Bifidobacteria ( 1 : Bifidobacteria, 2 : Bifidobacteria, 3 : Bifidobacteria, : Bifidobacteria ) : : : : : : : : : : : :. : : Bifidobact
|
|
- 수원 초
- 5 years ago
- Views:
Transcription
1 7 ] 1996 B ifidobacteria. : : : ( ) :
2 Bifidobacteria ( 1 : Bifidobacteria, 2 : Bifidobacteria, 3 : Bifidobacteria, : Bifidobacteria ) : : : : : : : : : : : :. : : Bifidobacteria 1 : Bifidobacteria 2 : Bifidobacteria 3 : Bifidobacteria : Bifidobacteria - 1 -
3 . Bifidobacteria,, cholesterol bifidobacteria : Bifidobacteria bifidobacteria. bifidobacteria B. bifid um Bb-11 B. bifidum K-7, MRS broth whey : Bifidobacteria. bifidobacteria. bifidobacteria,, bifidobacteria : B. bifidum. B. bifidum B. bifidum. 4. : Bifidobacteria. cholesterol bifidobacteria
4 bifidobacteria bifidobacteria. cholesterol : B. bifidum Bb-11 bifidobacteria B. bifidum K-7 bifidobacteria bifidobacteria. Bifidobacteria bifidobacteria, bifidobacteria yeast bifidobacteria MRS broth. B. bifidum Bb-11 B. bifidum K-7,, air atomization sodium alginate poly-l-lysine microparticles : bifidobacteria air-atomization. sodium alginate CaCl2 bifidobacteria, ( ) bifidobacteria :, in vitro bifidobacteria B cell, B cell B. bifidum, B. bifidum, B. bifidum, B. bifidum - 3 -
5 B. bifidum cytokine. 4. : 16S rdna bifidobacteria. Bifidobacteria,,, : bifidobacteria B. bifidum Bb-11 B. bifidum K-7 sodium alginate poly-l-lysine microparticles air atomization,. bifidobacteria B. bifidum K-7 L-cystein e HCl 0.05% MRS broth whey B. bifidum Bb-11. B. bifidum K-7 MRS broth B. bifidum K % B. bifidum Bb % B. bifidum K B. bifidum Bb , ph 2. Whey whey protein isolate(wpi) yeast extract 0.75% MRS broth B. bifidum K ph 5.20, 0.33% , B. bifidum Bb-11 ph 4.03, 0.64% %, yoghurt starter culture B-3 yoghurt,,., yoghurt 200 B. bifidum Bb-11 B. bifidum K-7 5g 4-20, 16, ph. B. bifidum Bb-11 B. bifidum K ph bifidobacteria - 4 -
6 bifidobacteria milk. B. bifidum Bb-11 B. bifidum K-7 ph % 16 ph T.A 1.07% 1.02% B. bifidum Bb-11 4 B. bifidum K-7 8. B. bifidum Bb-11 B. bifidum K ph bifidobacteria.. 2 : bifidobacteria sodium alginate 1.5%, 8 ml/min, 0.75 bar 7 curing m. Starter culture 0.5g, Yeast extract 0.5g, Glycerol 5.0g, NaHSO3 0.5g, Mg3(PO4)21.0g. slurry bifidobacteria culture cfu/g bifidobacteria 107 cfu/g. bifidobacteria ph. bifidobacteria cfu/g. bifidobacteria cfu/g cfu/g. bifidobacteria bfidobacteria bifidobacteria culture bifidobacteria. lactic acid bacteria, enterobacteriaceae staphylococci. bifidobacteria frequency
7 bifidobacteria.. 3 : B. bifidum spleen B cell. B cell cytokine (TGF- 1 IL-5) IgA. B cell polyclonal activator LPS. B. bifidum mesenteric lymph node (MLN) B cell IgA. B. bifidum spleen B cell Peyer's patch (PP) B cell MLN IgA. B. bifidum PP MLN B cell IgA, IgA. B. bifidum B. bifidum. B. bifidum B. bifidum. B. bifidum MLN cell TGF- 1 mrna. TGF- 1 IgA, bifidobacteria, IgA.. : 16S rdna ribotyping, PCR 16S rdna SDS-PAGE bifidobacteria PCR 16S rdna. Bifidobacteria RAPD SDS-PAGE. B. infantis B. bifidum bifidobacteria. B. bifidum K-7. B. bifidum. B. bifidum Bb-11 40,000 Caco2 cell B. bifidum K-7. B. bifidum K-7 bifidobacteria clostridia.. B. bifidum Bb-11 B. bifidum Bb-11 cholesterol B. bifidum Bb-11 cholesterol
8 . Whey bifidobacteria bifidobacteria bifidobacteria bifidobacteria, sodium alginate poly-l-lysine microparticles.. Bifidobacteria,.., bifidobacteria... bifidobacteria. Bifidobacteria
9 SUMMARY Subject 1: Development of Culturing Method of Bifidobacteria and value-added dairy products 1. Purpose of Study: In order to develop the value-added dairy products containing either B. bifidum Bb-11 or B. bifidum K-7 bifidobacteria-loaded microparticles, 2. Results and Conclusion: Both bifidobacteria were massively grown and stimulated at optimal condition then micrparticulated by air atomization with sodium alginate poly-l-lysine. To evaluate the employed bifidobacteria, the B. bifidum K-7, selected by this collaborative research project was compared to the commercial B. bifidum Bb-11. The growth of B. bifidum K-7 and B. bifidum Bb-11 in MRS broth containing L-cysteine HCl 0.05% were respectively and at 24 hours, indicates no difference. However, in the culture based on whey, the growth of B. bifidum K-7 was at 24 hours which was inferior to of B. bifidum Bb-11. Therefore, both bifidobacteria were employed in the experiment to develop value-added dairy products. The experimental 12.7% sterilized market skim milk was simulated with commercial skim milk powder. The experimented fermented milk was cultured with commercial yoghurt starter culture B-3. Finally the experimental ice cream was made from commercial ice cream mix. After individual addition 5g of either B. bifidum Bb-11 and B. bifidum K-7 microparticles into each 200 of the experimental 12.7% skim milk, fermented milk and ice cream mix, the skim milk and fermented milk were stored at 4 while the ice cream was stored at -20. The number of live bacteria, ph and titratable acidity in each product were measured every 4 days during 16 days of storage. During the storage of bifidobacteria added experimental skim milk, the initial number of live B. bifidum Bb-11 and B. bifidum K-7 were respectively and then changed to and after 16 days, indicates relatively good survivability. And the ph and titratable acidity were also nearly unchanged for 16 days. This result proved that the commercial production of so called bifidobacteria containing milk is technically feasible. In the fermented milk containing B. bifidum Bb-11 and B. bifidum K-7 microparticles, the initial ph was 4.95 and the initial titratable acidity was 0.8 %. At 16 days, the ph and the titratable acidity in the fermented milk containing B. bifidum Bb-11 were 4.62 and 1.07% while those in the fermented milk containing B. bifidum K-7 were 4.60 and 1.02%, respectively. However, the number of live B. bifidum - 8 -
10 Bb-11 and B. bifidum K-7 were zero at 4 days and 8 days of storage. In the ice cream containing B. bifidum Bb-11 and B. bifidum K-7 microparticles, the initial number of live bacteria were and , but at 16 days, those were and respectively. This showed no difference in number of live bacteria through the storage period. In addition, the ph and the titratable acidity were almost similar. Based on the results, it is likely that ice cream containing bifidobacteria microparticles also can be made. Subject 2: Preparation and Evaluation of Bifidobacteria-loaded microparticles 1. Purpose of Study: To develop bifidobacteria-loaded alginate poly-l-lysine m icroparticles using air atomization method. 2. Results and Conclusion: The optimal survival of bifidobacteria loaded in alginate poly-l-lysine microparticles during freeze-drying process was established. Thereafter, the survival and stability of bifidobacteria loaded in alginate poly-l-lysine microparticles was widely investigated as a function of ph, dissolution time, media and storage condition. Finally, the changes of microorganisms such as bifidobacteria, lactic acid bacteria, enterobacteriaceae and staphylococci in feces after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles to human volunteers were investigated in addition to physical status of feces. The mean size of bifidobacteria-loaded alginate poly-l-lysine microparticles was ranged between um. The bifidobacteria-loaded alginate poly-l-lysine microparticles were prepared by changing concentration of alginate solution (1.5%), spraying air pressure (0.75 bar) and delivery rate of alginate solution (8 ml/min). The bifidobacteria-loaded alginate poly-l-lysine microparticles were irregularly and roughly spherical in shape but had wrinkled surface. The bifidobacteria-loaded alginate poly-l-lysine microparticles were small sized and free flowable. The survival of bifidobacteria loaded in alginate poly-l-lysine microparticles was optimized when the formulation containing 0.5% yeast extracts, 5% glycerol, 0.5% NaHSO3and 1% Mg3(PO4)2was used. The moisture content was also important to influence survival of Bifidobacteria during the freeze-drying process. The optimal freeze-drying time was estimated around 14 h. The survival of bifidobacteria loaded in alginate poly-l-lysine microparticles was highly dependent on dissolution media, ph and incubation time. When the - 9 -
11 bifidobacteria was immobilized with alginate or even poly-l-lysine treatment, the survival of bifidobacteria was highly enhanced in the gastric fluid for 120 min, showing over 107 cfu/g. The bifidobacteria-loaded alginate poly-l-lysine microparticles maintain their survival over 107cfu/g after storage for 16 weeks. Bifidobacteria-loaded alginate poly-l-lysine microparticles significantly increased survival of bifidobacteria in fecal microflora in human beings when compared to bifidobacteria cultures as a control. It was evident that the microencapsulation improved resistance of bifidobacteria to gastric acid. However the survival of fecal lactic acid bacteria, enterobacteriaceae and staphylococci did not change significantly after ingestion of bifidobacteria products during the study period. Bifidobacteria-loaded alginate poly-l-lysine microparticles had a tendency to increase the frequency of stools. But the amount of stools was not changed. The viscosity of stools was also significantly decreased during the study periods. From these findings, bifidobacteria-loaded alginate poly-l-lysine microparticles could be use to deliver bifidobacteria to the colon without losing their viability in low ph conditions. The current microencapsulation method using air atomization technique provides an alternative to entrap bifidobacteria without using harmful organic solvents. The bifidobacteria-loaded alginate poly-l-lysine microparticles could be also used in the dairy products to deliver bifidobacteria to the colon without losing viability significantly in the low ph condition. Subject 3: Effect of Bifidobactria on Intesitinal Immune Function 1. Purpose of Study: Bifidobacterium is regarded to be stimulatory for overall host immune responses. However, its exact role in the systemic and mucosal immunity is largely unkown. This study was performed to determine the role of bifidobacterium in the systemic and mucosal antibody response 2. Results and Conclusion: We first examined the direct modulatory effect of bifidobacterium on the synthesis of antibodies by murine spleen B cells. Whole spleen B cells were cultured with Bifidobacterium bifidum or Clostridium perfringens (Welch's bacilli, negative control) and antibody synthesis was measured by ELISA and ELISPOT assay. B. bifidum, but not C. perfringens, substantially increased the total secretion of major Ig isotypes as well as the number of IgA-secreting cells. In addition, B. bifidum increased the proliferation of spleen cells by 3-fold while C. perfringens had little to diminishing effect on it. These results indicate that B
12 bifidum increased Ig synthesis through its mitogenic influence on B cells. Further, B. bifidum induced spleen B cells to be reactive to TGF- 1 and IL-5, resulting in the increase of surface IgA expression ( 3-fold) and total IgA production (>20 fold) but not IgM and IgG2a isotypes. As much as seen in spleen B cells, B. bifidum increased IgA production by mesenteric lymph node (MLN) B cells. In addition, peroral immunization with B. bifidum enhanced number of IgA secreting cells in MLN. Subsequently, we found that this modulating effect of B. bifidum is owing to its cell wall components. Further, it was found that perorally administered alginate-encapsulated B. bifidum is more potent in the increase of IgA expression by MLN B cells than unencapsulated B. bifidum. Finally, we examined the effect of B. bifidum on cytokine expression. Peroral immunization of alginate-encapsulated B. bifidum increased mrna level of TGF- 1 in MLN cells. Taken together, these studies indicate that B. bifidum can act as a LPS-like polyclonal activator for B cells. Furthermore, the fact that bifidobacterium enables B cells to respond to TGF- 1 and IL-5 for the IgA production has important implications in the primary defense against pathogens in the gastrointestinal tract. Subject 4: In Vivo biological activity of Bifidobacteria 1. Purpose of Study: The purpose of the present study is two fold. 1) To develop the molecular biological methods to identify and differentiate species and strains of bifidobacteria. 2) To examine physiological characteristics of bifidobacteria which are important as probiotics and the in vivo effects of bifidobacteria and microencapsulation on fecal bacteria and serum cholesterol 2. Results and Conclusion: 16S rdna ribotyping, restriction pattern of PCR-amplified 16S rdna, and SDS-PAGE of whole cell protein could be used to identify species of bifidobacteria. B. infantis strains and B. bifidum strains were tolerant to acid and bile acid, respectively. Commercial cultures of bifidobacteria were tolerant to both acid and bile acid. B. bifidum K-7 were tolerant to both acid and bile acid. All B. bifidum strains adhered to Caco2 cell better than other bifidobacteria. The protein with molecular weight of 40,000 which bound to Caco2 cell seemed to mediate adherence of B. bifidum Bb-11. Feeding of rat with milk and fermented milk containing B. bifidum K-7 decreased counts of clostridia and increased counts of bifidobacteria in feces. Microencapsulation of B. bifidum K-7 did not affect the bacterial counts of
13 the feces. There was no change in serum cholesterol due to feeding of B. bifidum K-7. Feeding of rat with milk containing microencapsulated B. bifidum Bb-11 and fermented milk decreased serum cholesterol but feeding with B. bifidum Bb-11 without microencapsulation did not. CONTENTS Chapter. Introduction Section 1. Purpose of study Section 2. Scope of study Chapter. Development of Culturing Method of Bifidobacteria and Value-added Dairy Products Section 1. Effects of casein hydrolyzates fractionated by molecula r weight on the growth of Bifidobacterium bifidum Bb Section 2. Growth of Bifidobacterium bifidum K-7 and stability of bifidobacteria microparticles in dairy products- 39 Section 3. References Chapter. Preparation and Evaluation of Bifidobacteria-loaded Microparticles Section 1. Introduction Section 2. Materials and methods Section 3. Results and discussion Section 4. Summary Section 5. References Chapter. Effects of Bifidobacteria on Intesitinal Immune Function Section 1. Introduction Section 2. Materials and methods Section 3. Results and discussion Section 4. Summary Section 5. References
14 Chapter. In Vivo Biological Activity of Bifidobacteria Section 1. Molecular biological identification of differentiation of bifidobacteria Section 2. Physiological characteristics and mechanisms of bifidobacteria adhesion ability to Caco2 cells Section 3. In vivo biological activity of microencapsulated bifidobacteria Section 4. References
15 Bifidobacteria 1 Bifidobacterium bifidum Bb B. bifidum Bb-11 B.bifidum K-7 Bifidobacteria Bifidobacteria Bifidobacteria Bifidobacteria 1 Bifidobacteria Bifidobacteria Bifidobacteria
16 - 15 -
17 1 1. Bifidobacteria,, cholesterol. bifidobacteria bifidobacteria bifidobacteria. bifidobacteria bifidobacteria. air atomization bifidobacteria sodium alginate poly-l-lysine microparticles, bifidobacteria bifidobacteria. 2 1 bifidobacteria bifidobacteria 2 bifidobacteria bifidobacteria microparticles,. 2 1 bifidobacteria bifidobacteria, bifidobacteria microparticles. 3 bifidobacteria bifidobacteria. in vitro bifidobacteria B cell, B cell B. bifidum, B.bifidum, B. bifidum, B. bifidum B. bifidum cytokine. bifidobacteria, bifidobacteria cholesterol
18 2 Bifidobacteria 1 Bifidobacterium bifidum Bb ,,,. peptide,. Kehagias (1977) casein peptide B. bifidum,. bifidobacteria (Poch Bezkorovainy, 1988, 1991; Petschow Talbott, 1991), Poch Bezkorovainy(1988)
19 casein bifidobacteria, trypsin -casein casein bifidobacteria (Poch Bezkorovainy, 1991). Proulx (1992) casein peptide bifidobacteria, Cheng Nagasawa(1984) 1,100 2,300Da peptide Norris, B. breve B. infantis. Azuma (1984) -casein chymosin pepsin bifidobacteria -casein.,,, bifidobacteria. -lactoglobulin, -lactalbumin, immuno globulin, serum albumin, proteose-peptone,. cheese 86 90% (Yamauchi, 1992). bifidobacteria B. bifidum Bb Bifidobacteria bifidobacteria Bifidobacterium bifidum Bb-11(Chr. Hansen's Lab., Denmark). B. bifidum Bb-11 L-cysteine HCl MRS 2.. B. bifidum Bb-11 Whey powder ( ), milk protein hydrolysate(mph) casein hydrolysate(ch) ( ), -casein, -casein, -casein, trypsin Sigma (St. Louis, U.S.A). whey powder 6.5% (ph 7.0, 1N NaOH ), (Beckman J2-21, England) 9,000rpm 5. whey L-cysteine HCl 0.05% yeast extract 0.75%, milk protein hydrolysate(mph) casein hydrolysate(ch),
20 trypsin 10,000Da, 10,000 3,000Da, 3,000Da -, -, -casein 1%(w/v) 0.25, 0.5, % B. bifidum Bb-11 1%, Trypsin casein -, -, -Casein M phosphate buffer(ph 8.0) , trypsin 1% 125 (1437U) ( : = 1:200, wt/wt), 40 6, , -, -Casein trypsin 2 10,000Da, 10,000 3,000Da, 3,000Da. trypsin Centriprep-10(Amicon, Inc., USA) 3,000 g 40 (Union 32R, Hanil Sci. Korea) 10,000Da 10,000Da, 10,000Da Centricon-3(Amicon, Inc., USA) 7,500 g 2 3,000Da fraction 3,000Da (Fig.1). Waddell (A215/A225 ) ( Uvikon 942, Kontron Co. Italy). ( / ) = (A215-A225) 144., ph ph Delta 350 ph (Mettler, England), (titratable acidity, TA) Marth (1978)., 9 9 1% phenolphtalein ph N NaOH ( ). Lactobacillus MRS agar(difico Lab., USA) L-cysteine HCl(Sigma Chem. Co. U.S.A.) 0.05% , MRS broth 1/2, L-cysteine HCl 0.05%,. 1 petridish MRS agar, (BBl Gas Pak 100 Anaerobic Jar Becton Dickinson Microbio. systems, Cockeysville, MD. U.S.A) Gas Pak 100TM Anaerobic Envelops (Becton Dickinson Microbio. systems, Cockeysville, MD. U.S.A)
21 Casein Dissolved in 0.1M phosphate buffer(ph 8.0) 1% trypsin treatment (40 / 6hr) (enzyme : protein = 1 : 200 wt/wt) Inactivation (85 90 /10min) Centriprep-10 (MWCO : 10,000Da) centrifuge (3,000 g / 40min) retentate permeate Centricon-3 (MWCO : 3,000Da) centrifuge (7,500 g / 2hr) retentate permeate Mw>10,000Da Mw<3,000Da 10,000Da>Mw>3,000Da Fig.1. Procedure for the fractionation of -, -, - casein hydrolyzates by ultrafiltration after trypsin digestion. 3.. B. bifidum Bb-11 whey MPH(Milk protein hydrolysate) CH(Casein hydrolysate) 0.25, 0.5, % B. bifidum ph,. MPH ph (Table 1)
22 ph, MPH ph, 24 ph. Table 1. Changes of ph and titratable acidity of whey medium supplemented with milk protein hydrolyzate during the growth of B. bifidum Bb-11. Incubation time (hr) Control ph T.A. (%) Milk protein hydrolyzates 0.25% 0.5% 0.75% 1.0% T.A. ph ph T.A. T.A. ph ph T.A. (%) (%) (%) (%) , 1% (Table 1). 24, %., 12, 1% %,, 0.5%. MPH 0.75% 1% (Fig.2), MPH B. bifidum
23 2 Fig.2. Changes of viable cell counts during the growth of B. bifidum Bb-11 in whey medium supplemented with milk protein hydrolyzate. CH ph (Table 2) % 0.75%, 24 ph, ph. (Table 2) %,, 1% 0.75% %, 0.75%. 24, (Fig. 3). CH B. bifidum 12 24, B. bifidum. Table 2. Changes of ph and titratable acidity of whey medium supplemented with casein hydrolyzate during the growth of B. bifidum Bb
24 Casein hydrolyzates Control Incubation 0.25% 0.5% 0.75% 1.0% time (hr) T.A T.A T.A T.A T.A ph ph ph ph ph (%) (%) (%) (%) (%) Fig.3. Changes of viable cell counts during the growth of B. bifidum Bb-11 in whey medium supplemented with casein hydrolyzate.. Casein -Casein, -casein, -casein 40 6 trypsin 10,000Da, 10,000 3,000Da, 3,000Da Table 3. Table 3,,. -, - -Casein trypsin 10,000Da, 3,000 10,000Da 3,000Da, 1%(w/v) B. bifidum
25 ph,. ph -casein 24 10,000 3,000Da 3,000Da ph (Table 4), -casein (Table 5). -Casein 12 ph, 10,000Da ph (Table 6). Table 3. Protein concentration of three fractions with different molecular weight of -, - and -casein hydrolyzates by trypsin. ( / ) Molecular weight > 10,000 Da 10,000 3,000 Da 3,000 Da > -casein casein casein Table 4. Changes of ph and titratable acidity of whey medium supplemented with different molecular weights of -casein hydrolyzates during the growth of B. bifidum Bb-11. Incubation time (hr) Control >10,000Da 3,000 10,000Da <3,000Da ph T.A.(%) ph T.A.(%) ph T.A.(%) ph T.A.(%) Table 5. Changes of ph and titratable acidity of whey medium supplemented with different molecular weights of -casein hydrolyzates during the growth of B. bifidum Bb
26 Incubation time (hr) Control >10,000Da 3,000 10,000Da <3,000Da ph T.A.(%) ph T.A.(%) ph T.A.(%) ph T.A.(%) Table 6. Changes of ph and titratable acidity of whey medium supplemented with different molecular weights of -casein hydrolyzates during the growth of B. bifidum Bb-11. Incubation time (hr) Control >10,000Da 3,000 10,000Da <3,000Da ph T.A.(%) ph T.A.(%) ph T.A.(%) ph T.A.(%) B. bifidum Bb-11. -Casein 24 10,000Da, 10,000 3,000Da 3,000Da, 3,000Da (Table 4). -Casein 3,000Da (Fig.5). -Casein 10,000Da, 3,000Da
27 Fig.4. Changes of viable cell counts during the growth of B. bifidum Bb-11 in whey medium supplemented with different molecular weights of -casein hydrolyzates. Fig.5. Changes of viable cell counts during the growth of B. bifidum Bb-11 in whey medium supplemented with different molecular weights of -casein hydrolyzates. -casein B. bifidum Bb-11 12, 24 10,000Da,, 3,000Da 10,000 3,000Da (Fig.4). -Casein 12, 24 (Fig.5). -Casein
28 , 3,000Da 10,000Da,. 24 B. bifidum 10,000Da (Fig.6). Fig.6. Changes of viable cell counts during the growth of B. bifidum Bb-11 in whey medium supplemented with different molecular weights of -casein hydrolyzates. Whey B. bifidum Bb-11 (MPH, CH). 0.5% bifidobacteria,, bifidobacteria Park Heo(1995)., bifidobacteria. bifidobacteria, Rose (1963) pepsin, trypsin, papain bifidobacteria, Kehagias (1977), Jao (1978) casein casein bifidus factor, N-acetyl-glucosamine. casein bifidobacteria (Proulx Gaurhier. 1992) Klaver (1993) bifidobacteria casein, bifidobacteria. MPH CH 600Da
29 (Mcdonald, 1990). Trypsin 3 casein B. bifidum Bb-11, - and -casein 3,000Da. 1,100 2,300Da peptide bifidobacteria Cheng Nagasawa(1984) casein peptide peptide bifidobacteria Proulx (1992) 5,000Da peptide bifidobacteria Poch Betskorobainy(1991). Bouhallab (1993) casein tryptic hydrolysates (MP) peptide bifidobacteria, MP 2,000Da peptide., Poch Betzkorovainy(1991) trypsin -casein casein, -casein -, -casein 3,000Da peptide B. bifidum. Bezkorovainy Topouzian (1981) B. bifidum var. pennsylvanicus 10,000Da, B. bifidum, B. infantis B. breve 10,000Da 10,000Da bifidobacteria. 4. Whey Bifidobacterium bifidum Bb-11 protein hydrolysate (MPH) casein hydrolysate (CH), -, -, -casein trypsin ( > 10,000Da, 10,000 3,000Da, < 3,000Da)., MPH CH, 1%,,. casein 3,000Da, 3,000 10,000Da, 10,000Da B. bifidus Bb-11, -casein -casein (3,000Da ), -casein 10,000Da ph
30 , 2 B. bifidum Bb-11 B. bifidum K-7 Bifidobacteria 1. Bifidobacteria (Gibson, 1994 ; Misra, 1995; Moore 1995), (Link, 1994 ; Schiffrin 1995), (Gri ll, 1995 ; Kampmann, 1994 ; Singh, 1997 ; Van't, 1989) cholesterol (Seki, 1978) (Bouhnik Y, 1996). bifidobacteria. ph 2.0 bifidobacteria. (conway, 1987 ; Floch, 1971 ; Midtvedt, 1974). Mayer(1948) bifidobacteria bifidobacteria bifidobacteria. bifidobacteria B. bifidum Bb-11 B. bifidum K-7,, sodium alginate poly-l-lysine microparticles air atomization,,. 2.. Bifidobacteria
31 bifidobacteria B. bifidum Bb-11(Chr. Hansen's, Denmark) B. bifidum K-7 L-cysteine HCl(Sigma) MRS broth (Beckman J2-21, England) 3,000rpm 10.. Bifidobacteria MRS broth L-cysteine 0.05% ph 6.8. Whey whey powder 6.5% ph 1N NaOH 6.8 (Beckman J2-21, England) 9,000rpm 5,. whey 0.59%, 0.38%, 3.74%, 0.35%, 94.90%, B. bifidum K-7 Ammonium citrate 0.2%, Sodium Acetate 0.5% Magnesium sulfate 0.01% Manganese sulfate 0.005%.. ( ) 12.7%, yoghurt starter culture B-3 (S. salivarius s ubsp. thermophilus, L. delbrueckii subsp. bulgaricus, Chr. Hansen's, Denmar k ) yoghurt, (, ) (Sani-Serv A4071-E. U.S.A).. bifidobacteria B. bifidum Bb-11 B. bifidum K-7 sodium alginate poly-l-lysine air atomization,, 200 bifidobacteria 5g, 4, -20, (0, 4, 8, ) ph,.. ph, ph Mettler Delta 350, (titratable acidity, TA) Marth (1978) 9 1% phenolphtalein, ph N NaOH ( ). Bifidobacteria NPNL MRS agar. NPNL Neomycin sulfate 2g, Paromomycin sulfate 4g, Nalidixic acid 0.3g, Lithium chloride 60g m membrane filter
32 4. MRS agar L-cysteine HCl 0.05%, % NPNL MRS agar, MRS broth 1/2 L-cysteine HCl 0.05%. 0, 4, 8, ml 4. 1 MRS agar BBL Gas Pak 100TM Anaerobic Systems (Cockeysville, MD. U.S.A) B. bifidum Bb-11 B. bifidum K-7 bifidobacteria B. bifidum K-7 MRS broth whey B. bifidum Bb-11. B. bifidum Bb-11 B. bifidum K-7 MRS broth L-cysteine HCl 0.05% 37 24, ph Fig.1, Fig.2 Fig. 3. Fig.1. Growth effects of B. bifidum K-7 and B. bifidum Bb
33 in MRS broth. Fig.2. Changes of ph during the growth of B. bifidum K-7 and B. bifidum Bb-11 in MRS broth. Fig.3. Changes of titratable acidity during the growth of B. bifidum K-7 and B. bifidum Bb-11 in MRS broth. B. bifidum K-7 MRS broth B. bifidum K % B. bifidum Bb %, Fig.1 12 B. bifidum K B. bifidum
34 Bb B. bifidum K B. bifidum Bb ph 2. MRS broth L-cysteine HCl 0.05% B. bifidum K-7 B. bifidum Bb-11. Whey L-cysteine HCl 0.05% B. bifidum K ph 5.20 B. bifidum Bb-11 ph 4.03, B. bifidum K % B. bifidum Bb %, B. bifidum K , B. bifidum Bb MRS broth whey B. bifidum Bb-11 B. bifidum K-7 ph,. (Fig.4, Fig.5 Fig.6) Fig.4. Growth effects of B. bifidum K-7 and B. bifidum Bb-11 in Whey-based medium
35 Fig.5. Changes of ph during the growth of B. bifidum K-7 and B. bifidum Bb-11 in Whey-based medium. Fig.6. Changes of titratable acidity during the growth of B. bifidum K-7 and B. bifidum Bb-11 in Whey-based medium. B. bifidum K-7 whey whey whey protein isolate(wpi) 0.75%, yeast extract 0.75% B. bifidum K-7 B. bifidum Bb-11.. bifidobacteria
36 Acidophilus milk bifidobacteria bifidobacteria milk bifidobacteria ph bifidobacteria. bifidobacteria 12.7% 121 1, B. bifidum Bb-11 B. bifidum K-7 5g 4 16 (0, 4, 8 16 ) bifidobacteria, ph. B. bifidum Bb-11 B. bifidum K % 4 Fig.7. Fig.7. Changes of viable cell counts during the storage of milk added bifidobacteria microparticles B. bifidum Bb-11 B. bifidum K-7 B. bifidum Bb B. bifidum K B. bifidum Bb B. bifidum K B. bifidum Bb-11 B. bifidum K-7. B. bifidum Bb-11 B. bifidum K-7 bifidobacteria B. bifidum K-7 B. bifidum Bb-11. bifidobacteria. bifidobacteria
37 , 4 B. bifidum Bb-11 B. bifidum K-7 16 bifidobacteria. B. bifidum Bb-11 B. bifidum K % 4, ph Fig.8. Fig.8. Changes of ph during the storage of milk added bifidobacteria microparticles Fig.8 B. bifidum Bb-11 B. bifidum K-7 ph B. bifidum Bb-11 ph 6.5 B. bifidum K ph B. bifidum K-7 B. bifidum Bb-11 ph 16 ph bifidobacteria milk ph % B. bifidum Bb-11 B. bifidum K-7 4, (T.A) Fig
38 Fig.9. Changes of titratable acidity during the storage of milk added bifidobacteria microparticles B. bifidum Bb-11 B. bifidum K %, 8 B. bifidum Bb % B. bifidum K % 16 B. bifidum Bb % B. bifidum K %. ph bifidobacteria, bifidobacteria milk. 4 4 B. bifidum Bb % B. bifidum K %. 12.7% bifidobacteria (Gilliland, 1979), (Petterson, 1983), bifidobacteria ph bifidobacteria (, 1998). 2 bifidobacteria
39 bifidobacteria yoghurt starter culture B-3 (S. salivarius subsp. thermophilus, L. delbrueckii subsp. bulgaricus, Chr. Hansen's, Denmark ) yoghurt, yoghurt 200 B. bifidum Bb-11 B. bifidum K-7 5g 4, 16 (0, 4, 8, ) bifidobacteria, ph. S. salivarius subsp. thermophilus, L. delbrueckii subsp. bulgaricus 2 yoghurt bifidobacteria 4, Fig.10 Fig.10. Changes of viable cell counts during the storage of fermented milk added bifidobacteria microparticles Fig.10 B. bifidum Bb-11 B. bifidum K B. bifidum Bb B. bifidum K , yoghurt bifidobacteria B. bifidum K-7 B. bifidum Bb-11 B. bifidum K-7 B. bifidum Bb-11. B. bifidum Bb-11 B. bifidum K-7 4, ph Fig
40 Fig.11. Changes of ph during the storage of fermented milk added bifidobacteria microparticles Yoghurt B. bifidum Bb-11 B. bifidum K-7 ph 4.75, 8 B. bifidum Bb B. bifidum K , 16 B. bifidum Bb B. bifidum K Bifidobacteria 4 ph bifidobacteria. B. bifidum Bb-11 B. bifidum K-7 Fig
41 Fig.12. Changes of titratable acidity during the storage of fermented milk added bifidobacteria microparticles B. bifidum Bb-11 B. bifidum K-7 0.8%, 8 B. bifidum Bb % B. bifidum K %, 16 B. bifidum Bb % B. bifidum K %. bifidobacteria ph.. bifidobacteria ice cream frozen yoghurt.. (, ) (Sani-Serv A4071-E. U.S.A.) bifidobacteria. 200 B. bifidum Bb-11 B. bifidum K-7 5g , 4, 8, bifidobacteria, ph. bifidobacteria Fig.13 B. bifidum Bb B. bifidum K , 4 B. bifidum Bb B. bifidum K B. bifidum K-7 B. bifidum Bb-11,
42 16 B. bifidum Bb B. bifidum K B. bifidum K-7 B. bifidum Bb-11. bifidobacteria bifidobacteria. bifidobacteria. Fig.13. Changes of viable cell counts during the storage of ice added bifidobacteria microparticles cream B. bifidum Bb-11 B. bifidum K-7-20, 16 ph, Fig.14 Fig.15. B. bifidum Bb-11 B. bifidum K-7 ph , 16 B. bifidum Bb B. bifidum K bifidobacteria ph
43 Fig.14. Changes of ph during the storage of ice cream added bifidobacteria microparticles Bifidobacteria B. bifidum Bb-11 B. bifidum K % 16 B. bifidum Bb % B. bifidum K % bifidobacteria. Fig.15. Changes of titratable acidity during the storage of ice cream
44 added bifidobacteria microparticles 4. bifidobacteria B. bifidum Bb-11 B. bifidum K-7 sodium alginate poly-l-lysine microparticles air atomization. bifidobacteria B.bifidum K-7 L-cysteine HCl 0.05% MRS broth whey B.bifidum Bb-11. B.bifidum K-7 MRS broth B. bifidum K % B. bifidum Bb % B. bifidum K B. bifidum Bb , ph 2. Whey whey protein isolate(wpi) yeast extract 0.75% MRS broth B.bifidum K ph 5.20, 0.33% , B.bifidum Bb-11 ph 4.03, 0.64% %, yoghurt starter culture B-3 yoghurt,,., yoghurt 200 B. bifidum Bb-11 B. bifidum K-7 5g 4-20, 16, ph. B. bifidum Bb-11 B. bifidum K ph bifidobacteria bifidobacteria milk. B. bifidum Bb-11 B. bifidum K-7 ph % 16 ph T.A 1.07% 1.02% B. bifidum Bb-11 4 B. bifidum K-7 8. B. bifidum Bb-11 B. bifidum K ph bifidobacteria
45 3 1. Azuma, N., K., Yamauchi and T. Mitsuoka Bifidus growth-promoting activity of a glycomacropeptide derived from human -casein. Agric. Biol. Chem. 48(8): Bezkorovainy, A. and N. Topouzian Bifidobacterium bifidus var. pennsylvanicus growth promoting activity of human milk casein and its derivatives. Int. J. Biochem. 13: Bouhallab, S., C. Favrot and J. L. Maubois Growth-promoting activity of tryptic digest of caseinomacropeptide for Lactococcus lactis subsp. lactis. Lait 73: Bouhnik Y, B. Flourie, c. Andrieux, N. Bisetti, F. Brie and J.C. Rambaud Effects of bifidobacterium sp. fermented milk ingested with or without inulinon colonic bifidobacteria and enzymatic activities in healthy humans. Eur.J.Clin.Nutr. 50 : Cheng, C. C. and Nagasawa, T Effect of peptides and amino acids produced by Lactobacillus casei in milk on the acid production of bifidobacteria. Jpn. J. Zootech. Sci. 55: Desjardins, M. L., D. Roy, and J. Goulet. 1990a. Growth of bifidobacteria and their enzyme profiles. J. Dairy Sci. 73: Desjardins, M. L., D. Roy, C. Toupin, and J. Goulet. 1990b. Uncoupling of growth and acids production in Bifidobacterium spp. J. Dairy Sci. 73: El-Soda, M., A. Macedo, and N. F. Olson The peptide hydrolase system of Bifidobacterium species. Milchwissenschaft Gibson, G.R. and X. Wang Regulatory effect of bifidobacteria on the growth of other colonic bacteria. J.Appl.Bacteriol. 77 : Grill, J.P., J. Crociani and J. Ballongue Effect of bifidobacteria on nitrites and nitrosamines. Appl. Microbiol. 20: Hukins, R. W., and N. L. Nannen ph homeostasis in lactic acid bacteria. J. Dairy Sci. 76: Jao, V. C., E. M. Milkolajcik, and P. M. T. Hansen, Growth of Bifidobacterium bifidum var. pennsylvanicus in laboratory media supplemented with amino sugars and spent broth from E. coli. J. Food Sci. 43: Kampmann, E, A. Goldbohm, V.D.Brandt and P. Veer Fermented dairy products,
46 calcium and colorectal cancer in the Netherlands Cohort Study. Cancer Res. 54 : Kehagias, C., Y. C., Jao,E. M., Mikolajick and P. M. T. Hansen Growth response of Bifidobacterium bifidum to a hydrolytic product isolated from bovine casein. J. Food Sci. 42: Klaver, A. M., F. Kingma and H. Weewkamp Growth and survival over Bifidobacteria in milk. Neth. Milk Dairy J. 47: Link, A.H., F. Rochat, K.Y. Saudan, O. Mignot and J. M. Aeschlimann Modulation of a specific humoral immune response and change in intestinal flora mediated through fermented milk intake. Immunol. Med. Microbiol. 10 : Marth, E. H Standard methods for the examination of dairy products. Americ. Public Health Assoc. Washington, DC Marteau, P., P. Pochart, B. Flourie, P. Pellier, L. Sanots, J. F. Desjeux, and J. C. Rambaud Effect of chronic ingestion of a fermented dairy product containing Lactobacillus acidophilus and Bifidobacterium bifidum on metabolic activities of the colonic flora in humans. Am. J. Clin. Nutr. 52, Mcdonald, L. C., H. P. Fleming, and H. M. Hassen Acid tolerance of Leuconost oc mesenteroides and Lactobacillus plantarum. Appl. Enviro n. Microbiol. 56: Misra, A.K. and P.k. Kuila Antimicrobial substances from Bifidobacterium bi fidum. Indian J. Dairy Sci. 48: Modler, H. W., R. C. Mc Kellar, H. D. Goff, and D. A. Mackie Using ice cream as a mechanism to incorporate Bifidobacteria and fructooligosaccharides into the human dite. Cult. Dairy Prod. J. 25: 4-9. Moore, W.E and L.H. Moore Intestinal floras of populations that have a high of coion cancer. Appl. Environ. Microbiol. 61: Park, H. K., and T. R. Heo Studies on the characteristics of Bifidobacterium spp. for the Industrial use. Korean, J. Food Sci. Ani. Resour. Vol.15(2): Petschow, B. W., and R. D. Talbott Response of Bifidobacterium sp -ecies to gr owth promoters in human and cow milk. Pediatr Res. 29: Poch, M., and A. Bezkorovainy Growth-enhancing supplements for varous species of the genus. Bifidobacterium. J. Dairy Sci. 71: Poch, M., and A. Bezkorovainy Bovine milk -casein trypsin digest is a growth enhancer for the genus Bifidobacterium. J. Agric Food Chem. 39: Proulx, M., S. F. Gauthier and D. Roy Utilisation d'hydrolysats enzymatiques de caseine pour la croissance des bifidobacteries. Lait 72:
47 27. Reuter, G Bifidobacteria cultures as components of yoghurt-like products. Bifidobacteria Microflora 9: Rose, C. S. and P. György Bifidus factor II for growth of Lactobacillus bifidus. Proc. Soc. Exp. Bio. N.Y. 112(4): Van't, V.P., J. Dekker, J.W.J. Lamers, F.J.Kok, E.G.Schouten, H. Brants, F. Sturmans and R.J.J Hermus Consumption of fermented milk products and breast cancer : A case-cotrol study in the Netherlands. Cancer Res. 49 : Schiffrin, E.J., F. Rochat, H.A. Link, J.M. Aeschlimann and A.H. Donnet Immunomodulation of human blood cells following the ingestion of lactic acid bacteria J. Dairy Sci. 78: Seki, M., M. Igarashi, Y. Fukuda, S. Simamura, T.Kawashima and K. Ogasa The effect of bifidobacterium cultured milk on the "regularity" among aged group. Nutr. Food. 4 : Singh, j., A. Rivenson, M. Tomita, S. Shimamura, N. Ishibashi and B.S Reddy Bifidobacteria longum, a lactic acid-producing intestinal bacterium inhibits coion cancer and modulates the intermediate biomarkers of coiol carcinogenesis. Carcinogenesis. 18 : Yamauchi, K Biologically functional proteins of milk and peptides derived from milk proteins. Bulletin of the IDF. 272: Yoshigawa, M., H. Suganuma, A. Shiata, H. Usui, K. Kurahashi, T. Mizumoto, Y. Suitani, and K. Kashimoto In peptides chemistry 1993". Y. Okata(Editor), Protein Rerch Foundation, Osaka, Yoshihama, M., E. Mochizuki, S. Mitsuhashi, and K. Ahiko, Studies on application of galactosyl lactose for infant formula.. Effects of galactosyl lactose on intestinal bacterial flora of newborn infantis, Reports of researich lab. Technical research institute, snow brand milk products Co.,Ltd, 78:
48 3 Bifidobacteria 1 Bifidobacteria,,, cholesterol. Bifidobacteria. Bifidobacteria. Bifidobacteria,. Bifidobacteria. sodium alginate. Sodium Alginate. mm. alginate m mm bead Bifidobacteria. Nozzle Bifidobacteria. Bifidobacteria Bifidobacteria.... Bifidobacteria. Bifidobacteria cholesterol,
49 anti-mutagenicity,. Bifidobacteria. Bifidobacteria Bifidobacteria. Bifidobacteria Bifidobacteria. air-atomization ( ) sodium alginate CaCl2 Bifidobacteria, ( ) (Bifidobacteria lactic acid bacteria, enterobacteriaceae staphylococci) Bifidobacteria. ( ), Bifidobacteria,, in vitro in vivo. 1.,,, Bifidobacteria.. 2 Bifidobacteria in vitro /,. 3 Bifidobacteria in vivo
50 2 1. Bifidobacteria Chr. Hansen Lab.(Denmark) B.bifidum Bb-11 B.bifidum K-7 MRS broth whey (Beckman J-21, England) 3,000rpm % Sodium alginate stirring autoclave 30. Bifidobacteria Start culture sodium alginate. 30 stirring homogeneous. Peristaltic pump air atomization device 8ml/min 0.2M CaCl2 15 CaCl2 curing 0.02% poly-l-lysine 5 cross-linking. washing pre-freezing 56, 8mmtorr 14.,,, alginate polylysine. 3. Bifidobacteria microcapsules SEM(scanning electron micrograph), Laser particle size.. 4. Bifidobacteria, yeast extract, cryoprotectant (glycerol, lactose), (ascorbic acid, NaHSO3), (Mg3(PO4)2)
51 . 5. Bifidobacteria 1g (0.5% yeast extract) 200ml (ph= ) (ph= ). 1ml MRS gradient MRS-Agar colon formed unit.. MRS-agar 1) Bifidobacteria 5.5% MRS 0.05% Yeast extract Paraffin autoclave 15. 2) MRS-agar 5.5% MRS, 1.5% agar 0.05% Cystein.HCl autoclave g NaCl 15g Yeast extract 2900ml. 7.4% HCl ph ml. 20.4g KH2PO4(MW ) 15g Yeast extract 2900ml. 1N NaOH ph ml.. Poly-lysine Bifidobacteria Bifidobacterium cultures, Bifidobacteria alginate poly-lysine 1 g (0.5% yeast extract) (0.05% cysteine.hcl) 200 ml (ph=1.5) ml 2.5 % MRS gradient 10-8 MRS agar 37, colon formed unit.. ph Bifidobacteria Phosphate buffer (ph=7.4) 0.1M HCl ph 6.8, 4.0,
52 1.5 ph. Bifidobacteria 1g 200ml (0.5% yeast extract 0.05% cysteine.hcl ) N NaOH ph 6.8 Bifidobacteria ph.. (ph=1.5) Bifidobacteria Bifidobacteria 1 g (0.5% yeast extract) (0.05% cysteine.hcl) 200 ml (ph=1.5) 37. 1ml 2.5 % MRS gradient N NaOH ph 6.8 MRS agar 37, colon formed unit Bifidobacteria.. Bifidobacteria Bifidobacteria petri dish 4. sampling 12 Bifidobacteria. 6. Bifidobacteria in vivo. 8 group control group 2. Bifidobacterium bifidum cultures Bifidobacteria gelatin capsule cfu/g, fecal sample, , 7, Bifidobacteria, Lactic acid bacteria, Enterobacteriaceae Staphylococci
53 -Bifidobacteria (g) BL agar 58 Sodium propionate 15 Paromomycin 0.05 Neomycin 0.1 Lithium chloride 3 Water added 1000 ml Bifidobacteria BS medium 37, colony Bifidobacteria colony. -Lactic acid bacteria (g) Lactobacilli MRS broth 55 Agar 15 NaN3 0.2 Water added 1000 ml 121, Lactic acid bacteira MRS agar medium 37, colony. -Enterobacteriaceae EMB agar Water added (g) 27 g 1000 ml Enterobacteriaceae EMB agar medium 37, 48 colony. -Staphylococci (g) Baird-parker agar base 63 Bacto EY Tellurite 50 (ml) Water 950 (ml)
54 Baird-parker agar base 950 ml Bacto EY Tellurite 50ml. 55. Staphylococci Baird-parked agar medium colony.. Bifidobacteria Bifidobacteria (frequency), 1. Table 1. Score and criterion for evaluation of characteristics of stool before, during and after taking Bifidobacteria-loaded microparticles Scores Frequency of stools/day Amount of stools Viscosity of stools 1 irregular highly reduced very soft 2 half reduced soft 3 one normal normal 4 two increase hard 5 three highly increased very hard
55 3 1.Bifidobacteria Air atomization Fig.1. Air atomization Fig.2. Bifidobacteria particle. sodium alginate 1.2% 1.5%, 2%. Bifidobacteria loading sodium alginate. 30ml 200ml sodium alginate 50ml/200ml 10ml/200ml. Sodium alginate 8ml/min 12ml/min. Air pressure atomization device sodium alginate atomization device CaCl2. Air pressure
56 Fig.1. Diagram of air atomization device
57 Fig.2. Surface morphology of Bifidobacteria-loaded microparticles using scanning electron microscope Bifidobacteria sodium alginate 2.0% 1.5%, 1.2%. Peristaltic pump sodium alginate Bifidobacteria atomization device 8ml/min, 12ml/min (50%) 4ml/min.. Bifidobacteria (50%) air pressure. loading
58 Bifidobacteria. Bifidobacteria sodium alginate 1.5%, 8 ml/min, 0.75 bar 7 curing 15. poly-l-lysine 0.02%. slurry Table 2. Table 2. Processing parameters for the preparation of Bifidobacteria-loaded No. Alginate conc. (%) alginate-polylysine microparticles and their size distribution Air pressure (bar) Delivery rate (ml/min) Culture loading (%) Size ( m) 1 1.2% % % % % % % % % The 0.02 % poly-l-lysine was invariably used to cross-link Bifidobacteria-loaded algiante microparticles. 2. Bifidobacteria
59 Bifidobacteria. 1.5g. Bifidobacteria croyprotectant. 5% glycerol 2.5% lactose. yeast extract Bifidobacteria 0.5%. antioxidants. NaHSO3 ascorbic acid. 0.5% NaHSO3. Ascobic acid alginate spraying CaCl2 aggregation. Mg3(PO4)2 neutralizer 1%. Table 3. Formulation for the optimization of survival of Bifidobacteria loaded in alginate poly-l-lysine microparticles during freeze-drying process Cryoprotectant Antioxidant Neutralizer Survival Yeast Culture rate extract Glycerol Lactose NaHSO3 Ascorbic Mg3(PO4)2 acid Log cfu/g F1 0.5 g F2 1.5 g F3 2.5 g F4 1.5 g 0.5 % F5 1.5 g 2.5 % F6 1.5 g - 5 % F6 1.5 g - 10 % F8 1.5 g % F9 1.5 g % F g % F g % F g % F g % F g % F g % Alginate solution (1.5%) was used invariably used. Bifidobacteria Table
60 Table 4. Optimal condition for the survival of Bifidobacteria loaded in alginate poly-l-lysine microparticles during freeze-drying process Alginate Start culture Yeast extract Glycerol NaHSO3 Mg3(PO4)2 H2O 1.5g 0.5 g 0.5g 5.0g 0.5g 1.0g 100 ml Fig Fig.3. Effect of freeze-drying time on the survival of bifidobacteria loaded in alginate poly-l-lysine microparitcles. Bar represents the standard deviation. 3. Bifidobacteria. 1) Polylysine Bifidobacteria
61 Bifidobacteria ph. air-atomization Bifidobacteria alginate-polylysine alginate. Bifidobacteria. Bifidobacteria alginate polylysine Fig.4. Bifidobacteria culture cfu/g 103cfu/g alginate polylysine Bifidobacteria cfu/g cfu/g. alginate ph polylysine. Bifidobacteria 120. Fig.4. Comparison of survival of bifidobacteria loaded in alginate and alginate poly-l-lysine microparticles after 120 min treatment in simulated gastric fluid (without pepsin, ph 1.5). ap<0.01, compared to bifidobacteria culture in simulated gastric fluid; *, the survival was less than 103cfu/g
62 2) ph Bifidobacteria ph bifidobacteria Fig.5. Bifidobacteria ph ph. ph 6.8 ph 1.5. alginate polylysine bifidobacteria ph ph.. Fig.5. Effect of ph on the survival of bifidobacteria loaded in alginate poly-l-lysine microparticles. Bar represents standard deviation. ap<0.05, compared to ph 1.5 and ph ) (ph=1.5) Bifidobacteria Bifidobacteria. Bifidobacteria Fig (108cfu/g) ( ) 107 cfu/g ( ) 107 cfu/g. gastric emptying
63 Bifidobacteria. ph. Fig.6. Survival of bifidobacteria loaded in alginate poly-l-lysine microparticles in simulated gastric fluid (without pepsin, ph 1.5) as a function of time. Bar represents the standard deviation.. Bifidobacteria Bifidobacteria (4 ) Fig.7. Bifidobacteria cfu/g cfu/g cfu/g. 20 ( cfu/g). 20 Bifidobacteria
64 Fig.7. Stability of bifidobacteria-loaded alginate poly-l-lysine microparticles during storage in a refrigerator at 4. Bar represents the standard deviation. 4. Bifidobacteria in vivo. Bifidobacteria Bifidobacteria Fig.8. Bifidobacteria culture Bifidobacteria. Bifidobacteria ( ) 108cfu/g Bifidobacteria 3, , ( 108cfu/g). Bifidobacteria Lactic acid bacteria, Enterobacteriaceae Staphylococci Fig.9, Bifidobacteria Bifidobacteria
65 Fig.8. Changes of bifidobacteria in feces after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles to human subjects. Bar represents the standard deviation. ap<0.05, compared to before study period
66 Fig.9. Changes of lactic acid bacteria in feces after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles to human beings. Bar represents the standard deviation
67 Fig.10. Changes of enterobacteriaceae in feces after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles to human beings. Bar represents the standard deviation
68 Fig.11. Changes of staphylococci in feces after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles to human beings. Bar represents the standard deviation.. Bifidobacteria frequency, Fig.12. Bifidobacteria frequency. Bifido bacteria
69 Fig.12. Effect of bifidobacteria-loaded microparticles on the characteristics of stools. Bifidobacteria Table 5. Table 5. Physical characteristics of stools after oral administration of bifidobacteria-loaded alginate poly-l-lysine microparticles
70 before after stop Frequency A group 1.00± ± ±0.75 B group 0.71± ± ±0.34 Amount A group 2.75± ± ±0.50 B group 3.25± ± ±0.50 Viscosity A group 3.00± ± ±0.58 B group 3.25± ± ±0.00 A group; Bifidobacteria cultures were orally given. B group, Bidobacteria-loaded alginate poly-l-lysine microparticles were orally given
71 4 Bifidobacteria sodium alginate 1.5%, 8 ml/min, 0.75 bar 7 curing m. 0.5 g Start culture, 0.5g Yeast extract, 5.0g Glycerol, 0.5g NaHSO3,1.0g Mg3(PO4)2. slurry Bifidobacteria culture cfu/g Bifidobacteria 107 cfu/g. Bifidobacteria ph. Bifidobacteria cfu/g. Bifidobacteria cfu/g cfu/g. Bifidobacteria Bfidobacteria Bifidobacteria culture Bifidobacteria. Lactic acid bacteria, Enterobacteriaceae Staphylococci. Bifidobacteria frequency. Bifidobacteria
72 5 1. Bodmeier, R., Chen, H. and Paeratakul, O., A novel approach to the oral delivery of micro- or nanoparticles, Pharm. Res., 6(5), (1989) 2. Goh, J. S., Kwon, I. K. and Kim, Y. O., Studies on the growth of Bifidobacterium bifidum ATCC in milk, Kor. J. Dairy Sci., 8(1), (1986) 3. Goh, J. S., Kwon, I. K., Ahn, J. K. and Yoon, Y. H., Fermentation of milk by Bifidobacteria, and improvement of usability of Bifidobacterium bifidum ATCC by lactic acid bacteria for the fermentation of milk, Kor. J. Dairy Sci., 9(4), (1987) 4. Goh, J. S., Kwon, I. K., Ahn, J. K. and Yoon, Y. H., Fermentation of milk by Bifidobacterium bifidum ATCC ; Conversion of milk constituents by fermentation, Kor. J. Anim. Sci., 30(10), (1988) 5. Kim, D. H. and Han, M. J., Inhibition of intestinal bacterial enzymes by lactic acid bacteria,yakhak Hoeji, 39(2), (1995) 6. Kim, H. S., Kamara, B. C., Good, I. C. and Enders, G. L., Method for the preparation of stabile microencapsulated lactic acid bacteria, J. Ind. Microbiol., 3, (1988) 7. Krueter, J. and Liehl, E., Long-term studies microencapsulated and adsorbed influenza vaccine nanoparticles, J. Pharm. Sci., 70(4), (1981) 8. Kwok, K. K., Groves, M. J. and Burgess, D. J., Production of 5-15 diameter anginate-polylysine microcapsules by an air-atomization technique, Pharm. Res., 8(3), (1991) 9. Lee, B.-J. and Min, M.-G., Preparation and release characteristics of polymer-reinforced and coated alginate beads. Arch. Pharm. Res., 18(3), , 1995b. 10. Lim, F. and Moss, R. D., Microencapsulation of living cells and tissues, J. Pharm. Sci., 70(4), (1981) 11. Lin, S. Y., Ayres, J. W., Winkler, W. and Sandine, W. E., Lactobacillus effects on cholesterol ; In vitro and In vivo results, J. Dairy Sci., 72, (1989) 12. Lin, S. Y. and Kao, Y. H., Tablet formulation study of spray-dried sodium diclofenac enteric-coated microcapsules, Pharm. Res., 8(7), (1991)
73 4 Bifidobacteria 1 Bifidobacteria, (Tisser, 1899). Elie Metchnikoff Bifidobacteria (Mechnikoff, 1908), bifidobacteria (Chandan, 1989). microflora (Bullen et al., 1977), mitogenic (Simone et al., 1992), (Duffy et al., 1993 ; Yasui et al., 1996). (Gilliland et al., 1989; Klaver et al., 1990). bifidobacteria (Fernandes et al., 1990). Bifidobacteria macrophage lymphocyte (Hatcher et al.,1993),, spleen Peyer's patch (PP) mitogenic response (Kado-oka et al., 1991) natural killer cell (Igarashi et al., 1990).. Perdigon (1991) bacteria host mucosal immunity. Lactobacillus GG, human Lactobacillus strain, rotavirus IgA response (Kaila et al., 1992). virus mucosal surface dietary lactic acid bacteria.,, (Hanson Brandtzaeg, 1989),, systemic immunity. S-IgA (Holmgren et al., 1992). lympoid organ B cell. PP, mesenteric lymph node (MLN), Lamina propria (LP) (McGhee et al., 1992 ; Russell et al., 1991). PP M cell PP (Owen et al., 1990) B cell
74 IgA B cell. IgA+ B cell B cell MLN, thoracic duct LP homing (Stollman et al., 1989) IgA B cell plasma cell IgA (McGhee et al., 1992 a : Briere et al., 1994 a). IgA secretory component. IgA. IgA class 80. (Kagnoff, 1987). IgA (Lambert et al., 1974). LPS B cell TGF- 1 B cell IgA. TGF- 1 IL-2 Il-5 IgA (Kim Kagnoff et al., 1990)., bifidobacterium bifidobacteira B cell. spleen B cell bifidobacteira ELISA flow cytometry bifidobacteira thymidine uptake. Peyer's patch mesenteric lymph node B cell bifidobacteira in vitro. bifidobacteria TGF-beta1 IL-5. 2 bifidobacteria B cell. 1. Bifidobacteria spleen B cell. in vitro bifidobacteria spleen cell 7 ELISA ELISPOT assay. spleen cell Peyer's patch mesenteric lymph node cell ELISPOT assay. bifidobacteria B cell IgA cytokine IL-5 TGF-beta1 ELISA
75 bifidobacteria. 3 Bifidobacteria., bifidobacterium alginate bifidobacterium 4 BALB/C spleen, MLN, PP. bifidobacterium, bifidobacterium cell spleen, MLN IgA.. T cell macrophage bifidobacteira spleen cell RT-PCR cytokine. B cell polyclonal activator LPS T cell polyclonal activator ConA spleen cell cytokine. bifidobacteria macrophage T cell cytokine. bifidobacteria T cell macrophage
76 2 1. BALB/C Bifidobacterium bifidum Bifidobacterium bifidum MRS. MRS 0.5% L-cystein, HCl 0.1% sodium azide Liquid paraffin 1.5 ml B. bifidum washing. MRS parpffin oil 400g 10. bacteria HBSS cell/well. RPMI Encapsulated bacterial cell counting Bifidobacteria 5 ml 30 ml suspension rpm 5. 2 ml 100 ml tube. tube 0.01 M PBS with 0.1% yeast extract. tube 37 shaker 4. capsule 50 ml tube 1000 rpm.. 4. Bifidobacterium bifidum cell Encapsulated Bifidobacterium bifidum bifidobacterium powder 0.01 M PBS 1 108cells/ml powder 0.1 g 0.01 M PBS 5 ml tip blunted feeding needle. Bifidobacterium bifidum cell ethyl ether retroorbital bleeding
77 .. PBS. 25G needle 2 ml soybean trypsin inhibitor 0.1 /ml lavage solution NaCl 25 nm, NaSO4 40 mm, KCl 10 mm, NaHCO3 20 mm, Polyethylene glycol ; average M.W mm ml EDTA solution 50 mm centrifuge tube. sample PBS 6 ml vortaxing 650 g 10. sample 3 ml 95% ethanol 30 phenylmethylsulfonyl fluoride PMSF, 100 mm 4 14,000 g ml 20 PMSF 20 1% sodium azide ) Spleen cell spleen cell Murray et al. (1987). spleen PBS needle forcep g ammonium chloride solution 5. ammonium chloride solution 5 HBSS suspension. suspension HBSS washing. RPMI FBS. 2) MLN cells MLN PBS needle forcep. suspension 500g 5. HBSS washing RPMI FBS. 3) PP cells PP cell Frangakis et al. (1982). PP PBS. PP RPMI-1640 Dispase 50 ml stirring. supernatant 30 ml 500 g HBSS
78 washing 10 FBS-RPMI ml resuspension, Dispase RPMI Isotype-specific ELISA Goat anti-mouse isotype spesific antibody 1.2 /ml sodium bicarbonate buffer ph well plate coating. 4 overnight 0.5% gelatin 37 1 blocking. PBST 3 well 50 standard protein 0.5% gelatin 37 1 plate 3 horseradish peroxidase-conjugated goat anti-mouse antibody 1.2 /ml PBST 3, 3 2 substrate 2,2-azino-bis 3-ethylbenzhiazolin -6-sulfuric acid nm ELISA reader. 6. ELISPOT assay isotype-specific antibody-secreting cell ELISPOT assay. Anti-mouse isotype-specific antibody 0.05 M sodium bicarbonate buffer 1.2 / nitrocellulose bottomed polystyrene 96-well microplates coating (Costar, Cambridge, MA). 4 overnighat incubation 0.05 Tween-20 PBS (PBST) 1 gelatin solution blocking. PBST RPMI-1640 well PBST 3 Biotin-conjugated gote anti-mouse Ig isotype 0.5 gelatin 1:1000 well incubation. PBST 3 Avidin-peroxidase 1:1000 well incubation. plate PBST AEC (3-amino-9-ethyl carbazole) 15 spot counting. 7. RNA B cell, cells TRIzol (Gibco) 1 lysis chloroform 4, 12, aqueous phase tube 500 isopropyl alcohol 10 4, 12, ( RNA) 75% cold ethanol 7,500 5 DEPC-H2O 50. RNA reverse transcription UV Spectrophotometer A260/A280 RNA purity
79 500ng/ DEPC-H2O. 8. RT-PCR. Reverse Transcription RNA 10 mm Tris, 50 mm KCl, 5 mm MgCl2, 1 mm datp, dctp, dgtp dttp, 20 U RNasin (ribonuclease inhibitor ; Promega), 0.1 oligo (dt)15 (Boehringer Mannheim) 50 U M-MLV reverse transcriptase (BRL) PCR tube RNA reverse transcription heat-inactivation 4.. Primer 1) -actin primer 3' - TGACGGGGTCACCCACACTGTGCCCATCTA 5' - CTAGAAGCACTGCGGTGGACGATGGAGGG 2) TGF- 1 primer 3' - CTGCTCCACCTTGGGCTTGCGACCCAC 5' - CGGGGCGACCTGGGCACCATCCATGAC 3) TNF- primer 3' - TACAGGCTTGTCACTCGAATT 5' - ATGAGCACAGAAAGCATGATC 4) IL-2 primer 3' - CTTATGTGTTGTAAGCAGGAGGTAC 5' - CCTGAGCAGGATGGAGAATTACAG 5) IL-4 primer 3' - GCATGGTGGCTCAGTACTACG 5' - CTTCTTTCTCGAATGTACCAGG 6) IL-5 primer 3' - AGGTAATCCAGGAACTGCCTCGTC 5' - ATGAGCACAGTGGTGAAAGAGACC 7) IL-6 primer 3' - CTGTTAGGAGAGCATTGGAAATTG 5' - GAACGATAGTCAATTCCAGAAACC 8) IL-10 primer 3' - TCATTCATGGCCTTGTAGACAC 5' - AGCTGGACAACATACTGCTAACC 9) IL-12 primer
80 3' - TGGAGCACTCCCCATTCCATT 5' - AGAGGTGGACTGGACTCCCGA 10) IFN- primer 3' - GGCTGGATTCCGGCAACA 5' - CGCTACACACTGCATCTTGG. Polymerase Chain Reaction RT cdna products PCR buffer (10 mm Tris, 50 mm KCl, 2 mm MgCl2, 200 um datp, dctp, dgtp dttp) specific 5' 3 primer 25 pmol PCR. PCR temperature profile 95 1 denaturation, 55 1 annealing, 72 1 extension 35 cycle. PCR products 2% agarose gel. 9. Flow cytometry 500 g dimethyl sulfoxide in sucrose-citrate buffer (Becton Dickinson, San Jose, CA, USA) % BSA 0.1% sodium azide PBS 2, 200 PBS FITC goat anti-iga (Becton Dickinson, San Jose, CA, USA) 25 / % BSA 0.1% sodium azide PBS 2 4, FACScan (Becton Dickinson, Mountain View, CA, USA) IgA. 10. (retroorbital bleeding). ether. heparin. 4 overnight 100 g 3 microtube B. bifidum C. perfringens 96 well plate spleen cell (5 105 cells/well) Ci/ 3[H thymidine. cell harvester (Inotech IH-110, Switzerland), liquid scintillation counter (Wallac 1410, Pharmacia, Finland)
81 3 1. B. bifidum C. perfringens.. colony counting direct counting. Table 1 direct counting colony counting. direct counting. 2. in vitro Bifidobacteria B cell. B. bifidum spleen B cell B. bifidum spleen B cell. B. bifidum. BALB/C mouse spleen whole cell cells/ 96-well culture plate seeding, 5 103, 5 104, 5 105, 5 106, cells/ bifidobacteria LPS (12.5 / ) 37, 5% CO2incubator. 7 ELISA., cells/ bifidobacteria IgA, IgM, IgG1 isotype (Fig.1). LPS cells/ bifidobacteria LPS (Fig.2). bifidobacteria B cell. negative control Clostridium perfringens ( ) bifidobacteria Table 1. Comparison of bacterial viability between colony and direct counting method
82 B. bifidum C. perfring ens Method Dilution factor No. of cells Colony counting (CFU/ ) Direct count ing (cells / ) Colony counting method: B. bifidum and C. perfringens were serially diluted in culture media. Cell suspension was poured into MRS agar plates and covered with melted agar media. After mixing of bacterial cell suspension, it was transferred to anaerobic jar. The anaerobic jar was vaccumed and incubated at 37. Colonies were counted after 3 days of incubation. The data are the means of average number of duplicate samples. Direct counting method: Bacterium was washed with 0.01 M PBS and serially diluted in culture media. 5 of bacterial cell suspension was transferred on Petroff-Hausser bacteria counter and covered with cover glass. Then, cells were counted using inverted microscope. The data are the means of average number of duplicate samples. A B
83 C Fig. 1. Effect of B. bifidum on the secretion of Igs by murine whole spleen cells in the presence of LPS. Whole spleen cells were cultured with B. bifidum or C. perfringens (none, 1 103, 1 104, 1 105, 1 106, 1 107) in 96-well plates. LPS (12.5 / ) was added to culture on day 0. After 7 days of culture, supernatants were obtained and antibody response was measured by ELISA. Data are means of triplicate samples. Vertical bars represent SEM. C. perfringens ( ); B. bifidum ( ). A B C
84 Fig.2. B. bifidum alone stimulates whole spleen cells to secrete Igs. whole spleen cells were cultured as described in Figure 1 without LPS. Data are the means of triplicate samples. Vertical bars represent SEM. C. perfringens ( ); B. bifidum ( ). (Fig. 1, 2). B. bifidum B cell polyclonal activator LPS mitogen.. Fig.3, BB control C. perfringens B cell. B. bifidum B cell.. Bifidobacteria spleen whole cell 5, 1 106cells/ seeding ELISPOT., bifidobacteria IgA isotype 3. B. bifidum.. B. bifidum B cell cytokine TGF- 1 in vitro IgA class switch IgA (Kim and Kagnoff, 1990). IL-5 B cell cytokine. Bifidobacteria B cell TGF- 1 IL-5 B cell. spleen cell (5 105cell/well) media, B. bifidum, TGF- 1+IL-5, B+T+5 7, ELISA Ig. IgA IgG2b B. bifidum B+T+5 (Fig.5). IgM, IgG2a, IgG1 (Fig.6). B. bifidum LPS polyclonal activator. B cell surface IgA, IgA BB B cell TGF- 1 IL-5 (Fig.7)
85 A B Fig.3. B. bifidum enhances the proliferation of whole spleen cells. whole spleen cells were cultured with B. bifidum at a density of cells/well with or without LPS (12.5 / ) in 96-well culture plates and incubated for 4 days. Wells were pulsed for 18 h with 5 Ci/ of 3[H thymidine. Cells were harvested and filtered through glass fiber filters and counted in a liquid scintillation counter. A) In the presence of LPS. B) In the absence of LPS
86 Fig.4. B. bifidum increases number of IgA secreting cells. Spleen B cells (5 105 cells/well) were incubated with B. bifidum (1 107 cells/well) for 5 days. Number of IgA secreting cells were enumerated by ELISPOT assay as described in Materials and Methods. Data are means of duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars respresent SEM. A B
87 Fig.5. B. bifidum induces B cells to responsive to TGF- 1 and IL-5 resulting in increase of IgA and IgG2b synthesis. Spleen B cells (5 105cells/well) were cultured with B. bifidum (1 107 bacteria/well). Cells were stimulated with TGF- 1 (0.2 ng/ ) or IL-5 (0.5 ng/ ) on day 0. After 7 days of culture, supernatants were obtained and antibody response was measured by ELISA. Data are means of duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars represent SEM. B, B. bifidum; T, TGF- 1; 5, IL
88 Fig.6. Effect of B. bifidum on the synthesis of IgM, IgG1 and IgG2a by spleen B cells in the presence of TGF- 1 and IL-5. Culture conditions were the same as described in Fig. 5. Data are means of duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars represent SEM. B, Bifidobacterium bifidum; T, TGF- 1; 5, IL
89 Fig.7. Effect of B. bifidum on the expression of surface IgA by murine spleen B cells in the presence of TGF- 1 and IL-5. Culture conditions were the same as described in Figure 5. Cells were harvested after 4 days of culture and analyzed by FACS following staining with FITC-conjugated anti-mouse IgA antibody. T, TGF- 1; 5, IL
90 3. B cell B. bifidum. Mesenteric Lymph Node (MLN) B cell B. bifidum spleen B cell Ig. B. bifidum. MLN B cell. spleen B cell IgA IgM. IgG1 (Fig.8). B. bifidum surface IgA LPS (Fig.9). TGF- 1 IL-5 spleen B cell IgA, IgM IgG1 (Fig.10). B. bifidum B cell IgA.. Peyer's Patch (PP) B cell B. bifidum PP B cell IgA. C. perfringens. BB IgM IgG1 (Fig.11). MLN B cell, spleen B cell. B cell. spleen B cell B. bifidum PP B cell TGF- 1 IL-5 IgA (Fig.12).. PP B cell IgA TGF- 1 IgA isotype switching
91 Fig. 8. B. b i f i d u m stimulated murine MLN B cells to secrete IgA and IgM antibody. MLN cells (5 105 cells/well) were cultured with bacteria/well of B. bifidum or C. perfringens in a 96-well culture plate on day 0. Supernatants were harvested after 7 days of culture and Ig secretion was measured by ELISA. Data are the means duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars represent SEM
92 Fig.9. Bifidobacterium increased siga expression by murine MLN B cells. MLN cells were cultured with LPS (12.5 / ) or B. bifidum (1 107bacteria/well) at 5 105cells/well in a 96-well culture plate on day 0. After 4 days of culture, cells were harvested and analyzed with FITC-conjugated anti-mouse IgA antibody using FACS
93 Fig.10. Effect of TGF- 1 and IL-5 on Ig synthesis of murine MLN B cells by bifidobacterium. MLN cells were cultured with B. bifidum or C. perfringens (1 107bacteria/well) and/or TGF- 1 (0.2 ng/ ) and IL-5 (0.5 ng/ ) at per well in a 96-well culture plate on day 0. Supernatant were harvested after 7 days of culture and Ig secretion was measured by ELISA. Triplicate wells were pooled and the data are means of duplicate samples. B, B. bifidum; C, C. perfringens; T, TGF- 1; 5, IL-5. Vertical bars represent SEM
94 Fig.11. B. bifidum stimulated murine PP B cells to secrete IgA antibody. Culture conditions were the same as described in Fig.8. Supernatants were harvested after 7 days of culture. IgA, IgM, and IgG1 were assayed by ELISA. Data are the means of duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars represent SEM
95 F i g Effect of TGF- 1 and IL-5 on Ig synthesis of murine PP B cells by bifidobacterium. Culture conditions were the same as described in Fig.10. Supernatants were harvested after 7 days of culture. IgA, IgM, and IgG2b were assayed by ELISA. Data are the means duplicate samples. Each sample contains 2-fold diluted wells (n=3). Vertical bars represent SEM. 4. B. bifidum. B. bifidum B. bifidum B. bifidum. B. bifidum. B. bifidum C. Perfringens BB ELISA. B.bifidum BB control C. Perfrigens (Fig.13) (Fig.14). B. bifidum adjuvant.. B. bifidum spleen, MLN, PP
96 Bifidobacteria. ELISPOT assay (Fig.15). spleen B. bifidum, MLN IgA. PP B. bifidum IgG1, IgM control C. Perfringens. B. bifidum PP MLN B cell IgA, IgA. 5. Bifidobacteria B cell IgA B. bifidum B. bifidum B. bifidum. BALB/c spleen cell LPS 7. ELISA Fig.13. Effect of peroral administration of B. bifidum o n antigen-specifi c antibody responses in intestinal lavages. B. bifidum or C. perfringens (1010 cells/mouse) was administered every other day for 4 weeks. Lavages was collected as described in materials and Methods. Antigen-specific antibody responses was measured by ELISA
97 Fig.14. Effect of peroral administration of B. bifidum on antigen-specific antibody responses in the sera. B. bifidum or C. perfringens (1010cells/mouse) was administered every other day for 4 weeks. Sera was collected as described in materials and Methods. Antigen-specific antibody responses was measured by ELISA
98 Fig.15. Effect of peroral administration of B. bifidum on number of antigen non-specific Ig secreting cells. B. bifidum or C. perfringens (1010 cells/mouse) was administered every other day for 4 weeks. Number of antigen-specific antibody secreting cells was enumerated by ELISPOT assay. (Fig.16). LPS. LPS 2 5 B. bifidum cell IgA IgM. B. bifidum. 6. Bifidobacteria bacteria alginate B.bifidum B.bifidum (1 108 cells/day). 4 ELASA (Fig.17). B.bifidum B.bifidum cell, (non-feeding) IgA 2.5, 5. IgA B. bifidum IgA, control 3. B. bifidum IgA
99 B. bifidum. ELISPOT A- 1 assay (Fig.18). A- 2 MLN B cell, IgA B. bifidum B. bifidum cell B. bifidum 7. MLN B cell IgG B. bifidum B.bifidum cell,. Spleen B cell IgA B- 1 B- 2 B. bifidum B. bifidum cell, 9, 3, IgG 4.3, 3.4. B. bifidum IgA. C- 1 C- 2 D- 1 D- 2 Fig.16. Effect of bifidobacterial cells or its culture supernatants on IgA and IgM synthesis by murine spleen B cells. B cells were cultured with bifidobacterial cells (A and B panel) or its culture supernatants (C and D panel) in the presence of LPS and absence of LPS. Antigen non-specific antibody responses was measured by ELISA. D represents the incubation date of bacterial culture
100 Fig.17. Effect of peroal administration of B. bifidum on antigen-nonspecific antibody response in intestinal lavage and the sera. Male and female BALB/C mice were administered perorally with bifidobacterium cell (1 108 cells/ml) for 4 weeks for every other day. After 4 weeks, intestinal fluid and serum were obtained from mouse and antibody response was measured by ELISA assay. Fig.18. Effect of peroral administration of Encapsulated B. bifidum on the mouse
101 number of a n t i g e n nonspecific Ig s e c r e t i n g cells. MLN and Spleen were i s o l a t e d f o l l o w i n g p e r o r a l administration cells per well were incubated in a nitrocellulose-bottomed 96 well plate for 4h and IgA secreting cell and IgG secreting cell number were determined by ELISPOT assay as described in Material and Methods. Data are the means duplicate samples. Each sample contains 2-fold diluted wells
102 7. Bifidobacteria cytokine. Bifidobacteria cytokine cytokine Bifidobacteria mrna B cell T cell A macrophage cytokine. Bifidobacteria Peyer's patch (PP) mesenteric lymph node (MLN) mrna RT-PCR. mrna control -actin RT-PCR. Fig.19 mrna.. TGF- 1 mrna. PP Bifidobacteria TGF- 1 mrna. MLN. MLN IgA Fig. 18. TGF- 1 IgA cytokine. Bifidobacteria, IgA.. B. bifidum spleen cell cytokine B. bifidum cytokine. T helper cell IL-2, IFN-, IL-4, IL-5, IL-6, macrophage IL-1, IL-10, IL-12. cytokine B. bifidum BB. B. bifidum B cell polyclonal activator LPS, T cell polyclonal activator Con A. IL-2 mrna B. bifidum (Fig.20)
103 A. IL- 2/IL- 4 B. IL- 5/IL- 6 C. IL- 10/IL- 12 D. IFN- r B Fig.19. Detection of TGF- 1 mrna by RT-PCR. Appropriate samples were prepared from mice administered with Bifidobacterium alone or encapsulated Bifodobacterium. A) mrna level of TGF- 1. B) mrna level of -actin. Lane 1; conrol (PP), Lane 2; Bifidobacterium alone (PP), Lane 3; encapsulated Bifodobacterium (PP), Lane 4; conrol (MLN), Lane 5; Bifidobacterium alone (MLN), Lane 6; encapsulated Bifodobacterium (MLN)
104 Fig.20. Detection of mrna of various cytokines by RT-PCR. Mouse spleen cells (2 106 cells/well) were stimulated with LPS, ConA or B. bifidum for 2 days. Lane 1, spleen cells only; Lane 2, spleen cells + LPS; Lane 3, spleen cells + ConA; Lane 4, spleen cells+ B. bifidum. IL-10 LPS mrna. IFN- IL-12 B. bifidum. B. bifidum T helper cell macrophage cytokine. cytokine
105 4 B. bifidum. B. bifidum. B. bifidum. B. bifidum spleen B cell. B cell cytokine (TGF- 1 IL-5) IgA. B cell polyclonal activator LPS. B. bifidum mesenteric lymph node (MLN) B cell IgA. B. bifidum spleen B cell Peyer's patch (PP) B cell MLN IgA. B. bifidum PP MLN B cell IgA, IgA. B. bifidum B. bifidum. B. bifidum B. bifidum. B. bifidum MLN cell TGF- 1 mrna. TGF- 1 IgA, Bifidobacteria, IgA
106 5 1. Andre, C., Lambert, R., Bazin, H., and Heremans, J.F Interference of oral immunization with the intestinal absoption of heterologous albumin. Eur. J. Immunol. 4: Beagley, K.W., Eldridge, J.H., Kiyono, H., Everson, M.P., Koopman, W.J., Honjo, T., and McGhee, J.R Recombinant murine IL-5 induces high rate IgA synthesis in cycling IgA-positive Peyer's patch B cells. J. Immunol. 141: Brandtzaeg, P., Sollid, L.M., Thrane, P.S., Kvale, D., Bjerke, K., Scott, H., Kett, K., and Rognum, T.O Lymphoepithelial interactions in the mucosal immune system. Gut. 29: Bullen, C.L., P.C. Terle, M.G. Srewart The effect of humanized milks and supplemented breast feeding on the fecal flora of infants. Br. Med. J. 16, Chabarri, F.J., M. De Paz, and M. Nunez Cryptotective agents for frozen concentrated starters from non-bitter Streptococcus lactis strains. Biotechnol. Lett. 10, Chandan, R.C Yogurt : Nutritional and Health properties, ed. National Yogurt Association, McLean, Virginia. 7. Coffman, R.L., Lebman, D.A., and Shrader, B Transforming growth factor- specifically enhances IgA production by lipopolysaccharide stimulated murine B lymphocytes. J. Exp Med. 170: Craig, S.W., and Cebra, J.J Peyer's patches: An enriched source of precursors of IgA-producing immunocytes in the rab. bifidumit. J. Exp Med. 134: Czerkinsky, C.C., Nilsson, L., Nygren, H., Ouchterlony, O., and Tarkousky, A A solid-phase enzyme-linked immunospot (ELISPOT) assay for enumeration of specific antibody secreting cells. J. Immunol Methods. 65: De Aizpurua, H.J., and Russel-Jones, G.J Identification of Classes of Proteins that Provoke an Immune Response upon Oral Feeding. J. Exp Med. 167: De Simone, R., R. Vesely, B. Negri, B.S. Salvadori, A. Zanzoglu, Cilli, and L. Lucci Immunopharmacol. Immunotoxicol. 9, Duffy, L.C., M.A. Zielezny, T.M. Riepenhoff, D. Dryja, A.S. Sayahtaheri, E. Griffiths, D. Ruffin, H. Barrett, J. Rossman, and P.L. Ogra Effectiveness of B. bifidium in experimentally induced MRV infection: dietary implications in formulars for newborns. Endocrine Regulations. 27, Fernandes, C.F., Shahani, K.M J. Food. Prot. 53:
107 14. Gilliland, S.E Acidophilus Milk Products: A Review of Potential Benefits to Consumers. J. Dairy Sci. 72: Harriman, G.R., Kumimoto, D.Y., Elliott, J.F., Paetkau, V., and Strober, W The role of IL-5 in IgA B cell differentiation. J. Immunol. 140: Kagnoff, M.F In physiology of the Gastrointestinal Track, and 2nd Ed. pp Raven, New York. 17. Kehrl, J., Roberts, H.A.B., Wakefield, L.M., Jakowlew, S., Sporn, M.B., and Fauci, A.S Transforming growth factor is an important immunomodulatory protein for human B lymphocytes. J. Immunol. 137: Kehrl, J.H., Wakefield, L.M., Roberts, A.B., Jakowlew, S., Alvarez-Mon, M., Derynck, R., Sporn, M.B., and Fauci, A.S Production of transforming growth factor by human T lymphocytes and its potential role in the regulation of T cell growth. J. Exp. Med. 163: Kim, P.H., and Kagnoff, M.F Transforming growth factor- 1 is a costimulator for IgA production. J. Immunol. 144(9): Klaver, F.A.M., and van der Meer, R Appl. Environ Microbiol. 59: Lebman, D.A., Lee, F.K., and Coffman, R.L The effects of IL-4 and IL-5 on the IgA response by murine Peyer's patch B cell subpopulations. J. Immunol. 141: Lebman, D.A., Nomura, D.Y., Coffman, R.L., and Lee, F.D Molecular characterization of germ-line immunoglobulin A transcripts produced during transforming growth factor -induced isotype switching. Proc. Natl. Acad. Sci. USA. 87: Matsuoka, M., Yoshida, K., Usuda, S., and Sakano, H Switch circular DNA formed in cytokine-treated mouse splenocytes: evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell. 62: McIntyre, T.M., Klinman, D.R., Rothman, P., Lugo, M., Dasch, J.R., Mond, J.J., and Snapper, C.M J. Exp Med. 177: Murray, P.D., McKenzie, D.T., Swain, S.L., and Kagnoff, M.F Interleukin 5 and interleukin 4 produced by Peyer's patch T cells selectively enhance immunoglobulin A expression. J. Immunol. 139: Nagaoka, M., S. Hashimoto, T. Watanabe, T. Yokokura, and Y. Mori Anti-ulcer effects of lactic acid bacteria and their cell wall polysaccharides. Biol. Pharm. Bull. 17, Ogra, P.L., Mestecky, J., Lamm, M.E., Strober, W., McGhee, J.R., and Bienenstock, J Handbook of Mucosal Immunology. ed. pp , Academic Press, Inc. 28. Owen, R.L., and Ermak, T.H Structural specialization for antigen uptake and processing in the digestive track. Spring Semin. Immunopathol. 12: Pestka, J.J Food, diet and gastrointestinal immune fuction. In (Kinsella, J. ed. Advances in Food and Nutrition Research. Academic Press (in press)) 30. Roberts, A.B., Sporn, M.B., Assoian, R.K., Smith, J.M., Roche, N.S., Wakefield,
108 L.M., Heine, U.I., Liotta, L.A., Falanga, V., Kehrl, J.H., and Fauci, A.S Transforming growth factor type : rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc Natl Acad Sci. USA. 83: Sasaki, T., S. Fukami, and S. Namioka Enhancement of cytotoxic activity of lymphocytes in Mice by oral administration of peptidoglycan (PG) derived from Bifidobacterium thermophilus. J. Vet. Med. Sci. 56, Sekine, K., Ohta, J., Onishi, M., Tatsuki, T., Shimokawa, Y., Toida, T., Kawashima, T., and Hashimoto, Y Analysis of Antitumor Properties of Effector Cells Stimulated with a Cell Wall Preparation (WPG) of Bifidobacterium infantis. Biol. Pharm. Bull. 18(1): Sonoda, E., Matsumoto, R., Hitoshi, Y., Ishii, T., Sugimoto, M., Araki, S., Tominaga, A., Yamaguchi, N., and Takatsu, K Transforming growth factor induces IgA production and acts additively with interleukin 5 for IgA production. J. Exp Med. 170: Stokes, C.R., Newby, T.J., Huntley, D.P., and Bourne, F.J The Immune response of mice to bacterial antigens given by mouth. Immunology. 38: Stokes, C.R., Soothill, J.F., and Turner, M.W Immune exclusion is a function of IgA. Nature (London) 255: Tahri K., Grill J.P., and Schneder, F Bifidobacteria strain behavior toward cholesterol: coprecipitation with bile salts and assimilation. Curr Microbiol. 33(3): Takahashi, T., Oka, T., Iwana, H., Kuwata, T., and Yamamoto, Y Immune Response of Mice to Orally Administered Lactic Acid Bacteria. Biosci. Biotech. Biochem. 57(9): Tissier a reaction chromophile d Echerich et le Bacteriym Coli. C. R. Soc Biol. 51, Tsunawaki, S., Sporn, M., Ding, A., and Nathan, C Deactivation of macrophages by transforming growth factor-. Nature (Lond.). 334: Yasui, H., and Ohwaki, M Enhancement of Immune Response in Peyer's patch Cells Cultured with Bifidobacterium breve. J. Dairy Sci. 74: Yasui, H., Nagadka, N., Hayakawa, K. 1996, Augmentation of anti-influenza virus hemagglutinin antibody production by Peyer's patch cells with Bifidobacterium breve YIT Clin Diagn Lab Immunol. 1(2):
109 5 Bifidobacteria 1 Bifidobacteria 1. Bifidobacteria (Robin and Tamine, 1990; Fuller, 1992). bifidobacteria.,,,,,. fingerprinting. Bifidobacteria bifidobacteria (Biviati, 1982; Roy Ward, 1990). DNA/DNA hybridization(scardovi, 1971) (Biviati, 1982; Roy, 1994). DNA probe primer dot blot polymerase chain reaction(pcr) (Chareris, 1997). Yamamoto (1992) 16S rrna B. adolescentis, B. bifidum, B. breve, B. infantis, B. longum DNA probe. Bifidobacterium genus 16S rrna probe (Frothingham, 1993; Langendijk, 1995).,, phage, -. sodium dodecyl sulfate-polyacrylamide gel electrophoresis(sds-page) polypeptide (Pot, 1993; Tsakalidou, 1992). genome DNA
110 (, 1995), SmaI DNA genome DNA pulsed field gel electrophoresis DNA band (Roy, 1996; Tanskanen, 1990). Random primer polymerase chain reaction DNA band random amplified polymorphic DNA(RAPD) (Cancilla, 1992;, 1994;, 1997). 16S rrna 23S rrna probe restricton fragment length polymorphism(rflp) ribotyping M13 probe RFLP (Mangin, 1994;, 1997), bifidobacteria ribotyping PCR 16S rdna, SDS-PAGE RAPD. 2.. Bifidobacteria (KCTC) American Type Culture Collection(ATCC) 15 2 (Table 1). 5 bifidobacteria Bb-11, Bb-12L, Bb-12S, ABT-4, ABT-B, SJ Bifidobacteria. Table 1. Type strains of bifidobacteria used in the study
111 Species Strain Synonym Source B. adolescentis KCTC 3216 ATCC Intestine of adult B. adolescentis KCTC 3352 ATCC Intestine of adult B. adolescentis KCTC 3416 ATCC Intestine of adult B. bifidum KCTC 3202 ATCC Stool of breast-fed infant B. bifidum KCTC 3357 ATCC Human feces B. bifidum KCTC 3418 ATCC Intestine of infant B. bifidum KCTC 3476 ATCC Lactobacillus bifidus subsp. pensylvancum B. breve KCTC 3220 ATCC Intestine of infant B.breve KCTC 3419 ATCC Intestine of infant B. breve KCTC 3461 ATCC Intestine of infant B. infantis KCTC 3127 ATCC Intestine of infant B. infantis KCTC 3249 ATCC Intestine of infant B. infantis KCTC 3270 ATCC Intestine of infant B. infantis KCTC 3368 ATCC Intestine of infant B. infantis KCTC 3460 ATCC Intestine of infant B. longum KCTC 3466 DSM Calf feces B. longum ATCC Intestine of adult B. longum ATCC Intestine of infant. Bifidobaceria bifidobacteria Lactobacilli MRS agar(difco) NPNL(nalidixic acid, 15 / ; paromomycin sulphate, 125 / ; neomycin sulphate 10 / ; lithium chloride 300 / ). bifidobacteria BSI agar Beeren's agar. colony Y, V colony TPY agar(biviati, 1991) colony.. Bifidobacteria Bifidobacteria TPY broth anaerobic catalyst(difco) anaerobic jar(difco) 90% H2 10% CO2 anaerobic indicator strip(difco) % glycerol DNA Bifidobacteira Versalovic (1991) genomic DNA. TPY broth 24 7,000rpm
112 bifidobacteria. 1 1M NaCl 50mM TE (50mM Tris, 50mM EDTA, ph 7.8) mM TE (10mM Tris, 1mM EDTA, ph 7.8) 25 mutanolysin(5,000 unit/ 10mM TE ) 25 RNase A(6mg/ml 10mM Tris, 15mM NaCl, ph 7.8) SDS(10%) 30 proteinase K (10mg/ml, 10mM TE ) Phenol(0.4 ) 1. phenol chloroform(0.4 ) 2. 10mM TE M sodium acetate(ph 5.2) 0.8 ethanol DNA 70% ethanol 10mM TE. DNA RNase A proteinase K SDS phenol chloroform 3M sodium acetate(ph 5.2) ethanol DNA.. PCR bifidobacteria 16S rdna probe PCR 20 PCR PCR PreMix(50mM Tris-HCl; ph 8.3, 10mM KCl, 1.5mM MgCl2, 250 M dntp, 1U Taq polymerase) (Bioneer) 2 primer( 25 M), 1 bifidobacteria DNA(20ng), 17 H2O PCR. Perkin-Elmer thermal cycler 94 1, 60 1, 72 2, 30cycles. primer bifidobacteria 16S rrna 9bp 31bp 5'-GGTTCGATTCTGGCTCAGGATG-3' oligonucleotide primer 1351bp 1372bp 5'-TACAAGGCCCGGGAACGCATTC-3' oligonucleotide (Leblond-Bourget, 1996). PCR DNA 1364bp. Digoxigenin labeling 16S rdna probe 200 M dttp 130 M dttp 70 M digoxigenin-11-dutp(boehringer Mannaheim).. Southern blot EcoRI 20 1 bifidobacteria DNA, 10unit EcoRI (Promega), 2 10 reaction buffer % agarose gel 1 TAE (40mM Tris-acetate, 1mM EDTA) 30V 24. DNA marker HindIII/EcoRI(Promega). agarose gel depurination, denaturation, neutralization (Sambrook, 1989). gel positively-charged nylon membrane(boehringer Mannaheim) (Hoeffer) blotting UV crosslinker(uvp) DNA nylon membrane. Nylon
113 membrane DNA digoxigenin-labeled 16S rdna probe hybridization prehybridization (50% formamide, 5 SSC, 0.1% N-lauroylsarcosine, 0.02% SDS, 2% blocking reagent(boehringer Mannaheim) 42 2 prehybridization 200 digoxigenin-labeled 16S rdna hybridization. 0.1% SDS 2 SSC nylon membrane DIG luminescent detection kit(boehringer Mannheim) X-ray film(agfa Curix RP-1).. PCR 16S rdna PCR 20 PCR PCR PreMix(50mM Tris-HCl; ph8.3, 10mM KCl, 1.5m M MgCl2, 250 M dntp, 1U Taq polymerase; Bioneer) 2 forward primer(5'-10-g GTTCGATTCTGGCTCAGGATG-31-3')(25 M) reverse primer (5'-1376-TACAAGGCCCGGGAACGCATTC ')(25 M), 1 Template DNA(20ng), 17 H2O PCR. Perkin-Elmer thermal cycler 94 1, 60 1, 72 2, 30cycles. PCR 16S rdna RsaI, HhaI, AluI, HaeIII, MboI, DdeI. PCR 2.5% agarose gel (Nusieve : agarose = 3 : 1) 1 TAE buffer. DNA 0.5 ethidium bromide.. RAPD OPB-07(Operon) random primer PCR DNA agarose gel. PCR 20 PCR PCR PreMix(50mM Tris-HCl; ph 8.3, 10mM KCl, 1.5mM MgCl2, 250 M dntp, 1U Taq polymerase) (Bioneer) mM MgCl2(1.5mM), 1 OPB-07 primer(l M)(Operon), 1 Template DNA(20ng) 16.5 H2O PCR. Perkin-Elmer thermal cycler cycles. 1.5% agarose gel, 0.5 TBE buffer, 70V 4. DNA ethidium bromide.. SDS-PAGE Glucose lactose TPY broth bifidobacteri a Vibra Cell-VCX 600(Sonics and Materials Inc.) 37% amplitude 5 5 cycle 30 sonication. Sonication. SDS-PAGE sample buffer % polyacrylamide gel s
114 eparating gel. silver staining(pharmac ia). bovine serum albumin(66,000), egg albumin(45,000), glyceraldehyde-3-phosphate dehydrogenase(36,000), carbonic anhydrase(29,000), tryps in inhibitor(20,100) -lactalbumin(14,200) ( ). 3.. Ribotyping bifidobacteria Bifidobacterium 16S rrna 1364bp digoxigenin-labeled probe PCR ribotyping. EcoRI bifidobacteria genomic DNA agarose nylone membrane blot DNA digoxigenin-labeled 16S rdna probe hybridize nucleotide band pattern (Fig. 1;Table 2). Fig Chemiluminescence detection of EcoRI-digested DNA from Bifidobacterium strains
115 hybridized with digoxigenin-labeled 16S ribosomal DNA probe amplified in PCR. A, B. bifidum KCTC 3418; B, B, bifidum KCTC 3357; C, B. bifidum KCTC 3476; D, B. longum KCTC 3466; E. B. adolescentis KCTC 3416; F, B. adolescentis KCTC 3216; G, B. adolescentis KCTC 3352; H, B. breve KCTC 3461; I, B. breve KCTC 3220; J, B. infantis KCTC 3270; K. B. infantis KCTC 3460; L. B. infantis KCTC 3368; M. B. infantis KCTC 3127; N, Bifidobacterium spp. Bb-11; O, Bifidobacterium spp. Bb-12L; P, Bifidobacterium spp. Bb-12S. The numbers at left indicate the base pair of the nucleotides in HindIII/EcoRI marker. Table 2. The nucleotides detected by hybridization of EcoRI-digested DNA from Bifidobacterium strains probed with digoxigenin-labeled 16S ribosomal DNA amplified with PCR. Species Strain Length of nucleotide (base pair) B. adolescentis KCTC ,500 6,600 3,700 2,900 1,250 KCTC ,500 6,600 3,700 2,900 KCTC ,600 5, ,700 2,900 B. bifidum KCTC ,700 5,600 3,900 3,700 KCTC ,700 4,000 3,700 KCTC ,600 3,900 3,700 B. breve KCTC ,200 3,700 3,200 2,200 KCTC ,200 3,700 3,200 2,200 B. infantis KCTC ,200 3,700 2,400 1,800 1,250 KCTC ,200 3,700 3,100 2,400 1,250 KCTC ,200 3,700 3,100 2,400 1,250 KCTC ,200 3,700 3,100 2,400 1,250 B. longum KCTC ,100 3,700 3,500 3,400 1, Bifidobacterium Bb-11 9,700 6,600 3,900 3,700 sp. Bb-12L 9,700 6,600 3,900 3,700 Bb-12S 5,200 3,700 3,200 2,200 1,600 1,450 Bifidobacterium band 3,700bp B. adolescentis band 6,600bp 2,900bp B. bifidum 3 band 9,700bp B. breve band 4,200bp, 3,700bp 2,200bp
116 B. infantis band 4,200bp, 2,400bp, 1,250bp. B. infantis B. longum 4,200bp band. B. longum KCTC 3466 band 3,700bp band band. Bb-11 Bb-12L B. bifidum KCTC 3418 B. bifidum KCTC 3357 band B. bifidum. Bb-12S Bifidobacterium 3,700bp band band. B. bifidum KCTC 3357 genomic DNA template DNA 16S rdna PCR digoxigenin-labeled probe ribotyping. probe Bifidobacterium 16S rrna. Bifidobacterium genus band band. Ribotyping probe.. PCR 16S rdna bifidobacteria PCR primer 16S rdna DNA 1367bp DNA 1400bp. bifidobacteria DNA (Fig. 2). PCR 16S rdna AluI, HaeIII, HhaI, MboI RsaI DNA (bp) (Fig. 2). HaeIII MboI 6 bifidobacteria. HaeIII A, B, C, D E F. MboI. MboI D 380bp, 190bp, 100 bp DNA 1400bp. 1400bp 100bp DNA DNA. bifidobacteria (Table 3, 4). Bifidobacteria. B. adolescentis AluI MboI A B. bifidum HaeIII HhaI C, B. breve AluI D MboI C D, B. infantis MboI E F. HaeIII MboI A B
117
118
119 Fig.2. Restriction pattern of PCR-amplified 16S rdna of bifidobacteria M : pgem marker, A, B, C, D, E, and F : Restrction pattern (Table 3) Table 3. DNA fragment size and restriction pattern of PCR-amplified 16s rdna digested with restriction endonuclease
120 Restriction Endonuclease DNA fragment size (bp) Restriction pattern AluI A B C D HaeIII A B C D E F HhaI A B C D MboI A B C D E F RsaI A B Table 4. Classification of restriction pattern of PCR-amplified 16S rdna from the type culture of Bifidobacterium
121 Strains AluI HaeIII HhaI MboI RsaI B. adolescentis KCTC 3216 A A A A A B. adolescentis KCTC 3352 A B B A A B. adolescentis KCTC 3416 A B A A A B. bifidum KCTC 3202 B C C B A B. bifidum KCTC 3357 B C C B A B. bifidum KCTC 3418 C C C B A B. bifidum KCTC 3476 C C C B A B. breve KCTC 3220 D A A C A B. breve KCTC 3416 D A D D A B. breve KCTC 3419 D A A C A B. infantis KCTC 3127 C D A E A B. infantis KCTC 3249 C A A F B B. infantis KCTC 3270 C A A F B B. infantis KCTC 3368 C A A F B B. infantis KCTC 3460 C A A F B B. longum KCTC 3466 C A A B B B. longum ATCC C A A B B B. longum ATCC C A A B B (Table 5) (Table 6). Bifidobacterium Bb-11 Bb-12L B. bifidum B. bifidum Bifidobacterium Bb-12S, ABT4, ABTB, SJ-1 5. BSI agar K-2, K-4, K-5, K-7 K-10 Beeren's agar K-C B. bifidum Beeren's agar K-A, K-B, K-E, K-H, K-J B. adolescentis. K-3, K-C, K-I. PCR 16S rdna bifidobacteria 16S rdna
122 . Table 5. Identification of commercial culture of Bifidobacterium based on restriction pattern of PCR-amplified 16S rdna Culture name AluI HaeIII HhaI MboI RsaI Identification Bb-11 C C C B A B. bifidum Bb-12L C C C B A B. bifidum Bb-12S A E A C B Not identified ABT4 A E A C B Not identified ABTB A E A C B Not identified SJ-1 A E A C B Not identified Table 6. Identification of wild strain of Bifidobacterium isolated from human stool based on restriction patterns of PCR-amplified 16S rdna
123 Selective agar Culture name AluI HaeIII HhaI MboI RsaIII Identification BSI agar K-2 C C C B A B. bifidum K-3 C F A D B Not identified K-4 C C C B A B. bifidum K-5 C C C B A B. bifidum K-7 C C C B A B. bifidum K-10 C C C B A B. bifidum Beeren's K-A A A A A A B. adolescentis agar K-B A A A A A B. adolescentis K-C C C C B A B. bifidum K-E A A A A A B. adolescentis K-G C F A D B Not identified K-H A A A A A B. adolescentis K-I C F A D B Not identified K-J A A A A A B. adolescentis. SDS-PAGE bifidobacteria Bifidobacterium TPY cell sonicate SDS-PAGE (Fig 3). B. bifidum KCTC 3418 B. bifidum ,000, 69,000, 63,000, 60,000, 56,000, 54,000, 50,000, 47,000, 45,000, 21,000, 20,000 polypeptide B. adolescentis KCTC 3416 KCTC ,000, 62,000, 61,000, 20,000, 14,000 polypeptide B. breve KCTC 3461 B. breve KCTC 3419 polypeptide band B. breve KCTC 3220 B. breve 29,000 polypeptide polypeptide. B. infantis KCTC 3249 B. infantis KCTC 3460 polypeptide band
124 Fig.3. SDS-PAGE of cell proteins of bifidobacteria. S. Molecular marker; A. B. bifidum KCTC 3418; B. B. bifidum KCTC 3357; C. B. adolesecntis KCTC 3416; D. B. adolescentis KCTC 3216; E. B. breve KCTC 3461; F. B. breve KCTC 3419; G. B. breve KCTC 3220; H. B. infantis KCTC 3249; I. B. infantis KCTC Tsakalidou (1992) L. delbrueckii subsp. bulgaricus S. salivarius subsp. thermophillus cell SDS-PAGE polypeptide. Leuconostoc mesenteroides SDS-PAGE L. mesenteroides 3 subspecies. bifidobacteria SDS-PAGE polypetide band polypeptide.. RAPD Bifidobacterium genomic DNA random amplified DNA polymorphism(rapd) (Fig. 4). RAPD DNA band B. bifidum 3 750bp, 590bp, 300bp band. B. breve 3 340bp band B. infantis 340bp 300bp band. B. adolescentis band. B. infantis KCTC 3249 B. infantis KCTC 3270 band pattern B. infantis ATCC
125 15697 band pattern. Fig. 4. Agarose gel electrophoresis of random-amplified DNA products of bifidobacteria. S. 100bp DNA ladder marker; A, B. bifidum KCTC 3418; B. B. bifidum KCTC 3357; C. B. bifidum KCTC 3476; D. B. longum KCTC 3466; E. B. adolescentis KCTC 3416; F. B. adolescentis KCTC 3216; G. B. adolescentis KCTC 3352; H. B. breve KCTC 3461; I. B. breve KCTC 3419; J. B. breve KCTC 3220; K. B. infantis KCTC 3249; L. B. infantis KCTC 3270; M. B. infantis KCTC 3460; N. B. infantis KCTC RAPD 7-10bp random primer annealing MgCl2 stringency PCR DNA band fingerprinting (Welsh McClelland, 1990). (1994) bp degenerated primer 28 annealing PCR DNA pattern. (1997) S. salivarius subsp. thermophilus L. delbrueckii subsp. bulgraicus L. acidophilus band. Tyler (1997) RAPD
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information05-08 087ÀÌÁÖÈñ.hwp
산별교섭에 대한 평가 및 만족도의 영향요인 분석(이주희) ꌙ 87 노 동 정 책 연 구 2005. 제5권 제2호 pp. 87118 c 한 국 노 동 연 구 원 산별교섭에 대한 평가 및 만족도의 영향요인 분석: 보건의료노조의 사례 이주희 * 2004,,,.. 1990. : 2005 4 7, :4 7, :6 10 * (jlee@ewha.ac.kr) 88 ꌙ 노동정책연구
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information........
Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering
More information11¹Ú´ö±Ô
A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationIntroduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소 분석시스템의 결과를 기본으로 하여 제품의 품질을 결정 R&D 실험실
적정의 올바른 분석방법 Kopack Seminar May 2012 Agenda Introduction Risks and Measures Summary 1 1 Introduction 신뢰성 있는 결과 높은 품질의 제품을 생산하기 위해서는 제품의 공정 시스템이 중요 품질관리실험실은 품질보증과정에서 매우 중요한 역할 분석시스템은 품질관리실험실의 매우 중요한 요소
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationca_02.hwp
SPSPSPSP SPSPSPS SPSPSP SPSPS SPSP SPS 공기청정기 항균필터 SPS - KACA009-139 한국공기청정협회 2002년 12월 31일 제정 2016년 -월 -일 개정예정 http://www.kaca.or.kr 1.1 적용범위 이 표준은 에어필터로 공기중의 입자제거 및 미생물 제균 성능을 지닌 필터에 대하여
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information5. .......hwp
X i D i ) 8 6 4 2 0-2 -4 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 12 8 4 0-4 -8 1987 1988 1990 1992 1994 1996 1998 2000 2002 year 45 40 35 30 25 20 15 1987 19 90 1994 1998 2002 year ln W X 30
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information... 수시연구 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 권혁구ㆍ서상범...
... 수시연구 2013-01.. 2010 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 2010... 권혁구ㆍ서상범... 서문 원장 김경철 목차 표목차 그림목차 xi 요약 xii xiii xiv xv xvi 1 제 1 장 서론 2 3 4 제 2 장 국가물류비산정방법 5 6 7 8 9 10 11 12 13
More information12È«±â¼±¿Ü339~370
http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,
More information<C0C7B7CAC0C720BBE7C8B8C0FB20B1E2B4C9B0FA20BAAFC8AD5FC0CCC7F6BCDB2E687770>
ꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚ ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ 儀 禮 의 社 會 的 機 能 과 變 化 李 顯 松 裵 花 玉 ꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏꠏ ꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚꠚ
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More informationBuy one get one with discount promotional strategy
Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More informationhttp://www.kbc.go.kr/ Abstract Competition and Concentration in the Market for the Multichannel Video Programming G h e e - Young Noh ( P r o f e s s o, rschool of Communication,
More informationVol.259 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2018.01 Vol.259 C O N T E N T S 02 06 28 61 69 99 104 120 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2018.1 3 4 2018.1 1) 2) 6 2018.1 3) 4) 7 5) 6) 7) 8) 8 2018.1 9 10 2018.1 11 2003.08 2005.08
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationMicrosoft PowerPoint - ch03ysk2012.ppt [호환 모드]
전자회로 Ch3 iode Models and Circuits 김영석 충북대학교전자정보대학 2012.3.1 Email: kimys@cbu.ac.kr k Ch3-1 Ch3 iode Models and Circuits 3.1 Ideal iode 3.2 PN Junction as a iode 3.4 Large Signal and Small-Signal Operation
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More information12Á¶±ÔÈŁ
Journal of Fashion Business Vol. 5, No. 4. pp.158~175(2001) A Study on the Apparel Industry and the Clothing Culture of North Korea + Kyu Hwa Cho Prof., Dept. of Clothing & Textiles, Ewha Womans University
More information大学4年生の正社員内定要因に関する実証分析
190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and
More information00내지1번2번
www.keit.re.kr 2011. 11 Technology Level Evaluation ABSTRACT The Technology Level Evaluation assesses the current level of industrial technological development in Korea and identifies areas that are underdeveloped
More information歯제7권1호(최종편집).PDF
********* (*, **, *** ).., 2002, 7, 1, 1-12. 2-5 80.,.,..,,... :,,. (naming).., (word finding), (lexical look- up), (lexical retrieval), (word recall) (Fried- Oken, 1987). (pause),,, (naming error) (Snyder
More information歯3이화진
http://www.kbc.go.kr/ Abstract Terrestrial Broadcasters Strategies in the Age of Digital Broadcasting Wha-Jin Lee The purpose of this research is firstly to investigate the
More information<C3D6C1BEBAB8B0EDBCAD2E687770>
Counter Pulse Generator TRX(Thyratron) Oscilloscope Pump Chamber Power Supply Oscilloscope Controller Inductor High Voltage Pulse Generator (-) 펄스폭:-0.5uS, 승압비:-1:2(GND) (-) 펄스폭:-2uS, 승압비:-1:1(GND)
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information300 구보학보 12집. 1),,.,,, TV,,.,,,,,,..,...,....,... (recall). 2) 1) 양웅, 김충현, 김태원, 광고표현 수사법에 따른 이해와 선호 효과: 브랜드 인지도와 의미고정의 영향을 중심으로, 광고학연구 18권 2호, 2007 여름
동화 텍스트를 활용한 패러디 광고 스토리텔링 연구 55) 주 지 영* 차례 1. 서론 2. 인물의 성격 변화에 의한 의미화 전략 3. 시공간 변화에 의한 의미화 전략 4. 서사의 변개에 의한 의미화 전략 5. 창조적인 스토리텔링을 위하여 6. 결론 1. 서론...., * 서울여자대학교 초빙강의교수 300 구보학보 12집. 1),,.,,, TV,,.,,,,,,..,...,....,...
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More information204 205
-Road Traffic Crime and Emergency Evacuation - 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 Abstract Road Traffic Crime
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information본문01
Ⅱ 논술 지도의 방법과 실제 2. 읽기에서 논술까지 의 개발 배경 읽기에서 논술까지 자료집 개발의 본래 목적은 초 중 고교 학교 평가에서 서술형 평가 비중이 2005 학년도 30%, 2006학년도 40%, 2007학년도 50%로 확대 되고, 2008학년도부터 대학 입시에서 논술 비중이 커지면서 논술 교육은 학교가 책임진다. 는 풍토 조성으로 공교육의 신뢰성과
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More informationePapyrus PDF Document
Trans. of the Korean Hydrogen and New Energy Society(2013. 4), Vol. 24, No. 2, pp. 136~141 DOI: http://dx.doi.org/10.7316/khnes.2013.24.2.136 흡기관 분사식 수소 SI기관의 희박과급 적용에 관한 연구 이광주 1 ㆍ이종구 1 ㆍ이종태 2 1 성균관대학교
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information<B9AEC8ADB0E6C1A6BFACB1B820C1A63137B1C720C1A633C8A3283135303131332033C2F720BCF6C1A4BABB292E687770>
한국문화경제학회 문화경제연구 제17권 제3호, 2014년 12월, pp.189~223 드라마 제작 영유 기업들의 변화와 성장: 상장기업을 중심으로 7년간의 사업현황 검토 김 훈 * 김 정 훈 ** 목 차 Ⅰ. 서 론 Ⅱ. 국내 엔터테인먼트 시장규모 및 제작시장 현황 Ⅲ. 상장기업 경영 현황 조사결과 Ⅳ. 결론 및 시사점 한국 드라마산업은 한류를 이끄는 주요산업으로
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information<C7C1B7A3C2F7C0CCC1EE20B4BABAF1C1EEB4CFBDBA20B7B1C4AA20BBE7B7CA5FBCADB9CEB1B35F28C3D6C1BE292E687770>
Through proactively respond Franchise New business launching instance : Focus on the BEERBARKET s successful story of INTO FRANCHISE SYSTEMS, INC. 선행적 대응을 통한 프랜차이즈 뉴비즈니스 런칭 사례 : 인토외식산업의 맥주바켓 성공사례 MAXCESS
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information로의 흡수 및 에너지 대사 등을 조절한다 면서 유산균은 유해균의 성장을 억제하면서 동시에 유산균의 증식 을 도울 수 있는 능력이 있다. 따라서 프레바이오틱스(prebiotics)나 프로바이오틱스가 함유된 식품이나 의약 품을 꾸준히 섭취하는 것이 중요하다 고 강조했다.
프로바이오틱스의 진면목(2) 저자 김성철 영남대학교 임상약학대학 겸임교수 약학정보원 학술자문위원 개요 인간의 위장관에는 숙주세포, 영양소, 미생물로 이루어진 복잡하고 다양한 생태계(ecosystem)가 존재한 다. 장관에서 배양 가능한 미생물의 종류는 500종 이상이며, 위, 십이지장, 공장에는 미생물의 수가 10 5 CFU/g으로 증가한다. 장내 세균의 수는
More informationhwp
심사위원 심사위원 심사위원 인 인 인 - i - - ii - - iii - - iv - - v - Ⅰ. 서 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - 항목 건강하지못하다 주관적구강상태 보통이다
More informationMicrosoft PowerPoint - Freebairn, John_ppt
Tax Mix Change John Freebairn Outline General idea of a tax mix change Some detailed policy options Importance of casting assessment in the context of a small open economy Economic effects of a tax mix
More information216 동북아역사논총 41호 인과 경계공간은 설 자리를 잃고 배제되고 말았다. 본고에서는 근세 대마도에 대한 한국과 일본의 인식을 주로 영토와 경계인 식을 중심으로 고찰하고자 한다. 이 시기 대마도에 대한 한일 양국의 인식을 살펴볼 때는 근대 국민국가적 관점에서 탈피할
전근대시기 한국과 일본의 대마도 인식 215 전근대시기 한국과 일본의 대마도 인식 하우봉 전북대학교 사학과 교수 Ⅰ. 머리말 브루스 배튼(Bruce Batten)의 정의에 따르면 전근대의 국경에는 국경선으로 이루어진 boundary가 있고, 공간으로 이루어진 frontier란 개념이 있다. 전자 는 구심적이며 내와 외를 격리시키는 기능을 지니고, 후자는 원심적이며
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: NCS : * A Study on
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.157-176 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.157 NCS : * A Study on the NCS Learning Module Problem Analysis and Effective
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information