untitled

Transcription

1 Korean J Clin Microbiol Vol. 11, No. 2, October, 2008 Characteristics of Acquired β-lactamase Gene in Clinical solates of Multidrug-resistant Pseudomonas aeruginosa un Yang Chung 1, Ji Youn ung 2, Kye Chul Kwon, 2 Jong Woo Park, 2 Chi eon Ko, 2 o Youn hin, 2 Jeong Hoon ong, 2 un Hoe Koo 2 1 Health Promotion Center, amsung Medical Center, eoul, 2 Department of Laboratory Medicine, Chungnam National University College of Medicine, Daejeon, Korea Background: ecently, there have been reports of infections with multidrug-resistant Pseudomonas aeruginosa. To determine the mechanism of the resistance, we investigated the prevalence of Ambler class A and D β-lactamases, their extended-spectrum derivatives, and class B and D carbapenemase in multidrug-resistant P. aeruginosa isolates. Methods: During the period of March 2006 to May 2007, clinical isolates of multidrug-resistant P. aeruginosa were collected from patients in Chungnam National University Hospital, Daejeon, Korea. nhibitor-potentiated disk diffusion tests were used for the screening of metallo-β-lactamase (MBL) production. PC and DNA sequencing were conducted for the detection of β-lactamase genes. We also employed the enterobacterial repetitive intergenic consensus (EC)- PC method for an epidemiologic study. esults: A total of 37 consecutive, non-duplicate, multidrug-resistant P. aeruginosa were isolated. Twentynine of 37 isolates harbored bla OXA- 10 (56.8%), bla (18.9%), and bla OXA-1 (5.4%). Only one isolate produced MP-1, and it also harbored bla OXA-1. None harbored Ambler class A β-lactamase or class D carbapenemase. The strains producing OXA type β-lactamases showed a significantly higher resistance to aminoglycoside compared to non-producers. The EC-PC pattern of the 19 producing strains indicated that the isolates were closely related in terms of clonality. Conclusion: OXA type β-lactamases are the most prevalent among the acquired β-lactamases produced by multidrug-resistant P. aeruginosa isolated at a university hospital in Chungcheong Province. Besides β-lactam antibiotics, the strains harboring OXA type β-lactamase showed a significantly higher resistance to aminoglycoside and qunolone. (Korean J Clin Microbiol 2008;11:98-106) Key Words: Multidrug resistance, Pseudomonas aeruginosa, OXA type β-lactamase, Metallo-βlactamase (MBL) 서 녹농균 (Pseudomonas aeruginosa) 은호기성포도당비발효그람음성간균으로병원감염의주요원인균이다. 녹농균에의한감염은대부분기회감염이며, 외이도염, 골수염, 뇌수막염, 심내막염, 폐렴, 요로감염, 균혈증등다양한감염증을유발한다 [1]. 녹농균에의한감염증의치료에는이세균에비교적강한항균력을지닌 β-lactam계열의항균제인 ceftazidime, cefepime 및 carbapenem 등의약제가사용되고있다. 그러나, 최근 cefepime이나 carbapenem에도내성을보이는다제내성녹농균의감염이증가하고있어많은문제가되고있다 [2]. 2003년 eceived 31 January, 2008, Accepted 20 August, 2008 Correspondence: un Hoe Koo, Department of Laboratory Medicine, Chungnam National University Hospital, 640, Daesa-dong, Jung-gu, Daejeon, Korea. (Tel) , (Fax) , ( ) shkoo@cnu.ac.kr 론 KONA surveillance 조사에의하면 imipenem 내성인녹농균의비율이 20% 로높았고, 이중대부분은다제내성균이었다 [3]. 녹농균이 cefepime이나 carbapenem에대한내성을획득하는기전중하나가 Ambler class A와 D에속하는 extended spectrum β-lactamase (EBL) 의생성혹은 class B와 D에속하는 carbapenemase의생성이다 [4]. Class A에속하며장내세균에의해흔히생성되는 TEM형및 HV형 EBL은드물지만녹농균에서도생성되는것으로알려져있다 [5]. VEB형 [6] 및 cephalosporin계항균제에강한분해활성을갖는 PE-1형 [7] 또한녹농균에서검출된바있다. 그러나녹농균에서주로보고되는 EBL은 class D에속하는 OXA형 β-lactamase로우리나라에도널리퍼져있으며 EBL인 OXA-17 생성녹농균도보고된바있다 [8,9]. 녹농균이생성하는 carbapenemase 에는 2000년남아프리카공화국에서분리된녹농균에서처음보고된 class A의 GE형 EBL[10], class B metallo-β-lactamase (MBL), 그리고 class D 98

2 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 99 의 OXA형 carbapenemase등이있다. 이중가장강력한 carbapenemase 인 MBL은 1988년일본에서처음발견되었으며 [11], imipenem 을가수분해하는효소라는의미에서 MP-1으로명명되었다 [12]. 그후일본을비롯한여러나라에서 VM형 [13,14], PM-1형 [15], GM-1형 [16], 그리고 M-1형 [17] 등의 MBL이보고되었다. Class D의 OXA형 carbapenemase는 1985년에스코틀랜드에서분리된 imipenem 내성 Acinetobacter baumannii에서처음확인되었으며 [18] 지금은유럽, 아시아, 브라질등전세계적으로확산되었고 [19], 국내에서도 2005년도에분리된녹농균에서검출된바있다 [20]. 다제내성녹농균의출현및확산은이세균에의한감염증치료에많은어려움을가중시킬수있으므로임상적으로중요한문제이다. 녹농균이다제내성을보이는중요한원인중의하나가 β-lactamase생성에의한획득내성이므로다제내성녹농균을대상으로 β-lactamase의성상을규명하는것은내성기전을연구하는데중요하다. 본연구에서는충청지역에서분리된다제내성녹농균을대상으로 Ambler class A와 D에속하는 EBL과 class B와 D에속하는 carbapenemase의대표적인유전형들을규명하여내성세균의확산을방지하기위한기초자료를제공하고자하였다. 재료및방법 1. 균주의수집 2006년 3월부터 2007년 5월까지충남대학교의과대학병원진단검사의학과에의뢰된임상검체분리녹농균중다제내성을보인 37주를대상으로하였다. 분리된녹농균이광범위항균제인 cefepime, amikacin, ciprofloxacin, piperacillin / tazobactam과 meropenem 중 3가지이상의항균제에내성을보일경우다제내성균으로정하였다 [21]. 항균제내성에상관없이분리된순서대로균주를수집하였으며, 동일환자에서반복분리된균주는수집대상에서제외하였다. 분리된균주의균종은전통적인생화학적방법및 Vitek GN card (biomerieux Vitek nc., Hazelwood, MO, UA) 로확인하였다. 2. 항균제감수성시험미국의 Clinical and Laboratory tandards nstitute (CL) 지침에따라 [22] amikacin, gentamicin, netilmicin, tobramycin, ceftazidime, imipenem, piperacillin, ticarcillin, 및 ciprofloxacin (BBL, Cockeysville, MD, UA) 과 aztreonam, cefepime, meropenem, piperacillin tazobactam, 및 ticarcillin-clavulanic acid (Oxoid, Cambridge, UK) 에대한감수성을 Mueller-Hinton 한천배지 (Difco, Cockeysville, MD, UA) 를사용하여디스크확산법으로확인하였다. 항균제에대한최소억제농도 (minimum inhibitory concentration, MC) 는 Mueller-Hinton 액체배지 (BBL) 를사용하여액체미량희석법으로구하였다. Amikacin, gentamicin, netilmicin, tobramycin, aztreonam 및 piperacillin 은 igma-aldrich (t. Louis, MO, UA) 에서구입하여사용하였으며, 그외사용한항균제는 ceftazidime ( 한미약품, 서울, 한국 ), cefepime ( 보령제약, 서울, 한국 ), imipenem (MD, Elkton, VA, UA), meropenem (AstraZeneca, Cheshire, UK), ticarcillin 및 ciprofloxacin (CN Biomedicals nc, Costa, Mesa, CA, UA) 이었다. 정도관리를위해서 Escherichia coli ATCC 25922와 P. aeruginosa ATCC 27853을동시에시험하여허용범위에드는지확인하였다. 3. nhibitor-potentiated disk diffusion (PD) 방법을이용한 Metallo-β-lactamase 생성선별검사다제내성녹농균을대상으로 PD 검사를 [23] 실시하여 MBL 생성균주를선별하였다. MacConkey 한천배지 (Difco) 에서 35 o C, 24시간동안배양한균집락을풀어 McFarland 표준액 0.5에맞춘후균액을 Mueller-Hinton 한천배지에접종하였다. 접종한균액이마른후두개의 10μg imipenem disk를두디스크중심간의거리가 4 5 cm간격이되게하여배지위에올려놓고두개중한개의디스크에만 0.5 M EDTA 용액 10μl 를분주하였다. 35 o C, 18시간배양한다음억제대를판독하여 imipenem과 imipenem-edta 디스크의억제대차가 7 mm 이상인균주를 MBL 생성선별검사의양성으로판단하였다 [23]. 4. 분자생물학적방법에의한 β-lactamase 유전형확인 β-lactamase의유전형을분석하기위해이미보고된바있는기존의시발체를사용하여중합효소연쇄반응 (polymerase chain reaction, PC) 을수행하였다 (Table 1). 대상균주를 brain heart infusion 액체배지 (Difco, Cockeysville, M, UA) 에접종하여 37 o C로하룻밤진탕배양한후 DNA purification kit (Promega, Madison, W, UA) 을사용하여배양액으로부터 DNA를추출하였다. DNA 추출액 (5μL), 10 Taq buffer (2.5μL), 10 mm dntp mix (0.5μL), primer 각 10 pmol, 0.7U Taq DNA polymerase ( 솔젠트, 대전, 한국 ) 및증류수를혼합하여 25μL의반응용액을만들었다. Gene Amp PC ystem 9600 (Perkin- Elmer Centus Corp., Norwalk, CT, UA) 으로 95 o C에서 5분간반응시킨후, 95 o C에서 20초, 59 o C에서 40초, 72 o C에서 30초씩 30회증폭반응시키고, 70 o C에서 5분간연장반응시켰다. 각각의 PC 생산물을 ethidium bromide 가포함된 1% agarose gel에서 40분간전기영동하여밴드를확인하였다. 증폭산물을 DNA extraction kit (Qiagen, Hilden, Germany) 로분리후, BigDye Terminator Cycle equencing Kit (PE Applied Biosystems, Foster City, CA, UA) 와 AB PM 3730xl DNA analyzer (PE Applied Biosystems) 를이용하여염기서열을분석하였다.

3 Korean J Clin Microbiol 2008;11(2): Table 1. Oligonucleotides used as primers for amplification and sequencing Enzyme Class Primer pairs Target equence (5-3 ) Amplicon size (bp) eference Class A Class B Class D TEM F bla TEM and derivative ATGAGTATTCAACATTTCCGT TEM TTACCAATGCTTAATCAGTGA HV F CCGGGTTATTCTTATTTGTCGCT bla HV and derivative HV TAGCGTTGCCAGTGCTCG PE F GTTAATTTGGGCTTAGGGCAGA bla PE PE CAGCGCAATCCCCACTGT VEB F CGACTTCCATTTCCCGATGC bla VEB VEB GGACTCTGCAACAAATACGC GE F GTTAGACGGGCGTACAAAGATAAT bla GE, bla BC GE TGTCCGTGCTCAGGATGAGT MP F CATGGTTTGGTGGTTCTTGT bla MP MP ATAATTTGGCGGACTTTGGC VM F ATTGGTCTATTTGACCGCGTC bla VM VM TGCTACTCAACGACTGAGCG M F GTACAAGGGATTCGGCATCG bla M M TGGCCTGTTCCCATGTGAG PM F CTAAATCGAGAGCCCTGCTTG bla PM PM CCTTTTCCGCGACCTTGATC GM F TCAATTAGCTCTTGGGCTGAC bla GM GM CGGAACGACCATTTGAATGG OXA-1F AGCCGTTAAAATTAAGCCC bla OXA group OXA-1 CTTGATTGAAGGGTTGGGCG F GCCAAAGGCACGATAGTTGT bla OXA group GCGTCCGAGTTGACTGCCGG F TCTTTCGAGTACGGCATTAGC blaoxa group CCAATGATGCCCTCACTTTCC 3F GATGTGTCATAGTATTCGTCG bla3, 27, 49 3 TCACAACAACTAAAAGCACTG 4F GTACTAATCAAA GTTGTGAA bla4, 25, 26, 40, 72 4 TTCCCCTAACATGAATTTGT OXA-58F CGATCAGAATGTTCAAGCGC OXA-58 blaoxa-58 ACGATTCTCCCCTCTGCGC , Abbreviations: F, forward;, reverse. 5. Enterobacterial repetitive intergenic consensus polymerase chain reaction (EC PC) 에의한역학적연관성조사 DNA purification kit (Promega) 로대상균주의 DNA를추출하여주형 DNA로사용하였다. Primer로는 EC1 (5'-ATGT AAGCTCCTGGGGA-TTCAC-3') 과 EC2 (5'-AAGTAAGTG ACTGGGGTGAGCG-3') 로명명된장내세균의반복서열을사용하였다 [32]. 증폭반응은 DNA 추출액 (5.0μL), 10 Taq buffer (5.0μL), 10 mm dntp mix (1.0μL), primer 각 20 pmol, 1.4U Taq DNA polymerase ( 솔젠트 ) 및증류수를혼합하여 50 μl의혼합액으로시행하였다. 95 o C에서 5분간반응시킨후, 92 o C에서 50초, 52 o C에서 55초, 70 o C에서 7분씩 35회증폭반응시키고, 70 o C에서 10분간연장반응시켰다. 증폭산물 (10μL) 은 ethidium bromide가포함된 2% agarose gels에전기영동한후 BioDoc-14 TM maging system (UVP, Cambridge, UK) 을이 용하여분석하였다. Band의강도와상관없이 band의분자량과개수로각균주를비교하며, 두개이상의밴드차이가있으면역학적상관관계가없는것으로판단하였다 [33]. 결과 1. 항균제감수성양상시험기간중총 37주의다제내성녹농균이환자의임상검체에서분리되었으며, amikacin 91.9%, gentamicin 97.3%, netilmicin 91.9%, tobramycin 86.5%, aztreonam 56.8%, ceftazidime 75.7%, cefepime 78.4%, imipenem 67.6%, meropenem 67.6%, piperacillin 54.1%, piperacillin-tazobactam 48.6%, ticarcillin 97.3%, ticarcillin-clavulanic acid 83.8%, 그리고 ciprofloxacin 94.6% 의내성율을보였다 (Table 2).

4 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 101 Table 2. Antibiotic susceptability profiles and β-lactamases of multi-drug resistant Pseudomonas aeruginosa solates Antibiotic susceptibilities β-lactamase AMK GEN NET TOB ATM CAZ FEP PM MEM PP TZP TC TM CP P2 P3 P4 P5 P7 P15 P17 P18 P21 P23 P25 P26 P29 P31 P34 P35 P40 P41 A2 A3 A8 A9 A10 A11 A13 A14 A15 A16 A18 A19 A26 A32 A36 A41 A42 A43 A50, OXA-1, MP OXA-1 Abbreviations: AMK, amikacin; GEN, gentamicin; NET, netilmicin; TOB, tobramycin; ATM, aztreonam; CAZ, ceftazidime; FEP, cefepime; PM, imipenem; MEM meropenem; PP, piperacillin; TZP, piperacillin-tazobactam; TC, ticarcillin; TM, ticarcillin-clavulanic acid; CP, ciprofloxacin. Table 3. Prevalence of Ambler class A, B, and D β-lactamases in multi-drug resistant Pseudomonas aeruginosa Class Type of β-lactamases No.(%) of isolates Class B Class D Combined Not detected MP-1 OXA-1 MP and OXA-1 and OXA10 1 (2.7) * 7 2 (5.4) * 7 7 (18.9) 20 (54.1) 1 (2.7) * 7 1 (2.7) 7 9 (24.3) * P23 strain: MP-1 was combined with OXA-1; P17 strain: was combined with. 2. PD 방법을이용한 MBL 생성녹농균선별대상균주 37 주중한주인 P23 만이 MBL 생성선별검사에서양성을보였으며 imipenem 디스크에서생긴억제대보다 imipenem 에 EDTA 를넣어준디스크에서생긴억제대크기가 10 mm 더컸다. 3. β-lactamase 유전형 PD 검사에서양성반응을나타낸 P23 주를대상으로 MBL 유전자검출을위한 PC 을수행한결과 P23 주는 bla MP 에만양성반응을보였고그외의 MBL 유전자 (bla VM, bla M, bla PM, bla GM) 에는음성반응을보였다.

5 102 Korean J Clin Microbiol 2008;11(2): Table 4. Comparison of the antimicrobial resistance (%) between the class D β-lactamase producers and non-producers Antimicrobialagents Class D β-lactamase producers (N=28) Class D β-lactamase non-producers (N=9) MC 50 MC 90 esistant (%) MC 50 MC 90 esistant (%) AMK GEN NET TOB ATM CAZ FEP PM MEM PP TC CP Abbreviations : ee Table 2. Fig. 1. EC-PC patterns of genomic DNA from clinical isolates of multi-drug resistant Pseudomonas aeruginosa harboring bla. Lane M is 1 kb DNA size marker. Nineteen strains of β-lactamase producing clinical isolates show A or B pattern. Ambler class D β-lactamase 유전자검출을위해총 37주의다제내성녹농균을대상으로 PC을한결과 bla OXA-1 bla 그리고 bla 에대해각각 2주 (5.4%), 7주 (18.9%) 및 20주 (54.1%) 가양성반응을보였다. 이중한주 (P17) 는 bla 과 bla 에동시에양성반응을보였으며, bla 에양성반응을보인 20주중에는 bla MP 에양성을보인 P23주가속해있었다. 그외 class D에속하는 bla 3, bla 4 및 bla OXA-58 에대해서는대상균주모두음성반응을보였다. Ambler class A에속하는 EBL (bla HV, bla TEM, bla PE, bla VEB, bla GE) 을검출하기위한 PC에는양성반응을보인균주가한주도없었다 (Table 3). 대상균주중 bla MP 유전자증폭산물은 MP-1 유전자의염기서열과일치하였다. bla OXA-1, bla 및 bla 유전자증폭산물의염기서열은각각 bla OXA-1, bla 및 bla 유전자와염기서열이일치하였다. 4. Class D β-lactamase 생성균주에대한항균제 MC 특성 OXA형 β-lactamase를생성하는균주들이 OXA형 β-lactamase를생성하지않는균주들보다 aminoglycoside계항균제 (amikacin, gentamicin, netilmicin, tobramycin) 와 cephalosporin 계항균제 (ceftazidime 및 cefepime) 에대한내성율이각각평균 26.0% 와 26.5% 높았다. 또한 quinolone계항균제 (ciprofloxacin) 에대해서도내성율이 15.1% 높은것으로나타났다 (Table 4). 5. EC PC에의한역학적연관성조사 β-lactamase를생성하는녹농균 19주를대상으로 EC PC을시험한결과 1500 bp에서굵은밴드를보인 A 형과 2000 bp 이하의밴드여섯개를보인 B형이관찰되었다 (Fig. 1). 고찰 β-lactam 제제는가장널리사용되고있는항균제중하나로, penicillin, cephalosporin, monobactam 및 carbapenem등다양한계열로분류되며, 현재 150가지이상의 β-lactam계항균제가임상에서사용되고있다 [34]. 그러나이러한항균제사용의증가는내성세균의양산이라는부작용을동반하였으며, 이들내성세균의치료를위해서새로운항균제를개발하여야하는악순환이되풀이되어왔다.

6 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 103 그람음성간균의 β-lactam항균제에대한내성은주로 β-lactam항균제를가수분해하는 β-lactamase 생성에의해나타나는데특히획득성 β-lactamase 유전자는 plasmid나 integron에위치하는경우가많아항균제내성유전자의수평전달을유도하여항균제내성을급격히확산시키는요인이된다. 본연구에서는다제내성녹농균을대상으로획득성 β-lactamase의유전형을분석하였는데검출된 β-lactamase의대부분이 class D인 OXA형 β-lactamase들이었다. OXA형 β-lactamase는 oxacillin과 cloxacillin에대해강한활성을가지는효소로녹농균에서빈번하게검출되며, 이효소로부터유래한 EBL을생성하는세균은 oxyimino cephalosporins에대해내성을갖는다 [35]. 본연구에서는 narrow-spectrum β-lactamase인 OXA- 10이가장높은빈도 (51.4%) 로검출되었으며그다음으로 β-lactamase (13.5%) 가많았다. 반면 OXA형 EBL은하나도검출되지않았다. 2005년도에국내에서분리된녹농균을대상으로조사한결과에서도 [9] class A β-lactamase들에비해 class D OXA β-lactamase들이빈번하게검출이되었고그중 의검출율이제일높았으며 (13.5%) 그다음으로 OXA-4 (4.4%), (2.3%) 및 OXA-30 (2.0%) 이었다. 반면대상균주중 1주 (0.3%) 만이 OXA형 EBL을생성하여본연구와유사한결과를보였다. 2005년터키에서도녹농균을대상으로 OXA형β-lactamase들의빈도를조사한결과 β- lactamase의빈도가가장높았던반면 OXA형 EBL은검출되지않았다고했다 [36]. 그러나 2006년에대만에서분리된 OXA 형 β-lactamase들을생성하는녹농균의경우 OXA형 EBL인 OXA-17을가장많이생성했으며최근들어그비율이감소하고있는중이라고했다 [37]. 녹농균에서 OXA형 β- lactamase 의분리양상은지역적, 시간적으로차이를보이며국내에서는 OXA형 EBL의검출율이비교적낮은것으로나타났다. OXA형 β-lactamase 생성주를대상으로항균제의 MC 측정결과대상항균제중 aztreonam과 carbapenem계항균제를제외한대부분의항균제에대해높은내성율을보였다. 특히 aminoglycoside계항균제에대한내성율은다른항균제들에비해월등하게높았는데이는 2006년도에대만에서 [38] 분리된녹농균에서보여진결과와일치하였다. 또한국내에서도 class D β- lactamase를생성하는녹농균의경우 aminoglycoside와 quinolone계항균제에대해교차내성을보인다는보고가있다 [9]. 가장높은빈도로검출된 β-lactamase 생성주를대상으로역학적연관성을조사하기위해 EC PC을실행한결과두개의 pattern이관찰되었다. 총 19주중 5주가 A형을나타냈으며나머지 14주가 B형을나타내었는데이결과는이들이각각동일한감염원에서유래되었음을추측하게한다. 다제내성녹농균이생성하는획득성 β-lactamase중가장높은빈도를차지한것이 OXA형 β-lactamase인반면 carbapenemase에속하는 3, 4, 및 OXA-58 β-lactamase는 검출되지않았다. 이들 OXA형 carbapenemase는 Acinetobacter baumannii에서는흔히생성되는것으로알려져있고국내에서도많이보고가되었으나 [19] 녹농균에서는드물게보고가되고있다. 국내에서는 2005년에 3 β-lactamase가처음으로녹농균에서분리된바있다 [20]. 본연구에서분리된획득성 β-lactamase중에 class A에속하는 β-lactamase는발견되지않았다. 2006년도에국내에서처음으로 HV-12 β-lactamase를생성하는녹농균이보고되었으나 [39] 그이외의 class A에속하는 β-lactamase는보고된적이없다. 녹농균이 TEM형혹은 HV형 EBL을생성하는경우는드문것으로알려졌는데, 이는이들세균이광범위 β-lactam 항균제에대한내성을획득하는데 plasmid성 TEM형혹은 HV 형 EBL을생성하는것보다탈억제에의해서염색체성 cephalosporinase를과량생성하는것이더손쉬운방법이고 [40], 또한이들세균이 class D의 OXA형 EBL을 [37] 흔히생성하기때문에 TEM 혹은 HV형 EBL의필요성이장내세균에비해상대적으로낮기때문인것으로추측한다. 한편, PD방법을이용한 MBL 생성검사에서 P23만이양성반응을보였고이균주가 MP-1형 MBL을생성함이밝혀졌다. 일본에서는 MP-1을생성하는그람음성세균의분리가흔한것으로알려진데반하여 [41], 국내에서의 MP-1 생성균주의분리는흔하지않았으나 2005년 Yoon 등에의해 MP-1형 MBL이 imipenem에내성인녹농균사이에서확산되고있음이보여졌다 [20]. 본연구에서는총 37주의다제내성녹농균중 1주만이 MBL을생성하였는데, 이는다제내성의원인이 MBL 생성에이외의다른요인들에의한것임을추측하게한다 [9]. 최근일본에서다제내성녹농균을대상으로분자생물학적특성을조사한결과에의하면다제내성이 MBL 및 ND 유출펌프생성에의해유도되기도하지만그보다는오히려더많은경우가 porin단백의발현감소및염색체성 cephalosporinase를과량생성과같은다른기전들에의해유도된다고했다 [42]. 본연구에서도이를뒷받침하는결과를보여주었다. 이상의결과에서충청지역의한대학병원에서분리된다제내성녹농균에가장광범위하게확산되어있는획득성 β-lactamase는 OXA 형 β-lactamase임을확인하였다. 또한 OXA 형 β-lactamase 유전자가 aminoglycoside 또는 quinolone계통의항균제에대한내성유전자와동시에존재할수있음을시사했다. 그러나본연구에서검출된 β-lactamase는모두 narrow spectrum의 β-lactamase이었으며 P23균주를제외하고는 carbapenemase도검출되지않았다. 이는녹농균의다제내성이획득성 β-lactamase 생성보다는그이외의다른요인들즉염색체성 cephalosporinase의과량생성, 항균제의유출 (efflux), 또는 porin단백의발현감소로인한세포막의투과성감소등에의해유도되는것임을추측하게한다. 따라서다제내성녹농균의내성기전을밝히기위해서는추가적인연구가필요할것이다.

7 104 Korean J Clin Microbiol 2008;11(2): 감사의글 본연구는산업자원부지방기술혁신사업의지역 &D 클러스터사업 (B000935) 지원으로수행되었음. 참고문헌 1. Bergogne-Berezin E. Pseudomonas and miscellaneous gramnegative bacilli. n: Cohen J and Powerly WG, eds. nfectious Diseases. 2nd ed, New York; Mosby, 2003; ong W, Woo HJ, Kim J, Lee KM. n vitro activity of β-lactams in combination with other antimicrobial agents against resistant strains of Pseudomonas aeruginosa. nt J Antimicrob Agents 2003;21: Lee K, Park KH, Jeong H, Lim H, hin JH, Yong D, et al., KONA group. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONA surveillance. Yonsei Med J 2006;47: McGowan JE Jr. esistance in nonfermenting gram-negative bacteria: multidrug resistance to the maximum. Am J nfect Control 2006;34: Weldhagen GF, Poirel L, Nordmann P. Ambler class A extended spectrum β-lactamases in Pseudomonas aeruginosa: novel developments and clinical impact. Antimicrob Agents Chemother 2003;47: Poirel L, Naas T, Guibert M, Chaibi EB, Labia, Nordmann P. Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum β-lactamase encoded by an Escherichia coli integron gene. Antimicrob Agents Chemother 1999;43: Nordmann P, onco E, Naas T, Duport C, Michel-Briand Y, Labia. Characterization of a novel extended-spectrum β-lactamase from Pseudomonas aeruginosa. Antimicrob Agents Chemother 1993;37: Chen HY, Yuan M, Livemore DM. Mechanisms of resistance to β- lactam antibiotics amongst Pseudomonas aeruginosa isolates collected in the UK in J Med Microbiol 1995;43: Lee, Park YJ, Kim M, Lee HK, Han K, Kang C, et al. Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother 2005;56: Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, Nordmann P. GE-2, a class A β-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrob Agents Chemother 2001;45: Watanabe M, yobe, noue M, Mitsuhashi. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991;35: iccio ML, Franceschini N, Boschi L, Caravelli B, Cornaglia G, Fontana, et al. Characterization of the metallo-β-lactamase determinant of Acinetobacter baumannii AC-54/97 reveals the existence of bla MP allelic variants carried by gene cassettes of different phylogeny. Antimicrob Agents Chemother 2000;44: Lauretti L, iccio ML, Mazzariol A, Cornaglia G, Amicosante G, Fontana, et al. Cloning and characterization of bla VM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 1999;43: Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. bla VM-2 cassette-containing novel integrons in metallo-β-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrob Agents Chemother 2002;46: Toleman MA, imm AM, Murphy TA, Gales AC, Biedenbach DJ, Jones N, et al. Molecular characterization of PM-1, a novel metallo-β-lactamase isolated in Latin America: report from the ENTY antimicrobial surveillance programme. J Antimicrob Chemother 2002;50: Castanheira M, Toleman MA, Jones N, chmidt FJ, Walsh T. Molecular characterization of a β-lactamase gene, bla GM-1, encoding a new subclass of metallo-β-lactamase. Antimicrob Agents Chemother 2004;48: Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, et al. Novel acquired metallo-β-lactamase gene, bla (M-1), in a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005;49: Donald HM, caife W, Amyes G, Young HK. equence analysis of A-1, a novel OXA β-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92. Antimicrob Agents Chemother 2000;44: Bou G, Oliver A, Martinez-Beltran J. 4, a novel class D β- lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob Agents Chemother 2000;44: Yoon W, Lee BY, Bae K, Kwon B, Jeong H, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol 2005;8: Timurkaynak F, Can F, Azap OK, Demirbilek M, Arslan H, Karaman O. n vitro activities of non-traditional antimicrobials alone or in combination against multidrug-resistant strains of Pseudomonas aeruginosa and Acinetobacter baumannii isolated from intensive care units. nt J Antimicrob Agents 2006;27: Clinical and Laboratory tandards nstitute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M-10(M2). Wayne, Pensylvania; CL, Oh EJ, Lee, Park YJ, Park JJ, Park K, Kim, et al. Prevalence of metallo-β-lactamase among Pseudomonas aeruginosa and Acinetobacter baumannii in a Korean university hospital and comparison of screening methods for detecting metallo-β-lactamse. J Microbiol Methods 2003;54: Kang JH, Bae K, Kwon B, Jeong H, Lee J, Lee WG, et al. Prevalence of ambler class A extended-spectrum β-lactamaseproducing Escherichia coli and Klebsiella pneumoniae isolates in Korea. Korean J Clin Microbiol 2005;8: Naas T, Benaoudia F, Massuard, Nordmann P. ntegron-located VEB-1 extended-spectrum β-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J Antimicrob Chemother 2000; 46: Park JH, Lee H, Jeong H, Kim BN, Kim KB, Yoon JD, et al. Characterization and prevalence of Escherichia coli and Klebsiella pneumoniae isolates producing an extended spectrum β-lactamase from Korean hospitals. Korean J Lab Med 2003;23: Jeon BC, Jeong H, Bae K, Kwon B, Lee K, Young D, et al. nvestigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the 3-β-lactamase in

8 un Yang Chung, et al. : β-lactamase in Multidrug-resistant P. aeruginosa 105 Korea. J Clin Microbiol 2005;43: Aubert D, Poirel L, Chevalier J, Leotard, Pages JM, Nordmann P. Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2001;45: De Champs C, Poirel L, Bonnet, irot D, Chanal C, irot J, et al. Prospective survey of β-lactamases produced by ceftazidimeresistant Pseudomonas aeruginosa isolated in a French hospital in Antimicrob Agents Chemother 2002;46: Heritier C, Dubouix A, Poirel L, Marty N, Nordmann P. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J Antimicrob Chemother 2005;55: Mendes E, Kiyota KA, Monteiro J, Castanheira M, Andrade, Gales AC, et al. apid detection and identification of metallo-βlactamase-encoding genes by multiplex real-time PC assay and melt curve analysis. J Clin Microbiol 2007;45: Versalovic J, Koeuth T, Lupski J. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids es 1991;19: Park KO, on HC, Bae K, Jeong H. Molecular epidemiology of infection caused by 3 or MP-1 β-lactamase-producing Acinetobacter baumannii. Korean J Lab Med 2005;8: Yao JDC and Moellering C Jr. Antibacterial agents. n: Murray P, Baron EJ, et al, eds. Manual for Clinical Microbiology. 7th ed. Washington: American ociety for Microbiology, 1999; Danel F, Hall LM, Duke B, Gur D, Livermore DM. OXA-17, a further extended-spectrum variant of β-lactamase, isolated from Pseudomonas aeruginosa. Antimicrob Agents Chemother 1999;43: Aktaş Z, Poirel L, alcioğlu M, Ozcan PE, Midilli K, Bal C, et al. PE-1- and -like β-lactamases in ceftazidime-resistant Pseudomonas aeruginosa isolates from intensive care unit patients in stanbul, Turkey. Clin Microbiol nfect 2005;11: Poirel L, Girlich D, Naas T, Nordmann P. 8, an extended-spectrum variant of β-lactamase from Pseudomonas aeruginosa and its plasmid- and integron-located gene. Antimicrob Agents Chemother 2001;45: Yan JJ, Tsai H, Chuang CL, Wu JJ. OXA-type β-lactamases among extended-spectrum cephalosporin-resistant Pseudomonas aeruginosa isolates in a university hospital in southern Taiwan. J Microbiol mmunol nfect 2006;39: Oh J, Lee U, Hwang HY, Bae K, Jo H, Lee BH, et al. Prevalence of class a extended-spectrum β-lactamases in clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa. Korean J Lab Med 2006;26: Nordmann P and Guibert M. Extended-spectrum β-lactamases in Pseudomonas aeruginosa. J Antimicrob Chemother 1998;42: to H, Arakawa Y, Ohsuka, Wacharotayankun, Kato N, Ohta M. Plasmid-mediated dissemination of the metallo-β-lactamase gene bla MP among clinically isolated strains of erratia marcescens. Antimicrob Agents Chemother 1995;39: Ohara M, Kouda, Onodera M, Fujiue Y, asaki M, Kohara T, et al. Molecular characterization of imipenem-resistant Pseudomonas aeruginosa in Hiroshima, Japan. Microbiol mmunol 2007;51:

9 106 Korean J Clin Microbiol 2008;11(2): = 국문초록 = 임상검체에서분리된다제내성녹농균의획득성 β-lactamase 유전형특성 1 삼성서울병원건강의학센터, 2 충남대학교의과대학진단검사의학교실정선양 1, 성지연 2, 권계철 2, 박종우 2, 고지선 2, 신소연 2, 송정훈 2, 구선회 2 배경 : 최근 cefepime이나 carbapenem계항균제에도내성을보이는다제내성녹농균이증가하고있다. 저자들은충청지역에서분리된다제내성녹농균을대상으로 Ambler class A, B 그리고 D 에속하는 β-lactamase와그들의광범위활성유도체의빈도를조사하고대표적인유전형들을규명하고자하였다. 방법 : 2006년 3월부터 2007년 5월까지충남대학교병원환자의임상검체에서분리된다제내성녹농균을대상으로하였다. Metallo-β-lactamase (MBL) 생성은 inhibitor-potentiated disk diffusion 시험으로확인하였으며 Ambler Class A, B, 그리고 D에해당하는 β- lactamase 유전자를검출하기위해중합연쇄반응과염기서열분석을하였다. 또한돌발감염이있었는지를알아보기위해서 enterobacterial repetitive intergenic consensus (EC)-PC 을수행하였다. 결과 : 시험기간중총 37주의다제내성녹농균이환자의임상검체에서분리되었다. 37주의녹농균중 29주가 bla (56.8%), bla (18.9%), 또는 bla OXA-1 (5.4%) 를가지고있는것으로나타났다. MP-1을생성하는균주는단한주였으며 bla OXA-1 도가지고있었다. Ambler class A β-lactamase와 class D carbapenemase는검출되지않았다. OXA형 β-lactamase를가지고있는균주의경우그렇지않은균주보다 aminoglycoside계항균제에대한내성율이더높은것으로나타났다. EC-PC 결과 을생성하는 19주는유전적으로매우밀접한것으로나타났다. 결론 : 충청지역의한대학병원에서분리된다제내성녹농균에가장광범위하게확산되어있는획득성 β-lactamase는 OXA형 β-lactamase였다. 그리고 OXA형 β-lactamase를갖고있는균주들은 β-lactam계항균제뿐아니라 aminoglycosie 계항균제와 qunolone계항균제등에대해내성높은내성율을보였다. [ 대한임상미생물학회지 2008;11:98-106] 교신저자 : 구선회, , 대전광역시중구대사동 640 충남대학병원진단검사의학과 Tel: , Fax: shkoo@cnu.ac.kr