untitled
|
|
- 다솜 태
- 6 years ago
- Views:
Transcription
1 Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye Chul Kwon, 2 Jong Woo Park, 2 Chi eon Ko, 2 o Youn hin, 2 Jeong Hoon ong, 2 un Hoe Koo 2 1 Health Promotion Center, amsung Medical Center, eoul, 2 Department of Laboratory Medicine, Chungnam National University College of Medicine, Daejeon, Korea Background: ecently, there have been reports of infections with multidrug-resistant Pseudomonas aeruginosa. To determine the mechanism of the resistance, we investigated the prevalence of Ambler class A and D β-lactamases, their extended-spectrum derivatives, and class B and D carbapenemase in multidrug-resistant P. aeruginosa isolates. Methods: During the period of March 2006 to May 2007, clinical isolates of multidrug-resistant P. aeruginosa were collected from patients in Chungnam National University Hospital, Daejeon, Korea. nhibitor-potentiated disk diffusion tests were used for the screening of metallo-β-lactamase (MBL) production. PC and DNA sequencing were conducted for the detection of β-lactamase genes. We also employed the enterobacterial repetitive intergenic consensus (EC)- PC method for an epidemiologic study. esults: A total of 37 consecutive, non-duplicate, multidrug-resistant P. aeruginosa were isolated. Twentynine of 37 isolates harbored bla OXA- 10 (56.8%), bla (18.9%), and bla OXA-1 (5.4%). Only one isolate produced MP-1, and it also harbored bla OXA-1. None harbored Ambler class A β-lactamase or class D carbapenemase. The strains producing OXA type β-lactamases showed a significantly higher resistance to aminoglycoside compared to non-producers. The EC-PC pattern of the 19 producing strains indicated that the isolates were closely related in terms of clonality. Conclusion: OXA type β-lactamases are the most prevalent among the acquired β-lactamases produced by multidrug-resistant P. aeruginosa isolated at a university hospital in Chungcheong Province. Besides β-lactam antibiotics, the strains harboring OXA type β-lactamase showed a significantly higher resistance to aminoglycoside and qunolone. (Korean J Clin Microbiol 2008;11:98-106) Key Words: Multidrug resistance, Pseudomonas aeruginosa, OXA type β-lactamase, Metallo-βlactamase (MBL) 서 녹농균 (Pseudomonas aeruginosa) 은호기성포도당비발효그람음성간균으로병원감염의주요원인균이다. 녹농균에의한감염은대부분기회감염이며, 외이도염, 골수염, 뇌수막염, 심내막염, 폐렴, 요로감염, 균혈증등다양한감염증을유발한다 [1]. 녹농균에의한감염증의치료에는이세균에비교적강한항균력을지닌 β-lactam계열의항균제인 ceftazidime, cefepime 및 carbapenem 등의약제가사용되고있다. 그러나, 최근 cefepime이나 carbapenem에도내성을보이는다제내성녹농균의감염이증가하고있어많은문제가되고있다 [2]. 2003년 eceived 31 January, 2008, Accepted 20 August, 2008 Correspondence: un Hoe Koo, Department of Laboratory Medicine, Chungnam National University Hospital, 640, Daesa-dong, Jung-gu, Daejeon, Korea. (Tel) , (Fax) , ( ) shkoo@cnu.ac.kr 론 KONA surveillance 조사에의하면 imipenem 내성인녹농균의비율이 20% 로높았고, 이중대부분은다제내성균이었다 [3]. 녹농균이 cefepime이나 carbapenem에대한내성을획득하는기전중하나가 Ambler class A와 D에속하는 extended spectrum β-lactamase (EBL) 의생성혹은 class B와 D에속하는 carbapenemase의생성이다 [4]. Class A에속하며장내세균에의해흔히생성되는 TEM형및 HV형 EBL은드물지만녹농균에서도생성되는것으로알려져있다 [5]. VEB형 [6] 및 cephalosporin계항균제에강한분해활성을갖는 PE-1형 [7] 또한녹농균에서검출된바있다. 그러나녹농균에서주로보고되는 EBL은 class D에속하는 OXA형 β-lactamase로우리나라에도널리퍼져있으며 EBL인 OXA-17 생성녹농균도보고된바있다 [8,9]. 녹농균이생성하는 carbapenemase 에는 2000년남아프리카공화국에서분리된녹농균에서처음보고된 class A의 GE형 EBL[10], class B metallo-β-lactamase (MBL), 그리고 class D 98
2 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 99 의 OXA형 carbapenemase등이있다. 이중가장강력한 carbapenemase 인 MBL은 1988년일본에서처음발견되었으며 [11], imipenem 을가수분해하는효소라는의미에서 MP-1으로명명되었다 [12]. 그후일본을비롯한여러나라에서 VM형 [13,14], PM-1형 [15], GM-1형 [16], 그리고 M-1형 [17] 등의 MBL이보고되었다. Class D의 OXA형 carbapenemase는 1985년에스코틀랜드에서분리된 imipenem 내성 Acinetobacter baumannii에서처음확인되었으며 [18] 지금은유럽, 아시아, 브라질등전세계적으로확산되었고 [19], 국내에서도 2005년도에분리된녹농균에서검출된바있다 [20]. 다제내성녹농균의출현및확산은이세균에의한감염증치료에많은어려움을가중시킬수있으므로임상적으로중요한문제이다. 녹농균이다제내성을보이는중요한원인중의하나가 β-lactamase생성에의한획득내성이므로다제내성녹농균을대상으로 β-lactamase의성상을규명하는것은내성기전을연구하는데중요하다. 본연구에서는충청지역에서분리된다제내성녹농균을대상으로 Ambler class A와 D에속하는 EBL과 class B와 D에속하는 carbapenemase의대표적인유전형들을규명하여내성세균의확산을방지하기위한기초자료를제공하고자하였다. 재료및방법 1. 균주의수집 2006년 3월부터 2007년 5월까지충남대학교의과대학병원진단검사의학과에의뢰된임상검체분리녹농균중다제내성을보인 37주를대상으로하였다. 분리된녹농균이광범위항균제인 cefepime, amikacin, ciprofloxacin, piperacillin / tazobactam과 meropenem 중 3가지이상의항균제에내성을보일경우다제내성균으로정하였다 [21]. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의균종은전통적인생화학적방법및 Vitek GN card (biomerieux Vitek nc., Hazelwood, MO, UA) 로확인하였다. 2. 항균제감수성시험미국의 Clinical and Laboratory tandards nstitute (CL) 지침에따라 [22] amikacin, gentamicin, netilmicin, tobramycin, ceftazidime, imipenem, piperacillin, ticarcillin, 및 ciprofloxacin (BBL, Cockeysville, MD, UA) 과 aztreonam, cefepime, meropenem, piperacillin tazobactam, 및 ticarcillin-clavulanic acid (Oxoid, Cambridge, UK) 에대한감수성을 Mueller-Hinton 한천배지 (Difco, Cockeysville, MD, UA) 를사용하여디스크확산법으로확인하였다. 항균제에대한최소억제농도 (minimum inhibitory concentration, MC) 는 Mueller-Hinton 액체배지 (BBL) 를사용하여액체미량희석법으로구하였다. Amikacin, gentamicin, netilmicin, tobramycin, aztreonam 및 piperacillin 은 igma-aldrich (t. Louis, MO, UA) 에서구입하여사용하였으며, 그외사용한항균제는 ceftazidime ( 한미약품, 서울, 한국 ), cefepime ( 보령제약, 서울, 한국 ), imipenem (MD, Elkton, VA, UA), meropenem (AstraZeneca, Cheshire, UK), ticarcillin 및 ciprofloxacin (CN Biomedicals nc, Costa, Mesa, CA, UA) 이었다. 정도관리를위해서 Escherichia coli ATCC 25922와 P. aeruginosa ATCC 27853을동시에시험하여허용범위에드는지확인하였다. 3. nhibitor-potentiated disk diffusion (PD) 방법을이용한 Metallo-β-lactamase 생성선별검사다제내성녹농균을대상으로 PD 검사를 [23] 실시하여 MBL 생성균주를선별하였다. MacConkey 한천배지 (Difco) 에서 35 o C, 24시간동안배양한균집락을풀어 McFarland 표준액 0.5에맞춘후균액을 Mueller-Hinton 한천배지에접종하였다. 접종한균액이마른후두개의 10μg imipenem disk를두디스크중심간의거리가 4 5 cm간격이되게하여배지위에올려놓고두개중한개의디스크에만 0.5 M EDTA 용액 10μl 를분주하였다. 35 o C, 18시간배양한다음억제대를판독하여 imipenem과 imipenem-edta 디스크의억제대차가 7 mm 이상인균주를 MBL 생성선별검사의양성으로판단하였다 [23]. 4. 분자생물학적방법에의한 β-lactamase 유전형확인 β-lactamase의유전형을분석하기위해이미보고된바있는기존의시발체를사용하여중합효소연쇄반응 (polymerase chain reaction, PC) 을수행하였다 (Table 1). 대상균주를 brain heart infusion 액체배지 (Difco, Cockeysville, M, UA) 에접종하여 37 o C로하룻밤진탕배양한후 DNA purification kit (Promega, Madison, W, UA) 을사용하여배양액으로부터 DNA를추출하였다. DNA 추출액 (5μL), 10 Taq buffer (2.5μL), 10 mm dntp mix (0.5μL), primer 각 10 pmol, 0.7U Taq DNA polymerase ( 솔젠트, 대전, 한국 ) 및증류수를혼합하여 25μL의반응용액을만들었다. Gene Amp PC ystem 9600 (Perkin- Elmer Centus Corp., Norwalk, CT, UA) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20초, 59 o C에서 40초, 72 o C에서 30초씩 30회증폭반응시키고, 70 o C에서 5분간연장반응시켰다. 각각의 PC 생산물을 ethidium bromide 가포함된 1% agarose gel에서 40분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit (Qiagen, Hilden, Germany) 로분리후, BigDye Terminator Cycle equencing Kit (PE Applied Biosystems, Foster City, CA, UA) 와 AB PM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다.
3 Korean J Clin Microbiol 2008;11(2): Table 1. Oligonucleotides used as primers for amplification and sequencing Enzyme Class Primer pairs Target equence (5-3 ) Amplicon size (bp) eference Class A Class B Class D TEM F bla TEM and derivative ATGAGTATTCAACATTTCCGT TEM TTACCAATGCTTAATCAGTGA HV F CCGGGTTATTCTTATTTGTCGCT bla HV and derivative HV TAGCGTTGCCAGTGCTCG PE F GTTAATTTGGGCTTAGGGCAGA bla PE PE CAGCGCAATCCCCACTGT VEB F CGACTTCCATTTCCCGATGC bla VEB VEB GGACTCTGCAACAAATACGC GE F GTTAGACGGGCGTACAAAGATAAT bla GE, bla BC GE TGTCCGTGCTCAGGATGAGT MP F CATGGTTTGGTGGTTCTTGT bla MP MP ATAATTTGGCGGACTTTGGC VM F ATTGGTCTATTTGACCGCGTC bla VM VM TGCTACTCAACGACTGAGCG M F GTACAAGGGATTCGGCATCG bla M M TGGCCTGTTCCCATGTGAG PM F CTAAATCGAGAGCCCTGCTTG bla PM PM CCTTTTCCGCGACCTTGATC GM F TCAATTAGCTCTTGGGCTGAC bla GM GM CGGAACGACCATTTGAATGG OXA-1F AGCCGTTAAAATTAAGCCC bla OXA group OXA-1 CTTGATTGAAGGGTTGGGCG F GCCAAAGGCACGATAGTTGT bla OXA group GCGTCCGAGTTGACTGCCGG F TCTTTCGAGTACGGCATTAGC blaoxa group CCAATGATGCCCTCACTTTCC 3F GATGTGTCATAGTATTCGTCG bla3, 27, 49 3 TCACAACAACTAAAAGCACTG 4F GTACTAATCAAA GTTGTGAA bla4, 25, 26, 40, 72 4 TTCCCCTAACATGAATTTGT OXA-58F CGATCAGAATGTTCAAGCGC OXA-58 blaoxa-58 ACGATTCTCCCCTCTGCGC , Abbreviations: F, forward;, reverse. 5. Enterobacterial repetitive intergenic consensus polymerase chain reaction (EC PC) 에의한역학적연관성조사 DNA purification kit (Promega) 로대상균주의 DNA를추출하여주형 DNA로사용하였다. Primer로는 EC1 (5'-ATGT AAGCTCCTGGGGA-TTCAC-3') 과 EC2 (5'-AAGTAAGTG ACTGGGGTGAGCG-3') 로명명된장내세균의반복서열을사용하였다 [32]. 증폭반응은 DNA 추출액 (5.0μL), 10 Taq buffer (5.0μL), 10 mm dntp mix (1.0μL), primer 각 20 pmol, 1.4U Taq DNA polymerase ( 솔젠트 ) 및증류수를혼합하여 50 μl의혼합액으로시행하였다. 95 o C에서 5분간반응시킨후, 92 o C에서 50초, 52 o C에서 55초, 70 o C에서 7분씩 35회증폭반응시키고, 70 o C에서 10분간연장반응시켰다. 증폭산물 (10μL) 은 ethidium bromide가포함된 2% agarose gels에전기영동한후 BioDoc-14 TM maging system (UVP, Cambridge, UK) 을이 용하여분석하였다. Band의강도와상관없이 band의분자량과개수로각균주를비교하며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [33]. 결과 1. 항균제감수성양상시험기간중총 37주의다제내성녹농균이환자의임상검체에서분리되었으며, amikacin 91.9%, gentamicin 97.3%, netilmicin 91.9%, tobramycin 86.5%, aztreonam 56.8%, ceftazidime 75.7%, cefepime 78.4%, imipenem 67.6%, meropenem 67.6%, piperacillin 54.1%, piperacillin-tazobactam 48.6%, ticarcillin 97.3%, ticarcillin-clavulanic acid 83.8%, 그리고 ciprofloxacin 94.6% 의내성율을보였다 (Table 2).
4 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 101 Table 2. Antibiotic susceptability profiles and β-lactamases of multi-drug resistant Pseudomonas aeruginosa solates Antibiotic susceptibilities β-lactamase AMK GEN NET TOB ATM CAZ FEP PM MEM PP TZP TC TM CP P2 P3 P4 P5 P7 P15 P17 P18 P21 P23 P25 P26 P29 P31 P34 P35 P40 P41 A2 A3 A8 A9 A10 A11 A13 A14 A15 A16 A18 A19 A26 A32 A36 A41 A42 A43 A50, OXA-1, MP OXA-1 Abbreviations: AMK, amikacin; GEN, gentamicin; NET, netilmicin; TOB, tobramycin; ATM, aztreonam; CAZ, ceftazidime; FEP, cefepime; PM, imipenem; MEM meropenem; PP, piperacillin; TZP, piperacillin-tazobactam; TC, ticarcillin; TM, ticarcillin-clavulanic acid; CP, ciprofloxacin. Table 3. Prevalence of Ambler class A, B, and D β-lactamases in multi-drug resistant Pseudomonas aeruginosa Class Type of β-lactamases No.(%) of isolates Class B Class D Combined Not detected MP-1 OXA-1 MP and OXA-1 and OXA10 1 (2.7) * 7 2 (5.4) * 7 7 (18.9) 20 (54.1) 1 (2.7) * 7 1 (2.7) 7 9 (24.3) * P23 strain: MP-1 was combined with OXA-1; P17 strain: was combined with. 2. PD 방법을이용한 MBL 생성녹농균선별대상균주 37 주중한주인 P23 만이 MBL 생성선별검사에서양성을보였으며 imipenem 디스크에서생긴억제대보다 imipenem 에 EDTA 를넣어준디스크에서생긴억제대크기가 10 mm 더컸다. 3. β-lactamase 유전형 PD 검사에서양성반응을나타낸 P23 주를대상으로 MBL 유전자검출을위한 PC 을수행한결과 P23 주는 bla MP 에만양성반응을보였고그외의 MBL 유전자 (bla VM, bla M, bla PM, bla GM) 에는음성반응을보였다.
5 102 Korean J Clin Microbiol 2008;11(2): Table 4. Comparison of the antimicrobial resistance (%) between the class D β-lactamase producers and non-producers Antimicrobialagents Class D β-lactamase producers (N=28) Class D β-lactamase non-producers (N=9) MC 50 MC 90 esistant (%) MC 50 MC 90 esistant (%) AMK GEN NET TOB ATM CAZ FEP PM MEM PP TC CP Abbreviations : ee Table 2. Fig. 1. EC-PC patterns of genomic DNA from clinical isolates of multi-drug resistant Pseudomonas aeruginosa harboring bla. Lane M is 1 kb DNA size marker. Nineteen strains of β-lactamase producing clinical isolates show A or B pattern. Ambler class D β-lactamase 유전자검출을위해총 37주의다제내성녹농균을대상으로 PC을한결과 bla OXA-1 bla 그리고 bla 에대해각각 2주 (5.4%), 7주 (18.9%) 및 20주 (54.1%) 가양성반응을보였다. 이중한주 (P17) 는 bla 과 bla 에동시에양성반응을보였으며, bla 에양성반응을보인 20주중에는 bla MP 에양성을보인 P23주가속해있었다. 그외 class D에속하는 bla 3, bla 4 및 bla OXA-58 에대해서는대상균주모두음성반응을보였다. Ambler class A에속하는 EBL (bla HV, bla TEM, bla PE, bla VEB, bla GE) 을검출하기위한 PC에는양성반응을보인균주가한주도없었다 (Table 3). 대상균주중 bla MP 유전자증폭산물은 MP-1 유전자의염기서열과일치하였다. bla OXA-1, bla 및 bla 유전자증폭산물의염기서열은각각 bla OXA-1, bla 및 bla 유전자와염기서열이일치하였다. 4. Class D β-lactamase 생성균주에대한항균제 MC 특성 OXA형 β-lactamase를생성하는균주들이 OXA형 β-lactamase를생성하지않는균주들보다 aminoglycoside계항균제 (amikacin, gentamicin, netilmicin, tobramycin) 와 cephalosporin 계항균제 (ceftazidime 및 cefepime) 에대한내성율이각각평균 26.0% 와 26.5% 높았다. 또한 quinolone계항균제 (ciprofloxacin) 에대해서도내성율이 15.1% 높은것으로나타났다 (Table 4). 5. EC PC에의한역학적연관성조사 β-lactamase를생성하는녹농균 19주를대상으로 EC PC을시험한결과 1500 bp에서굵은밴드를보인 A 형과 2000 bp 이하의밴드여섯개를보인 B형이관찰되었다 (Fig. 1). 고찰 β-lactam 제제는가장널리사용되고있는항균제중하나로, penicillin, cephalosporin, monobactam 및 carbapenem등다양한계열로분류되며, 현재 150가지이상의 β-lactam계항균제가임상에서사용되고있다 [34]. 그러나이러한항균제사용의증가는내성세균의양산이라는부작용을동반하였으며, 이들내성세균의치료를위해서새로운항균제를개발하여야하는악순환이되풀이되어왔다.
6 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 103 그람음성간균의 β-lactam항균제에대한내성은주로 β-lactam항균제를가수분해하는 β-lactamase 생성에의해나타나는데특히획득성 β-lactamase 유전자는 plasmid나 integron에위치하는경우가많아항균제내성유전자의수평전달을유도하여항균제내성을급격히확산시키는요인이된다. 본연구에서는다제내성녹농균을대상으로획득성 β-lactamase의유전형을분석하였는데검출된 β-lactamase의대부분이 class D인 OXA형 β-lactamase들이었다. OXA형 β-lactamase는 oxacillin과 cloxacillin에대해강한활성을가지는효소로녹농균에서빈번하게검출되며, 이효소로부터유래한 EBL을생성하는세균은 oxyimino cephalosporins에대해내성을갖는다 [35]. 본연구에서는 narrow-spectrum β-lactamase인 OXA- 10이가장높은빈도 (51.4%) 로검출되었으며그다음으로 β-lactamase (13.5%) 가많았다. 반면 OXA형 EBL은하나도검출되지않았다. 2005년도에국내에서분리된녹농균을대상으로조사한결과에서도 [9] class A β-lactamase들에비해 class D OXA β-lactamase들이빈번하게검출이되었고그중 의검출율이제일높았으며 (13.5%) 그다음으로 OXA-4 (4.4%), (2.3%) 및 OXA-30 (2.0%) 이었다. 반면대상균주중 1주 (0.3%) 만이 OXA형 EBL을생성하여본연구와유사한결과를보였다. 2005년터키에서도녹농균을대상으로 OXA형β-lactamase들의빈도를조사한결과 β- lactamase의빈도가가장높았던반면 OXA형 EBL은검출되지않았다고했다 [36]. 그러나 2006년에대만에서분리된 OXA 형 β-lactamase들을생성하는녹농균의경우 OXA형 EBL인 OXA-17을가장많이생성했으며최근들어그비율이감소하고있는중이라고했다 [37]. 녹농균에서 OXA형 β- lactamase 의분리양상은지역적, 시간적으로차이를보이며국내에서는 OXA형 EBL의검출율이비교적낮은것으로나타났다. OXA형 β-lactamase 생성주를대상으로항균제의 MC 측정결과대상항균제중 aztreonam과 carbapenem계항균제를제외한대부분의항균제에대해높은내성율을보였다. 특히 aminoglycoside계항균제에대한내성율은다른항균제들에비해월등하게높았는데이는 2006년도에대만에서 [38] 분리된녹농균에서보여진결과와일치하였다. 또한국내에서도 class D β- lactamase를생성하는녹농균의경우 aminoglycoside와 quinolone계항균제에대해교차내성을보인다는보고가있다 [9]. 가장높은빈도로검출된 β-lactamase 생성주를대상으로역학적연관성을조사하기위해 EC PC을실행한결과두개의 pattern이관찰되었다. 총 19주중 5주가 A형을나타냈으며나머지 14주가 B형을나타내었는데이결과는이들이각각동일한감염원에서유래되었음을추측하게한다. 다제내성녹농균이생성하는획득성 β-lactamase중가장높은빈도를차지한것이 OXA형 β-lactamase인반면 carbapenemase에속하는 3, 4, 및 OXA-58 β-lactamase는 검출되지않았다. 이들 OXA형 carbapenemase는 Acinetobacter baumannii에서는흔히생성되는것으로알려져있고국내에서도많이보고가되었으나 [19] 녹농균에서는드물게보고가되고있다. 국내에서는 2005년에 3 β-lactamase가처음으로녹농균에서분리된바있다 [20]. 본연구에서분리된획득성 β-lactamase중에 class A에속하는 β-lactamase는발견되지않았다. 2006년도에국내에서처음으로 HV-12 β-lactamase를생성하는녹농균이보고되었으나 [39] 그이외의 class A에속하는 β-lactamase는보고된적이없다. 녹농균이 TEM형혹은 HV형 EBL을생성하는경우는드문것으로알려졌는데, 이는이들세균이광범위 β-lactam 항균제에대한내성을획득하는데 plasmid성 TEM형혹은 HV 형 EBL을생성하는것보다탈억제에의해서염색체성 cephalosporinase를과량생성하는것이더손쉬운방법이고 [40], 또한이들세균이 class D의 OXA형 EBL을 [37] 흔히생성하기때문에 TEM 혹은 HV형 EBL의필요성이장내세균에비해상대적으로낮기때문인것으로추측한다. 한편, PD방법을이용한 MBL 생성검사에서 P23만이양성반응을보였고이균주가 MP-1형 MBL을생성함이밝혀졌다. 일본에서는 MP-1을생성하는그람음성세균의분리가흔한것으로알려진데반하여 [41], 국내에서의 MP-1 생성균주의분리는흔하지않았으나 2005년 Yoon 등에의해 MP-1형 MBL이 imipenem에내성인녹농균사이에서확산되고있음이보여졌다 [20]. 본연구에서는총 37주의다제내성녹농균중 1주만이 MBL을생성하였는데, 이는다제내성의원인이 MBL 생성에이외의다른요인들에의한것임을추측하게한다 [9]. 최근일본에서다제내성녹농균을대상으로분자생물학적특성을조사한결과에의하면다제내성이 MBL 및 ND 유출펌프생성에의해유도되기도하지만그보다는오히려더많은경우가 porin단백의발현감소및염색체성 cephalosporinase를과량생성과같은다른기전들에의해유도된다고했다 [42]. 본연구에서도이를뒷받침하는결과를보여주었다. 이상의결과에서충청지역의한대학병원에서분리된다제내성녹농균에가장광범위하게확산되어있는획득성 β-lactamase는 OXA 형 β-lactamase임을확인하였다. 또한 OXA 형 β-lactamase 유전자가 aminoglycoside 또는 quinolone계통의항균제에대한내성유전자와동시에존재할수있음을시사했다. 그러나본연구에서검출된 β-lactamase는모두 narrow spectrum의 β-lactamase이었으며 P23균주를제외하고는 carbapenemase도검출되지않았다. 이는녹농균의다제내성이획득성 β-lactamase 생성보다는그이외의다른요인들즉염색체성 cephalosporinase의과량생성, 항균제의유출 (efflux), 또는 porin단백의발현감소로인한세포막의투과성감소등에의해유도되는것임을추측하게한다. 따라서다제내성녹농균의내성기전을밝히기위해서는추가적인연구가필요할것이다.
7 104 Korean J Clin Microbiol 2008;11(2): 감사의글 본연구는산업자원부지방기술혁신사업의지역 &D 클러스터사업 (B000935) 지원으로수행되었음. 참고문헌 1. Bergogne-Berezin E. Pseudomonas and miscellaneous gramnegative bacilli. n: Cohen J and Powerly WG, eds. nfectious Diseases. 2nd ed, New York; Mosby, 2003; ong W, Woo HJ, Kim J, Lee KM. n vitro activity of β-lactams in combination with other antimicrobial agents against resistant strains of Pseudomonas aeruginosa. nt J Antimicrob Agents 2003;21: Lee K, Park KH, Jeong H, Lim H, hin JH, Yong D, et al., KONA group. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONA surveillance. Yonsei Med J 2006;47: McGowan JE Jr. esistance in nonfermenting gram-negative bacteria: multidrug resistance to the maximum. Am J nfect Control 2006;34: Weldhagen GF, Poirel L, Nordmann P. Ambler class A extended spectrum β-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob Agents Chemother 2003;47: Poirel L, Naas T, Guibert M, Chaibi EB, Labia, Nordmann P. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum β-lactamase encoded by an Escherichia coli integron gene. Antimicrob Agents Chemother 1999;43: Nordmann P, onco E, Naas T, Duport C, Michel-Briand Y, Labia. Characterization of a novel extended-spectrum β-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 1993;37: Chen HY, Yuan M, Livemore DM. Mechanisms of resistance to β- lactam antibiotics amongst Pseudomonas aeruginosa isolates collected in the UK in J Med Microbiol 1995;43: Lee, Park YJ, Kim M, Lee HK, Han K, Kang C, et al. Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother 2005;56: Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, Nordmann P. GE-2, a class A β-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrob Agents Chemother 2001;45: Watanabe M, yobe, noue M, Mitsuhashi. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991;35: iccio ML, Franceschini N, Boschi L, Caravelli B, Cornaglia G, Fontana, et al. Characterization of the metallo-β-lactamase determinant of Acinetobacter baumannii AC-54/97 reveals the existence of bla MP allelic variants carried by gene cassettes of different phylogeny. Antimicrob Agents Chemother 2000;44: Lauretti L, iccio ML, Mazzariol A, Cornaglia G, Amicosante G, Fontana, et al. Cloning and characterization of bla VM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 1999;43: Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. bla VM-2 cassette-containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46: Toleman MA, imm AM, Murphy TA, Gales AC, Biedenbach DJ, Jones N, et al. Molecular characterization of PM-1, a novel metallo-β-lactamase isolated in Latin America: report from the ENTY antimicrobial surveillance programme. J Antimicrob Chemother 2002;50: Castanheira M, Toleman MA, Jones N, chmidt FJ, Walsh T. Molecular characterization of a β-lactamase gene, bla GM-1, encoding a new subclass of metallo-β-lactamase. Antimicrob Agents Chemother 2004;48: Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, et al. Novel acquired metallo-β-lactamase gene, bla (M-1), in a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49: Donald HM, caife W, Amyes G, Young HK. equence analysis of A-1, a novel OXA β-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92. Antimicrob Agents Chemother 2000;44: Bou G, Oliver A, Martinez-Beltran J. 4, a novel class D β- lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob Agents Chemother 2000;44: Yoon W, Lee BY, Bae K, Kwon B, Jeong H, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol 2005;8: Timurkaynak F, Can F, Azap OK, Demirbilek M, Arslan H, Karaman O. n vitro activities of non-traditional antimicrobials alone or in combination against multidrug-resistant strains of Pseudomonas aeruginosa and Acinetobacter baumannii isolated from intensive care units. nt J Antimicrob Agents 2006;27: Clinical and Laboratory tandards nstitute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M-10(M2). Wayne, Pensylvania; CL, Oh EJ, Lee, Park YJ, Park JJ, Park K, Kim, et al. Prevalence of metallo-β-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-β-lactamse. J Microbiol Methods 2003;54: Kang JH, Bae K, Kwon B, Jeong H, Lee J, Lee WG, et al. Prevalence of ambler class A extended-spectrum β-lactamaseproducing Escherichia coli and Klebsiella pneumoniae isolates in Korea. Korean J Clin Microbiol 2005;8: Naas T, Benaoudia F, Massuard, Nordmann P. ntegron-located VEB-1 extended-spectrum β-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J Antimicrob Chemother 2000; 46: Park JH, Lee H, Jeong H, Kim BN, Kim KB, Yoon JD, et al. Characterization and prevalence of Escherichia coli and Klebsiella pneumoniae isolates producing an extended spectrum β-lactamase from Korean hospitals. Korean J Lab Med 2003;23: Jeon BC, Jeong H, Bae K, Kwon B, Lee K, Young D, et al. nvestigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the 3-β-lactamase in
8 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 105 Korea. J Clin Microbiol 2005;43: Aubert D, Poirel L, Chevalier J, Leotard, Pages JM, Nordmann P. Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2001;45: De Champs C, Poirel L, Bonnet, irot D, Chanal C, irot J, et al. Prospective survey of β-lactamases produced by ceftazidimeresistant Pseudomonas aeruginosa isolated in a French hospital in Antimicrob Agents Chemother 2002;46: Heritier C, Dubouix A, Poirel L, Marty N, Nordmann P. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J Antimicrob Chemother 2005;55: Mendes E, Kiyota KA, Monteiro J, Castanheira M, Andrade, Gales AC, et al. apid detection and identification of metallo-βlactamase-encoding genes by multiplex real-time PC assay and melt curve analysis. J Clin Microbiol 2007;45: Versalovic J, Koeuth T, Lupski J. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids es 1991;19: Park KO, on HC, Bae K, Jeong H. Molecular epidemiology of infection caused by 3 or MP-1 β-lactamase-producing Acinetobacter baumannii. Korean J Lab Med 2005;8: Yao JDC and Moellering C Jr. Antibacterial agents. n: Murray P, Baron EJ, et al, eds. Manual for Clinical Microbiology. 7th ed. Washington: American ociety for Microbiology, 1999; Danel F, Hall LM, Duke B, Gur D, Livermore DM. OXA-17, a further extended-spectrum variant of β-lactamase, isolated from Pseudomonas aeruginosa. Antimicrob Agents Chemother 1999;43: Aktaş Z, Poirel L, alcioğlu M, Ozcan PE, Midilli K, Bal C, et al. PE-1- and -like β-lactamases in ceftazidime-resistant Pseudomonas aeruginosa isolates from intensive care unit patients in stanbul, Turkey. Clin Microbiol nfect 2005;11: Poirel L, Girlich D, Naas T, Nordmann P. 8, an extended-spectrum variant of β-lactamase from Pseudomonas aeruginosa and its plasmid- and integron-located gene. Antimicrob Agents Chemother 2001;45: Yan JJ, Tsai H, Chuang CL, Wu JJ. OXA-type β-lactamases among extended-spectrum cephalosporin-resistant Pseudomonas aeruginosa isolates in a university hospital in southern Taiwan. J Microbiol mmunol nfect 2006;39: Oh J, Lee U, Hwang HY, Bae K, Jo H, Lee BH, et al. Prevalence of class a extended-spectrum β-lactamases in clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa. Korean J Lab Med 2006;26: Nordmann P and Guibert M. Extended-spectrum β-lactamases in Pseudomonas aeruginosa. J Antimicrob Chemother 1998;42: to H, Arakawa Y, Ohsuka, Wacharotayankun, Kato N, Ohta M. Plasmid-mediated dissemination of the metallo-β-lactamase gene bla MP among clinically isolated strains of erratia marcescens. Antimicrob Agents Chemother 1995;39: Ohara M, Kouda, Onodera M, Fujiue Y, asaki M, Kohara T, et al. Molecular characterization of imipenem-resistant Pseudomonas aeruginosa in Hiroshima, Japan. Microbiol mmunol 2007;51:
9 106 Korean J Clin Microbiol 2008;11(2): = 국문초록 = 임상검체에서분리된다제내성녹농균의획득성 β-lactamase 유전형특성 1 삼성서울병원건강의학센터, 2 충남대학교의과대학진단검사의학교실정선양 1, 성지연 2, 권계철 2, 박종우 2, 고지선 2, 신소연 2, 송정훈 2, 구선회 2 배경 : 최근 cefepime이나 carbapenem계항균제에도내성을보이는다제내성녹농균이증가하고있다. 저자들은충청지역에서분리된다제내성녹농균을대상으로 Ambler class A, B 그리고 D 에속하는 β-lactamase와그들의광범위활성유도체의빈도를조사하고대표적인유전형들을규명하고자하였다. 방법 : 2006년 3월부터 2007년 5월까지충남대학교병원환자의임상검체에서분리된다제내성녹농균을대상으로하였다. Metallo-β-lactamase (MBL) 생성은 inhibitor-potentiated disk diffusion 시험으로확인하였으며 Ambler Class A, B, 그리고 D에해당하는 β- lactamase 유전자를검출하기위해중합연쇄반응과염기서열분석을하였다. 또한돌발감염이있었는지를알아보기위해서 enterobacterial repetitive intergenic consensus (EC)-PC 을수행하였다. 결과 : 시험기간중총 37주의다제내성녹농균이환자의임상검체에서분리되었다. 37주의녹농균중 29주가 bla (56.8%), bla (18.9%), 또는 bla OXA-1 (5.4%) 를가지고있는것으로나타났다. MP-1을생성하는균주는단한주였으며 bla OXA-1 도가지고있었다. Ambler class A β-lactamase와 class D carbapenemase는검출되지않았다. OXA형 β-lactamase를가지고있는균주의경우그렇지않은균주보다 aminoglycoside계항균제에대한내성율이더높은것으로나타났다. EC-PC 결과 을생성하는 19주는유전적으로매우밀접한것으로나타났다. 결론 : 충청지역의한대학병원에서분리된다제내성녹농균에가장광범위하게확산되어있는획득성 β-lactamase는 OXA형 β-lactamase였다. 그리고 OXA형 β-lactamase를갖고있는균주들은 β-lactam계항균제뿐아니라 aminoglycosie 계항균제와 qunolone계항균제등에대해내성높은내성율을보였다. [ 대한임상미생물학회지 2008;11:98-106] 교신저자 : 구선회, , 대전광역시중구대사동 640 충남대학병원진단검사의학과 Tel: , Fax: shkoo@cnu.ac.kr
untitled
Korean J Clin Microbiol Vol. 12, No. 1, March, 2009 Characterization of Class 1 Integrons in Metallo-βlactamase-producing Pseudomonas aeruginosa Ji Youn Sung, Sun Hoe Koo, Kye Chul Kwon, Jong Woo Park,
More information< D34302D303420B1E8BCF6C1A42DC0FAC0DABCF6C1A4BABB2D312E687770>
대한임상검사학회지 : 40권제2호, 75-79, 2008 ISSN 1738-3544 대구지역병원에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의항생제내성현황 대구보건대학임상병리과 1, 세명대학교임상병리학과 2 김수정 1 이재식 2 Antibiotic Resistance Patterns of Acinetobacter
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. Vol. 45, No. 1, Mar. 2013 21 Korean J Clin Lab Sci. 2013, 45(1):21-25 ISSN 1738-3544 Errors of Antibiotic Susceptibility Testing from Automated and Manual Systems
More information12_HM hwp
The Korean Journal of Microbiology (2010) Vol. 46, No. 3, pp. 303-307 Copyright c 2010, The Microbiological Society of Korea 단보 국내에서분리된 Acinetobacter baumannii 의 Integron 과연관된다제내성분석 김성환 최지혜 박은진 서인원 손승렬
More informationuntitled
210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662
More informationuntitled
Ann Clin Microbiol Vol., No., September, http://dx.doi.org/./acm... ISSN - Loss of bla and bla IMP- during the Storage of Gram- Bacilli, Antimicrobial Susceptibility of the Gene-Lost Strain, and Location
More informationA. baumannii 와 P. aeruginosa 의 ESBL 생성현황 15 인하여광범위 -lactam 제제일부를포함한여러항균제에내재적내성이지만, ceftazidime, piperacillin, ticarcillin 등은이들세균에비교적강한항균력을지닌다 [3]. Cla
대한진단검사의학회지제 26 권제 1 호 2006 Korean J Lab Med 2006;26:14-20 원저 임상미생물학 임상검체에서분리된 Acinetobacter baumannii와 Pseudomonas aeruginosa의 Class A Extended-Spectrum -Lactamase 생성현황 오세진 이상욱 황현용 1 배일권 1 조현수 1 이병호 1
More information296 Korean J Lab Med 2010;30: S. maltophila 감염증치료에는낮은항균제내성률을보이는 trimethoprim/sulfamethoxazole (TMP/SMX) 이일차치료제로사용되고있으며, quinolone, moxalactam,
Korean J Lab Med 2010;30:295-300 DOI 10.3343/kjlm.2010.30.3.295 Original Article Clinical Microbiology Analysis of Acquired Resistance Genes in Stenotrophomonas maltophilia Jeong Hoon Song, M.D. 1, Ji
More informationKJFP Jeongsook Yoon. bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Vitek(Biomerieux, Marcy 1 Etoile, France) 으로균을동정하였다. 항균제감수성검사는디
KJFPpISSN 2233-9019 eissn 2233-9116 Original Article 한국 1 차병원의 Pseudomonas aeruginosa 에서 blavim-2 유전자관찰 윤정숙 서울베스티안병원 bla VIM-2 of Pseudomonas aeruginosa in primary hospitals in Korea Jeong-sook Yoon Director
More informationuntitled
Korean J Clin Microbiol Vol., No., December, 20 http://dx.doi.org/0.55/kjcm.20...3 Chromosomal Mutations in oprd, gyra, and parc in Carbapenem Resistant Pseudomonas aeruginosa Ji Youn Sung, Hye Hyun Cho
More informationORIGINAL ARTICLE Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resist
ORIGINAL ARTICLE http://dx.doi.org/10.15263/jlmqa.2015.37.4.209 Discordance in Colistin Susceptibility Test for Acinetobacter baumannii Showing Resistance: MicroScan versus Etest Goeun Kang, Hyun Soo Kim,
More information400 김정민 신경섭 집락을쉽게형성하여장기입원환자나비뇨기계질환이있는노인에서흔히감염을일으킬수있다 [2, 3]. P. rettgeri는 P. stuartii보다 aminoglycoside, cephalosporin 및페니실린계항균제에대한내성률이낮으며, 다제내성인경우도드물다
대한진단검사의학회지 : 제 25 권제 6 호 2005 Korean J Lab Med 2005; 25: 399-405 임상미생물학 요검체에서분리된 Providencia rettgeri 에서 VIM-2형 Metallo- -Lactamase의생성 김정민 신경섭 1 경북대학교의과대학미생물학교실, 충북대학교의과대학진단검사의학교실 1 Production of VIM-2
More informationuntitled
Korean J Clin Microbiol Vol. 13, No. 1, March, 2010 DOI: 10.5145/KJCM.2010.13.1.27 Carbapenem Resistance Mechanisms and Molecular Epidemiology of Acinetobacter spp. from Four Hospitals in Seoul and Gyeonggi
More information2 - ceftazidime-clavulanate 디스크를이용하여 ESBL 생성균주를확인하였다. 또한 2009년도에수집된균주인 P. aeruginosa(386주 ), A. baumannii(349주 ) 를대상으로 imipenem에대한감수성을확인하였고 imipenem-h
1 - 국내종합병원을대상으로한항균제내성모니터링 Monitoring of antimicrobial resistance on general hospitals in Korea 질병관리본부국립보건연구원감염병센터약제내성과 연세대학교의과대학진단검사의학교실, 세균내성연구소 Ⅰ. 들어가는말 항균제내성세균의출현과확산으로인하여세균감염증치료는점점어려워지고있다 [1-4]. 항균제내성률은흔히국가간,
More information<5BC0FAC0DABCF6C1A430345D434D30362D313220C8ABBDC2BAB92D E687770>
대한임상검사학회지 : 38 권제 3 호, 166-172, 2006 Metallo-β-lactamase 생성 Pseudomonas aeruginosa의시험관내항균제병합요법에대한연구 분당제생병원진단검사의학과 홍승복 In vitro Antimicrobial Combination Therapy in Metallo-β-lactamase Producing Pseudomonas
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2017;49(4):427-434 https://doi.org/10.15324/kjcls.2017.49.4.427 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 49, No. 4, December 2017 427 Distribution
More informationMicrosoft PowerPoint - PDFCoTemp.PPT
주요유방염세균의검출및 항생제감수성검사 임숙경 1. 검사시료 1. 시료채취 유방염우유 2. 체세포수측정 3. 대상세균 - Staphylococcus aureus - Coagulase negative staphylococci -Escherichia coli 3. 균분리방법 E. coli CHEC Agar 직접도말 (37 18-24h) 보라색집락 EMB Agar
More informationMicrosoft Word - 15-홍승복.doc
J. Exp. Biomed. Sci. 2012, 18(3): 299~306 pissn : 1738-3226 Original Article Molecular Characterization and Prevalence of 16S Ribosomal RNA Methylase Producing Bacteria in Amikacin Resistant Gram-negative
More information<5BC0FAC0DABCF6C1A430355D434D30362D313320BEE7BAB4BCB12D E687770>
대한임상검사학회지 : 38 권제 3 호, 173-178, 2006 Multiplex Polymerase Chain Reaction 을이용한 Extended-Spectrum β-lactamase 생성 Klebsiella pneumoniae 균주의검출 진주보건대학임상병리과 양병선 Detection of Extended-Spectrum β-lactamase Producing
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):217-224 http://dx.doi.org/10.15324/kjcls.2016.48.3.217 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 48, No. 3, September 2016 217 An Analysis
More informationuntitled
Korean J Clin Microbiol Vol. 12, No. 3, September, 2009 Metallo-β-lactamase Producing Gram-negative Bacilli Dongeun Yong Department of Laboratory Medicine and Research Institute of Bacterial Resistance,
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information22 신경섭 손보라 oxyimino-cephalosporin은물론 monobactam계항생제도분해하는효소이다 [1-3]. 장내세균에서 ESBL 생성균주의증가에대한여러보고가있는데 [4-6], Escherichia coli와 Klebsiella pneumoniae는임상에서
대한임상병리학회지 : 제 22 권제 1 호 2002 Korean J Clin Pathol 2002; 22: 21-6 임상미생물학 Escherichia coli와 Klebsiella Species에서 Extended-Spectrum -Lactamase 검출을위한 Vitek ESBL Test와그외방법의비교 신경섭 손보라 충북대학교의과대학임상병리학교실 Comparison
More information03(12-65)p fm
한국임상약학회지제 23 권제 1 호 Kor. J. Clin. Pharm., Vol. 23, No. 1. 2013 화상감염소아환자에서분리된주요균종에대한항생제의내성률 강주연 신혜순 * 덕성여자대학교약학대학 (2012 년 12 월 28 일접수 2013 년 3 월 2 일수정 2013 년 3 월 4 일승인 ) Antimicrobial Resistance of Clinically
More informationKang CI 문제가되고있는주요병원균으로는소위 ESKAPE 균주들 이있는데, 이는 Enterococci, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aerugino
DOI: 10.5124/jkma.2011.54.3.325 pissn: 1975-8456 eissn: 2093-5951 http://jkma.org Pharmacotherapeutics 다제내성그람음성균감염의치료전략 강철인 * 성균관대학교의과대학삼성서울병원감염내과 Therapeutic strategy for the management of multidrug-resistant
More informationuntitled
병원감염관리 : 제19권제1호 2014 Korean J Nosocomial Infect Control 2014;19(1):29-36 http://dx.doi.org/10.14192/kjnic.2014.19.1.29 원저 국내중환자실환자에서분리된세균의항균제내성 이양순 1 ㆍ김영아 2 ㆍ송원근 3 ㆍ이혁민 4 ㆍ이혜수 5 ㆍ장숙진 6 ㆍ정석훈 1 ㆍ홍성근 7 용동은
More information<37375FB1E8C0E7C1DF2DC7F7BED7B9E8BEE7BFA1BCAD20BAD0B8AEB5C820C0D3BBF3C0FB2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 17, No. 5 pp. 653-659, 2016 http://dx.doi.org/10.5762/kais.2016.17.5.653 ISSN 1975-4701 / eissn 2288-4688 혈액배양에서분리된임상적주요균주의항균제사용량에따른내성률변화
More information(59-69)Kjcm13.hwp
Korean J Clin Microbiol Vol. 10, No. 1, April, 2007 Antimicrobial Resistance of Clinically Important Bacteria Isolated from 12 Hospitals in Korea in 2005 and 2006 Hyukmin Lee 1, Chang Ki Kim 2, Jongwook
More informationMicrosoft Word - 3-김정민.doc
Journal of Bacteriology and Virology 2006. Vol. 36, No. 1 p.21 30 다약제내성 Acinetobacter 균의유전종결정및항균제내성의특성규명 경북대학교의과대학미생물학교실, 단국대학교의과대학미생물학교실 1 임유미 최태생 1 김정민 * Determination of Genomospecies and Characterization
More informationKJFP Jeongsook Yoon. Bacterial Strains and Antimicrobial Resistance in Burn Patients 심부화상인경우 Clostridium, Bacteroides 등을감별하기위해무산소성배양을시행해야한다고권장하고있다. 6)
KJFP Original Article http://dx.doi.org/10.21215/kjfp.2016.6.3.179 pissn 2233-9019 eissn 2233-9116 화상창 감염의 균종 및 항균제 감수성률 윤정숙* 서울베스티안병원 진단검사의학과 Bacterial Strains and Antimicrobial Resistance of Wound Infection
More information2101
대한진단검사의학회지제 28 권제 3 호 2008 Korean J Lab Med 2008;28:185-90 DOI 10.3343/kjlm.2008.28.3.185 원저 임상미생물학 Escherichia coli, Klebsiella spp., Proteus mirabilis에서 Phoenix Automated Microbiology System의 Extended-Spectrum
More informationuntitled
ORIGINAL ARTICLE Korean J Clin Lab Sci. 017;9():13-19 https://doi.org/10.153/kjcls.017.9..13 pissn 173-35 eissn -6 Korean J Clin Lab Sci. Vol. 9, No., December 017 13 The Characteristics of Imipenem-Resistant
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationuntitled
Ann Clin Microbiol Vol. 16, No. 3, September, 213 http://dx.doi.org/1.5145/acm.213.16.3.126 ISSN 2288-585 Molecular Characteristics of bla OXA-23 -Producing Acinetobacter baumannii Isolated from a University
More information< D34312D303628BEE7BAB4BCB12CC0B0B1D9B5B9292E687770>
대한임상검사학회지 : 41권제4호, 153-157, 2009 ISSN 1738-3544 SHV ESBL 생성 Klebsiella pneumoniae 균주의실시간중합효소반응분석 진주보건대학임상병리과 1, 대전보건대학임상병리과 2 양병선 1 육근돌 2 Real-Time PCR Analysis of SHV Extended-Spectrum beta-lactamases
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information<303220C6AFC1FD303220B0ADC3B6C0CE2E687770>
대한내과학회지 : 제 88 권제 5 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.5.502 특집 (Special Review) - 다제내성균감염의위협 다제내성그람음성균감염의항생제치료 성균관대학교의과대학삼성서울병원감염내과 강철인 Antimicrobial Therapy for Infections Caused by Multidrug-Resistant
More informationFebruary 2007
November 2009 Vol. 17 No. 4 Ser. No. 67 Quarterly ISSN 1226-1734 www.whonetkorea.org Antimicrobial resistance of bacteria isolated during July to September in 2009 at a KONSAR program participating hospital
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information< BFF8C0FA2D B9E8C7F6C1D62E687770>
대한내과학회지 : 제 권제 호 다약제내성 Pseudomonas aeruginosa 에대한항생제병합효과 한양대학교의과대학감염내과학교실 배현주 In Vitro Effects of Combined Antibiotics against Multidrug-resistant Pseudomonas aeruginosa HyunJoo Pai, M.D. Infectious Diseases,
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More informationÇмúº¸°í5¿À´ÙÇö
병원약사회지 (28), 제 35 권제 호 J. Kor. Soc. Health-syst. Pharm., Vol. 35, No., 48 ~ 58 (28) Original Article 국내병원획득폐렴원인균의경험적항균제에대한내성현황 오다현 a, 김윤숙 a, 천부순 b, 인제대학교해운대백병원약제부 a, 인제대학교약학대학 b The Status of Resistance
More information84 계명의대학술지제 31 권 1 호 2012 μg /ml). Isolation frequency of MDRAB strains was 97.7% (172 strains) and was highly prevalent. Fifty eight (33.0%) strains
계명의대학술지제 31 권 1 호 Keimyung Med J Vol. 31, No. 1, June, 2012 다약제내성 Acinetobacter baumannii 의 유병율과항균제감수성 계명대학교의과대학미생물학교실, 의과학연구소 서성일 백원기 서민호 High Prevalence and Antimicrobial Drug Susceptibility of Multidrug
More informationAug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN Antimicrobial resistance of clinical isolates of bacteria during Apri
Aug 2012 Vol. 20, No. 3 Ser. No. 78, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during April to June, 2012 Antimicrobial resistance rates in April-June,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationMicrosoft Word - 20-김윤태.doc
J. Exp. Biomed. Sci. 12 (2006) 267 274 Random mplified Polymorphic DN (RPD) nalysis for Extended Spectrum β-lactamase Producing Klebsiella pneumonia Isolated from Clinical Specimens in Korea Yun-Tae Kim
More informationÇмúº¸°í6ÇÏÇý¹Î
병원약사회지 (27), 제 34 권제 4 호 J. Kor. Soc. Health-syst. Pharm., Vol. 34, No. 4, 433 ~ 442 (27) Original Article 국내지역사회획득폐렴원인균의경험적항균제에대한내성현황 하혜민 a, 김윤숙 b, 안정미 c, 천부순 a, 인제대학교약학대학 a, 인제대학교해운대백병원약제부 b, 인제대학교상계백병원약제부
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationFebruary 2007
May 2008 Vol. 16 No. 2 Ser. No. 61 Quarterly ISSN 1226-1734 www.whonet.org Antimicrobial resistance of bacteria isolated during January to March in 2008 at a KONSAR program participating hospital Antimicrobial
More information( ) 이남용.hwp
임상검사와정도관리 : 제 32 권제 12 호 2010 J Lab Med Qual Assur 2010; 32:11-24 11 임상미생물학검사신빙도조사결과보고 (2009) 이남용 ( 집필대표 ) 김명숙 김미나 김민중 김선주 김성일 김의종 김재석 용동은 윤남섭 이장호 주세익 대한임상검사정도관리협회임상미생물학분과위원회 Annual Report on External
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More informationuntitled
대한내과학회지 : 제 72 권제 1 호 27 Streptococcus pneumoniae와 Haemophilus influenzae 임상분리주에대한 Cefditoren의시험관내항균력 인제대학교의과대학일산백병원감염내과, 울산대학교의과대학서울아산병원감염내과 2, 울산대학교항균제내성ㆍ미생물유전학연구센터 3 곽이경 추은주 2, 3 박수진 3 이정은 3 정진용 2,
More information10 원저 hwp
대한내과학회지 : 제 94 권제 1 호 2019 https://doi.org/10.3904/kjm.2019.94.1.107 비병원장기요양기관에서입원하는노인의다제내성그람음성균보유 서울특별시서울의료원내과 김민성ㆍ신진호ㆍ정연상ㆍ조진경ㆍ최재필 Multidrug-Resistant, Gram-Negative Bacteria in Hospitalized Elderly Patients
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationDrug-Resistant Bacteria: Tertiary Hospitals versus Smaller Medical Institutions resistant Pseudomonas aeruginosa (CRPA), carbapenem resistant Acinetob
Original Article Ewha Med J 2013;36(2):126-131 http://dx.doi.org/10.12771/emj.2013.36.2.126 pissn 2234-3180 eissn 2234-2591 전원온환자의의료기관별호흡기검체에서의균종류비교 김태형, 조경표, 이재성, 우용문, 성지석, 노창석 1 서울적십자병원내과, 1 서울특별시서남병원호흡기내과
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationTable 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 45/27 b 0/0 55/73 Pi
May 2012 Vol. 20, No. 2 Ser. No. 77, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during January to March, 2012 Antimicrobial resistance rates determined
More information안도희외 6 인 : ESBL 생성균주와비생성균주에의한지역사회획득요로감염비교 감염에서균주의항생제감수성에변화를가져왔고특히광범위세팔로스포린에대한내성균의감염이증가하고있다 2). 이러한내성균에의한요로감염은치료실패, 합병증증가및치료기간의연장등과의연관성이제기되고있어관심이증가하고있다
ORIGINAL ARTICLE pissn 2384-1079 eissn 2384-1087 Pediatr Infect Vaccine 2015;22:29-35 DOI: http://dx.doi.org/10.14776/piv.2015.22.1.29 Extended-Spectrum β-lactamase 생성균주와비생성균주에의한지역사회획득요로감염비교 안도희ㆍ김규원ㆍ조혜경ㆍ차한ㆍ전인상ㆍ류일ㆍ선용한
More informationA Case of Acute Cholecystitis Caused by Stenotrophomonas maltophilia Bacteremia,. 5,6 B S. maltophilia. 증례 B,, 3 2 (entecavir 0.5 mg) 7. 3,.
Case Report The Korean Journal of Pancreas and Biliary Tract 2014;19:189-193 http://dx.doi.org/10.15279/kpba.2014.19.4.189 pissn 1976-3573 eissn 2288-0941 Stenotrophomonas maltophilia 균혈증에의해발생한급성담낭염 1
More informationuntitled
Korean J Clin Microbiol Vol. 5, No., March, http://dx.doi.org/.545/kjcm..5.. Carbapenem-Resistant Acinetobacter baumannii Il Kwon Bae, Seok Hoon Jeong, Kyungwon Lee Department of Laboratory Medicine and
More information<303120C6AFC1FD20B9E8C7F6C1D62E687770>
대한내과학회지: 제 81 권 제 6 호 2011 특 집(Special Review) - 흔한 감염질환에서의 항생제 내성 및 최신 치료 지역사회 단순 요로감염에서의 항생제 내성 및 최신 치료 한양대학교병원 감염내과 배 현 주 Treatment of Community-Acquired Uncomplicated Urinary Tract Infection Hyunjoo
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information6 JH Byun, et al. IRS-PCR on E. coli 성을나타낸다. CTX-M ESBL 유전자는 mobile genetic element 와연관되어지역사회에서 ESBL 이쉽게전파할수있다 [5, 6]. 병원균의역학적분석을하기위
Original Article http://dx.doi.org/10.3947/ic.2012.44.1.5 Infect Chemother 2012;44(1):5-10 pissn 2093-2340 eissn 2092-6448 Infection & Chemotherapy Infrequent-Restriction-Site 중합효소연쇄반응 (ISR-PCR) 을사용한지역사회발생
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information112 성흥섭 최수진 유수진외 1 인 균제에내성이며다른여러항균제에도내재성혹은획득내성을지니고있기때문에치료항균제선택범위가매우좁다 [3, 4]. Imipenem은세포외막의 porin을잘투과하고, penicillin-binding protein (PBP) 과의친화도와 -lac
대한진단검사의학회지제 27 권제 2 호 2007 Korean J Lab Med 2007;27:111-7 원저 임상미생물학 Imipenem 내성 Acinetobacter baumannii에서항균제병합요법의시험관내상승작용검사 성흥섭 최수진 유수진 김미나 울산의대서울아산병원진단검사의학과 In vitro Antimicrobial Synergy against Imipenem-Resistant
More informationMicrosoft Word doc
1994-2003 년혈액배양에서분리된병원균및세균의항균제감수성 연세대학교대학원 의학과 고은미 1994-2003 년혈액배양에서분리된병원균및세균의항균제감수성 지도교수이경원 이논문을석사학위논문으로제출함 2006 년 12 월일 연세대학교대학원의학과고은미 고은미의석사학위논문을인준함 심사위원 인 심사위원 인 심사위원 인 연세대학교대학원 2006 년 12 월일 감사의글 본눈문을완성함에있어서많은지도편달과가르침을주신이경원교수님과바쁘신중에도따뜻하게지도하여주신김준명교수님과이경호교수님께도깊은감사를드립니다.
More informationuntitled
J Korean Soc Transplant 2013;27:81-86 http://dx.doi.org/10.4285/jkstn.2013.27.3.81 Review Article 다제내성세균의시대에세균성감염질환에대한항생제치료의최근발전들 성균관대학교의과대학삼성서울병원감염내과 강철인 What s New in the Management of Bacterial Infections
More information한수지 49(5), , 2016 Original Article Korean J Fish Aquat Sci 49(5), ,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escheri
한수지 49(5), 564-572, 2016 Original Article Korean J Fish Aquat Sci 49(5),564-572,2016 창선해역의지중해담치 (Mytilus galloprovincialis) 양식장및육상오염원에서분리한대장균 (Escherichia coli) 의항생제내성 권순재 이가정 * 정연중 박상기 고경리 양지혜 목종수 국립수산과학원남동해수산연구소
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information주간건강과질병 제 12 권제 16 호 연구단신, Brief report 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : s
연구단신, Brief report 2 2013 2017 년국내표본감시기관의료관련감염병 ( 항생제내성균 6 종 ) 발생현황 질병관리본부감염병관리센터의료감염관리과이승재, 이은주, 박현정, 이상은, 김성남, 이형민 * * 교신저자 : sea2sky@korea.kr, 043-719-7580 Results of healthcare-associated infection
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More informationuntitled
Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Detection of CTX-M-Type Extended-Spectrum β-lactamase in Clinical Isolates of Chromosomal AmpC β-lactamase-producing Enterobacteriaceae from Korea
More information< BFEBBFAAB0E1B0FABAB8B0EDBCAD2DBCF6C1A42028BCADBFEFB4EB292E687770>
제출문 질병관리본부장 귀하 이보고서를 균혈증과요로감염원인균의내성실태및내성기전연구 ( 서울대학교의과대 학 / 김의종 ) 과제의연구결과보고서로제출합니다. 2006. 1. 25 주관연구기관명 : 서울대학교의과대학 주관연구책임자 : 김의종 제 1세부과제명 : 균혈증및요로감염을일으키는주요원인균의내성실태 ( 제1세부연구기관 / 세부과제책임자 ): 서울대학교의과대학 /
More informationTable 2. Antimicrobial susceptibility (%) of P. aeruginosa a Antimicrobial agents Resistant Intermediate Susceptible Piperacillin 44/25 b 12/11 44/64
Nov 2012 Vol. 20, No. 4 Ser. No. 79, Quarterly ISSN1226-1734 www.whonetkorea.org Antimicrobial resistance of clinical isolates of bacteria during July to September, 2012 Antimicrobial resistance rates
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationuntitled
한국가축위생학회지제 36 권제 3 호 (2013) Korean J Vet Serv, 2013, 36(3), 171-180 ISSN 1225-6552, eissn 2287-7630 http://dx.doi.org/10.7853/kjvs.2013.36.3.171 Korean Journal of Veterinary Service
More informationuntitled
Pseudomonas aeruginosa 에의한요로감염의임상적특성 The Clinical Features of Complicated Urinary Tract Infections by Pseudomonas aeruginosa Jung Woo Lee, Kyung Jae Oh, Seung Chol Park, Joung Sik Rim From the Departments
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationE coli aminoglycoside 3-10% ESBL aminoglycoside (Table 2), cefotaxime S marcescens, imipenem Acinetobacter baumannii, vancomycint e i c o p l a n i n
NCCLS Table 1-3 6,326 4-6 5, 127 (234%) 344%, 75% Serratia marcescens (105%) A n t i m i c r o b i a l a g e n t E C O C F R K P N K O X E C L E A E S M A P M I P V U M M O P S T A B A S M P ( 993 ) (
More information