약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 79 레스에저항성인유전자를확보하는데제한적이다 (Jeung et al. 2005). 자포니카는인디카에비해상대적으로약한벼멸구저항성을나타내며, 벼멸구저항성주동유전자중대부분인 26개가인디카와야생벼로부터발견되었

Size: px
Start display at page:

Download "약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 79 레스에저항성인유전자를확보하는데제한적이다 (Jeung et al. 2005). 자포니카는인디카에비해상대적으로약한벼멸구저항성을나타내며, 벼멸구저항성주동유전자중대부분인 26개가인디카와야생벼로부터발견되었"

Transcription

1 Korean J. Breed. Sci. 46(1):78-89( ) Online ISSN: Print ISSN: 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 박현수 1 * 백소현 1 김우재 1 정지웅 2 이종희 3 하기용 1 박종호 1 남정권 1 백만기 1 유재수 1 백채훈 2 노태환 1 김기영 1 조영찬 1 김보경 2 이점호 1 1 농촌진흥청국립식량과학원벼맥류부, 2 농촌진흥청국립식량과학원, 3 농촌진흥청연구정책국 Development of Multi-resistant Lines to Brown Planthopper, Bacterial Blight, and Rice Stripe Virus using Anther Culture in Rice Hyun-Su Park 1 *, So-Hyeon Baek 1, Woo-Jae Kim 1, Ji-Ung Jeung 2, Jong-Hee Lee 3, Ki-Yong Ha 1, Jong-Ho Park 1, Jeong-Kwon Nam 1, Man-Kee Baek 1, Jae-Soo Yoo 1, Chae-Hoon Paik 2, Tae-Hwan Noh 1, Ki-Young Kim 1, Young-Chan Cho 1, Bo-Kyeong Kim 2, and Jeom-Ho Lee 1 1 Department of Rice and Winter Cereal Crop, NICS, RDA, Iksan , Korea 2 National Institute of Crop Science, RDA, Suweon , Korea 3 Research Policy Bureau, RDA, Suweon , Korea Abstract : This study was conducted to develop multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus using anther culture in rice. A total of 213 double haploid lines were developed the cross between HR conferring resistant to bacterial blight and rice stripe virus and SR conferring resistant to brown planthopper, bacterial bight, and rice stripe virus. Using DNA molecular marker, HR26234 and SR30071 were confirmed to have Xa3+xa5+Stvb-i and Bph18+Xa4+Stvb-i, respectively. All double haploid lines carried Stvb-i, and Bph18+Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+xa3, bph18+xa4, bph18+xa3+xa5, and bph18+xa4+xa5 combinations were identified. Segregation distortions such as no combinations carrying Bph18(or bph18)+xa5+stvb-i and fewer lines carrying Bph18 than bph18 were occurred in DH population. Brown planthopper resistant lines carrying Bph18 showed longer culm length than susceptible lines. Selected Bph18+Xa4+xa5+Stvb-i combination lines with short culm conferred resistant to brown planthopper, bacterial blight, and rice stripe virus, while showed deleterious effects such as spikelet sterility, lower yield, and vulnerable to lodging than standard and comparative varieties. Using anther culture, we rapidly developed multi-resistant lines to brown planthopper, bacterial blight, and rice stripe virus. However, distorted segregation in DH population and linkage drag with Bph18 were obstacles to develop practical multi-resistant cultivars. Keywords : Rice, Multi-resistant, Anther culture, Segregation distortion, Linkage drag 서 지속가능하고안정적인쌀생산을위해서는병해충에대한관리가필수적이다 (Savary et al. 2006). 벼의병해충에의한피해를가장적극적으로대처하는방법은저항성품종을 *Corresponding author ( mayoe@korea.kr, Tel: , Fax: ) (Received on February 3, Revised on February 27, Accepted on March 3, 2014.) 언 개발하고이를재배하는것이다 (Khush 1989). 세계각국에서벼병해충에대한저항성품종육종사업이수행되고있다. 우리나라자포니카벼품종에대해가장피해를많이주는병은도열병, 벼흰잎마름병, 벼줄무늬잎마름병이며, 해충은벼멸구에의한피해가가장많다 (Lee et al. 2011). 저항성육종사업은해당병해충에대해효과적인저항성원을확보하고이를우량품종으로도입하는일련의과정을거친다. 자포니카유전자원은협소한유전적배경으로생물적스트 Copyright c 2014 by the Korean 78 Society of Breeding Science This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 79 레스에저항성인유전자를확보하는데제한적이다 (Jeung et al. 2005). 자포니카는인디카에비해상대적으로약한벼멸구저항성을나타내며, 벼멸구저항성주동유전자중대부분인 26개가인디카와야생벼로부터발견되었다 (Huang et al. 2013). Bph18 저항성유전자는야생벼 O.australiensis로부터인디카계통에이전되었고마커활용선발법 (marker-assisted selection; MAS) 과전게놈의배경분석 (genome-wide background analysis) 을통해자포니카주남벼배경에도입되었다 (Jena et al. 2006, Suh et al. 2011). Bph18 도입계통들은벼멸구유묘및성체검정에서강한저항성반응을나타냈으며, 선발된우량계통이 2010년에품종명안미로등록되었다. 벼흰잎마름병저항성유전자 Xa2 (Tetep), Xa4 (TKM6), Xa11 (IR8), Xa18 (IR24) 등은인디카품종에서유래하였고, 야생벼로부터 Xa21 (O. longistaminata), Xa23 (O. rufipogon), Xa27(t) 와 Xa35(t) (O. minuta), Xa38 (O. nivara) 이도입되었다. 우리나라벼흰잎마름병저항성원으로많이활용되고있는 Xa3 는저항성이자포니카일본품종인 Wase Aikoku 3로부터유래하였고 1991년에저항성품종인화영벼와안중벼가개발된이후로이를이용하여많은우량품종이개발되었다 (Kim et al. 2007, Shin et al. 2011). 여교배를통해방글라데시 Aus 품종 DV85의 xa5를자포니카수원345호배경으로도입한근동질유전자계통이육성되었고실질적인품종개발로이어져 2006년에강백이육성되었고, 이를활용하여 Xa3와 xa5 가결합된진백 (2008) 이개발되어변이균인 K3a에대응할방안을마련하였다 (Shin et al. 2011). 우리나라자포니카벼품종의벼줄무늬잎마름병저항성은인디카 Modan 유래저항성유전자 Stvb-i가도입되어안정적으로이용되고있다 (Kwon et al. 2012). 1975년에최초의저항성품종인낙동벼가개발 (Chung et al. 1975) 된이후로저항성품종개발에 Stvb-i이지속적으로이용되고있다. 여러육종방법중에서약배양은육종기간을단축시키고분리집단에서고정계통을개발하는데유용하다 (Grewal et al. 2011). 농촌진흥청에서는약배양을통해 1985년에화성벼가개발된이후로 2013년까지 27개품종이개발되었다. 병해충저항성육종사업에서표현형정보만을이용할경우생물검정의어려움과하나의저항성유전자가다른저항성유전자의효과를숨길수있기때문에여러개의저항성유전자를집적시키거나다양한병해충에대한저항성품종개발에어려움이따른다 (Lee et al. 2011, Yoshimura et al. 1995). 해당저항성유전자를표지하는분자마커가개발되어있을경우이 를활용하여저항성유전자도입여부를초기세대부터확인할수있으며여러저항성유전자를하나의품종에집적시킬수있다 (Dokku et al. 2013, Suh et al. 2013, Xu 2013). 본연구는벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에저항성인자포니카복합내병충성품종을조기에개발하고자약배양을수행하여고정계통을육성하고, DNA 분자마커를활용하여저항성유전자를확인함과동시에병해충에대한생물검정을통해목표저항성유전자가집적된복합내병충성계통을선발하고자수행되었다. 또한육성과정중에발생할수있는문제점을파악하여저항성육종사업에반영하고자하였다. 재료및방법시험재료및재배방법벼흰잎마름병과벼줄무늬잎마름병에저항성인계통 HR 을자방친으로하고벼멸구, 벼흰잎마름병및벼줄무늬잎마름병에저항성인계통 SR 을화분친으로하여인공교배한 F 1 을약배양하여얻은 double haploid (DH) 213계통을이용하였다. 이들계통을 2011년국립식량과학원벼맥류부시험포장에재식거리 cm 로주당 1본씩이앙하였다. 주요농업형질조사와벼흰잎마름병균계검정을수행하였고벼멸구저항성검정은유묘검정법을이용하였다. DNA 분자표지를이용하여이들계통에대한저항성유전자를확인하였다. 2011년에선발된저항성유전자가집적된 7개계통을표준품종남평벼, 비교품종진백, 안미와함께 2012년에재식거리 cm로주당 3본식, 구당 180 주가량을 3반복으로이앙하여생산력검정시험을수행하였다. 벼흰잎마름병접종에따른수량성및품질변이를조사하기위해서생산력검정시험에공시된동일한재료를재식거리 cm로주당 3본식, 구당 180 주가량을무접종구, 접종구로나누어이앙하였다. 접종시험구는대조품종의최고분얼기에 K3a 균계 (HB0109 균주 ) 를이용하여시험구전개체를가위절엽접종하였다. 시비량은 N-P 2 O 5 - K 2O를 kg/ha으로질소는기비 : 분얼비 : 수비를 50 : 20 : 30 비율로분시하였고, 인산은전량기비로, 칼륨은기비 : 수비를 70 : 30 비율로분시하였다. 그밖의재배방법은농촌진흥청표준재배법을따랐다. 병해충저항성검정벼멸구저항성검정에이용된벼멸구는국립식량과학원벼

3 80 韓育誌 (Korean J. Breed. Sci.) 46(1), 2014 맥류부간척지농업과해충사육실에서동진벼를식이품종으로사육된벼멸구를이용하였다. 벼멸구유묘검정은 cm 기계이앙상자를 20칸으로구획한상자에계통당 20립정도씩파종하여유리온실베드에치상하였다. 파종후 15 20일경식물체가 4 5엽까지자랐을때개체당벼멸구유충이 7 10 마리씩되게접종하였고, 감수성인남평벼가완전히고사되었을때저항성여부를판정하였다 (Shin et al. 2011). 벼멸구성체검정은포장에재식된공시재료를최고분얼기에 3주씩플라스틱상자 ( cm) 에이식후벼멸구를접종하여감수성인남평벼가완전히고사되었을때저항성여부를판정하였다. 벼흰잎마름병검정은공시된약배양 213계통에대해서 HB01013 (K1 레이스 ), HB01009 (K3a) 균주를이용하여균계별로 3주씩엽선단약 3 cm 부위를가위절엽접종 (Kauffman et al. 1973) 하여접종후 3주후에가장긴병반을가진 3개엽의병반장을측정하여평균한값을이용하였다. 질적저항성은평균병반장이 5 cm 이하는저항성 (R; resistant), 5 10 cm는중도저항성 (MR; moderately resistant), 10 cm이상은이병성 (S; susceptible) 으로구분하였다 (Shin et al. 2011). 선발된우량고정계통에대해서는 HB01013 (K1), HB01014 (K2), HB01015 (K3), HB01009 (K3a 레이스 ) 균주를접종하여저항성에대해좀더면밀히검정하였다. 벼줄무늬잎마름병검정은망실을이용한대량검정법으로바이러스보독충의방사및계대사육으로보독충이충분히유지된망실에서계통당 1.5g을조파하였으며, 파종후 30일경이병성대비품종일품벼가병징을나타낼때저항성과감수성으로판정하였다 (Kwak et al. 2007). 수량및품질관련형질조사생산력검정시험에공시된재료의출수기를조사하고성숙기에시험구별 10개체에대해서간장, 수장, 수수를측정하였다. 출수후 45일에시험구별로 3주를예취하여등숙률및수당립수를측정하고, 수량조사는 100주를예취하여정조수량을측정한다음이중 1.5 kg에대해정현기로제영하여정현비율을측정하고, 100주정조수량에정현비율을곱하여현미수량을구하고 10a당수량으로환산하였다. 정현된현미를가지고현미천립중을측정하였다. 벼흰잎마름병접종에따른시험에서대조구와접종구에서각각 3주를예취하여등숙률을측정하고, 수량조사는 20주를 3반복으로예취하여정조수량을측정한다음제영하여현미수량을측정하였다. 현미외관품위조사는 RN300 (Kett Co., Japan) 을이용하여정립율을측정하였고, 단백질함량은 Infratec 1241 Grain Analyzer (Foss Co., Sweden) 를이용하여측정하였다. 저항성유전자확인 Genomic DNA 추출은 BioSprint 96 (Qiagen Co., Germany) 을이용하였다. 샘플을 TissueLyserⅡ (Qiagen Co., Germany) 를이용하여마쇄한후 BioSprint 96 DNA Plant Kit (Qiagen Co., Germany) 를이용하여 DNA를추출하였다. 벼줄무늬잎마름병저항성유전자 Stvb-i, 벼멸구저항성유전자 Bph18, 벼흰잎마름병저항성유전자 Xa3, Xa4, xa5 를확인하기위해대상유전자와밀접하게연관된 DNA 분자마커인 ST10 (Hayano-Saito et al. 2000), 7312.T4A (Jena et al. 2006), 9643.T4, T14, T10Dw을이용하였다 (Table 1). PCR은 10 ng의 DNA와 AccuPower PCR PreMix (Bioneer Table 1. Gene-specific PCR primers used for the identification of resistance genes. R-genes Chr. No. Marker name Stvb-i 11 ST10 Bph T4A Xa T4 Xa T14 xa T.10Dw Primer sequences Forward (5-3 ), Reverse (5-3 ) CGAAAGATGGTTTCTCCACC GACCAAGCAACTAATGACGC ACGGCGGTGAGCATTGG TACAGCGAAAAGCATAAAGAGTC AGCCGAGCAATGATACCGACA ACAACTGGGATCGAACCGACA TGTTGGAGGATTGGCAAGGAA TTCGTTGCGGCGTTGTTAATC GCACTGCAACCATCAATGAATC CCTAGGAGAAACTAGCCGTCCA Expected size (bp) Reference Hayano-Saito et. al. (2000) Jena et al. (2006) Jeung et al. (unpublished) Jeung et al. (unpublished) Jeung et al. (unpublished)

4 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 81 Co., Korea) 를이용하여 My-Genie 96 Thermal block (Bioneer Co., Korea) 에서수행되었다. PCR 반응은 ST10은 94 에서 4분간초기변성후 94 40초, 62 30초, 72 1분간총 35회반복하였고, 7312.T4A는 94 에서 5분간초기변성후 94 30초, 57 30초, 72 40초간총 45회반복하였고 72 에서 5분간반응하였다 T4와 T14는 94 에서 5분간초기변성후 94 40초, 63 또는 60 (10571.T14) 40초, 72 1분간총 40회반복하였고, T10Dw은 95 에서 4분간초기변성후 95 30초, 초, 72 1분간총 35회반복하고 72 에서 5분간반응하였다. 증폭된 PCR 산물 4 μl를 7312T4A는 3U Hinf I, 9643.T4는 2U Taqα Ⅰ와 65 에서 3시간, T14는 3U Tsp509 I와 65 에 2시간, T10Dw는 Rsa Ⅰ와 37 에서 3시간제한효소처리하였다. ST10에의한증폭산물은제한효소처리없이전기영동에이용하였다. EtBr이포함된 2% agarose gel에서전기영동후 UV transilluminator 를이용하여유전자형을판정하였다. 통계분석통계분석은 SAS 프로그램 (Version 9.2, SAS Institute Inc, Cary, North Carolina) 을이용하였다. 저항성유전자조합들의농업형질에대한평균과표준편차를기술통계법으로구하였고, 평균간비교는 PROC ANOVA로분산분석후유 의성이있을경우 5% 유의수준에서 Duncan s Multiple Range test (DMRT) 로분석하였다. PROC t-test를이용하여 K3a 균계접종에따른대조구와접종구의형질변이를비교하였다. 결과약배양계통육성약배양에모부본으로이용한 HR ( 이하 HR26234) 과 SR ( 이하 SR30071) 계통의농업형질특성과병해충저항성은 Table 2와같다. SR30071이 HR26234보다간장이 11 cm 컸고수장이길었으며수수는적었다. HR26234는벼흰잎마름병 K1과 K3a 레이스와벼줄무늬잎마름병에저항성을보였고, SR30071은벼멸구, 벼흰잎마름병 K1과 K3a 레이스및벼줄무늬잎마름병에저항성을나타냈다. HR26234를모본으로하고 SR30071을부본으로인공교배하여 F 1 29개체를육성하였다. 각개체에서이삭을채취하여약배양을수행하였고총 213개의고정계통을육성하였다 (Table 3). 저항성유전자확인목표유전자와연관된 DNA 분자마커를이용하여저항성유전자를확인하였다. HR26234는 Xa3+xa5, Stvb-i를 SR30071 은 Bph18, Xa4, Stvb-i를가지고있는것으로나타났다. 이들 Table 2. Characteristics of the parents using anther culture. Parents Heading date (DAS z ) Culm length (cm) Panicle length (cm) No. of panicles per hill rice stripe virus Reaction to brown plant-hopper bacterial blight K1 race K3a race Resistance genes HR R y S R R Xa3+xa5+Stvb-i SR R R R R Xa4+Bph18+Stvb-i z Day after seedling y R and S mean resistant and susceptible to insect and disease Table 3. Anther culture ability and double haploid lines derived from the cross of HR /SR Cali induced Plant regeneration Green plants Albino (no. and %) (no. and %) z (no. and %) y (no. and %) x 5,300 1,898 (35.8) 399 (21.0) 232 (58.1) 167 (41.9) 213 Anther cultured (no.) z Percent plant regeneration is the number of plants regenerated over number of cali plated y Percent green is the number of green plants regenerated over total plants regenerated x Percent albino is the number of albino plants regenerated over total plants regenerated w Double haploid lines are harvested plants having fertile grain Double haploid lines (no.) w

5 82 韓育誌 (Korean J. Breed. Sci.) 46(1), 2014 유래약배양계통들은모두 Stvb-i를가지고있었고, Bph18 +Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+xa3, bph18+xa4, bph18+xa3+xa5과 bph18+xa4+ xa5 등총 8개의유전자조합이확인되었다 (Fig. 1). Bph18을가지고있는계통은 42계통으로 bph18 계통에비해 4배가량 적게발생하였고, 작성가능한벼흰잎마름병저항성유전자조합중에서 xa5 단독계통은발생하지않았다 (Table 4). 약배양계통의농업형질특성및병해충저항성반응 Bph18 보유계통은 bph18에비해서출수기, 수장, 수수는 Fig. 1. PCR analysis to confirm the resistance genes using the gene specific DNA markers. Stvb-i, Bph18, Xa3, Xa4, and xa5 was confirmed by PCR product amplified with primer, ST10 (A), 7312.T4A(cleaved by HinfⅠ, B), 9643.T4 (cleaved by TaqαⅠ, C), T14 (cleaved by Tsp509 Ⅰ, D), and T10Dw (cleaved by Rsa Ⅰ, E), respectively. The white stars represent the lines carrying the resistance genes. Table 4. Agronomic characteristics of the groups classified by resistance genes combination and their resistance reaction to brown planthopper and bacterial blight. Resistance gene RSV z BPH BB No. of lines Reaction to BPH Reaction to BB K1 K3a Heading date (DAS) Culm length (cm) Panicle length (cm) No. of panicles per hill Remark Xa3 10 R S 112 ± 2.4ab y 77.1 ± 3.5bc 19.3 ± 1.7c 9.7 ± 1.3c sterility Xa4 9 R R 106 ± 1.9abc 80.4 ± 5.0ab 22.0 ± 0.7a 12.1 ± 1.0a R Bph18 Xa3+xa5 13 R R 113 ± 13.0a 83.7 ± 10.8a 20.6 ± 1.2b 11.9 ± 1.9a sterility Xa4+xa5 10 R R 101 ± 1.8c 76.8 ± 4.2bc 21.0 ± 0.8b 11.9 ± 1.4a Stvb-i Total ± 8.9A 79.8 ± 7.4A 20.7 ± 1.5A 11.4 ± 1.7A Xa3 53 R S 107 ± 12.5abc 68.4 ± 6.9d 20.4 ± 1.1b 11.8 ± 1.6ab Xa4 60 R R 104 ± 8.0bc 70.1 ± 7.9d 20.7 ± 1.1b 11.4 ± 1.5ab S bph18 Xa3+xa5 51 R R 109 ± 10.abc 70.4 ± 6.2d 20.8 ± 1.4b 11.7 ± 1.6ab Xa4+xa5 7 R R 103 ± 7.1c 71.8 ± 4.6cd 20.9 ± 0.9b 10.5 ± 1.5bc Total ± 10.3A 69.7 ± 7.0B 20.7 ± 1.2A 11.6 ± 1.6A z RSV: rice stripe virus, BPH: brown planthopper, BB: bacterial blight y Means with same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

6 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 83 차이가없었으나간장이 10.1 cm 컸다. Bph18 보유계통중벼흰잎마름병 Xa3와 Xa3+xa5 조합의계통은출수가늦고불임이발생하는등열악형질이발현되었다. 자포니카형 Bph18 계통은벼멸구유묘저항성에서 Bph1을가지는통일형다산2 호와 Bph3를가지는인디카 IR72와비슷한수준의강한저항성반응을나타냈다 (Fig. 2). Xa4, Xa3+xa5와 Xa4 +xa5는벼흰잎마름병 K1과 K3a레이스에저항성반응을나타냈다. 내병충성계통선발및농업형질특성벼멸구저항성유전자 Bph18, 벼흰잎마름병저항성유전자 Xa4+xa5, 벼줄무늬잎마름병저항성유전자 Stvb-i가집적된 7 계통을선발하여 2012년에생산력검정시험을수행하였다 (Table 5). 출수일수는 96, 97일로진백 (110일), 남평벼 (106), 안미 (102) 보다빠른중생종이었고, 간장은 cm 로진백 (71 cm), 남평벼 (78), 안미 (77) 보다짧으며, 수당립수는 개로진백 (93개), 남평벼 (95) 보다는많고안미 (119) 보다는적었다. 등숙률이 % 로안미 (84.0%), Fig. 2. Resistance reaction of SR (A) and double haploid lines (B) derived from the combination of HR /SR to brown planthopper at seedling stage. Table 5. Yield-related traits of varieties and DH lines at yield trial. Var./lines Heading date (DAS z ) Culm length (cm) Panicle length (cm) No. of panicles per hill No. of spikelets per panicle Ratio of ripened grain (%) 1,000 grain weight of brown rice (g) Rough rice yield (kg/10a) Brown/rough rice ratio (%) Brown rice yield (kg/10a) Index of brown rice yield y (%) Nampyeongbyeo 106b x 78.3a 20.0bc 14 95b 90.1a 20.9ab 647a a 100 Jinbaek 110a 71.4b 20.8b 15 93b 87.6a 21.3a 643a a 100 Anmi 102c 76.5a 22.9a a 84.0ab 20.3b 674a a 104 HR28869-AC65 96d 65.6d 19.8c ab 77.8bcd 20.6ab 528b bc 82 HR28869-AC68 96d 67.4bcd 19.9c a 78.5bcd 20.3b 517b bc 80 HR28869-AC75 96d 67.5bcd 20.3bc a 80.7bc 21.2a 508b bc 79 HR28869-AC117 97d 70.6bc 20.1bc ab 78.7bc 20.9ab 527b bc 82 HR28869-AC157 96d 67.0cd 20.0bc a 74.8cd 21.1a 505b c 78 HR28869-AC158 96d 67.1bcd 20.3bc ab 79.4bc 21.2a 537b b 84 HR28869-AC159 96d 68.5bcd 20.4bc ab 72.0d 20.9ab 508b bc 79 z Day after seedling y Brwon rice yield of Nampyeongbyeo was a standard x Means with the same letter are not significantly different at P< 0.05 (ANOVA followed by DMRT)

7 84 韓育誌 (Korean J. Breed. Sci.) 46(1), 2014 진백 (87.6), 남평벼 (90.1) 에비해낮았고수량성은표준품종인남평벼에비해 79 84% 수준으로낮았다. 선발계통의병해충저항성성능검정선발된내병충성계통들은유묘및성체에서벼멸구에강한저항성을나타냈으며벼흰잎마름병 K1, K2, K3, K3a 균 계에저항성이고벼줄무늬잎마름병에강하였다 (Table 6, Fig 3, 4). 벼흰잎마름병에대한저항성성능검정을위해 K3a 균계접종한결과이병성인남평벼와안미는수량, 등숙률, 현미정상립률이대조구에비해유의하게감소한반면이들계통들은차이가나지않는경향이었다 (Table 7). Fig. 3. Resistance reaction to brown planthopper. At seedling stage (A). At maximum tillering stage (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. Check variety is Nampyeongbyeo. Fig. 4. Resistance reaction to bacterial blight, K3a (HB1009 isolate) race. Lesion length at 2 weeks after inoculation (A). Field scenery at maturing stage after inoculation (B). 1: Nampyeongbyeo, 2: Jinbaek, 3: Anmi, 4: HR28869-AC65, 5: HR28869-AC68, 6: HR28869-AC75, 7: HR28869-AC117, 8: HR28869-AC157, 9: HR28869-AC158, 10: HR28869-AC159. White bar indicates 10 cm.

8 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 85 고찰여러육종방법중에서약배양은육종기간을단축시키고분리집단에서고정계통을개발하는데유용하다 (Grewal et al. 2011). 벼흰잎마름병과벼줄무늬잎마름병에저항성우량계통 HR ( 이하 HR26234) 과벼멸구, 벼흰잎마름병및벼줄무늬잎마름병에저항성인 SR ( 이하 SR30071) 계통을인공교배한 F 1 을약배양하여총 213 개고정계통을조기에육성하였다 (Table 3). DNA 분자마커 는마커활용선발법 (marker-assisted selection; MAS) 을통해전통육종의효율성과정확성을개선할커다란가능성을가지고있다 (Collard and Mackill 2008). 저항성육종사업에서해당저항성유전자를표지하는분자마커가개발되어있을경우이를활용하여저항성유전자도입여부를초기세대부터확인할수있으며여러저항성유전자를하나의품종에집적시킬수있다 (Dokku et al. 2013, Suh et al. 2013, Xu 2013). 본연구에서는벼멸구저항성유전자 Bph18에 7312.T4A (Jena et al. 2006), 벼흰잎마름병저항성유전자 Xa3, Xa4, Table 6. Reaction of varieties and DH lines to brown planthopper, bacterial blight, and rice stripe virus. Var./lines Brown planthopper at seedling at maximum tillering Bacterial blight K1 K2 K3 K3a Rice stripe virus Resistance genes Nampyeongbyeo S z S S S S S R Stvb-i Jinbaek S S R R R R S Xa3+xa5 Anmi R R R R R S R Bph18+Xa3+Stvb-i HR28869-AC65 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC68 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC75 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC117 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC157 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC158 R R R R R R R Bph18+Xa4+xa5+Stvb-i HR28869-AC159 R R R R R R R Bph18+Xa4+xa5+Stvb-i z R and S mean resistant and susceptible to insect and disease Table 7. Comparison of the control and K3a inoculation about rice yield, ratio of ripened grain, and perfect kernel of brown rice. Var./lines Rough rice yield (g) Brown rice yield (g) Control Ratio of Perfect kernel ripened grain of brown rice (%) (%) Rough rice yield (g) K3a inoculation Brown rice yield (g) Ratio of Perfect kernel ripened grain of brown rice (%) (%) Nampyeongbyeo **z 378 ** 79.5 ** 63.9 ** Jinbaek ns 443 ns 85.0 ns 82.2 ns Anmi ** 399 ** 71.5 ** 72.1 * HR28869-AC ns 292 ns 81.7 ns 70.1 ns HR28869-AC ns 341 ns 77.7 ns 74.4 ns HR28869-AC ns 318 ns 65.6 ns 72.4 ns HR28869-AC * 322 * 74.6 ns 73.6 ns HR28869-AC ns 343 ns 70.8 ns 72.7 ns HR28869-AC ns 343 * 70.2 ns 70.9 ns HR28869-AC ns 332 * 71.7 ns 71.8 ns z ns, *, and ** mean no significant, significant at P< 0.05, and P< 0.01 by t-test, respectively

9 86 韓育誌 (Korean J. Breed. Sci.) 46(1), 2014 xa5에 9643.T4, T14, T.10Dw (Jeung et al. unpublished), 벼줄무늬잎마름병저항성유전자 Stvb-i에 ST10 (Hayano-Saito et al. 2000) 을이용하여저항성유전자도입여부를확인하였다 (Fig. 1). HR26234는 Xa3+xa5, Stvb-i을, SR30071은 Bph18, Xa4, Stvb-i를가지고있는것으로나타났다. 약배양유래계통중 Bph18을가지고있는계통은 42 계통으로 171개인 bph18 계통에비해 4배가량적게발생하였고작성가능한벼흰잎마름병저항성유전자조합중에서 xa5 단독계통은발생하지않았다. 또한 Bph18+Xa4+xa5+ Stvb-i 저항성유전자조합의선발된 7개내병충성계통들의출수기, 간장, 수장, 수당립수, 등숙률등농업형질이비슷한특성을나타내어 segregation distortion이발생한것으로생각된다 (Table 4, 5). Segregation distortion은분리집단에서멘델의분리법칙을따르지않고편의되어서후대가생성되는것으로모부본배우체의불임에기인한다든지특정배우체의유전자형이선택적으로수정이되어서생성되는것으로나눌수있다 (Xu et al. 1997). 약배양에서인디카는약의조기사멸, 낮은캘러스형성률과식물체재분화율및잦은백색체발생으로자포니카에비하여저조한효율을보이는것으로알려져있어생태형에따라다르며 (Grewal et al. 2011), 불임관련유전자들의작용에의해특정유전자형의소멸또는약배양효율이높은배우체유전자형의선택적수정으로인하여 segregation distortion이발생하는것으로보인다. 자포니카유전자원은협소한유전적배경으로생물적스트레스에저항성인유전자를확보하는데제한적이다. 이를보완하기위해인디카의유용한유전자를자포니카로도입하는데있어서전통적육종법을활용해서는높은불임, 불량한초형과열악형질수반 (linkage drag) 으로어려움이있다 (Jeung et al. 2005). Bph18 저항성유전자는야생벼 O.australiensis로부터인디카계통에이전되었고 MAS기법과전게놈의배경분석 (genome-wide background analysis) 을통해자포니카주남벼배경에도입되었다 (Jena et al. 2006, Suh et al. 2011). Bph18은 12번염색체장완에위치하고있으며이위치에는교잡불임과관련된대립유전자가존재한다. Kubo and Yoshimura (2005) 는 12번염색체장완에서인디카품종 IR24와자포니카품종 Asominori의교잡시불임과관련된대립유전자 hsa1-ir을보고하였고, Yara et al. (2010) 또한 Bph26(t) 와 hsa1부근에서교잡불임과관련된 hsy(t) 가존재한다고하였다. 2011년육성당시 Bph18 보유약배양계통중 Xa3와 Xa3+xa5 조합은심한불임을나타내었으나 SR30071 의 Xa4와 HR26234의 xa5가결합된유전자집적 Xa4+xa5 조합의계통은불임에문제가없는것으로판단되어선발하여생산력검정을수행하였다. 그러나 2012년생산력검정시험중에 Bph18+Xa4+xa5 조합의계통들에서불임의문제점이발견되었다 (data not shown). 이는선발과정에서면밀한검토가이루어지지않았고 2012년기상이불임발현에영향을미친것으로생각한다. 자포니카주남벼배경으로 Bph18 이도입된 SR30071 조합의계통들은 Bph18 표지마커를이용하여 MAS 후반복적인여교배를통해육성되어대부분의게놈이주남벼로회복이되었으나, 여교배후대계통들에대해서전게놈배경분석을실시한결과 1, 2, 10, 11, 12번염색체상에 Bph18 수여친인인디카계통 IR 의염색체절편이남아있고이부위는여교배세대진전에관계없이유지된다고하였다 (Shin et al. 2011, Suh et al. 2011). 인디카 IR24의불임관련대립유전자 hsa1-ir (Chr. 12) 는 Asominori의불임과관련된대립유전자 hsa2-as (Chr. 8) 와 hsa3-as (Chr. 9) 와한게놈상에존재할경우심한불임이발생한다 (Kubo and Yoshimura 2005). hsa1-ir 발현에 hsa2-as 와 hsa3-as가상위성 (epistasis) 을나타내고이로인한불임발생은특정대립유전자조합의선택적제거를가져오게된다. 따라서약배양집단에서 segregation distortion이발생한것이나일부계통들에서불임이발생한것은재조합과정중 Bph18 부근의불임관련대립유전자와상위성을나타내는다른대립유전자들간의조합에기인한것으로생각한다. Shin et al. (2011) 은자포니카벼에 Bph18 도입할경우출수일수는짧은쪽으로, 간장과수장은큰쪽으로작용하며등숙비율은낮은쪽으로영향을미치는것으로보인다하였다. 본연구에서도 Bph18 도입계통이 bph18 계통에비해간장이유의한수준에서 10.1 cm 컸고등숙비율은표준품종과비교품종들에비해낮았다 (Table 4, 5). Bph18이위치하고있는 12번염색체장완에는다른벼멸구저항성유전자 Bph1, bph2, Bph9, Bph10, Bph21, Bph26(t) 가위치하는것으로알려져있다 (Jena and Kim 2010, Murai et al. 2003, Yara et al. 2010). Bph1는간장을크게한다고하였고 bph2에의해간장과 3절간장이길어져도복지수가커진다하였다 (Lee et al. 2005, Yeo and Sohn 2001, Yeo et al. 2002). 이러한결과를종합하여 Shin et al. (2011) 은 12번염색체장완에존재하는 Bph1, bph2, Bph18은장간유전자와밀접히연관되어있어이들유전자를가지고있는벼품종들은재배과정에서도복되기쉬운특성을가진것으로보인다하였다. 본연구

10 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 87 에서는이러한도복관련문제에대응하기위해단간위주로복합내병충성계통을선발하여생산력검정을수행하였다. 이들계통들은표준품종인남평벼와비교품종인진백, 안미에비해서간장이작았다 (Table 5). 하지만등숙후기에이들계통들의식물체기부가기울어서단간임에도도복에안정적이지못한특성이나타났는데 (data not shown). 간장은줄어들었으나상대적으로 3절간장의길이가길어도복에안정적이지못한것이아닌가생각한다. 우리나라벼흰잎마름병저항성원으로많이활용되고있는 Xa3는저항성이자포니카일본품종인 Wase Aikoku 3로부터유래하였고 1991년에저항성품종인화영벼와안중벼가개발된이후로이를이용하여많은우량품종이개발되었다 (Kim et al. 2007, Shin et al. 2011). 여교배를통해방글라데시 Aus 품종 DV85의 xa5를자포니카수원345호배경으로도입한근동질유전자계통이육성되었고실질적인품종개발로이어져 2006년에강백이육성되었고이를활용하여 Xa3와 xa5가결합된진백 (2008) 이개발되어변이균인 K3a 에대응할방안을마련하였다 (Shin et al. 2011). 현재우리나라자포니카벼흰잎마름병저항성육종사업의목표유전자조합은 Xa3와 xa5가결합된 Xa3+xa5 조합 (Park et al. 2013) 으로이들조합의품종으로진백 (2008), 신백 (2010), 해품 (2013) 이개발되었으며저항성유전자도입에따른열악형질수반문제는보고된바가없다. Xa4는인디카품종 TKM6 로부터도입되어인디카품종의벼흰잎마름병저항성원으로광범위하게이용되었다 (Mew et al. 1992). Suh et al. (2013) 는 DNA 분자마커활용여교배법 (marker-assisted backcrossing; MAB) 을이용하여 Xa4+xa5+Xa21을자포니카품종에도입하였고, 이들도입된여교배진전육성계통 (advanced backcross breeding line; ABL) 들은열악형질이수반되지않고반복친인자포니카품종과비슷한농업형질과품질특성을나타낸다하였다. 하지만 Xa4는아직까지우리나라에서실질적인품종개발에활용된적이없기때문에 Xa4 도입에따른파악되지않은문제점이발생할수있으므로면밀한검토가필요하다고생각한다. 우리나라자포니카벼품종의벼줄무늬잎마름병저항성은인디카 Modan 유래저항성유전자 Stvb-i가도입되어안정적으로이용되고있다 (Kwon et al. 2012). 1975년에최초의저항성품종인낙동벼가개발 (Chung et al. 1975) 된이후로저항성품종개발에 Stvb-i이지속적으로이용되고있으나 Stvb-i 도입에따른열악형질수반문제는보고된바가없다. 약배양을통해단기간에벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에저항성인복합내병충성계통을확보할수있었다. 하지만계통선발시파악되지않았던불임립의발생, 낮은수량성, 단간임에도도복에안정적이지못한점등열악형질이발견되었다. 병해충에대한저항성육종사업에서약배양을활용하여조기에육종목표를달성하고자할경우에 segregation distortion이발생하여편의된변이가발생할수있고, 저항성유전자도입시 linkage drag에의해예기치못한열악형질특성이나타날수있음을고려하여신중하게목표에접근하여야할것으로생각한다. 적요본연구는벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에저항성인자포니카복합내병충성품종을조기에확보하고자약배양을수행하여목표저항성유전자조합의우량고정계통을개발하고육성과정중에발생할수있는문제점을파악하여병해충저항성육종사업에반영하고자수행하였다. 벼흰잎마름병과벼줄무늬잎마름병에저항성인우량계통 HR 과벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에저항성인 SR 을인공교배한 F 1 을약배양하여 213개고정계통을육성하였다. HR26234는 Xa3+xa5, Stvb-i, SR30071은 Bph18, Xa4, Stvb-i를가지고있는것으로확인되었다. 이들유래약배양계통들은모두 Stvb-i를가지고있었고, Bph18+Xa3, Bph18+Xa4, Bph18+Xa3+xa5, Bph18+Xa4+xa5, bph18+xa3, bph18+xa4, bph18+xa3+ xa5과 bph18+xa4+xa5의조합이확인되었다. 약배양집단에서 xa5+bph18( 또는 bph18)+stvb-i 조합이발생하지않았고 Bph18 보유계통이 bph18 보다적게발생하는등 segregation distortion이발생하였다. Bhp18을보유하며벼멸구에저항성인계통들이감수성인계통들에비해간장이컸다. 선발된 Bph18+Xa4+xa5+Stvb-i 조합의계통은단간이면서벼멸구, 벼흰잎마름병, 벼줄무늬잎마름병에저항성을나타내었으나, 낮은수량성과일부불임의발생, 단간임에도도복에안정적이지못한특성을나타냈다. 병해충에대한저항성육종사업에서약배양을활용하여조기에육종목표를달성하고자할경우에 segregation distortion이발생하여편의된변이가발생할수있고, 저항성유전자도입시 linkage drag에의해예기치못한열악형질특성이나타날수있음을고려하여신중하게목표에접근하여야할것으로생각한다.

11 88 韓育誌 (Korean J. Breed. Sci.) 46(1), 2014 사사본논문은농촌진흥청연구사업 ( 과제번호 : PJ008710) 의지원에의해이루어진것임 References 1. Chung KY, Park RK, Chung KS, Lee SK, Jeon BT, Jin YD A new high yielding rice variety resistant to rice stripe virus Milyang 15 (Nagdong). Res. Rept. NYAES 17: Collard BC, Mackill DJ Marker-assisted selection: an approach for precision plant breeding in the twentyfirst century. Philosophical Transactions Royal Soc. B: Biological Sciences 363: Dokku P, Das K, Rao G Pyramiding of four resistance genes of bacterial blight in Tapaswini, an elite rice cultivar, through marker-assisted selection. Euphytica 192: Grewal D, Manito C, Bartolome V Doubled haploids generated through anther culture from crosses of elite and cultivars and/or lines of rice: large-scale production, agronomic performance, and molecular characterization. Crop Sci. 51: Hayano-Saito Y, Saito K, Fujii K, Touyama T, Tsuji T, Sugiura N, Izawa T SCAR marker selection of the rice stripe resistance gene Stvb-i. Breeding Res. 2: Huang D, Qiu Y, Zhang Y, Huang F, Meng J, Wei S, Li R, Chen B Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.). Theor. Appl. Genet. 126: Jena KK, Jeung JU, Lee JH, Choi HC, Brar DS High-resolution mapping of a new brown planthopper (BPH) resistance gene, Bph18(t), and marker-assisted selection for BPH resistance in rice (Oryza sativa L.). Theor. Appl. Genet. 112: Jena KK, Kim SM Current status of brown planthopper (BPH) resistance and genetics. Rice 3: Jeung JJ, Hwang HG, Moon HP, Jena KK Fingerprinting temperate japonica and tropical indica rice genotypes by comparative analysis of DNA markers. Euphytica 146: Kauffman HE, Reddy APK, Hsieh SPY, Merca SD An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis. Rep. 57: Khush G Multiple disease and insect resistance for increased yield stability in rice. Progress in irrigated rice research. International Rice Research Institute, Manila, Philippines: Kim KY, Shin MS, Shin SH, Ko JC, Kim BK, Ko JK, Kim JG Resistant response of rice varieties to Korean and Philippines bacterial blight, Xanthomonas oryzae. pv. oryzae. Korean J. Intl. Agri. 19: Kubo T, Yoshimura A Epistasis underlying female sterility detected in hybrid breakdown in a Japonica Indica cross of rice (Oryza sativa L.). Theor. Appl. Genet. 110: Kwak DY, Yeo US, Lee JH, Oh BG, Shin MS, Ku YC Mass screening method for rice virus resistance using screen house. Korean J. Crop. Sci. 52: Kwon TM, Lee JH, Park SK, Hwang UH, Cho JH, Kwak DY, Youn YN, Yeo US, Song YC, Nam JS, Kang HW, Nam MH, Park DS Fine mapping and identification of candidate rice genes associated with qstv11 SG, a major QTL for rice stripe disease resistance. Theor. Appl. Genet. 125: Lee JH, Yeo US, Kwak DY, Park DS, Oh BG, Ku YC, Kim HY, Sohn JG QTL analysis for ripening traits of BPH resistant backcross inbred lines in rice. Korean J. Breed. Sci. 37: Lee JH, Yeo US, Cho JH, Lee JY, Song YC, Shin MS, Kang HW, Sohn JK Marker assisted selection of brown planthopper resistance and development of multiresistance to insect and disease in rice (Oryza sativa L.). Korean J. Breed. Sci. 43: Mew T, Vera CCM, Medalla E Changes in race frequency of Xanthomonas oryzae pv. oryzae in response to rice cultivars planted in the Philippines. Plant Dis. 76: Murai H, Sharma P, Murata K, Hashimoto Z, Ketipearachi Y, Shimizu T, Takumi S, Mori N, Kawasaki S, Nakamura C Constructing linkage maps of brown planthopper resistance genes Bph1, bph2, and Bph9 on rice chromosome 12. Rice genetics collection. World Scientific Publishing, Singapore: Park HS, Shin MS, Kim KY, Noh TH, Baek SH, Lee JH, Ha KY, Baek MK, Kim WJ, Park JH, Yoo JS, Cho YC,

12 약배양이용벼멸구, 흰잎마름병및줄무늬잎마름병저항성복합내병충성벼계통육성 89 Kim BK Reaction of single resistance genes and their pyramiding effects in indica and japonica rice against Xanthomonas oryzae pv. oryzae in Korea. Korean J. Breed. Sci. 45: Savary S, Teng PS, Willocquet L, Nutter Jr FW Quantification and modeling of crop losses: a review of purposes. Annu. Rev. Phytopathol. 44: Shin MS, Kim KY, H.S. P, Ko JK Breeding for resistance to bacterial blight in rice. Korean J. Breed. Sci. 43: Shin MS, Kim WJ, Shin WC, Park HS, Seo CS, Choi IB, Ha KY, Kang HJ, Ko JK Effect of brwon planthopper resistance gene, Bph18 to yield components in rice. Korean J. Breed. Sci. 43: Suh J-P, Yang S-J, Jeung J-U, Pamplona A, Kim J-J, Lee J-H, Hong H-C, Yang C-I, Kim Y-G, Jena KK Development of elite breeding lines conferring Bph18 gene-derived resistance to brown planthopper (BPH) by marker-assisted selection and genome-wide background analysis in japonica rice (Oryza sativa L.). Field Crop. Res. 120: Suh J-P, Jeung J-U, Noh T-H, Cho Y-C, Park S-H, Park H-S, Shin M-S, Kim C-K, Jena KK Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice. Rice 6: Xu J Pyramiding of two BPH resistance genes and Stv-b i gene using marker-assisted selection in japonica rice. Crop Breed. Appl. Biot. 13: Xu Y, Zhu L, Xiao J, Huang N, McCouch S Chromosomal regions associated with segregation distortion of molecular markers in F 2, backcross, doubled haploid, and recombinant inbred populations in rice (Oryza sativa L.). Mol. Gen. Genet. 253: Yara A, Phi CN, Matsumura M, Yoshimura A, Yasui H Development of near-isogenic lines for BPH25(t) and BPH26(t), which confer resistance to the brown planthopper, Nilaparvata lugens (Stål.) in indica rice ADR52. Korean J. Breed. Sci. 60: Yeo US, Sohn JG Linkage analysis between some agronomic traits and resisatnce gene to brown planhopper in rice. Korean J. Breed. Sci. 33: Yeo US, Kwak DY, Lim SJ, Ha WG, Cho JH, Sohn JG Relationship between agronomic traits and resistance to brown planthopper in Japonica RIL population. Korean J. Breed. Sci. 34: Yoshimura S, Yoshimura A, Iwata N, McCouch SR, Abenes ML, Baraoidan MR, Mew TW, Nelson RJ Tagging and combining bacterial blight resistance genes in rice using RAPD and RFLP markers. Mol. Breeding 1:

Kor. J. Breed. Sci. 44(3): ( ) Online ISSN: Print ISSN: 중만생고품질벼멸구저항성벼품종 친농 신문식 1 * 고재권 1 고종철 2 김보경 1 강현중 1 김영두 1 남정권 1

Kor. J. Breed. Sci. 44(3): ( ) Online ISSN: Print ISSN: 중만생고품질벼멸구저항성벼품종 친농 신문식 1 * 고재권 1 고종철 2 김보경 1 강현중 1 김영두 1 남정권 1 Kor. J. Breed. ci. 44(3):373-378(22. 9) Online IN: 2287-574 Print IN: 25-336 중만생고품질벼멸구저항성벼품종 친농 신문식 * 고재권 고종철 2 김보경 강현중 김영두 남정권 하기용 김기영 3 백만기 신운철 김우재 박현수 백소현 모영준 4 최인배 이건휘 이영복 김정곤 4 농촌진흥청국립식량과학원벼맥류부, 2

More information

<31332E28C7B0C1BE29B9E8BCAEBAB92E687770>

<31332E28C7B0C1BE29B9E8BCAEBAB92E687770> 韓 育 誌 (Korean J. Breed. Sci.) 40(2) : **~** (2008) 단경 내병 다수성 땅콩 품종 풍산 배석복 * 정영근 2 박장환 이명희 황정동 심강보 정찬식 강철환 박금룡 박충범 최규환 4 이재철 5 김인재 6 김제규 영남농업연구소, 2 호남농업연구소, 작물과학원, 4 전라북도노업기술원, 5 충청남도농업기술원, 6 충청북도 농업기술원,

More information

<C7D1B1B9C0B0C1BEC7D0C8B B1C732C8A35FC7D0C8B8C3D6C1BEBABB E687770>

<C7D1B1B9C0B0C1BEC7D0C8B B1C732C8A35FC7D0C8B8C3D6C1BEBABB E687770> Korean Journal of Breeding Science Korean J. Breed. Sci. 50(2):171-176(2018. 6) Online ISSN: 2287-5174 Print ISSN: 0250-3360 https://doi.org/10.9787/kjbs.2018.50.2.171 중생고품질복합내병성벼 선품 정응기 원용재 * 양창인 조영찬

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

<30305FC7D1B1B9C0B0C1BEC7D0C8B8C1F B1C732C8A35FBCF6C1A4C6EDC1FDBABB E687770>

<30305FC7D1B1B9C0B0C1BEC7D0C8B8C1F B1C732C8A35FBCF6C1A4C6EDC1FDBABB E687770> Korean Journal of Breeding Science Korean J. Breed. Sci. 51(2):140-145(2019. 6) Online ISSN: 2287-5174 Print ISSN: 0250-3360 https://doi.org/10.9787/kjbs.2019.51.2.140 원용재 1 정응기 1* 강경호 1 홍하철 2 조영찬 1 정오영

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

<C7D1B1B9C0B0C1BEC7D0C8B B1C733C8A35F36C2F7C6EDC1FDBABB E687770>

<C7D1B1B9C0B0C1BEC7D0C8B B1C733C8A35F36C2F7C6EDC1FDBABB E687770> Korean Journal of Breeding Science Korean J. Breed. Sci. 50(3):261-267(2018. 9) Online ISSN: 2287-5174 Print ISSN: 0250-3360 https://doi.org/10.9787/kjbs.2018.50.3.261 원용재 1 이정희 1 양창인 1 김명기 1 장재기 2 조영찬

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

<31315FC7B0C1BE5FC0E5C1A4C8F15F33C2F D322E687770>

<31315FC7B0C1BE5FC0E5C1A4C8F15F33C2F D322E687770> Korean Journal of Breeding Science Korean J. Breed. Sci. 51(3):251-257(2019. 9) Online ISSN: 2287-5174 Print ISSN: 0250-3360 https://doi.org/10.9787/kjbs.2019.51.3.251 밥맛이우수한경기지역적응중만생종벼 참드림 장정희 1* 이종형

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

Microsoft Word - KSR2012A021.doc

Microsoft Word - KSR2012A021.doc YWXY G ºG ºG t G G GGGGGGGGGrzyYWXYhWYXG Ÿƒ Ÿ ± k ¹Ÿˆ Review about the pantograph field test result adapted for HEMU-430X (1) ÕÕÛ äñ ã G Ki-Nam Kim, Tae-Hwan Ko * Abstract In this paper, explain differences

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

<C7D1B1B9C0B0C1BEC7D0C8B B1C733C8A35F36C2F7C6EDC1FDBABB E687770>

<C7D1B1B9C0B0C1BEC7D0C8B B1C733C8A35F36C2F7C6EDC1FDBABB E687770> Korean Journal of Breeding Science Korean J. Breed. Sci. 50(3):344-349(2018. 9) Online ISSN: 2287-5174 Print ISSN: 0250-3360 https://doi.org/10.9787/kjbs.2018.50.3.344 이원도 1 박용진 2 장성규 3 권순욱 3 이영상 4 조유현

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

À±½Â¿í Ãâ·Â

À±½Â¿í Ãâ·Â Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

歯5-2-13(전미희외).PDF

歯5-2-13(전미희외).PDF The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

전북지역간척지에적합한최고품질벼품종선발 197 장을통해쌀을자율적으로수급조절할수있는정책으로전환하였다. 따라서쌀증산에서품질향상으로전환하였으며, 유통부분에서는 RPC구조조정을통한민간중심, 시장중심의자율적유통체계를구축하기위해노력하고있다 (Kim, 2010b). 농림축산식품부의중

전북지역간척지에적합한최고품질벼품종선발 197 장을통해쌀을자율적으로수급조절할수있는정책으로전환하였다. 따라서쌀증산에서품질향상으로전환하였으며, 유통부분에서는 RPC구조조정을통한민간중심, 시장중심의자율적유통체계를구축하기위해노력하고있다 (Kim, 2010b). 농림축산식품부의중 한작지 (Korean J. Crop Sci.), 63(3): 196~204(2018) DOI : https://doi.org/10.7740/kjcs.2018.63.3.196 ISSN 0252-9777(Print) ISSN 2287-8432(Online) Original Research Article 전북지역간척지에서최고품질벼품종의작물학적 이화학적특성비교및선발

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

(2)-02(최경자).fm

(2)-02(최경자).fm Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish

More information

8(3)-01.fm

8(3)-01.fm w» wz, 8«3y(2006) Korean Journal of Agricultural and Forest Meteorology, Vol. 8, No. 3, (2006), pp. 125~131 2003 û šþ vw k y³á Á ûxáû «Á½» Á½ Á½ š w yû (2006 3 7 ; 2006 6 17 ) A Survey on Low Temperature

More information

27송현진,최보아,이재익.hwp

27송현진,최보아,이재익.hwp OSMU전략에 따른 산업 동향 및 발전방안 -영상콘텐츠를 중심으로- A current research & development study on the OSMU strategy in field of game industry -A special study on the popular visual contents- 주저자: 송현진 (Song Hyun Jin) 서울산업대학교

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 3. 계통육종법 ( 系統育種法 ; pedigree method) : F2 세대부터계속개체선발과계통재배를되풀이하면서우량계통을육성하는방법 --- 교잡육종법의기본 계통 (line; pedigree): F3부터전대 ( 前代 ) 에선발한 1개체씩을개체별로 1열씩재배할때각열을계통으로명명. 품종화이전까지계통으로불림. * line내의개체간유전조성 : 다름 / 비슷 ( 초기세대

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

12.077~081(A12_이종국).fm

12.077~081(A12_이종국).fm J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

제출문 - 2 -

제출문 - 2 - 제출문 - 2 - 요약문 - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

03-16-김용일.indd

03-16-김용일.indd Journal of the Korean Society of Surveying, Geodesy, Photogrammetry and Cartography Vol. 33, No. 2, 95-101, 2015 http://dx.doi.org/10.7848/ksgpc.2015.33.2.95 ISSN 1598-4850(Print) ISSN 2288-260X(Online)

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70

2.대상 및 범위(계속) 하천 하천 등급 하천명 연장 (km) 연장 (km) 시점 금회수립현황 종점 지방 하천 함안천 8.40 9.06 경남 함안군 여항면 내곡리 경남 함안군 함안면 함안천(국가)기점 검단천 7.00 3.34 경남 함안군 칠북면 검단리 칠원천 6.70 경상남도 고시 제2010-46호 하천기본계획 고시 하천법 제25조 및 같은 법 시행령 제24조의 규정에 따라 수립한 하천 기본계획을 같은 법 시행규칙 제13조에 따라 고시합니다. 2010. 1. 29 경 상 남 도 지 사 1.수립 또는 변경 목적 하천의 효율적인 이용과 계획적이고 체계적인 하천사업추진 및 원활한 유지관리와 하천의 일관된 개발계획을 위하여 하천법

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

AA - Report Web - Results

AA - Report Web - Results LINE DANCE FEMALE PRIMARY NEWCOMER OverAll Pulse Cuban Street Stage 101 Ja Yeong Jeon 전자영 1 1 1 1 102 Seung Yun Cho 조승연 2 2 2 2 LINE DANCE FEMALE YOUTH NEWCOMER OverAll Pulse Cuban Street Stage 110 Seong

More information

°í¼®ÁÖ Ãâ·Â

°í¼®ÁÖ Ãâ·Â Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of

More information

304.fm

304.fm Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun

More information

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상 6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

02양은용

02양은용 The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),

More information

<30362E20C6EDC1FD2DB0EDBFB5B4EBB4D420BCF6C1A42E687770>

<30362E20C6EDC1FD2DB0EDBFB5B4EBB4D420BCF6C1A42E687770> 327 Journal of The Korea Institute of Information Security & Cryptology ISSN 1598-3986(Print) VOL.24, NO.2, Apr. 2014 ISSN 2288-2715(Online) http://dx.doi.org/10.13089/jkiisc.2014.24.2.327 개인정보 DB 암호화

More information

07_Àü¼ºÅÂ_0922

07_Àü¼ºÅÂ_0922 176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)

More information

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for 2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon

More information

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

44-3대지.08류주현c

44-3대지.08류주현c A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional

More information

Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The obje

Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The obje Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The objectives of this study are analyzing research trends

More information

08원재호( )

08원재호( ) 30 2 20124 pp. 173~180 Non-Metric Digital Camera Lens Calibration Using Ground Control Points 1) 2) 3) Abstract The most recent, 80 mega pixels digital camera appeared through the development of digital

More information