 pqnu 벡터를만들었다. gale:lgtb fusion gene (2 kb) 은 pmuel 벡터에서 forward primer (5 -AGAGA GATCTCACACAGAATTCATTAAAGAGGAG-3, BglII) 와 reverseprimer (5 -CTTCTCGAGTCTATCAACAGGAGTCCAAGCT, XhoI) 를사용하여증폭하고, pqnu 에삽입하여 pqnglu 벡터를만들었다. 분석방법 UDP-kinase (Ndk), UDP-glucose pyrophosphorylase (GalU) 와 UDP-galactose 4 -epimerase fused with ß-1, 4-galactosyltrasnsferase (GalE:LgtB) 의발현은 SDS-PAGE gel 를통해서확인하였다. Carbohydrate 농도는 CarboPac PA20 analytical column 을가진 Dionex BioLC system (Sunnyvale, CA) 을사용하여측정하였다. 측정방법은다음과같다. Dionex ED50 electrochemical detector 의 pulsed amperometry (waveform: t=0.41 s, p=-2.00 V; t=0.42 s, p=-2.00 V; t=0.43 s, p=0.60 V; t=0.44 s, p=-0.10 V; t=0.50 s, p=-0.10 V) 를사용하였는데, 200 mm sodium hydroxide (A) 와 18 MΩ-cm water 로구성된 mobile phase 을사용하였고, linear gradient 는 t=0 min, 5:95 (A:B); t=5 min, 5:95; t=10 min, 20:80; t=20 min, 20:80; t=21 min, 100:0; t=30 min, 100:0; t=35 min, 5:95; t=50 min, 5:95 이다 Lactose and LacNAc 농도는 standard 용액으로측정한 calibration curves 를사용하여결정되었다. 결과 대사공학을이용한 UDP-glucose regeneration 시스템 Fig. 1 에서보듯이 UDP-glucose regeneration 시스템을이용하여올리고당을합성하는데있어서출발물질은 UDP-glucose 이고, regeneration flux 에관여하는효소는 4 가지이다. 본연구에서는효율적인 UDP-glucose regeneration system 을위해서 regeneration flux 에관련된 4 가지효소 (UDP-galactose-4 -epimerase, β-1,4- galactosyltransferase, UDP-kinase, UDP-glucose pyrophosphorylase) 들이한벡터에서각각발현되는시스템을사용하였다 (Fig. 2). 대사공학적으로구축된 UDP-glucose regeneration system 의효율성을확인하기위해서 E. coli AD202 에 vector 를 transformation 시켰고, 0.5 mm 의 IPTG 를첨가하여 regeneration flux 에관련된효소들의발현은 SDS-PAGE gel 상에서확인하였다. Fig. 3 에서보듯이 UDP-galactose-4 -epimerase 와 β-1,4-galactosyltransferase 의 fusion protein 은 68 KD, UDP-glucose pyrophosphorylase 은 32 KD 그리고 UDP-kinase 15.3 KD 로정확한크기의발현을확인할수있었다. UDP-glucose regeneration system 이 disaccharide 합성에미치는영향새롭게구축된 UDP-glucose regeneration system 에서의 LacNAc 합성에필요한최적효소의발현량을정하기위해서다양한 IPTG 농도 (0.1, 0.3, 0.5, 1mM) 에서 LacNAc 합성정도를비교해보았다. 샘플은다양한농도의 IPTG 첨가하고 5 시간동안효소를발현시킨후 reaction buffer 에서 20 시간배양을하였고, 일정량을취하여분석하였다. 다양한 IPTG 농도실험에서가장높은 LacNAc 합성농도는 0.5 mm 이다. Disaccharide 합성정도를최적의 IPTG 농도에서시간에따라비교해보았다. Fig. 5A 에서보듯이 E. coli AD202/pQNGLU 의 LacNAc 농도는 16 시간까지증가하는경향을보였고, 최대 LacNAc 농도는 1.34 mm 이다. 이농도는대조구인 AD202/pQE80L 에비해서 10 배정도높은생산성을보이고있다. Lactose 농도를비교해보면 AD202/pQNGLU 의최대 lactose 농도는 16 시간에 0.39 mm 로대조구보다 2.6 배높은농도를나타내었다 (Fig. 5B). 결론적으로 AD202/pQNGLU 의총 disaccharide 농도는 1.73 mm 이며, AD202/pQE80L 보다 6.5 배높은생산성을보였다 (Fig. 5C).
3 476 Korean J. Biotechnol. Bioeng., Vol. 23, No. 6 고찰 본논문에서는 oligosaccharide 합성에있어서 glucose-6-phosphate 에서 UDP-glucose 로가는 carbon flux 보다 UDP 에서 UTP 로전환시킨후 UDP-glucose 를재순환시키는것이더효율적인 flux 로가정하였다 (Fig. 1). 왜냐하면 oligosaccharide 합성은에너지의존적인시스템으로원활한 cofactor 의공급이제한인자이기때문이다. UDP-glucose regeneration 을간략하게설명하면다음과같다. UDP-kinase 에의해서 UDP 는 UTP 전환되고, UTP 는 UDP-glucose phosphorylase 에의해서 glucose-1-phosphate 에서 UDP-glucose 를전환된다. 이때만들어진 UDP-glucose 는 UDP-galactose-4-epimerase 와 β-1,4-galactosyltransferase 에의해서 N-acetyllactosamine (LacNAc) 이나 lactose 로전환되면서 UDP 를방출하게된다. 이때방출된 UDP 는 UDP-kinase 에의해서다시 UTP 가된다 (Fig. 1). Figure 2. Maps of pqnglu. Abbreviations are as follows: Amp R : ampicillin resistance gene; ColEI: ColEI origin of replication; gale:lgtb: fusion gene of UDP-galactose-4-epimerase and β-1,4-galactosyltransferase; galu: UDP-glucose pyrophosphorylase gene; ndk: UDP-kinase RBS: ribosome binding site; T5: T5 promoter. Figure. 1. Metabolic network of UDP-glucose (UDP-Glc) synthesis in E. coli. ACoA: acetyl-coa; ATP: adenosine triphosphate; Glc: glucose; G1P: glucose-1-phosphate; G6P: glucose-6-phosphate; GlcNAc: N-acetylglucosamine; G3P: glyceraldehyde-3-phosphate; KDGP: 2-keto-3-deoxygluconate-6-phosphate; LacNAc: N-acetyl lactosamine; PEP: phosphoenol-pyruvate; 6PG: 6-phosphogluconate; PRPP: 5-phosphoribosyl-1-pyrophosphate; PYR: pyruvate; R5P: ribose-5-phosphate; TCA cycle: tricarboxylic acid cycle; UDP-Gal: UDP-galactose; UDP-Glc: UDPglucose; UDP: uridine diphosphate; UMP: uridine monophsphate; UTP: uridine triphosphate. Enzymes/Proteins: 1: glucose-binding-protein for glucose uptake; 2: hexokinase; 3: phosphoglucomutase; 4: UDP-glucose pyrophosphorylase 5: UDPgalactose-4-epimerase; 6: β-1,4-galactosyltransferase 7: glucose-6-phosphate dehydrogenase; 8: 6-phosphogluconate dehydrogenase; 9: ribose-phosphate diphosphokinase; 10: orotate phosphoribosyltransferase and orotidine- 50-phosphate decarboxylase; 11: uridylate kinase; 12: UDP kinase; 13: phosphoglucose isomerase; 14: fructose-phosphate kinase and fructose diphosphate aldolase;15: glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate mutase, and enolase; 16: pyruvate kinase; 17: pyruvate dehydrogenase multienzyme complex; 18: citrate synthase. 효율적인효소발현을위해서하나의 vector 시스템을사용하였다. 각효소들은 ribosome binding site 와 stop cordon 을가지고 T5 promoter 에의해서발현을시켰고, SDS-PAGE 로확인을하였다 (Fig. 2, 3). Figure 3. Analysis of expression of Ndk, GalE:LgtB, GalU of AD202/pQNGLU by SDS-PAGE. The 68, 32, and 15.3 kd bands correspond to the fusion protein, GalU and Ndk proteins. The samples were taken 5 h after induction with 0.5 mm IPTG. UDP-glucose regeneration 의효율은각효소들의발현량에의존적이다. 따라서 IPTG 농도에따른 LacNAc 합성정도를비교해보았다 (Fig. 4). 0.5 mm IPTG 농도에서최대의 LacNAc 농도를나타내었다. 하지만 1 mm IPTG 에서는 0.5 mm IPTG 에서보다낮은 LacNAc 농도를나타내었다. 이것은각효소들의 overexpression 에의한 metabolic burden(18, 19) 으로추측된다. 대사공학적으로재구성된 metabolic flux regeneration 을가진 AD202/pQNGLU 은 Fig. 5 에서보듯이원활한 UTP 공급과효율적인 UDP-glucose 전환에의해서대조구인 AD202/pQE80L 보다높은 LacNAc 합성정도를보였다 (Fig. 5).
4 Oh, J. S., Disaccharide Synthesis using E. coli UDP-glucose regeneration system 477 본논문에서 metabolic flux regeneration 으로 disaccharides 합성을증가시킬수있다는것을보여주었다. 이전략은또한다른 oligosaccharides 합성에도적용시킬수있다. 왜냐하면 UDP-glucose 는 UDP-galactose 나 UDP-glucuronic acid 와같은다른 UDP-sugars 의 starting material 이기때문이다. 요약 Figure 4. LacNAc production depending on IPTG concentrations. The samples were taken the more 20 h culture after 5 h expression with different IPTG induction, centrifuge cells and resuspend with reaction buffer. 효율적인 UDP-glucose regeneration system 을구축하기위해서재순환시스템에관여하는 4 가지효소 (UDP-glucose pyrophosphorylase, UDP-Kinase gene, UDP-galactose 4-epimerase, and ß-1, 4-galactasyltrasnsferase) 들을 E. coli AD202 에서발현시켜 Disaccharide 합성정도를보았다. Disaccharide 는 0.5 mm IPTG 농도에서가장높은농도를나타내었다. 대조구와비교한결과 LacNAc 농도는 1.34 mm 로 10 배정도정가하였고, lactose 농도는 0.39 mm 로대조구보다 2.6 배증가하였다. 총 disaccharide 농도는 1.73 mm 이며, 대조구보다 6.5 배높은생산성을보였다. 본논문은결과는 metabolic flux regeneration 으로 disaccharides 합성을증가시킬수있다는것을보여주었다. Acknowledgment (A) 이논문은 2005 년도정부재원 ( 교육인적자원부학술연구조성사업비 ) 으로한국학술진흥재단의지원을받아연구되었음 (KRF D00255). REFERENCES (B) (C) Figure 5. Time course of disaccharide synthesis: (A) LacNAc, (B) Lactose, (C) total disaccharides, ( )AD202/pQE80L, ( )AD202/pQNGLU. 1. Wong, C.-H. and G. M. Whitesides (1994), Enzymes in Synthetic Organic Chemistry 12. 1st edition. New York: Oxford. 2. Gabius, H.-J. and S. Gabius (1997), Glycoscience: status and perspectives. Champman and Hall Gmbh. Weinheim, Germany. 3. Flowers, H. M. (1978), Chemical synthesis of oligosaccharides. Methods Enzymol. 50, Flitsch, S. L. (2000), Chemical and enzymatic synthesis of glycopolymers. Curr. Opin. Chem. Biol. 4(6), Koeller, K. M. and C. H. Wong (2000), Complex carbohydrate synthesis tools for glycobiologists: enzyme-based approach and programmable one-pot strategies. Glycobiology 10(11), Crout, D. H. and G. Vic (1998), Glycosidases and glycosyl transferases in glycoside and oligosaccharide synthesis. Curr. Opin. Chem. Biol. 2(1), Meynial-Salles, I and D. Combes. (1996), In vitro glycosylation of proteins: An enzymatic approach. J. Biotechnol. 46(1), Bailey, J. E. (1991), Toward a science of metabolic engineering. Science 252, Bettler, E., E. Samain, V. Chazalet, C. Bosso, A. Heyraud, D. H. Joziasse, W. W. Wakarchuk, A. Imberty, and R. A. Geremia. (1999), The living factory:in vivo production of N-acetyllactosamine containing carbohydrates in E. coli. Glycoconjugate J. 16, Endo, T. and S. Koizumi (2000), Large-scale production of oligosaccharides using engineered bacteria. Curr. Opin. Struct. Biol. 10, Endo, T., S. Koizumi, K. Tabata, S. Kakita, and A. Ozaki. (1999),
5 478 Korean J. Biotechnol. Bioeng., Vol. 23, No. 6 Largescale production of N-acetylactosamine through bacterial coupling. Carbohydrate Res. 316, Ruffing, A. and R. R. Chen. (2006), Metabolic engineering of microbes for oligosaccharide and polysaccharide synthesis. Microbial Cell Factories 5, Jana, S. and J. K. Deb, (2005), Strategies for efficient production of heterologous proteins in E. coli. Appl. Microbiol. Biotechnol. 67, Sorensen, H. P. and K. K. Mortenson. (2005), Advanced genetic strategies for recombinant protein expression in E. coli. J. Biotechnol. 115, Hokke, C. H., A. Zervosen, L. Ellig, D. H. Joziasse, and D. H. Van den Eijnden. (1996), One-pot enzymatic synthesis of the Gal α13galβ14glcnac sequence with in situ UDP-Gal regeneration. Glycoconj. J. 13, Ruffing, A., M. Zichao, and R. R. Chen. (2006), Metabolic engineering of Agrobacterium sp. for UDP-galactose regeneration and oligosaccharide synthesis. Metabolic. Eng. 8, Nakano, H., T. Yamazaki, T. Ikeda, H. Masai, S. Miyataki, and L. Saito. (1994), Purification of glutathione S-transferase fusion proteins as a nondegraded form by using a protease-negative E. coli strain, AD202. Nucleic. Acids. Res. 22, Rozkov, A. Avignone-rossa, F. ERTL, Jones, D. O'kennedy, J. J. Smith, J. W. Dale, and M. E. Bushell. (2004), Characterization of the Metabolic burden on Escherichia coli DH1 cells imposed by the presence of a plasmid containing a gene therapy sequence. Biotechnol. Bioeng. 88, Dave, S.-W. O., P. M. Nissom, R. Philp, S. K.-W. Oh, and M. G.-S. Yap. (2006), Global transcriptional analysis of metabolic burden due to plasmid maintenance in Escherichia coli DH5 during batch fermentation. Enzyme Microb. Technol. 39, Yanisch-Perron, C., J. Vieira, and J. Messing. (1985), Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and puc19 vectors. Gene 33,
Chapter 14
5 주 Gycoysis 5.1 Gycoysis의일반적특징 Gycoysis - Gucose가 degradation 과정을거쳐두개의 pyruvate를형성하는과정. - 이때발생하는 free energy는 ATP와 NADH로보존됨. - Gucose 2 Pyruvate - ADP phosphoryation을통하여, ATP 형성 - NAD + 로 hydride ion
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationPowerPoint Presentation
Interchapeter B : 핵산생물공학기술 (part A) Recombinant DNA techniques - 전기영동 - 제한효소 - 클로닝 - 대장균을이용한단백질대량생산 Agarose mesh DNA 분리기술 : Agarose Gel Electrophoresis ( 수평형 ) _ + DNA is negatively charged from the phosphate
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationGlucose pyruvate (EMP경로, HMP 경로, ED 경로 ) 1 Embden-Meyerhof-Parnas pathways(emp 경로 ) - 전체적인반응 : Glucose 2 pyruvate + 2ATP + 2NADH 지방과인지질합성
Chapter 7. 미생물대사 (Microbial Metabolism) 탄수화물대사 : EMP경로, HMP경로, ED경로, TCA cycle, Glyoxylate 회로 지방대사 : β-산화, 지방산합성 ( 중성지방, phospholipid 단백질대사 : transamination, decarboxylation 전자전달과산화적인산화반응 * ATP 생성경로 :
More informationA
2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information제 6 주차 : 16 장계속 피루브산형성과함께추가의 ATP 가생성된다 *3-PG 2-PG (by phosphoglycerate mutase): 효소의 histidine 잔기가인산화된상태로반응 에참여. Enz-his-P + 3-PG Enz-his + 2,3-BPG Enz
제 6 주차 : 16 장계속 피루브산형성과함께추가의 ATP 가생성된다 *3-PG 2-PG (by phosphoglycerate mutase): 효소의 histidine 잔기가인산화된상태로반응 에참여. Enz-his-P + 3-PG Enz-his + 2,3-BPG Enz-his-P + 2-PG 의순서로일어나며 2,3-BPG 가중간물질로생성 *2-PG Phosphoenolpyruvate
More informationweek4.hwp
4 세포생화학반응 4.1 개요세포안에서일어나는모든생화학반응을일컬어대사작용 (metabolism 이라한다. 세포는대사작용을통해에너지와환원력을만들고세포를구성하는고분자물질을합성하게된다. 세포대사는물질을분해하는이화작용 (catabolism 과새로운물질을합성하는동화작용 (anabolism 으로구분된다. 이화작용은에너지와환원력을얻기위해서기질을분해하고동시에산화시키는과정이고,
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationPowerPoint 프레젠테이션
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More information........
Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering
More informationChapter 11
Chapter 14 Regulation of Bacterial Gene Transcription 1 14.1 Messenger RNA Characteristic of Bacterial mrna; 1. monocistronic or polycistronic 박테리아에서는전사가끝나기전에해독이일어나 nascent RNA 를변화시킬수있는기회가없으나진핵세포에서는초기전사체를핵내에서성숙된
More informationweek_6-16장.hwp
Chapter 16: 해당과글루코스신생합성 * 해당과정 (glycolysis) 은한분자의글루코스를두분자의피루브산 (pyruvate) 으로대사하는 10 여개의연속된반응들로이루어지고 2 분자의 ATP 가알짜로발생하는무산소성과정이다 * 이후 pyruvate 는주로세갈래경로를밟을수있는데 : 1. 유산소호흡 (aerobic respiration) 을하는세포에서는 acetyl
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationOP_Journalism
1 non-linear consumption 2 Whatever will change television will do so by re-defining the core product not just the tools we use to consume it. by Horace Dediu, Asymco 3 re-defining the core product not
More informationuntitled
Clinical Pediatric Hematology-ncology Volume 20 ㆍ Number 1 ㆍ April 2013 REVIEW ARTICLE 적혈구효소검사 송정한 서울대학교의과대학분당서울대학교병원진단검사의학과 Junghan Song, M.D. Department of Laboratory Medicine, Seoul National University
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information슬라이드 1
1. 에너지, 효소와조절 (1) 에너지와일 (2) 효소 (3) 물질대사조절 2. 에너지생성 (1) 물질대사개요 (2) 포도당분해 (3) 발효 (4) TCA 회로 (5) 전자전달과산화적인산화 (6) 무기호흡 (7) 탄수화물분해 (8) 지질이화 (9) 단백질이화 (10) 무기분자산화 (11) 광합성 3. 에너지이용 (1) 생합성 (2) 광합성 (3) P. S.
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationLehninger Principles of Biochemistry 5/e
David L. Nelson and Michael M. Cox LEHNINGER PRINCIPLES OF BIOCHEMISTRY Fifth Edition CHAPTER 18 Amino Acid Oxidation and the Production of Urea 2008 W. H. Freeman and Company Dietary proteins Synthesis
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationLehninger Principles of Biochemistry 5/e
David L. Nelson and Michael M. Cox LEHNINGER PRINCIPLES OF BIOCHEMISTRY Fifth Edition CHAPTER 17 Fatty Acid Catabolism 2008 W. H. Freeman and Company Chap. 17. Fatty acid oxidation 지방산의소화, 동원그리고운반 1. 식이성지방
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information(......).hwp
7 6 4 10 20 30 ph 5 4 3 0 10 20 30 40 50 60 Fermentation time(day) Fig.2-1. Changes of ph in DLMK according to various fermentation temperature 2 4 10 20 30 Acidity (%) 1 0 0 10 20 30 40 50 60 Fermentation
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
More information3. 클라우드 컴퓨팅 상호 운용성 기반의 서비스 평가 방법론 개발.hwp
보안공학연구논문지 Journal of Security Engineering Vol.11, No.4 (2014), pp.299-312 http://dx.doi.org/10.14257/jse.2014.08.03 클라우드 컴퓨팅 상호 운용성 기반의 서비스 평가 방법론 개발 이강찬 1), 이승윤 2), 양희동 3), 박철우 4) Development of Service
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information00내지1번2번
www.keit.re.kr 2011. 11 Technology Level Evaluation ABSTRACT The Technology Level Evaluation assesses the current level of industrial technological development in Korea and identifies areas that are underdeveloped
More informationSubject : 귀사의 일익번창하심을 진심으로 기원합니다.
1. 18 D-303 Tel : () 031-711-1560 Fax : 031-711-1563 www.iontec.co.kr e-mail : ion@iontec.co.kr (organic reaction). (esterification) (hydrolysis of ester). Porous type (alkylation) system. ( gel type ).
More informationstep 1-1
Written by Dr. In Ku Kim-Marshall STEP BY STEP Korean 1 through 15 Action Verbs Table of Contents Unit 1 The Korean Alphabet, hangeul Unit 2 Korean Sentences with 15 Action Verbs Introduction Review Exercises
More informationGlutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 29(4): 244-249 (2014) http://dx.doi.org/10.7841/ksbbj.2014.29.4.244 ISSN 1225-7117 / eissn 2288-8268 연구논문 재조합대장균에서 MaoC 를이용한지방산으로부터의중간사슬길이폴리하이드록시알칸산생산연구
More information45(3)-6(040)p fm
The Korean Journal of Microbiology, Vol. 45, No. 3, September 009, p. 63-67 Copyright 009, The Microbiological Society of Korea RpoS ³ ³ ƒ 1, Á½ ³ 1 * w w w w s» p RpoS w s w x w. ³ proline w w proba proc
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와
류코노스톡발현시스템개발연구동향 충북대학교식품생명공학과한남수교수 1. 류코노스톡및이의발현벡터류코노스톡속은락트산, 아세트산, 알코올, 이산화탄소, 아세토인등의방향족화합물및네개의탄소함유화합물을생성하는이종발효유산균이다. 이는광범위하게채소 ( 김치, 사우어크라우트, 피클 ) 와유발효에사용되며구연산대사및디아세틸배양유제품의주된맛화합물인휘발성화합물을생산한다. 일반적으로독소를생성하지않으며호기성및혐기성조건에서성장하고
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * The Participant Expe
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.17-40 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.17 * The Participant Experiences and Expectations of Pre-service Teachers for
More information1611-01제호
발 행 인 : 안 성 모 편 집 인 : 이 원 균 대한치과의사협회 발행 홈페이지:www.kda.or.kr 주2회발행(월 목) 2008년 1월 21일 (월) 1966년 12월 15일 창간 The Korean Dental Association News 제1611호 구강보건정책관 설치 추진위 출범 알 림 범치과계 단체장 참여 첫 회의 치과 의료계 전담부서인 보건
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information슬라이드 1
DNA technology (DNA 조작기술 ) 유전자 cloning Cloning & Plasmid Joshua Ledergerg & Edward Tatum, 1946 두종류의다른유전자를가진대장균사이에유전자의재조합이일어나새로운대장균이만들어지는것을발견했다. 이원리를바탕으로 1970 년대에 DNA 재조합기술이발전하게되었다. 원핵생물에서 DNA 의이동방법 플라스미드를이용한
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationPowerPoint Presentation
CHAPTER 7 Carbohydrates 자연계에가장많이존재하며다른생물과의연결고리 CO2 + H2O 산소, 수소탄소가 (CH2O)n 의비율로존재 Cabohydrate = Carbon + Hydrates 단당류, 이당류 Oligo- 당류 다당류 CHAPTER 7 Carbohydrates 탄수화물의역할 Cabohydrate : - 탄소의수화물형태 - 생체의 energy
More information08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More informationISSN 제 3 호 치안정책연구 The Journal of Police Policies ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE
11-1320082-000013-09 ISSN 1738-2963 2015 제 3 호 치안정책연구 The Journal of Police Policies 2015. 12 ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE : 통학버스를중심으로 차례 전병주 * 최은영 ** Ⅰ. 서론 1) Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과
More information01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
More information08원재호( )
30 2 20124 pp. 173~180 Non-Metric Digital Camera Lens Calibration Using Ground Control Points 1) 2) 3) Abstract The most recent, 80 mega pixels digital camera appeared through the development of digital
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationPowerPoint Presentation
11 강 CHAPTER 6 Enzymes Allosteric enzyme 과반응속도론 보조효소와 vitamin 효소반응과대사의조절 불활성상태 기질 Allosteric enzyme ( 다른자리입체성효소 ) 는다중단백질소단위체로기본단위체에 활성 Subunit 조절 Subunit 조절자 Effector 기질이결합하면인접한기본단위체의촉매부위가활성화되는효소를말하며생화학
More information