45(2)-6(015)p fm
|
|
- 채영 전
- 8 years ago
- Views:
Transcription
1 The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p Cpyright 2009, The Micrbilgical Sciety f Krea ü Leginella spp. w w ½ *Á xá½ Á Á Áw» p y w q ³ e s k ³,»z ùy wì ƒ š ³ l 8 ¾ ü 25 w ³ 73 w x x, Dt/cm f š Pulsed field gel electrphresis (PFGE) w x q w Leginella pneumphila x x s sg1 43, sg6 9, sg5 8, sg3 8, sg2 1 q, Leginella spp. 4 Leginella nautarum. Leginella pneumphila wš, Leginella nautarum ƒ v. PFGE pattern w, Leginella pneumphilaƒ w x x w y, s ¾. Key wrds ý dt/icm, Leginella, pathgenicity, PFGE (Leginellsis) s (s x) y sp ( s x) 2ƒ ƒ y» y ³ w w (7). p ù, y w e s w. ³ m y (w, y, ) ü (Ž)y w y w (8). w ³ ƒ mw œ ³ w. œ þƒ y þƒk w, k,,, w w. û wš p š ùyƒ ƒ y þ» w ƒ wš y ³ w ƒ v w, q w w. ³ w w ƒ w mip (macrphage infectivity ptentiatr)ƒ t, Leginella pneumphila ³ w w w t» w (1, 14). mip z» macrphage ü j w w w (5, 10). w ³ s ü s phagsme-lyssme fusin s ü w s ùkü, *T whm crrespndence shuld be addressed. Tel: , Fax: kja0324@seul.g.kr phagsme-lyssme fusin w w ƒ icm (intracellula multiplicatin) (3, 12, 18). dt (defective fr rganelle traficking) s plasmid DNA ƒ w ò w s w. dt ƒ v s w (2, 18). icm/dt ³ s ü,, v, w macrphage apptsis wš(20) w ùkü (4, 9, 13) l 8 ¾ 25 x w k, x þƒk l ³ w. š x x, q Pulsed field gel electrphresis (PFGE) pattern wš ƒ q wš w. x wš ³ w w w. ³ l 8 ¾ 25 x, k, ù kü,, Õ, x þƒk 708 w ³ x w. 1L w w ³ 20 ml w w, 50 C 30 w 126
2 Vl. 45, N. 2 Leginella w š 127 z w. 0.1 ml 0.01 ml GVPC (glicine-vancmycin-plymyxin B-clisitin) ƒw BCYE-α (buffered charcal yeast extract-ketglutarate) k ƒƒ w z, 37 C 7 w. z w x cut-glass xk w BCYE-α, L-cystein v BCYE-α, x w w BCYE- w, z 2ƒ w ³ ³ w (16). Sertype Leginella pneumphila w sertype sertyping kit (Denka Seiken, Japan) w w. ³ w t 100 C C 15 ƒ w z, x w wx -w 1 ü w x x x w (6, 16). Leginella spp.» w z NCB GenBank w sertype y w. PCR w mip, icm, dt ³ w 16S rrna mip (Table 1) w PCR (plymerase chain reactin) w Leginella pneumphila Leginella spp. w. 95 C 5 initial denaturatinw z, 95 C 1, 60 C 1, 72 C 1 cycle 30z w z 72 C 5 s g. ³ w icmtsrq, icmjb, icmwx, icmlk, dtdcb primer (17)(Table 1) w ƒƒ ƒ w y w. 95 C 5 initial denaturatinw z, 95 C 1, 55 C 1, 72 C 1 30 cycle 30z w z 72 C 5 s g. PCR 1.5% agarse gel w» w z y w. Pulsed field gel electrphresis (PFGE) BCYE w 72 w x³ cell suspensin TE buffer (100 ml Tris, 100 mm EDTA, ph 7.5) xkw k 13~15%ƒ w z, prteinase 10 µl ³ xk 200 µl yww. ³ xk yw 200 µl 1.2% agarse slutin ƒw plug mld 4 C, 5 x k. Prteinase K (20 mg/ml stck) 40 µl ES buffer 1.5 ml yw plug 55 C k w 2 w z, 55 C ³ 15 1z, 55 C Plug Wash TE buffer 30 5z w. óù plug 1mm Ì, Sfi ƒ yw 50 C w 2 g. óù z plug gel x cmb e k, 1% agarse gel xp z CHEF Mapper PFGE system (BiRad, USA) w gradient 6.0 V/cm, included angle 120, initial time 2.16 sec, final time sec 14 C 18» w. EtBr (0.5 µg/ml) gel 30 w z, k e transilluminatr w y w. PFGE BiNumerics sftware versin 3.5 (Applied Maths, Belgium) w dendrgram w w. ³ x x Leginella pneumphila ³ x x s 1 x 43 (62.3%), 6x 9 (13.0%), 5x 8 (11.6%), 3x 8 (11.6%), 2x 1 (1.4%) y (Table 2). Seung (16) w Leginella spp.ƒ 4, Leginella pneumphila x x s w y wš ƒ š, 4x Table 1. Primer sequence used in this study Primer Sequence (5 3 ) Prduct size 16S rrna mip icmtsrq icmjb icmwx icmlk dtdcb F : AGGGTTGATAGGTTAAGAGC R : CAACAGCTAGTTGACATCG F : GGTGACTGCGGCTGTTATGG R : GGCCAATAGGTCCGCCAACG F : CACAGTTAAAACTTCAAGCTGAACC R : CTGCTCAGAGCTATTTTT F : TGCCATGTTCTTTTTTGTGCTATTAC R : GAGCGTAAACCAGATCAATCCAAGTAG F : TGGGTTGGTTCCTGAGGTATGA R : TGGGGCGCTGAAATTTTGATAT F : CGGAAGGCTGGGACCAATT R : CCACTCGATAATCCACGGCTTTC F : CGATTGGTCTGGTCCGATTGA R : TCTCGAATAATGGAAGCTAACAATGTC 386 bp 630 bp 2.1 kb 1.8 kb 1.0 kb 1.0 kb 1.6 kb
3 128 Jin-Ah Kim et al. Kr. J. Micrbil Table 2. Descending rder f sergrup f L. pneumphila Species Sergrup Number f islates (%) L. pneumphila (62.3%) 9(13.0%) 8(11.6%) 8(11.6%) 1(1.4%) 0 Ttal 69. 6x x ƒ w w. 6x ƒ 1x w x x ùkù, ù w w x x dw. Leginella spp. ³ wš wx» w. 4 Leginella nautarum. PCR w ³ 73 16S rrnaƒ š 4 Leginella spp. w 68 mip ƒ Leginella pneumphila y. Leginella pneumphila 22-kb DNA lcus ewš ƒ icm macrphage killing ù w (cnjugatin) w š(15), dt 20-kb j» regin ù w w ù, s ƒ ³ DNA (18). icm/dt ³ w s l s l k ¾ w öe w. Leginella pneumphila icmtsrq, icmjb, icmwx, icmlk, dtdcbƒ ³ 20 š, ƒ ³ 39, ƒ ³ 10 š w ³. 5ƒ w w,,, V, V, Nx w. x icmtsrq-icmjb-icmwx-icmlk-dtdcb, icmtsrq-icmjbicmwx-icmlk-nd, x icmtsrq-icmjb-nd-icmlk-dtdcb, Vx ND-icmJB-ND-icmLK-dtDCB, š»k Vx w ü ƒ š ³ š, w ƒ ƒ w ³ Nx t w (Fig. 1). x Leginella nautarum y w. w ƒ ³ ƒ 1 š, ù 3 w ƒ. Leginella spp.ƒ Leginella pneumphila wš Terry Alli (17), x Leginella spp. Leginella pneumphila w Fig. 1. A cumulative bar graph shwing cntributin f pathgenic gene patterns t each pulstype. A, B, D, E, F, G, and pulstype cnsist f their ne pathgenic pattern. The number in each bar means the number f islates. w. Seung (16) w, 2007 w Leginella spp.ƒ Leginella spp.ƒ wš, ü wš ³ xƒ wš. ³ ³ w v w w. PFGE ql Fig. 2 plug Sfi w w PFGE clustering w. 65%» w A~J¾ 10 x pulstype ù š, 82%» A A1~A2, B B1~B2, C C1~C4, D D1~D2, E E1~E2, F F1~F2, G G1~G5, H H1~H2, J J1~J3 subtype ƒƒ w. Leginella pneumphila ƒ x C pulstype %, G pulstype 17.4%, E pulstype 13.0%, F pulstype 5.8%, A, B, H pulstype 4.3%, D, pulstype ƒƒ 2.9%, 1.4% w. Lee (11) ƒ ³ x w ùküš. C pulstype w (Table 3 and Fig. 2), ƒ sergrup 1 ùküš ù, sergrup 6 C1, sergrup 3 C2 C ³ 66.3%. C % w ³ š, š xw, ³ ƒ r dw. C4 ³ 90% ³. D ³, F 4³ sergrup 1 ùkû D1, D2 69.6% ³, F1 ³ û ³ 82.6% ³ w. w F2 F ³ ³. H ³
4 Vl. 45, N. 2 Leginella w š 129 Fig. 2. Dendrgram shwing the clustering f PFGE patterns after Sfi digestin fr the Leginella spp. H1 ³ 88%, sergrup 6 ³, H2 sergrup 6 ù w ³ w. Seung (16) w, pulstype sergrup p ù œm ³ sergrup w x w y š. w xw sergrup 2 ƒ Leginella pneumphila w 40% w x x wš. w 4 Leginella nautarum w Leginella pneumphila w û (37.2%) š.
5 130 Jin-Ah Kim et al. Kr. J. Micrbil Table 3. Categries f PFGE pattern, sergrup, and pathgenic gene pattern f Leginella spp. islates PFGE pattern PFGE sub-pattern Sample name Sergrup Pathgenic gene pattern A A1 A2 Gangnam-9 Jung-3 Geumchen-3 B B1 B2 Gangnam-3 Gangbuk-3 Gangnam-8 C C1 C2 C3 C4 Sngpa-7 Yungdeungp-3 Yangchen-1 Yangchen-3 Yangchen-4 Yangchen-6 Jung-4 Gur-1 Geumchen-1 Map-1 Map-3 Map-4 Sengdng-1 Sengdng-2 Sengdng-3 Sengdng-4 Sngpa-1 Sngpa-5 Yungdeungp-1 Eunpyeng-1 Jngn-1 Jngn-2 Jngn-3 Sech-1 Sengbuk-1 Sengbuk-3 Gangse-1 Sedaemun-1 Gangnam-5 Gangdng-1 Gwangjin-1 Sngpa-2 D D1 D2 Gangnam-6 Geumchen-4 E E1 E2 Geumchen-2 Dbng-1 Dbng-2 Gwangjin-3 Gangnam-4 Map-2 Sngpa-3 Sngpa-4 Sngpa-6 V V V V V V V V V F F1 F2 Gangnam-1 Gangnam-12 Gangnam-13 Jung-1
6 Vl. 45, N. 2 Leginella w š 131 Table 3. Categries f PFGE pattern, Sergrup, and Pathgenic gene pattern f Leginella spp. islates (cntinued) G š ³ y w ³ w ³, k Leginella spp. w ƒ Leginella pneumphila w x x ƒ, œ w ³ dw (11, 16). Fig. 1 Table 3 A pulstype w ³ sergrup x pathgenic pattern ƒ š š, B x, D x, E 9 ƒ Vx, F x, G 12 ƒ x. ƒ ³ ƒ Cx ƒ x pathgenic pattern š x Leginella nautarum Vx Nx q. PFGE pattern pathgenic gene pattern w š, PFGE pattern w d ƒ w w. cm/dt ³ w w t, ³ w w ò w v (3, 18, 19 etc). d w, cm/dt œ Œ, ³ ƒ w. x ~Vx, Nx pathgenic gene pattern w, >=>V>V>N ƒ w. ³ pathgenic gene pattern x ƒ % wš, x %, Vx %, x 8 11%, Nx 3 4.1%, Vx 1 1.4% ùkû. Leginella nautarum Leginella pneumphila 3 ƒ ³ ƒ 100%. w ƒ sergrup 2 pathgenic gene pattern V, Leginella pneumphila sergrup 2 w w ƒ dw. 3 Leginella nautarum G1 G2 G3 G4 G5 Yangchen-7 Yangchen-8 Gangnam-14 Jung-2 Yangchen-2 Gur-2 Gangnam-10 Gangnam-11 Gangbuk-1 Eunpyeng-2 Gangnam-2 Gangbuk-2 H1 Dngjak-1 H Jung-5 H2 Gwangjin-2 1 Yungdeungp-2 sg 2 V Vx ù Nx w. 73 w PFGE w w, x x p pattern ùkü pulstype w ù, x x pulstype pathgenic gene pattern ùkù, Leginella spp.ƒ w y dw. w pulstype pathgenic gene pattern w y w, PFGE mw Leginella spp. d w œw. ³ w ƒwš y ³ w x d œ w. y w ³ wì, w š, genetic pathgenicity intracellular pathgenicity ww ³ w w w yw, x q w œw. š x 1. Amemura-Maekawa, J., F. Kura, B. Chang, and H. Watanabe Leginella pneumphila sergrup 1 islates frm cling twers in Japan frm a distinct genetic cluster. Micrbil. mmunl. 49, Berger, K.H., J.J. Merriam, and R.R. sberg Altered intracellular targeting prperties assciated with mutatins in the Leginella pneumphila dta gene. Ml. Micrbil. 14, Brand, B.C., A.B. Sadsky, and H.A. Shuman The Leginella pneumphila icm lcus: a set f genes required fr intracellular mutiplicatin in human macrphages. Ml. Micrbil. 14, Ciancitt, N.P Pathgenicity f Leginella pneumphila. nt. J. Med. Micrbil. 291, Ciancitt, N.P., B.. Eisenstein, C.H. Mdy, and N.C. Engleberg A mutatin in the mip gene results in an attenuatin f
7 132 Jin-Ah Kim et al. Kr. J. Micrbil Leginella pneumphila virulence. J. nfect Dis. 162, Denka Seiken C Bacterilgy prduct infrmatin. Denka Seiken C. Ltd. 7. Field, B.S., R.F. Bensn, and R.E. Besser Leginella and Leginnaires disease: 25 Years f investigatin. Clin. Micrbil. Rev. 15, Fliermans, C.B., W.B. Cherry, L.H. Orrisn, S.J. Smith, D.L. Tisn, and D.H. Ppe Eclgical distributin f Leginella pneumphila. Appl. Envirn. Micrbil. 41, Gal-Mr, O., T. Zusman, and G. Segal Analysis f DNA regulatry elements required fr expressin f the Leginella pneumphila icm and dt virulence genes. J. Bacteril. 184, Khler, R., J. Franghnel, B. Knig, E. Lneberg, and M. Frsch Bichemical and functinal analyses f the Mip prtein: nfluence f the N-terminal half and f peptidylprlyl ismerase activity n the virulence f Leginella pneumphila. nfect. mmun. 71, Lee, H.K., H.S. Yang, S.R. Hng, M.S. Park, S.K. Sim, B.C. Lee, and M.Y. Park Mlecular typing f Leginella pneumphila Krean islates frm 1985 t The Reprt f Natinal nstitute f Health 38, Marra, A., S.J. Blander, M.A. Hrwitz, and H.A. Shuman dentificatin f a Leginella pneumphila lcus required fr intracellular multiplicatin in human macrphages. Prc. Natl. Acad. Sci. USA 89, Mlmeret, M., M. Santic, R. Asare, R.A. Carabe, and Y. Abu- Kwaik Rapid escape f the dt/icm Mutants f Leginella pneumphila int the cytsl f mammalian and prtzan cells. nfect. mmun. 75, Nintasen, R., F. Utrarachkij, K. Siripanichgn, A. Bhumiratana, Y. Suzuki, and O. Suthienkul Enhancement f Leginella pneumphila culture islatin frm micrenvirnments by macrphage infectivity ptentiatr (mip) gene-specific nested plymerase chain reactin. Micrbil. mmunl. 51, Segal, G., M. Purcell, and H.A. Shuman Hst cell killing and bacterial cnjugatin required verlapping sets f genes within a 22-kb regin f the Leginella pneumphila genme. Prc. Natl. Acad. Sci. USA 95, Seung, H.J., J.H. Jung, S.J. Kim, Y.H. Jin, S.M. Lee, M.S. Kim, and J.G. Kim Mlecular epidemilgical study f Leginella pneumphila islated frm water systems in Seul. The Reprt f Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment 43, Terry Alli, O.A., S. Zink, N.KU vn Lackum, and Y. Abu-Kwaik Cmparative assessment f virulence traits in Leginella spp. Micrbilgy 149, Vgel, J.P., H.L. Andrews, S.K. Wng, and R.R. sberg Cnjugative transfer by the virulence system f Leginella pneumphila. Science 279, Vgel, J.P. and R.R. sberg Cell bilgy f Leginella pneumphila. Curr. Opin. Micrbil. 2, Zink, S.D., L. Pedersen, N.P. Ciancitt, and Y. Abu-Kwaik The Dt/cm type V secretin system f Leginella pneumphila is essential fr the inductin f apptsis in human macrphages. nfect. mmun. 70, (Received March 27, 2009/Accepted April 28, 2009) ABSTRACT : Mlecular Epidemilgical Relatinship f the Pathgenicity f Leginella spp. slated frm Water Systems in Seul Jin-Ah Kim*, Ji-Hun Jung, S-Jin Kim, Yung-Hee Jin, Yung-Hee Oh, and Gi-Yung Han (Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment, Gwachen , Republic f Krea) Leginella spp. is the causative agent f Leginellsis, which induces a ptentially fatal frm f pneumnia. With a cncentrated perfrmance during the summer f 2008, we secured 73 islates frm the water systems f 25 wards in Seul. We analysed sertypes, pathgenic genes (Dt/cm), and patterns f pulsed-field gel electrphresis (PFGE) in an attempt t cnfirm relatinships amng them. Different frm the previus year's pattern (2007), amng the islates, 69 were Leginella pneumphila and 4 were Leginella sppug The sertype distributin f Leginella pneumphila was sg1 43, sg6 9, sg5 8, sg3 8, and sg2 1. The sertype fr the 4 Leginella spp. was Leginella nautarum. Mst f the Leginella pneumphila had several pathgenic genes. On the ther hand, the 4 Leginella spp. were defective in pathgenicity in genmic terms. The PFGE patterns f the sertypes shwed a tendency fr diversity f Leginella pneumphila and a clse crrelatin with genetic pathgenicity.
304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More information04.fm
w y wz 9«( 2y) 91~96, 2006 J. f the Krean Sciety fr Envirnmental Analysis üy wƒ w y k p ½» w w œw Adsrptin Prperties f the Activated Carbns fr Remving Harmful Gases in Indr Envirnments In-Ki Kim Department
More informationfm
w y wz 9«( 1y) 34~40, 2006 J. f the Krean Sciety fr Envirnmental Analysis V/ w y Áy yá váy * w» ( )», *» w y œw Simultaneus Remval f Dixin and Nitrgen Oxide n V/ Catalyst Jun-Yub Lee, Sung-H Hng, Sung-Pill
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
More information( )-103.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 6, pp. 643~647, 2009. DOI:10.4191/KCERS.2009.46.6.643 Densificatin Behavir f C/C Cmpsite Derived frm Cal Tar Pitch with Small Amunt f Idine Additin Kwang Yun
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information50(1)-09.fm
2006, Vol. 50, No. 1 Printed in the Republic of Korea 언빨래가마르는현상에대한중등학교화학전공교사들의인식조사 ½x Á» Á½ # Á x* w w yw y š w w # w w (2005. 5. 11 ) A Research of Secondary School Chemistry Major Teachers Perceptions
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information85.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 9, pp. 502~509, 2007. Examinatin n Applicatin f High-Perfrmance Cncrete using Fine Fly Ash as Replacement Material f Silica Fume Bum-Sik Lee, Sang-Kyu Kim,
More information605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information93-10.fm
w y wz 9«( 3y) 207~214, 2006 J. f the Krean Sciety fr Envirnmental Analysis š w ky gq p ½» w w œw Crrsin Prperties f Cating Mixtures fr the Desulfurizatin System under High Temperature and Acidic Envirnment
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information49(6)-06.fm
Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 중학교과학교과서불꽃반응실험에서선스펙트럼관찰의문제점분석및개선연구 ½ Á Á * w w yw (2005. 10. 4 ) An Analysis and Improvement of the Line Spectrum
More information< DC1A4C3A5B5BFC7E22E666D>
¼ (Jeong, Jung Chae)*, ý (Kim, Yoon Soo), (Shin, Woo Young), Þ Ñ (Park, Jong Man) ò ý ƒ Ð (Korea Evaluation Institute of Industrial Technology) (Shin, Jae-Heyg) Š æ (Ministry of Knowledge Economy) 1. :
More information(1)-01(정용식).fm
Textile Science and Engineering Vl. 48, N. 1, 2011 ƒ s j p y ky w xá½ Á½» 1 Á w œ w lœw, 1 w» w (2010. 12. 10. /2011. 1. 16. k) Analysis f Stabilizatin and Carbnizatin Behavirs f Ply(acrylnitrile) Fibers
More information42(3)-6(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 216-222 Cpyright 2006, The Micrbilgical Sciety f Krea β-galactsidase ³ p»á ù 2 Á 2 Á Á Áy 3 Á½ * w œw y œw l ƒm w œw œ f β-galactsidase (lactase)
More information10.fm
Jurnal f the Krean Ceramic Sciety Vl., N. 1, pp. 53~57, 2009. Effect f MgB Additin n Synthesis f Hexagnal Brn Nitride Dae-Jin Lee*, **, Mi-Jung Jee*, Byung-Hyun Chi*, Mi-Jai Lee*, Nam-Hee Ch**, and Mi-Sun
More information48.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N. 5, pp. 60~65, 007. Develpment f Black Clr Spinel Pigment fr High Temperature Kwang-H Lee, Min-S Myung, and Byung-Ha Lee Department f Ceramic Engineering, Myungji
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information04-46(1)-06(조현태).fm
w œwz, 46«1y 2009 Textile Science and Engineering Vol. 46, No. 1, 2009 ù 2'6 wx xk Á «w œ w» Áq œw k 1PG $CVJ1PG 5VGR &[GKPI H 0[NP2'6 5RNKV 6[RG /KETHKDGT *[GP 6CG %J CPF%JWN-YP2CTM &GRCTVOGPV H 1TICPKE
More information( )-129.fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 1, pp. 80~85, 2011. DOI:10.4191/KCERS.2011.48.1.080 Effect f HF Treatment n the Crystallizatin Behavir f the Glass Cntaining Cal Bttm Ashes Sinae J and Seunggu
More information12(3) 10.fm
KIGAS Vol. 12, No. 3, September, 2008 (Journal of the Korean Institute of Gas) ü LP ƒ š Database w š Á Á½z w ywœw (2008 6 10, 2008 8 12 (1 ), 2008 9 5 (2 ), 2008 9 5 k) Constructing a Database Structure
More information50(5)-07.fm
Printed in the Republic of Korea w 3w yû x w w w Á x* w w w yw (2006. 3. 14 ) A research of the Difference in Teaching Styles and Understanding of 9 th Grade Students About Lead-iodide Precipitation Reaction
More information( )-100.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 6, pp. 491~497, 2010. DOI:10.4191/KCERS.2010.47.6.491 Temperature Dependence n Elastic Cnstant f SiC Ceramics Jng In Im, Byung-W Park, H-Yng Shin, and Jng-H
More informationw w l v e p ƒ ü x mw sƒw. ü w v e p p ƒ w ƒ w š (½kz, 2005; ½xy, 2007). ù w l w gv ¾ y w ww.» w v e p p ƒ(½kz, 2008a; ½kz, 2008b) gv w x w x, w mw gv
ª Œª Œ 30ƒ 5A Á 2010 9œ pp. 475 ~ 484 gj p ª v e p p PSC ƒ gv : II. x w Precast Concrete Copings for Precast Segmental PSC Bridge Columns : II. Experiments and Analyses ½kzÁ½ Á zá x Kim, Tae-HoonÁKim,
More information, 66~67dB»e 55dB š 12dBù û»e(65db) w 70~71dB ñ. ù ü»» 35dB(ü), 45dB() r. w» w 1938 œk ³Ø w, 1960 Ø, 1968 ³Ø w. w 1972 ³Ø w w ³ ƒwš, ù y Ø w ³w
ª Œª Œ 26ƒ 1D Á 2006 1œ pp. 1~11 ª qp md w An Analysis of the Traffic Noise Measurement Plans of Apartment Complexes A Case on the North Riverside Expressway in Seoul Á Kang, Jun MoÁLee, Sung Kyung Abstract
More informationuntitled
ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective
More information10(3)-02.fm
w y wz 10«3y 203~211 (2010.12.) Journal of Korean Society of Urban Environment w ù p yá k«áyw *Á xá½k w y œw Á* y w (2010 9 15, 2010 12 2 k) Characterization of Nonpoint Source Pollutant Loads from the
More information139.fm
Jurnal f the Krean Ceramic Sciety Vl. 43, N. 12, pp. 839~845, 2006. Manufacture f High Density Graphite Using Cal Tar Pitch Kwang Yun Ch, Kyung Ja Kim, Dh Hyung Riu, Kwang Hyun Lim,* Jung Il Kim,* In Chel
More information16(5)-02(57).fm
Jurnal f Krean Pwder Metallurg Institute Vl. 16, N. 5, 2009 DI: 10.4150/KPMI.2009.16.5.310 /ekœ w TiC/C w w ¼ *Áw a w œ w œw, a Snthesis f TiC/C Cmpsite Pwder b the Carbthermal Reductin Prcess Gil-Geun
More informationfm
w y wz 9«( 1y) 63~68, 2006 J. f the Krean Sciety fr Envirnmental Analysis Ÿ w k y w w w p xá **Á vá *Áy y*áy ** š w ywœw, *w» ( ) y, **» w y œw Water Inhibitin and Tungsten Lading Effect f SCR ver NMO
More information10(1)-08.fm
w y wz 10«( 1y) 47~52, 2007 J. of the Korean Society for Environmental Analysis œ w t y ½ xá Á x Á½ Á x* Ÿ œ, * w œw Optimization of Coagulation In The Conventional Water Treatment Plant Jun-Hyun Kim,
More information69-1(p.1-27).fm
99 A 380 B 787 : wœ z w * w w wœ» A380 B787 wœ» w. wœ» ww r. w wœ» p j y w r» w. I. II. z III. A380 B787 IV. A380 V. wœ» : x VI. z VII. I. A380 B787»ƒ z wœ w, w w p j w w ƒ r. t wœ w ƒ w w wœ» š œm wš,
More information(153번 김철영).fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 4, pp. 269~277, 2011. DOI:10.4191/KCERS.2011.48.4.269 Effect f Varius Oxides n Crystallizatin f Lithium Silicate Glasses Chul Min Kim, Hyung Bng Lim, Yug Su
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information416.fm
Journal of the Korean Housing Association Vol. 20, No. 4, 2009 œ qp œ y An Analysis of Change on the Apartment Unit Plans and the Interior Spaces Related to Women * Choi, ByungSook ** Park, JungA "CTUSBDU
More information42(3)-5(p ).fm
The Krean Jurnal f Micrbilgy, Vl. 42, N. 3, September 2006, p. 210-215 Cpyright 2006, The Micrbilgical Sciety f Krea Dipldia gssypina ATCC10936 ³ w (+)-Jasmnic acid y š yá½ Á½ {* w tœw tœw Dipldia gssypina
More information6.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 54~59, 2008. Expansin Characteristics f the Hydrated Sdium Silicate Yang Py Kng, H Yen Ch, and Dng S Suhr Department f Materials Science and Engineering,
More information44.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 5, pp. 263~267, 2008. Piezelectric Prperties and Phase Transitin behavirs f (Bi 1/2 ) 1 x Ca x Ceramics Yng-Hyun Lee*, **, Jeng-H Ch**, Byung-Ik Kim**, and
More information17.393~400(11-033).fm
Journal of the Korea Concrete Institute Vol. 23, No. 3, pp. 393~400, June, 2011 GGGGG DOI 10.4334/JKCI.2011.23.3.393 x RC { sƒ y y 1) *Á½ 1) Á 2) 1) y w œw 2) w œw Bond Strength Evaluation of RC Beams
More information50(4)-10.fm
2006, Vol. 50, No. 4 Printed in the Republic of Korea 칼코겐이도핑된망간산화물의저온합성연구 k Á z Á, *Áy, * y w ù w yw x ù l w» ww (2006. 7. 13 ) Chimie Douce Synthesis of Chalcogen-Doped Manganese Oxides Seung Tae Lim,GDae
More information07.045~051(D04_신상욱).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 45-51 f m s p» w Á xá zá Ÿ Á w m œw Image Retrieval Based on Gray Scale Histogram Refinement and Horizontal Edge Features Sang-Uk Shin,
More informationuntitled
[ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings
More information17.fm
Jurnal f the Krean Ceramic Sciety Vl. 44, N., pp. 110~115, 007. Micrwave Dielectric Prperties f BaNd - BaO-B -K O-SiO -xtio Glass Cmpsites Dng-Eun Kim,*, ** Sung-Min Lee,* Hyung-Tae Kim,* and Hyung-Sun
More information14.fm
Journal of the Korean Ceramic Society Vol. 44, No. 2, pp. 93~97, 2007. Preparation of High Purity Si Powder by SHS Chang Yun Shin, Hyun Hong Min, Ki Seok Yun, and Chang Whan Won Engineering Research Center
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information7.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 60~64, 008. Sintering Behavir and Mechanical Prperty f B 4 C Ceramics Fabricated by Spark Plasma Sintering Kyung Hun Kim*,, Jae Hng Chae*, J Sek Park
More information129.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 1, pp. 87~81, 008. Effects f Y O Additin n Densificatin and Thermal Cnductivity f AlN Ceramics During Spark Plasma Sintering Jae Hng Chae*, J Sek Park*, **,
More information<30332DB9E8B0E6BCAE2E666D>
kœw» y w k p y w k» z wš ye z w mdkqvqrg üœ» y» Ÿ w kœwgeqgpikpggtkpiy glj GEQVGEJPQNQI[ œw w k w yz š y j œ w m w y ˆ mw y» kœ w k û ³ y ƒ ƒ» ƒ w œw w w y ƒƒ» k z w» %NGCP 9CVGT #EV wšw y ù» œ w w w t
More information07.051~058(345).fm
w wz 8«3y 2008 6 pp. 51 ~ 58 m qp yp š w k sƒ Evaluation of Dynamic Modulus based on Aged Asphalt Binder y*á **Á***Á**** Lee, Kwan-HoÁCho, Kyung-RaeÁLee, Byung-SikÁSong, Yong-Seon Abstract Development
More information( )-47.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 4, pp. 302~307, 2010. DOI:10.4191/KCERS.2010.47.4.302 Effect f V-dping n Clur and Crystallizatin f Malayaite Pigments In-Dn J and Byung-Ha Lee Department f
More information( )-68.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 5, pp. 445~449, 010. DOI:10.4191/KCERS.010.47.5.445 Blating Mechanism f Artificial Lightweight Aggregate fr Recycling the Waste Glass Shin Hyu Kang and Ki Gang
More information( )-70.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 5, pp. 401~406, 010. DOI:10.4191/KCERS.010.47.5.401 Synthesis f Pure and Prus CaOÁAl Clinker by Burning f Hydrates Du Hyuk Kim and Tae Wng Sng Department f
More information83-07.fm
w y wz 8«( 3y) 137~142, 2005 J. of the Korean Society for Environmental Analysis sw n w Polychlorinated Biphenyls»y Áwx Á yá w w yw Analysis of Polychlorinated Biphenyls from Pohang and Gangseo, Busan
More information41(6)-09(김창일).fm
269 Ar v Na 0.5 K 0.5 NbO 3 t ½ t,, ½ w,, ½ w»œw Surface Reaction of Na 0.5 K 0.5 NbO 3 Thin Films in Inductively Coupled Ar Plasma w t œwz J. Kor. Inst. Surf. Eng. Vol. 41, No. 6, 2008. < > Dong-Pyo Kim,
More information( )-40.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 3, pp. 237~243, 2010. DOI:10.4191/KCERS.2010.47.3.237 Synthesis f Sphene pink Pigment by Rice Husk Ash In-Dn J, Hyun-S Lee, and Byung-Ha Lee Department f Materials
More information27(5A)-07(5806).fm
ª Œª Œ 27ƒ 5A Á 2007 9œ pp. 753 ~ 758 gj pœw gj p { x A New Test Method for Pure Isotropic Flexural Tensile Strength of Concretes Ÿ Á y Á x Zi, GoangseupÁOh, HongseobÁChoi, Jinhyek Abstract Proposed is
More information16(5)-06(58).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.336 y-y w Sm-Fe w ƒ w zá *Á w»» The Effect of Excess Samarium Oxide on the PreparationG of Sm-Fe Alloy Powder by Reduction-diffusion
More information( )-10.fm
J. f the Krean Sensrs Sciety Vl. 19, N. 6 (2010) pp. 483 489 DOI : 10.5369/JSST.2010.19.6.483 pissn 1225-5475/eISSN 2093-7563 p w» w v y Á Temperature sensr withut reference resistr by indium tin xide
More information( )-84.fm
Jurnal f the Krean Ceramic Sciety Vl. 7, N. 6, pp. 608~61, 010. DOI:10.191/KCERS.010.7.6.608 Synthesis and Characterizatin f Al-dped Uvarvite Green Pigments Sung-Gyu Se and Byung-Ha Lee Department f Materials
More information93.fm
Journal of the Korean Ceramic Society Vol. 45, No. 10, pp. 625~630, 2008. Effect of Storage Conditions on the Setting Properties of Brushite Bone Cement Containing Granular β-tricalcium Phosphate Sun-Ae
More information2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70
경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법
More information3.fm
Journal of the Korean Ceramic Society Vol. 44, No. 1, pp. 12~17, 2007. A Study on the Preparation of Bone Ash and Celadon Bone Body Using Pig Bone Jae-Jin Jeong, Sang-Hee Lee, Yong-Seok Lee,* and Byung-Ha
More information( )-59.fm
Jurnal f the Krean Ceramic Sciety Vl. 47, N. 4, pp. 319~324, 2010. DOI:10.4191/KCERS.2010.47.4.319 Preparatin f Screen Printable Cnductive MSi 2 Thick Films fr Ceramic Sheet Heater Bae-Yen Kim, Dng-Bin
More information10.063~070(B04_윤성식).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 63-70 Mg-3%Al-1%Zn w ƒœ» y Á x*á **Á Á w œw *w s l I ûer ** t Effect of Thermomechanical Treatment on Microstructure and Mechanical Properties
More information82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
More information16(5)-03(56).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.316 ƒ w Fe œ w Cu wy SPS (I) I. ƒ wy y Á xá½ Á½ *Á½{ a w œw, a w» gœ Production of Fe Amorphous Powders by Gas-atomization Process
More information11(5)-12(09-10)p fm
w wz J. Kor. Soc. Cloth. Ind. 11«5y, 2009 Vol. 11, No. 5, pp.799-807(2009) w w * k ƒm w pg p w, ƒm w q w A Qualitative Research on Pursuing Image and Appearance Management Behavior of Brides Eun-Joo Bae
More informationfm
w sw x w w w x y w w sw J[FTQRJ[VG w 5CVQƒw e UWDOGTIGF J[FTQRJ[VG šw z w w w w ù p w s w r w z w w kw p ³ w š w z w š w w kw mƒ w š w s w q 8CNNKUPGTKC FGPUGUGTTWNCVC½ ½ Õ 6[RJC NCZKOCPPK -KO CPF %JQK
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
More information<312D303128C1B6BAB4BFC1292E666D>
k Ÿy y y + ûz m Ì ˆw k Ÿ ø ky w y y» wk Ÿ v w k w w ƒ Ÿ ew k Ÿy yø k Ÿ ý k z» w ƒ w Ÿ y k y w x mw w w ³Ÿ wšy v mw y w r œw yÿ ý w z»ÿ Ÿ»» Ÿ ¾ Ÿ 6TCXGN 9GGMN[ ýw k Ÿ Ÿ ƒ š wš y w k Ÿ ƒ m ³ w w y y y 'EQVQWTKUO
More information<30312DC0CCC7E2B9FC2E666D>
균류의다양성과역할 이향범 û w œw 머리말 k w š ³ q š yw < Ð >» w ww k w w v š q w Á Á w tyw š 2QKPVKPI CPF *[FG ú ƒ x %QPXGPVKQP QP $KQNQIKECN &KXGTUKV[ %$&» w w ««wš y w» š x ƒ w œ ƒ» ƒ œsw w ³ wš ù š y š ƒ t š ƒ wš»ƒ
More information17(1)-05.fm
Krean J. Crystallgraphy Vl. 17, N. 1, pp.4~3, 006 ƒƒ Zn 3 j q p e w y Á k Áy w œw The Effect f Additin n the Micrwave Dielectric Prperties f Zn 3 Ceramics H Byung Yun, Tae-Kun Lee and Yen Hwang Department
More information46.fm
Jurnal f the Krean Ceramic Sciety Vl. 45, N. 5, pp. 285~289, 2008. Effect f Si:C Rati n Prsity and Flexural Strength f Prus Self-Bnded Silicn Carbide Ceramics Kwang-Yung Lim, Yung-Wk Kim, Sang-Kuk W*,
More information06.177~184(10-079).fm
Journal of the Korea Concrete Institute Vol. 23, No. 2, pp. 177~184, April, 2011 GGGGG DOI 10.4334/JKCI.2011.23.2.177 x w w MRS w p s y 1) Á z 2) Á x 3) * 1) wû w œw 2) w œw 3) w Nonlinear Analysis for
More information( )34.fm
Jurnal f the Krean Ceramic Sciety Vl 46, N 3, pp 75~81, 009 DOI:104191/KCERS00946375 Prus Materials frm Waste Bttle Glasses by Hydrthermal Treatment Dng-kyu Lim and Eun-Tae Kang Schl f Nan & Advanced Material
More information18(3)-10(33).fm
Journal of Korean Powder Metallurgy Institute Vol 18 No 3 011 DOI: 10150/KPMI01118383 e x 5Mg(OH) MgSO 3H O x w MgO NH OH w a báv y aá½xk aá½ aá½ cá½ bá½ a * aw» l bš w œw ck Effect of MgO and NH OH on
More information4.fm
Journal of the Korean Ceramic Society Vol. 46, No. 1, pp. 30~34, 2009. Optimization of Glass Wafer Dicing Process using Sand Blast Won Seo, Young-mo Koo*, Jae-Woong Ko**, and Gusung Kim Department of Electronic
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information353-11(07-31).fm
Kr. J. Micrbil. Bitechnl. Vl. 35, N. 3, 226 230(2007) ƒ w ³l Interfern α-1 œ e w ¼ÁÁ½Á 1 Á * ww œw» l, 1 vl Effect f Oxygen Supply n the Prductin f Interfern α-1 by Recmbinant Escherichia cli in Fedbatch
More information15.101~109(174-하천방재).fm
w wz 8«4y 2008 8 pp. 101 ~ 109 w» m -,, - A Study on Warnning Criteria Investigation of Automated Rainfall Warning System -Focused on Realationship of Water Level, Discharge and Precipitation - Á Á Á Ahn,
More information32(4B)-04(7455).fm
32«4ByÁ 2012 7 pp. 233 ~ 242 œ w w w y œ r Estimation of Domestic Water Supply Benefit Using Demand Function Approach ³ Á Á½¼yÁ Yeo, Kyu DongÁYi, Choong SungÁKim, Gil HoÁLee, Sang Won Abstract In the past,
More informationfm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
More information( )-106.fm
Jurnal f the Krean Ceramic Sciety Vl. 46, N. 6, pp. 648~652, 2009. DOI:10.4191/KCERS.2009.46.6.648 Prperties f the Electrlyte Separatrs fr Thermal Batteries Using SiOC Mat Kyung Hn Lim, Kwang Yun Ch, Dh
More information26(3D)-17.fm
26ƒ 3D Á 2006 5œ pp. ~ ª y w qp yw k d Predictive Equation of Dynamic Modulus for Hot Mix Asphalt with Granite Aggregates yá½x Á Lee, Kwan-HoÁKim, Hyun-OÁJang, Min-Seok Abstract The presented work provided
More information(154번 김사라은경).fm
Jurnal f the Krean Ceramic Sciety Vl. 48, N. 4, pp. 316~322, 2011. DOI:10.4191/KCERS.2011.48.4.316 The Effect f Vacuum Annealing f Tin Oxide Thin Films Obtained by RF Sputtering Sun-Phil Kim, Yungrae Kim*,
More information한 fm
Jurnal f the Krean Magnetics Sciety, Vlume 19, Number 6, December 2009 DOI: 10.4283/JKMS.2009.19.6.209 œe w w r p(bam) x» e ph w Áû k w œw, z w¼1, 200-701 (2009 10 7, 2009 11 20, 2009 11 21 y ) M-type
More information14(4) 09.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 4, pp 343~350(2007) w y y w z 14 «4 y 2007 yw» l s p»xá ³ *w w w œw, **w w w The Property of Pressure Distribution of Hybrid Underfloor Air Distribution
More information93-06.fm
w y wz 9«( 3y) 177~184, 2006 J. f the Krean Sciety fr Envirnmental Analysis ys» ƒ w p y ½ «Á«Á *Á y w, *swœ w y Characteristic Variatins f Heavy Metals in Fly Ashes frm MSW Incineratin Plants by Thermal
More information12(4) 10.fm
KIGAS Vol. 12, No. 4, December, 2008 (Journal of the Korean Institute of Gas) l x CNG» v m s w ½ Á y w» œw (2008 9 30, 2008 12 10, 2008 12 10 k) Numerical Analysis for Temperature Distribution and Thermal
More information201.fm
Jour. Korean Earth Science Society, v. 31, no. 2, p. 119 128, April 2010 (w ) w x 1, *Á 2 1w Ÿ, 305-350, Ÿ w 92 2 w w œw, 402-751, Ÿ û x 253 A Comparative Analysis of Linearity and Range of Gravity and
More information10.fm
Jurnal f the Krean Ceramic Sciety Vl., N. 1, pp. 65~69, 007. Crrsin f Refractry in Glass Melts fr Plasma Display Panel Substrate Ki-Dng Kim, Hyun-Su Jung, and Hy-Kwang Kim Department f Materials Science
More information202.fm
Journal of the Korean Housing Association Vol. 19, No. 2, 2008 w w w w Physical Identities of Bukchon Hanok Area Viewed from Literary Geography * Park, Cheol-Soo "CTUSBDU This study explores the beneficial
More information51(4)-13.fm
Journal of the Korean Chemical Society 2007, Vol. 51, No. 4 Printed in the Republic of Korea w x - w y *Á š w w w yw (2007. 3. 28 ) Case Study on Verbal Interactions of Teacher-Small Group StudentsG in
More information31(3B)-07(7055).fm
ª Œª Œ 31ƒ 3B Á 2011 5œ pp. 265 ~ 276 ª w w s³ The Correlation Between the Moving Average of Precipitation and Groundwater Level in Korea Á½û» Yang, Jeong-SeokÁKim, Nam-Ki Abstract Precipitation data and
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 436-443, 2005,1"$ w Q) t p z Á 1w w œw 2 w œ yw Effects of surface properties and solution ph on the pollutants removal of
More information