45(2)-6(015)p fm

Transcription

1 The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p Cpyright 2009, The Micrbilgical Sciety f Krea ü Leginella spp. w w ½ *Á xá½ Á Á Áw» p y w q ³ e s k ³,»z ùy wì ƒ š ³ l 8 ¾ ü 25 w ³ 73 w x x, Dt/cm f š Pulsed field gel electrphresis (PFGE) w x q w Leginella pneumphila x x s sg1 43, sg6 9, sg5 8, sg3 8, sg2 1 q, Leginella spp. 4 Leginella nautarum. Leginella pneumphila wš, Leginella nautarum ƒ v. PFGE pattern w, Leginella pneumphilaƒ w x x w y, s ¾. Key wrds ý dt/icm, Leginella, pathgenicity, PFGE (Leginellsis) s (s x) y sp ( s x) 2ƒ ƒ y» y ³ w w (7). p ù, y w e s w. ³ m y (w, y, ) ü (Ž)y w y w (8). w ³ ƒ mw œ ³ w. œ þƒ y þƒk w, k,,, w w. û wš p š ùyƒ ƒ y þ» w ƒ wš y ³ w ƒ v w, q w w. ³ w w ƒ w mip (macrphage infectivity ptentiatr)ƒ t, Leginella pneumphila ³ w w w t» w (1, 14). mip z» macrphage ü j w w w (5, 10). w ³ s ü s phagsme-lyssme fusin s ü w s ùkü, *T whm crrespndence shuld be addressed. Tel: , Fax: kja0324@seul.g.kr phagsme-lyssme fusin w w ƒ icm (intracellula multiplicatin) (3, 12, 18). dt (defective fr rganelle traficking) s plasmid DNA ƒ w ò w s w. dt ƒ v s w (2, 18). icm/dt ³ s ü,, v, w macrphage apptsis wš(20) w ùkü (4, 9, 13) l 8 ¾ 25 x w k, x þƒk l ³ w. š x x, q Pulsed field gel electrphresis (PFGE) pattern wš ƒ q wš w. x wš ³ w w w. ³ l 8 ¾ 25 x, k, ù kü,, Õ, x þƒk 708 w ³ x w. 1L w w ³ 20 ml w w, 50 C 30 w 126

2 Vl. 45, N. 2 Leginella w š 127 z w. 0.1 ml 0.01 ml GVPC (glicine-vancmycin-plymyxin B-clisitin) ƒw BCYE-α (buffered charcal yeast extract-ketglutarate) k ƒƒ w z, 37 C 7 w. z w x cut-glass xk w BCYE-α, L-cystein v BCYE-α, x w w BCYE- w, z 2ƒ w ³ ³ w (16). Sertype Leginella pneumphila w sertype sertyping kit (Denka Seiken, Japan) w w. ³ w t 100 C C 15 ƒ w z, x w wx -w 1 ü w x x x w (6, 16). Leginella spp.» w z NCB GenBank w sertype y w. PCR w mip, icm, dt ³ w 16S rrna mip (Table 1) w PCR (plymerase chain reactin) w Leginella pneumphila Leginella spp. w. 95 C 5 initial denaturatinw z, 95 C 1, 60 C 1, 72 C 1 cycle 30z w z 72 C 5 s g. ³ w icmtsrq, icmjb, icmwx, icmlk, dtdcb primer (17)(Table 1) w ƒƒ ƒ w y w. 95 C 5 initial denaturatinw z, 95 C 1, 55 C 1, 72 C 1 30 cycle 30z w z 72 C 5 s g. PCR 1.5% agarse gel w» w z y w. Pulsed field gel electrphresis (PFGE) BCYE w 72 w x³ cell suspensin TE buffer (100 ml Tris, 100 mm EDTA, ph 7.5) xkw k 13~15%ƒ w z, prteinase 10 µl ³ xk 200 µl yww. ³ xk yw 200 µl 1.2% agarse slutin ƒw plug mld 4 C, 5 x k. Prteinase K (20 mg/ml stck) 40 µl ES buffer 1.5 ml yw plug 55 C k w 2 w z, 55 C ³ 15 1z, 55 C Plug Wash TE buffer 30 5z w. óù plug 1mm Ì, Sfi ƒ yw 50 C w 2 g. óù z plug gel x cmb e k, 1% agarse gel xp z CHEF Mapper PFGE system (BiRad, USA) w gradient 6.0 V/cm, included angle 120, initial time 2.16 sec, final time sec 14 C 18» w. EtBr (0.5 µg/ml) gel 30 w z, k e transilluminatr w y w. PFGE BiNumerics sftware versin 3.5 (Applied Maths, Belgium) w dendrgram w w. ³ x x Leginella pneumphila ³ x x s 1 x 43 (62.3%), 6x 9 (13.0%), 5x 8 (11.6%), 3x 8 (11.6%), 2x 1 (1.4%) y (Table 2). Seung (16) w Leginella spp.ƒ 4, Leginella pneumphila x x s w y wš ƒ š, 4x Table 1. Primer sequence used in this study Primer Sequence (5 3 ) Prduct size 16S rrna mip icmtsrq icmjb icmwx icmlk dtdcb F : AGGGTTGATAGGTTAAGAGC R : CAACAGCTAGTTGACATCG F : GGTGACTGCGGCTGTTATGG R : GGCCAATAGGTCCGCCAACG F : CACAGTTAAAACTTCAAGCTGAACC R : CTGCTCAGAGCTATTTTT F : TGCCATGTTCTTTTTTGTGCTATTAC R : GAGCGTAAACCAGATCAATCCAAGTAG F : TGGGTTGGTTCCTGAGGTATGA R : TGGGGCGCTGAAATTTTGATAT F : CGGAAGGCTGGGACCAATT R : CCACTCGATAATCCACGGCTTTC F : CGATTGGTCTGGTCCGATTGA R : TCTCGAATAATGGAAGCTAACAATGTC 386 bp 630 bp 2.1 kb 1.8 kb 1.0 kb 1.0 kb 1.6 kb

3 128 Jin-Ah Kim et al. Kr. J. Micrbil Table 2. Descending rder f sergrup f L. pneumphila Species Sergrup Number f islates (%) L. pneumphila (62.3%) 9(13.0%) 8(11.6%) 8(11.6%) 1(1.4%) 0 Ttal 69. 6x x ƒ w w. 6x ƒ 1x w x x ùkù, ù w w x x dw. Leginella spp. ³ wš wx» w. 4 Leginella nautarum. PCR w ³ 73 16S rrnaƒ š 4 Leginella spp. w 68 mip ƒ Leginella pneumphila y. Leginella pneumphila 22-kb DNA lcus ewš ƒ icm macrphage killing ù w (cnjugatin) w š(15), dt 20-kb j» regin ù w w ù, s ƒ ³ DNA (18). icm/dt ³ w s l s l k ¾ w öe w. Leginella pneumphila icmtsrq, icmjb, icmwx, icmlk, dtdcbƒ ³ 20 š, ƒ ³ 39, ƒ ³ 10 š w ³. 5ƒ w w,,, V, V, Nx w. x icmtsrq-icmjb-icmwx-icmlk-dtdcb, icmtsrq-icmjbicmwx-icmlk-nd, x icmtsrq-icmjb-nd-icmlk-dtdcb, Vx ND-icmJB-ND-icmLK-dtDCB, š»k Vx w ü ƒ š ³ š, w ƒ ƒ w ³ Nx t w (Fig. 1). x Leginella nautarum y w. w ƒ ³ ƒ 1 š, ù 3 w ƒ. Leginella spp.ƒ Leginella pneumphila wš Terry Alli (17), x Leginella spp. Leginella pneumphila w Fig. 1. A cumulative bar graph shwing cntributin f pathgenic gene patterns t each pulstype. A, B, D, E, F, G, and pulstype cnsist f their ne pathgenic pattern. The number in each bar means the number f islates. w. Seung (16) w, 2007 w Leginella spp.ƒ Leginella spp.ƒ wš, ü wš ³ xƒ wš. ³ ³ w v w w. PFGE ql Fig. 2 plug Sfi w w PFGE clustering w. 65%» w A~J¾ 10 x pulstype ù š, 82%» A A1~A2, B B1~B2, C C1~C4, D D1~D2, E E1~E2, F F1~F2, G G1~G5, H H1~H2, J J1~J3 subtype ƒƒ w. Leginella pneumphila ƒ x C pulstype %, G pulstype 17.4%, E pulstype 13.0%, F pulstype 5.8%, A, B, H pulstype 4.3%, D, pulstype ƒƒ 2.9%, 1.4% w. Lee (11) ƒ ³ x w ùküš. C pulstype w (Table 3 and Fig. 2), ƒ sergrup 1 ùküš ù, sergrup 6 C1, sergrup 3 C2 C ³ 66.3%. C % w ³ š, š xw, ³ ƒ r dw. C4 ³ 90% ³. D ³, F 4³ sergrup 1 ùkû D1, D2 69.6% ³, F1 ³ û ³ 82.6% ³ w. w F2 F ³ ³. H ³

4 Vl. 45, N. 2 Leginella w š 129 Fig. 2. Dendrgram shwing the clustering f PFGE patterns after Sfi digestin fr the Leginella spp. H1 ³ 88%, sergrup 6 ³, H2 sergrup 6 ù w ³ w. Seung (16) w, pulstype sergrup p ù œm ³ sergrup w x w y š. w xw sergrup 2 ƒ Leginella pneumphila w 40% w x x wš. w 4 Leginella nautarum w Leginella pneumphila w û (37.2%) š.

5 130 Jin-Ah Kim et al. Kr. J. Micrbil Table 3. Categries f PFGE pattern, sergrup, and pathgenic gene pattern f Leginella spp. islates PFGE pattern PFGE sub-pattern Sample name Sergrup Pathgenic gene pattern A A1 A2 Gangnam-9 Jung-3 Geumchen-3 B B1 B2 Gangnam-3 Gangbuk-3 Gangnam-8 C C1 C2 C3 C4 Sngpa-7 Yungdeungp-3 Yangchen-1 Yangchen-3 Yangchen-4 Yangchen-6 Jung-4 Gur-1 Geumchen-1 Map-1 Map-3 Map-4 Sengdng-1 Sengdng-2 Sengdng-3 Sengdng-4 Sngpa-1 Sngpa-5 Yungdeungp-1 Eunpyeng-1 Jngn-1 Jngn-2 Jngn-3 Sech-1 Sengbuk-1 Sengbuk-3 Gangse-1 Sedaemun-1 Gangnam-5 Gangdng-1 Gwangjin-1 Sngpa-2 D D1 D2 Gangnam-6 Geumchen-4 E E1 E2 Geumchen-2 Dbng-1 Dbng-2 Gwangjin-3 Gangnam-4 Map-2 Sngpa-3 Sngpa-4 Sngpa-6 V V V V V V V V V F F1 F2 Gangnam-1 Gangnam-12 Gangnam-13 Jung-1

6 Vl. 45, N. 2 Leginella w š 131 Table 3. Categries f PFGE pattern, Sergrup, and Pathgenic gene pattern f Leginella spp. islates (cntinued) G š ³ y w ³ w ³, k Leginella spp. w ƒ Leginella pneumphila w x x ƒ, œ w ³ dw (11, 16). Fig. 1 Table 3 A pulstype w ³ sergrup x pathgenic pattern ƒ š š, B x, D x, E 9 ƒ Vx, F x, G 12 ƒ x. ƒ ³ ƒ Cx ƒ x pathgenic pattern š x Leginella nautarum Vx Nx q. PFGE pattern pathgenic gene pattern w š, PFGE pattern w d ƒ w w. cm/dt ³ w w t, ³ w w ò w v (3, 18, 19 etc). d w, cm/dt œ Œ, ³ ƒ w. x ~Vx, Nx pathgenic gene pattern w, >=>V>V>N ƒ w. ³ pathgenic gene pattern x ƒ % wš, x %, Vx %, x 8 11%, Nx 3 4.1%, Vx 1 1.4% ùkû. Leginella nautarum Leginella pneumphila 3 ƒ ³ ƒ 100%. w ƒ sergrup 2 pathgenic gene pattern V, Leginella pneumphila sergrup 2 w w ƒ dw. 3 Leginella nautarum G1 G2 G3 G4 G5 Yangchen-7 Yangchen-8 Gangnam-14 Jung-2 Yangchen-2 Gur-2 Gangnam-10 Gangnam-11 Gangbuk-1 Eunpyeng-2 Gangnam-2 Gangbuk-2 H1 Dngjak-1 H Jung-5 H2 Gwangjin-2 1 Yungdeungp-2 sg 2 V Vx ù Nx w. 73 w PFGE w w, x x p pattern ùkü pulstype w ù, x x pulstype pathgenic gene pattern ùkù, Leginella spp.ƒ w y dw. w pulstype pathgenic gene pattern w y w, PFGE mw Leginella spp. d w œw. ³ w ƒwš y ³ w x d œ w. y w ³ wì, w š, genetic pathgenicity intracellular pathgenicity ww ³ w w w yw, x q w œw. š x 1. Amemura-Maekawa, J., F. Kura, B. Chang, and H. Watanabe Leginella pneumphila sergrup 1 islates frm cling twers in Japan frm a distinct genetic cluster. Micrbil. mmunl. 49, Berger, K.H., J.J. Merriam, and R.R. sberg Altered intracellular targeting prperties assciated with mutatins in the Leginella pneumphila dta gene. Ml. Micrbil. 14, Brand, B.C., A.B. Sadsky, and H.A. Shuman The Leginella pneumphila icm lcus: a set f genes required fr intracellular mutiplicatin in human macrphages. Ml. Micrbil. 14, Ciancitt, N.P Pathgenicity f Leginella pneumphila. nt. J. Med. Micrbil. 291, Ciancitt, N.P., B.. Eisenstein, C.H. Mdy, and N.C. Engleberg A mutatin in the mip gene results in an attenuatin f

7 132 Jin-Ah Kim et al. Kr. J. Micrbil Leginella pneumphila virulence. J. nfect Dis. 162, Denka Seiken C Bacterilgy prduct infrmatin. Denka Seiken C. Ltd. 7. Field, B.S., R.F. Bensn, and R.E. Besser Leginella and Leginnaires disease: 25 Years f investigatin. Clin. Micrbil. Rev. 15, Fliermans, C.B., W.B. Cherry, L.H. Orrisn, S.J. Smith, D.L. Tisn, and D.H. Ppe Eclgical distributin f Leginella pneumphila. Appl. Envirn. Micrbil. 41, Gal-Mr, O., T. Zusman, and G. Segal Analysis f DNA regulatry elements required fr expressin f the Leginella pneumphila icm and dt virulence genes. J. Bacteril. 184, Khler, R., J. Franghnel, B. Knig, E. Lneberg, and M. Frsch Bichemical and functinal analyses f the Mip prtein: nfluence f the N-terminal half and f peptidylprlyl ismerase activity n the virulence f Leginella pneumphila. nfect. mmun. 71, Lee, H.K., H.S. Yang, S.R. Hng, M.S. Park, S.K. Sim, B.C. Lee, and M.Y. Park Mlecular typing f Leginella pneumphila Krean islates frm 1985 t The Reprt f Natinal nstitute f Health 38, Marra, A., S.J. Blander, M.A. Hrwitz, and H.A. Shuman dentificatin f a Leginella pneumphila lcus required fr intracellular multiplicatin in human macrphages. Prc. Natl. Acad. Sci. USA 89, Mlmeret, M., M. Santic, R. Asare, R.A. Carabe, and Y. Abu- Kwaik Rapid escape f the dt/icm Mutants f Leginella pneumphila int the cytsl f mammalian and prtzan cells. nfect. mmun. 75, Nintasen, R., F. Utrarachkij, K. Siripanichgn, A. Bhumiratana, Y. Suzuki, and O. Suthienkul Enhancement f Leginella pneumphila culture islatin frm micrenvirnments by macrphage infectivity ptentiatr (mip) gene-specific nested plymerase chain reactin. Micrbil. mmunl. 51, Segal, G., M. Purcell, and H.A. Shuman Hst cell killing and bacterial cnjugatin required verlapping sets f genes within a 22-kb regin f the Leginella pneumphila genme. Prc. Natl. Acad. Sci. USA 95, Seung, H.J., J.H. Jung, S.J. Kim, Y.H. Jin, S.M. Lee, M.S. Kim, and J.G. Kim Mlecular epidemilgical study f Leginella pneumphila islated frm water systems in Seul. The Reprt f Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment 43, Terry Alli, O.A., S. Zink, N.KU vn Lackum, and Y. Abu-Kwaik Cmparative assessment f virulence traits in Leginella spp. Micrbilgy 149, Vgel, J.P., H.L. Andrews, S.K. Wng, and R.R. sberg Cnjugative transfer by the virulence system f Leginella pneumphila. Science 279, Vgel, J.P. and R.R. sberg Cell bilgy f Leginella pneumphila. Curr. Opin. Micrbil. 2, Zink, S.D., L. Pedersen, N.P. Ciancitt, and Y. Abu-Kwaik The Dt/cm type V secretin system f Leginella pneumphila is essential fr the inductin f apptsis in human macrphages. nfect. mmun. 70, (Received March 27, 2009/Accepted April 28, 2009) ABSTRACT : Mlecular Epidemilgical Relatinship f the Pathgenicity f Leginella spp. slated frm Water Systems in Seul Jin-Ah Kim*, Ji-Hun Jung, S-Jin Kim, Yung-Hee Jin, Yung-Hee Oh, and Gi-Yung Han (Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment, Gwachen , Republic f Krea) Leginella spp. is the causative agent f Leginellsis, which induces a ptentially fatal frm f pneumnia. With a cncentrated perfrmance during the summer f 2008, we secured 73 islates frm the water systems f 25 wards in Seul. We analysed sertypes, pathgenic genes (Dt/cm), and patterns f pulsed-field gel electrphresis (PFGE) in an attempt t cnfirm relatinships amng them. Different frm the previus year's pattern (2007), amng the islates, 69 were Leginella pneumphila and 4 were Leginella sppug The sertype distributin f Leginella pneumphila was sg1 43, sg6 9, sg5 8, sg3 8, and sg2 1. The sertype fr the 4 Leginella spp. was Leginella nautarum. Mst f the Leginella pneumphila had several pathgenic genes. On the ther hand, the 4 Leginella spp. were defective in pathgenicity in genmic terms. The PFGE patterns f the sertypes shwed a tendency fr diversity f Leginella pneumphila and a clse crrelatin with genetic pathgenicity.