hwp

Size: px
Start display at page:

Download "hwp"

Transcription

1 담배연기에의한 Muc5ac 유전자발현에관여하는세포내신호전달경로로서의 ERK1/2 와 p38 MAPK 가톨릭대학교의과대학내과학교실, 가톨릭대학교의과대학성모병원호흡기질환연구실 1 김용현, 윤형규, 김치홍, 안중현, 권순석, 김영균, 김관형, 문화식, 박성학, 송정섭, 조경숙 1 Muc5ac Gene Expression Induced by Cigarette Smoke is Mediated Via a Pathway Involving ERK1/2 and p38 MAPK Yong Hyun Kim, M.D., Hyoung Kyu Yoon, M.D., Chi Hong Kim, M.D., Joong Hyun Ahn, M.D., Soon Seog Kwon, M.D., Young Kyoon Kim, M.D., Kwan Hyoung Kim, M.D., Hwa Sik Moon, M.D., Sung Hak Park, M.D., Jeong Sup Song, M.D., Kyung Sook Cho 1 Division of Pulmonology, Department of Internal Medicine and 1 Institute of Respiratory Disease, St. Mary s Hospital, College of Medicine, the Catholic University of Korea, Seoul, Korea Object : Cigarette smoking is a major cause of mucus hypersecretion, which is a pathophysiological feature of many inflammatory airway diseases. Mucins, which are an important part of the airway mucus, are synthesized from the Muc gene in airway epithelial cells. However, the signaling pathways for cigarette smoke-induced mucin synthesis are unknown. The aim of this study was to determine the signal pathway for smoking induced Muc5ac gene expression. Methods : A549 cells were cultured and transiently transfected with the Muc5ac promoter fragment. These cells were stimulated with 5% cigarette smoke extract (CSE) alone or with CSE after a pretreatment with various signal transduction pathway inhibitors (AG1478, PD98059 and SB203580). The Muc5ac promoter activity was examined using the luciferase reporter system, and the level of phosphorylated EGFR, ERK1/2, p38 MAPK and JNK were all examined using Western blot analysis. Muc5ac mrna expression was also examined using reverse transcriptase polymerase chain reactions (RT-PCR). Results : 1. The peak level of luciferase activity of the Muc5ac promoter was observed at 5% concentration and after 3 hours of incubation with the CSE. The level of EGFR phosphorylation and the luciferase activity of the transfected cells caused by the CSE were significantly suppressed by AG1478 or PD98059 (P<0.01). 2. CSE phosphorylated ERK1/2 or p38 MAPK but not JNK. The Muc5ac mrna expression level was increased by the CSE but that was suppressed by PD98059 or AG The CSE-induced phosphorylation of ERK1/2 was blocked by PD98059 and that of p38 MAPK was blocked by either PD98059 or SB Either PD98059 or SB suppressed the luciferase activity of the transfected cells (P<0.0001). Conclusion : The Muc5ac mrna expression level was increased by the CSE. The increased CSE-induced transcriptional activity was mediated via EGF receptor activation, which led to ERK1/2 and p38 MAPK phosphorylation. (Tuberc Respir Dis 2005; 58: ) Key words : Cigarette smoke, MUC5AC, MAPK, Signal transduction 서 흡연은오래전부터만성폐쇄성폐질환 (Chronic ob 론 Address for correspondence : Jeong Sup Song, M.D Division of Pulmonology, Department of Internal Medicine and Institute of Respiratory Disease, St. Mary s Hospital, College of Medicine, the Catholic University of Korea, Seoul, Korea Phone : Fax : jssong@catholic.ac.kr Received : Feb Accepted : May structive lung disease) 과죽상경화증의주요위험인자 1-4 로잘알려져있다. 또흡연은만성폐쇄성폐질환환자에서뿐만아니라건강한사람에서도기도내점액분비를증가시킨다. 특히만성폐쇄성폐질환의주요임상양상인점액의과다분비는이질환의중요한병태생리학적소견이며과도하게분비된점액은하부기도의폐쇄를일으켜호흡곤란과나아가호흡부전을야기하는중요한원인이된다 5. 기도점액은기도상피를덮고있으며수분의증발을막고병균이나화학적자극물질들로부터상피를보호하는역할을하는데, 590

2 Tuberculosis and Respiratory Diseases Vol. 58. No. 6, Jun 이는대기도상피에존재하는배상세포와점막하분비선에존재하는점액세포와장액세포에서분비된다 6-8. 점액은 95% 의물과소량의지방, 단백질및특정유전자에의해만들어지는당단백질등으로구성되어있으며 6 어떤이유에의해과다분비가일어나면문제를일으킨다. 점액의과다분비는기도내배상세포의증식및화생 (metaplasia) 때문이다 9. 점액의과다분비를일으키는원인은매우다양한데이중한가지가흡연이다. 담배연기내에는대략 4000 여가지의다양한물질들이기체혹은결정의형태로존재하며 nitrogen oxide, hydrogen peroxide, hydrogen cyanide, acrolein 등의다양한산화제를포함하고있다 10. 이들산화제는만성폐쇄성폐질환, 기관지확장증, 낭성섬유증과같은기도내염증질환의병태생리에중요한역할을한다고알려져있다. 기도내의점액분비를유발하고조절시키는기전은아직까지정확하게알려져있지않지만점액의주성분인점액당단백질을합성하는데관여하는기도상피세포내의점액유전자, 즉 Muc 유전자가있음이알려져있다. 현재까지인체에서는 15종류의 Muc 유전자가존재한다 11. 그중에서도 Muc5ac 유전자에의해합성되는당단백은정상인과기관지천식환자에서기도분비액의주된성분으로알려져있고 12 기도내배상세포증식및화생과가장관련성이있다고보고되었다 13. 최근이 Muc 유전자의발현과정에대한여러연구에서유전자를활성화시키는세포내신호전달과정에표피성장인자 (epidermal growth factor) 수용체가관여함이밝혀졌다 14,15. 하지만, 표피성장인자수용체활성화이후의세포내신호전달과정에대해서는확실하게규명이되어있지않고일부의연구들에서이신호전달과정에 mitogen-activated protein kinase (MAPK) 가관련되어있음을최근보고하였다 저자들은흡연에의노출이점액유전자의발현을활성화시키고이유전자의발현에어떠한 MAPK가신호전달과정에관여하는지알아보고자기도상피세포의특성을가지고있는폐선암세포주인 A549세포를담배연기추출물에노출시켜실험하였다. 방법 1. 세포배양사람의폐선암세포주인A549 세포 (KCLB, 한국세포주은행, Korea) 를 10% 우태아혈청 (Glbco-BRL, California, USA), penicillin (Glbco-BRL) 100 U/mL, streptomycin (Glbco-BRL) 100 μg /ml, HEPES 640 (Sigma, St. Louis, USA) 25 mmol 배지에서 37, 5% CO 2 의배양기에서배양하였다. 2. 담배연기추출용액 (cigarette smoke extract solution) 25 ml의 RPMI1640 medium (10% 우태아혈청, HEPES 50 mmol without penicillin and streptomy cin) 내로 one puff/min 의비율로 5분동안담배연기를모았다. ph 7.4가되도록적정을하고, 0.22 μm filter unit (Millipore, Bedford) 을사용하여여과를하였다. 이때만들어진담배연기추출용액은사용하기 30분전에만들어썼다. 또한이용액은동일한배지로 5% 혹은 10% 로희석하여세포에처리하였다. 3. Transient transfection과세포자극 A549 세포를 6-well 조직배양용기 (Nunc, Roskilde, Denmark) 에 세포 /ml 의양으로 2mL씩접종후 48시간동안배양하여, 용기의 80% 정도채워자랐을때 Muc5ac 의 transfection 실험을실시하였다. Trans fection을수행할 PGL3-Muc5ac-3752pro luciferase reporter plasmid와 PGL3-basic vector는실험을수행하기전에각각 200 ng/ μl로정량화하였고, 대조군으로사용할 β-galactosidase의양은 100 ng/ μl로정량화하였다. Transfection 전에세포는혈청이없는배지로세척을하고각용기당 800μl의혈청이없는배지를넣어미리적응을시켰다. 한튜브에는혈청이없는배지 300μl, PGL3-Muc5ac-3752pro luciferase reporter plasmid 5μl, plus reagent (Gibco-BRL) 5μl, β-galactosidase 3μl를혼합하여준비하고다른한튜 591

3 YH Kim, et al.: The signal transduction pathway for the Muc5ac gene expression 브에는혈청이없는배지 300μl, LIPOFECTAMINETM reagent (Gibco-BRL) 4μl를넣은후각각의튜브를상온에서 15분간반응시킨후, 두개의튜브를잘섞어서상온에서 15분간반응을시켜복합체를형성하도록하였다. 준비된복합체를미리적응시킨배양용기에 200μl씩골고루넣은후, 20% FBS를 1 ml을배양용기에첨가하여 24시간동안배양하였다. Trans fection한세포주를혈청이없는배지에 24시간배양한후, 5% 담배연기추출용액과 mitogen-activated protein kinase kinase (MAPKK) 의억제제인 PD mmol (Sigma), epidermal growth factor receptor (EGFR) kinase의억제제인 AG1478 (Calbiochem, Bad Soden, Germany) 50 μmol, p38 MAPK 억제제인 SB (Calbiochem) 50 μmol을넣어 30분간전처리한후, 다시 5% 담배연기추출용액으로 3시간자극하였다. phosphate buffer solution (PBS) 으로 2번세척하고 reporter lysis buffer (Promega, Madison, USA) 를넣고상온에서 20 분간반응시켜 12,000 rpm에서 15 초간원심분리한후, 세포단백질을얻었다. 4. Luciferase receptor assay 얻어진세포단백질을 20μl으로정량한후 lucife rase 활성화정도를측정하기위해서세포추출단백질에 100μl의 luciferase assay substrate (Promega) 를넣어반응시킨후, luminometer (Turner Designs, Turku, Finland) 를이용하여활성화정도를측정하였다. 또한각각의활성도는 β-galactosidase를이용하여보정하였다. 5. 역전사효소연쇄중합반응 (Reverse transcription polymerase chain reaction) A549 세포가배양용기의 80% 정도채워자랐을때, transient transfection 실험과동일한조건으로 Tri- ZolTM reagent (Invitrogen, California, USA) 500 μl로상온에서 5분간반응시키고제조자가제시한방법으로 RNA를추출하였다. 추출한 RNA는 spectropho tometer (Bio-RAD, California, USA) 를이용해 1 μg / μl 로정량화하였고, 여기에서 1 μl를채취하여역전사효소 (SUPERSCRIPT Ⅲ, Invitrogen) 0.5μl로 BioNeer Accupower PCR premix (BioNeer, Seoul, Korea) 를이용하여역전사효소연쇄중합반응을수행하였다. 활성화정도는 GAPDH 를사용하여보정하였으며사용한 Muc5ac 및 GAPDH 의 primer 염기서열은다음과같다. Muc5ac ;(F) 5 TCCGGCCTCATCTTCTCC 3 (R) 5 ACTTGGGCACTGGTGCTG 3 GAPDH ; (F) 5 ACCACAGTCCATGCCATCAC 3 (R) 5 TCCACCACCCTGTTGCTGTA 3 6. Western blot A549 세포를위에서언급한방법으로처리하여배양하고 Bradford assay (Bio-RAD) 방법으로정량하여세포단백질을준비하였다. 준비된세포단백질 30 μg을 10% SDS-polyacrylamide gel에서 120V에서약 1시간 30분간전기영동을하였다. 이어 PVDF mem brane (Bio-RAD) 으로 4, 250mA에서 1시간 30분간전기영동하여단백질을전이시키고차단용액으로차단시켰다. Phosphorylated EGFR (P-EGFR/EGFR), phosphorylated extracellular signal-related kinase (P-ERK/ERK), phosphorylated p38 MAPK (P-p38 MAPK/p38 MAPK), phosphorylated c-jun N-ter minal kinase (P-JNK/JNK) 에대한일차항체 (rabbit anti-human, Santacruz, California & Cell signaling, Beverly, MA, USA) 로 4 에서밤새반응시키고세척후이차항체 (anti-rabbit IgG HRP-linked antibody 또는 anti-mouse IgG HRP-linked antibody, Cell si gnaling) 로 1시간 30분동안반응시켰다. 세척후, ECLTM reagent (Amersham-Pharmacia Biotech, Seoul, Korea) 를이용하여제조자가제시한방법으로반응시킨후, X-ray 필름에감광시키고자동현상기를이용하여현상하였다. 7. 통계방법통계적검정은 SPSS 프로그램을사용하여 one-way 592

4 Tuberculosis and Respiratory Diseases Vol. 58. No. 6, Jun ANOVA와 independent sample T-test 를사용하였으며 P 값이 0.05 이하인경우를통계적유의성이있는것으로하였다. 결과 1. 담배연기추출물자극에의한 Muc5ac 유전자전사활성도의증가및표피성장인자수용체의인산화 자극시가장높은활성도를보였다 ( 그림 2). Western blot을이용하여표피성장인자수용체의인산화, 즉활성화된수용체를본결과대조군에비해담배연기추출물자극에의해수용체의인산화가증가되었고이는수용체인산화를억제하는 AG1478에의해억제되었다 ( 그림 3). 담배연기추출물의농도를달리하여 A549 세포를자극하였을때 5% 담배연기추출용액일때가장높은 luciferase 활성도를보여이농도에서 Muc5ac pro moter 의전사가가장증가됨을알수있어이후세포자극시 5% 담배연기추출용액을사용하였다 ( 그림 1). 자극시간에따른활성도는일반적으로자극시간이길수록활성도가더증가하는경향을보였으며 3시간 Figure 2. Effect of incubation time on the CSE-induced Muc5ac transcriptional activity. Transcriptional activity of Muc5ac promoter was the highest when cells were exposed to 5% CSE for three hours (PGL3-basic: PGL3-basic vector without Muc5ac promoter region, * P<0.01). Figure 1. Effect of cigarette smoke extract solution (CSE) concentration on the transcriptional activity of Muc5ac promoter. MUC5AC reporter plasmid was transfected into A549 cells and transfected cells were treated with CSE for one hour. The transcriptional activity of Muc5ac promoter was the highest when the transfected cells were exposed to 5% CSE. Luciferase activity was expressed as a relative value to a PGL3-basic value (PGL3-basic: PGL3-basic vector without Muc5ac promoter region, CTL: control/muc5ac promoter transfected, CSE: cigarette smoke extract solution, * P<0.01). Figure 3. Western blot analysis of epidermal growth factor receptor (EGFR) and phosphorylated epidermal growth factor receptor (P-EGFR). Western blot analy sis was performed under conditions as described in methods. A549 cells were incubated with 5% CSE for three hours. EGFR phosphorylation was increased by CSE and decreased by EGFR tyrosine kinase inhibitor, AG1478 or mitogen-activated protein kinase kinase inhibitor, PD98059 pretreatment (M: marker, CTL: control/ MUC5AC promoter transfected, 5% CSE: 5% cigarette smoke extract solution) 593

5 YH Kim, et al.: The signal transduction pathway for the Muc5ac gene expression 2. 세포내신호전달경로로써 MAPK와 Muc5ac 유전자의전사발현 Muc5ac 유전자의전사과정에서세포내신호를전달하는데표피성장인자수용체가관여하며그하위신호전달과정에 MAPK, 특히 ERK1/2 가관계있음이알려져있어저자들은표피성장인자수용체의 tyr osine kinase 억제제인 AG1478, MAPK kinase 억제제인 PD98059를사용하여 Muc5ac 유전자의전사가억제되는지 luciferase 활성도를통하여관찰하였다. 담배연기추출물자극시증가된 Muc5ac 유전자의전사는이들억제제에의하여모두억제되었다 ( 그림 4). Western blot을이용하여 3가지 MAPK 의활성화된형태, 즉인산화된 kinase 활성도를본결과담배연기추출물의자극에서인산화된 ERK1/2 와 p38 MAPK 의활성화는관찰되었으나 JNK의활성화는볼수없었다. 또표피성장인자수용체의인산화를억제하는 AG1478에의해 ERK 1/2와 p38 MAPK 활성도는예상대로억제되었고 MAPK kinase 억제제인 PD98059 처리시 ERK 1/2와 p38 MAPK 활성도역시감소하였다 ( 그림 5). 이를다시확인하기위하여역전사효소중 합연쇄반응을이용하여 Muc5ac mrna 발현을관찰해보니담배연기추출물자극시 Muc5ac mrna 발현이증가되었고 AG1478과 PD98059에의해 Muc5ac mrna 발현은억제되었다 ( 그림 6). PGL3-basic MUC5AC % CSE PD AG Figure 4. The effect of cell signal transduction inhibi tors on luciferase activity. Mitogen-activated protein kinase kinase inhibitor, PD98059 and EGFR tyrosine kinase inhibitor, AG1478 suppressed the CSE-induced luciferase activity (PGL3-basic: PGL3-basic vector with out Muc5ac promoter region, MUC5AC: Muc5ac pro moter transfected, 5% CSE: 5% cigarette smoke extract solution, * P<0.01). Figure 5. Effect of CSE and signal transduction in hibitors on the phosphorylation of ERK, p38 MAPK and JNK. Western blot analysis was performed to as sess the phosphorylation of mitogen-activated protein kinases under same conditions above described. CSE phosphorylated both ERKs and p38 MAPK but not JNK. Phosphorylations of ERKs and p38 MAPK were inhibited by PD98059 or AG1478 (M: marker, CTL: control, 5% CSE: 5% cigarette smoke extract solution, MAPK: mitogen-activated protein kinase, P-ERK: phosphorylated extracellular signal-related kinase, P-JNK: phosphorylated c-jun N-terminal kinase). 594

6 Tuberculosis and Respiratory Diseases Vol. 58. No. 6, Jun Figure 6. Reverse transcription polymerase chain re action (RT-PCR) analysis of Muc5ac mrna expression in A549 cells. PCR reaction was run on a 1% agarose gel and the band density was expressed as a relative value using densitometry measurement. CSE increased the Muc5ac mrna expression. Pretreatment of PD98059 or AG1478 suppressed the Muc5ac expression near to the control levels (CTL: control, 5% CSE: 5% cigar ette smoke extract solution). Figure 7. Western blot analysis of ERK and p38 MAPK. PD98059 inhibited phosphorylation of both ERKs and p38 MAPK. SB also inhibited p38 MAPK phosphorylation as much as to the level of control and CSE treatment group (CTL: control, CSE: 5% cigarette smoke extract solution). 3. SB 처리시세포내신호전달경로와 Muc5ac 유전자발현 담배연기추출물에의한 Muc5ac 유전자발현에관여하는 MAPK 중본실험에서 ERK1/2 와 p38 MAPK 의인산화가확인되어 p38 MAPK의선택적억제제인 SB203580으로처리한후 p38 MAPK 인산화와 Muc5ac promoter 활성도를관찰하였다. PD98059와 SB 은예상대로 p38 MAPK 인산화를억제하였으며 ( 그림 7) SB203580은PD98059에비하여훨씬강하게 lu ciferase 활성도를감소시켰다 ( 그림 8). 고찰기도내기류제한과반복적인기도염증으로요약되는만성폐쇄성폐질환에서기도내점액분비의증가는 Figure 8. The effect of cell signal pathway inhibitors on luciferase activity. PD98059 and SB signi ficantly suppressed CSE-induced luciferase activity, respectively (PGL3-basic: PGL3-basic vector without Muc5ac promoter region, CSE: 5% cigarette smoke extract solution, * P< ). 특징적인임상양상이다. 만성폐쇄성질환의원인은여러가지가알려져있으나그중흡연이가장중요한원인이며이는기도내점막의염증을일으키고기도내점액분비증가에기여한다 2,19. 기도점액의주성분은점액소 (mucin) 라는당단백질복합체로써구조의뼈대를이루는여러단백질이각각의특이유전자에 595

7 YH Kim, et al.: The signal transduction pathway for the Muc5ac gene expression 의해만들어짐이최근밝혀져있는데현재까지모두 15개의점액유전자 (Muc gene) 가알려져있다. 점액소는막결합성점액소와분비형점액소로나누며이중폐혹은기도내에존재하는분비형점액소는 Muc2, Muc5ac, Muc5B, Muc7 그리고 Muc8이고 11 이중 Muc5ac 가흡연에의해분비가유도됨이알려졌다 20. 하지만, 이러한점액유전자가어떠한세포내신호전달과정을통하여점액분비를증가시키는지에대해서는명확하게밝혀진바가없으나최근호중구의 ela stase, 흡연, 금속, 세균감염, 산화제의자극등에의하여표피성장인자수용체가활성화되고이어점액유전자의전사가일어난다는사실이알려졌다 17, 본실험에서도담배연기로처리하였을때 A549 세포의 Muc5ac mrna 발현이증가되었고표피성장인자수용체의활성화를동반하며표피성장인자수용체인산화를억제하는 AG1478 처리시 Muc5ac 유전자의발현이억제되어유전자발현에표피성장인자수용체가관여함을확인할수있었다. 표피성장인자수용체가자극에의해활성화되어세포내신호를전달하는데는 ERK1/2, JNK1/2/3, p38 MAPK 혹은 protein ki nase C를매개하는것이알려져있는데 Muc2 혹은 Muc5ac 유전자의발현에표피성장인자수용체의활성이먼저일어나고이어 ERK 신호전달체계를경유하여 NF-κB 나 SP1같은전사인자가 DNA에결합하여유전자의발현을증가시킨다는보고들이있다 16,18. 세포내신호전달에관여하는신호전달체계중 MAPK 군은 proline-targeted serine-threonine kinase에속하며외부자극을핵에전달하는역할을하는데포유동물에서는최소 4가지종류의 MAPK, 즉 ERK1/2, JNK1/2/3, p38 MAPK, ERK5가존재한다 24. 본연구자는담배연기에의한 Muc5ac 유전자의발현에표피성장인자수용체의활성화를확인하고그이하단계에서의신호전달과정에여러 MAPK 중어떤종류가관여하는지확인하였다. 담배연기자극시에 ERK1/2 와 p38 MAPK 의인산화는관찰하였으나 JNK 인산화는관찰되지않았고 MAPK 를활성화시키는 MAPK kinase (MAPKK) 억제제인 PD98059와 p38 MAPK 의선택적억제제인 SB203580으로처리시각각 ERK1/2 와 p38 MAPK 의인산화가억제되고 Muc5ac mrna 발 현이감소되었다. 이상의결과로보아담배연기에의한 Muc5ac 유전자의발현증가를일으키는세포내신호전달에는 MAPK 중 ERK1/2 와 p38 MAPK 가관여하고 JNK는관계없음을유추할수있다. 담배연기가표피성장인자수용체를활성화시키는기전은아직명확하지않다. 표피성장인자수용체의특이리간드인표피성장인자와 transforming growth factor 는직접수용체에결합하여표피성장인자수용체인산화를유도하지만 14 이외에도외부에서과산화수소와같은산화제로자극하거나활성화된호중구로자극시수용체-리간드결합과관계없는표피성장인자수용체인산화경로가보고되고있다 23. 활성화호중구역시많은종류의염증매개물을생성하여 DNA 의산화손상을일으킨다고알려져있어다양한자극에의해생성된산화물질들이리간드결합과는무관하게직접적으로표피성장인자수용체를활성화시키고 MAPK 경로를통하여점액분비를증가시킨다고추측된다. 담배연기내에도다양한산화제들이존재하므로이들산화제에의해표피성장인자수용체활성화가일어난다고생각할수있다. 하지만흡연은생체에서기도내염증을유발하여기도내세포로부터다양한염증매개물들을분비하게하는데특히호중구의동원을일으키는 IL-8과같은시토카인분비를자극함으로써먼저호중구가동원되고이차적으로산화자극에의해수용체의활성화가이루어질가능성을배제할수는없다. 그러나본실험은호중구의동원이불가능한폐암세포주에서이루어졌으며호중구의자극혹은외부에서의산화제처리에의한점액유전자발현을본이전의보고 23 와같이신호전달과정에 ERK1/2 경로는관여하나 p38 kinase 경로는무관하다고결론을내렸다. 연구자의실험결과담배연기자극으로나타난신호전달경로에는 ERK1/2 와 p38 MAPK 가모두관여하는결과를보여표피성장인자수용체인산화는호중구동원의이차적인결과이거나단순히담배연기내에포함된산화물질에만의한것이라단정할수는없다. 담배연기내에들어있는대표적물질인 acrolein 으로기도상피세포를직접자극하였을때 Muc5ac mrna 의발현증가가보고되었으며 25,26 이의기전으로 acrolein 이세포내 glutathione 을 596

8 Tuberculosis and Respiratory Diseases Vol. 58. No. 6, Jun 소모시켜 reactive oxygen species 를생성하여유전자발현을증가시킨다는보고도있다 4,27. 또 acrolein 은생체에서염증반응을일으켜호중구, 대식세포및단핵구의활성화를촉진하고이들세포들은다양한염증매개물을분비하는데이들염증매개물로기도상피세포를자극하였을때도역시 Muc5ac mrna의발현이증가되고단백질합성이이루어지는것으로보아 acrolein 은직접적으로 Muc5ac 유전자를활성화시키고동시에염증반응을매개하여간접적으로도 Muc5ac 유전자를자극하는것으로생각된다. 이처럼다른신호전달경로를가진자극원이담배연기에존재하거나산화물질의종류에따라각각다른신호전달경로를가질가능성이있다. 담배연기내에 4,000여가지물질들이존재하고이들의생물학적기능이나영향이완전히규명되지않았기에이러한물질들이직접적으로표피성장인자수용체를활성화시키고세포내신호를전달하는과정에서이미알려진산화자극과는다른세포내신호경로, 즉 p38 MAPK 를경유한다고생각할수있다. 요약하면담배연기추출물에의하여 A549 세포의표피성장인자수용체가활성화되고이어 MAPKK를통하여활성화되는 MAPK 중 ERK1/2 와 p38 MAPK 의경로를경유하여세포내신호가전달되어 Muc5ac 유전자의 mrna 발현을촉진하여점액분비증가가일어난다고생각한다. 요약연구배경 : 만성폐쇄성폐질환에서나타나는기도점액의과다분비는이질환의중요한병리학적소견이며호흡곤란등환자의증상을악화시키는요인중의하나이다. 기도점액을구성하는여러성분중 Muc 유전자에의해만들어지는당단백이흡연에의해생성이증가하는데이에관여하는세포내신호전달과정에대하여확실히밝혀진바가없다. 저자는 Muc 유전자중인체의기도에가장많이분비되는 Muc5ac 점액생성을담당하는 Muc5ac 유전자의발현이흡연에의하여증가하는데관여하는세포내신호전달과정을알아보고자하였다. 재료및방법 : 사람폐선암세포주인 A549 세포를배양하여 Muc5ac 유전자의 promotor를 luciferase reporter plasmid 를사용하여세포내에 transfection시키고 5% 담배연기추출물로자극하여배양하였다. 또세포내신호전달에관여하는표피성장인자수용체 kinase의억제제인 AG1478, mitogen-activated protein kinase kinase (MAPKK) 억제제인 PD98059, p38 mitogen-activated protein kinase 억제제인 SB203580으로각각전처치후역시 5% 담배연기추출물로자극배양하였다. 배양된세포에서단백질을추출하여 luciferase 분석을통하여 Muc5ac promoter 활성도를측정하고 Western blot을이용하여표피성장인자수용체와 mitogen-act ivated protein kinase (MAPK) 인 extracellular signalrelated kinase (ERK)1/2, p38 MAPK, c-jun N-terminal kinase (JNK) 의발현을확인하였다. 또세포에서 RNA 를추출한후 Muc5ac primer를이용하여역전사효소중합연쇄반응을수행하여 Muc5ac mrna 발현을관찰하였다. 결과 : 1. Muc5ac promoter를삽입한 A549 세포를 5% 담배연기추출물로자극하였을때의의있게 luciferase 활성도가증가하였고 (P<0.001) 자극하는시간이 3시간이었을때 luciferase 활성도가최고치를보였다 (P<0.01). 또담배연기추출물자극은표피성장인자수용체를인산화시켰으며인산화는 AG1478과 PD98059 에의하여억제되었다. 2. AG1478 혹은 PD98059로전처치후 5% 담배연기추출물로자극한경우 5% 담배연기추출물단독으로자극한것에비하여유의하게 lucifearse 활성도가억제되었고 (P<0.01) 세가지종류의 MAPK 중 ERK1/2 와 p38 MAPK 의인산화는관찰되었으나 JNK의인산화는관찰되지않았다. 역전사효소중합연쇄반응을이용하여관찰한 Muc5ac mrna 발현은담배연기추출물에의해증가되었고 PD98059와 AG1478에의하여역시억제되었다. 3. 담배연기추출물에의하여인산화된 ERK1/2 는 PD98059에의하여인산화가감소하였고 p38 MAPK 의인산화는 PD98059와 SB203580에의하여감소하 597

9 YH Kim, et al.: The signal transduction pathway for the Muc5ac gene expression 였으며이두가지억제제는모두 luciferase 활성도를유의하게억제시켰다 (P<0.0001). 결론 : 담배연기추출물은 Muc5ac 유전자의발현을증가시켜기도내점액분비를증가시키며이는표피성장인자수용체를매개로 ERK1/2 와 p38 MAPK 를경유하여세포내신호전달이이루어진다고생각된다. 따라서점액유전자활성화를매개하는신호전달과정을차단하는약제나방법이개발된다면과도한점액분비를치료할수있을것으로생각한다. 참고문헌 1. Hogg JC, Macklem PT, Thurlbeck WM. Site and nature of airway obstruction in chronic obstructive lung disease. N Engl J Med 1968;278: Higgins M. Epidemiology of COPD: state of the art. Chest 1984;85:3S-8S. 3. Holbrook JH, Grundy SM, Hennekens CH, Kannel WB, Strong JP. Cigarette smoking and cardiovascular diseases. Circulation 1984;70:1114A-7A. 4. Grafstrom RC, Dypbukt JM, Willey JC, Sundqvist K, Edman C, Atzori L, et al. Pathobiological effects of acrolein in cultured human bronchial epithelial cells. Cancer Res 1988;48: Dunnill MS. The pathology of asthma, with special reference to changes in the bronchial mucosa. J Clin Pathol 1960;13: Widdicombe JG. Airway mucus. Eur Respir J 1989; 2: Rogers DF. Airway goblet cells: responsive and ada ptable front-line defenders. Eur Respir J 1994;7: Jeffery PK, Li D. Airway mucosa: secretory cells, mucus and mucin genes. Eur Respir J 1997;10: Coles SJ, Levine LR, Reid L. Hypersecretion of mucus glycoproteins in rat airways induced by tobacco smoke. Am J Pathol 1979;94: Hoffmann D, Wynder EL. Chemical constituents and bioactivity of tobacco smoke. IARC Sci Publ 1986: Leikauf GD, Borchers MT, Prows DR, Simpson LG. Mucin apoprotein expression in COPD. Chest 2002;121: 166S-82S. 12. Hovenberg HW, Davies JR, Herrmann A, Linden CJ, Carlstedt I. Muc5ac, but not MUC2, is a prominent mucin in respiratory secretions. Glycoconj J 1996;13: Zuhdi Alimam M, Piazza FM, Selby DM, Letwin N, Huang L, Rose MC. Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet cell metaplasia in murine airways. Am J Respir Cell Mol Biol 2000;22: Takeyama K, Dabbagh K, Lee HM, Agusti C, La usier JA, Ueki IF, et al. Epidermal growth factor system regulates mucin production in airways. Proc Natl Acad Sci U S A 1999;96: Nadel JA. Role of epidermal growth factor receptor activation in regulating mucin synthesis. Respir Res 2001;2: Li JD, Feng W, Gallup M, Kim JH, Gum J, Kim Y, et al. Activation of NF-kappaB via a Src-dependent Ras-MAPK-pp90rsk pathway is required for Pse udomonas aeruginosa-induced mucin overproduction in epithelial cells. Proc Natl Acad Sci U S A 1998; 95: Kohri K, Ueki IF, Shim JJ, Burgel PR, Oh YM, Tam DC, et al. Pseudomonas aeruginosa induces Muc5ac production via epidermal growth factor receptor. Eur Respir J 2002;20: Perrais M, Pigny P, Copin MC, Aubert JP, van Se uningen I. Induction of MUC2 and Muc5ac mucins by factors of the epidermal growth factor (EGF) family is mediated by EGF receptor/ras/raf/extracellular signal-regulated kinase cascade and Sp1. J Biol Chem 2002;277: Roth MD, Arora A, Barsky SH, Kleerup EC, Simmons M, Tashkin DP. Airway inflammation in young ma rijuana and tobacco smokers. Am J Respir Crit Care Med 1998;157: Takeyama K, Jung B, Shim JJ, Burgel PR, Dao- Pick T, Ueki IF, et al. Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke. Am J Physiol Lung Cell Mol Physiol 2001;280:L Voynow JA, Young LR, Wang Y, Horger T, Rose MC, Fischer BM. Neutrophil elastase increases Muc5ac mrna and protein expression in respiratory epithelial cells. Am J Physiol 1999;276:L Wu W, Graves LM, Jaspers I, Devlin RB, Reed W, Samet JM. Activation of the EGF receptor signaling pathway in human airway epithelial cells exposed to metals. Am J Physiol 1999;277:L Takeyama K, Dabbagh K, Jeong Shim J, Dao-Pick T, Ueki IF, Nadel JA. Oxidative stress causes mucin synthesis via transactivation of epidermal growth fa ctor receptor: role of neutrophils. J Immunol 2000;164: 598

10 Tuberculosis and Respiratory Diseases Vol. 58. No. 6, Jun Chang L, Karin M. Mammalian MAP kinase signalling cascades. Nature 2001;410: Borchers MT, Wert SE, Leikauf GD. Acrolein-induced Muc5ac expression in rat airways. Am J Physiol 1998; 274:L Borchers MT, Carty MP, Leikauf GD. Regulation of human airway mucins by acrolein and inflammatory mediators. Am J Physiol 1999;276:L Lam CW, Casanova M, Heck HD. Depletion of nasal mucosal glutathione by acrolein and enhancement of formaldehyde-induced DNA-protein cross-linking by simultaneous exposure to acrolein. Arch Toxicol 1985; 58:

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

Rhinology Korean J Otorhinolaryngol-Head Neck Surg 2017;60(5): / pissn / eissn

Rhinology Korean J Otorhinolaryngol-Head Neck Surg 2017;60(5): / pissn / eissn Rhinology Korean J Otorhinolaryngol-Head Neck Surg 217;6(5):222-31 / pissn 292-5859 / eissn 292-6529 https://doi.org/1.3342/kjorl-hns.216.17594 Asian Sand Dust Up-Regulates Expression in Human Upper Airway

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

Microsoft Word doc

Microsoft Word doc KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

KISEP Otology Korean J Otolaryngol 2001;44:124-8 삼출성중이염에서삼출액의점도에따른조성의차이 최재영 1 윤주헌 1,2 이원상 1,2 정명현 1 Compositional Difference of Middle Ear Effusion ac

KISEP Otology Korean J Otolaryngol 2001;44:124-8 삼출성중이염에서삼출액의점도에따른조성의차이 최재영 1 윤주헌 1,2 이원상 1,2 정명현 1 Compositional Difference of Middle Ear Effusion ac KISEP Otology Korean J Otolaryngol 2001;44:124-8 삼출성중이염에서삼출액의점도에따른조성의차이 최재영 1 윤주헌 1,2 이원상 1,2 정명현 1 Compositional Difference of Middle Ear Effusion according to Viscosity of the Effusion Jae Young Choi,

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -

농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 - 농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

KISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants

KISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants KISEP Otology Korean J Otolaryngol 2000;43:136-42 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants and Dexamethasone on inducible Nitric Oxide Synthase

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

KISEP Rhinology Korean J Otolaryngol 2003;46: 사람코점막과배양된코점막상피세포에서 15-Lipoxygenase 와 Cyclooxygenase-2 의발현 연세대학교의과대학이비인후과학교실, 1 두뇌한국 21 의과학사업단 2 김경

KISEP Rhinology Korean J Otolaryngol 2003;46: 사람코점막과배양된코점막상피세포에서 15-Lipoxygenase 와 Cyclooxygenase-2 의발현 연세대학교의과대학이비인후과학교실, 1 두뇌한국 21 의과학사업단 2 김경 KISEP Rhinology Korean J Otolaryngol 2003;46:649-53 사람코점막과배양된코점막상피세포에서 15-Lipoxygenase 와 Cyclooxygenase-2 의발현 연세대학교의과대학이비인후과학교실, 1 두뇌한국 21 의과학사업단 2 김경수 1,2 윤주헌 1,2 김창훈 1 김선구 1 장정현 1 김지훈 1 Expression of

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

15.hwp

15.hwp airway, mucin, Mahwangyunpye-tang (MYT), MUC5AC mrna LDH release (% control) 150 120 90 60 30 0 cont 10 20 40 80 Concentrations (µ l / 200µ l PBS) Absorbance (% control) 150 100 50 0 cont 0.2 Concentrations

More information

Microsoft Word doc

Microsoft Word doc KISEP Otology Korean J Otolaryngol 2006;49:263-8 사람중이점막상피세포에서 Uridine-5 Triphosphate 에의한칼슘이동과점액분비에미치는카페인의효과 최재영 김성헌 정상호 손은진 박헌이 신중욱 윤주헌 Effect of Caffeine on UTP-induced Ca 2+ Mobilization and Mucin Secretion

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

김도희_HT protein expression 표준 보고서_v1.5

김도희_HT protein expression 표준 보고서_v1.5 Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분

목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분 세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------

More information

<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>

<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770> 버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

<B0E6C8F1B4EBB3BBB0FAC0D3BBF3B0ADC1C E687770>

<B0E6C8F1B4EBB3BBB0FAC0D3BBF3B0ADC1C E687770> 개원의와함께하는임상강좌 2011 역류성식도질환제대로이해하기 Division of Gastroenterology, Department of Internal Medicine, Kyung Hee University College of Medicine, Seoul, Korea Jae-Young Jang, M.D., PhD. 개원의와함께하는임상강좌 2011 109 최신치료

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

<30372EC0CCC0AFC1F82E687770>

<30372EC0CCC0AFC1F82E687770> 산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

550호(01-09)

550호(01-09) T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 8 11 13 24 25 27 29 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine

More information

Kaes010.hwp

Kaes010.hwp 갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

책임연구기관

책임연구기관 2009. 2. 책임연구기관 - i - - ii - - iii - - iv - 6.3.1 Sample Collection and Analysis 161 6.3.1.1 Sample Collection 161 6.3.1.2 Sample Analysis 161 6.3.2 Results 162 6.3.2.1 Dalian 162 6.3.2.2 Xiamen 163 6.3.3

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

PowerPoint 프레젠테이션

PowerPoint 프레젠테이션 Apr. 30. 2016. GBCC in JeJu Island Sensitization of breast cancer cells to chemotherapeutic drugs by metabolic regulation InChul Park, Ph. D. Korea Institute of Radiological & Medical Sciences (KIRAMS)

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

KISEP Rhinology Korean J Otolaryngol 2000;43: 오존노출에의한백서비점막의형태학적변화 정진욱 김용민 나기상 김병국 박찬일 Morphologic Changes in Nasal Mucosa of the Rat after Ozon

KISEP Rhinology Korean J Otolaryngol 2000;43: 오존노출에의한백서비점막의형태학적변화 정진욱 김용민 나기상 김병국 박찬일 Morphologic Changes in Nasal Mucosa of the Rat after Ozon KISEP Rhinology Korean J Otolaryngol 000;:9500 오존노출에의한백서비점막의형태학적변화 정진욱 김용민 나기상 김병국 박찬일 Morphologic Changes in Nasal Mucosa of the Rat after Ozone Exposure Jin Uk Jeong, MD, Yong Min Kim, MD, Ki Sang Rha,

More information

hwp

hwp 일반담배 (Cigarette) 와금연보조담배 ( 금연초, 허브담배, 쑥담배 ) 의기관지상피세포에서 IL-6 유리효과비교 서울위생병원내과 1, 원광대학교의과대학내과학교실. 원광대학교의과대학산본병원 2 김명찬 1, 정재일 1, 정종훈, 김학렬, 양세훈, 정은택, 김휘정 2 The Comparison of the Effect of Cigarette and Stop

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

untitled

untitled Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

main.hwp

main.hwp 열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

2 3 4 5 6 8 9 11 12 13 14 16 44 68 80 86 1 ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) (, ) ( ) ( ) ( ) ( ) ( ) ( ) (KORDI/KRISO) () () () () () () 2 3 : 1 : 2005 5 12() 09:00~14:30 Session 15:00~19:00 : 19:00~20:30

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

7월웹진

7월웹진 최근연구소식 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. 새로운항암치료타겟인 c-met 저해제의연구현황 Livio Trusolino, Andrea Bertotti and Paolo M. Comoglio (2010) MET signalling: principles and function in development, organ regeneration

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,

More information

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽 울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를

More information

¼Û±âÇõ

¼Û±âÇõ 223 Table 1. Results of FEV 1.0, Methacholine Challenge Test, and Exercise Provocation Test in Eight Patients Who Performed PFT Pts Tests 1 2 3 4 5 6 7 8 FEV 1.0 (%pred) 66.6 88.8 120 101 90.5 95.4 91.6

More information

歯 PDF

歯 PDF * * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22

More information

<392E5FB8B8BCBAC6F3BCE2BCBAC6F3C1FAC8AF5FC4A1B7E1C1A65FB0B3B9DFC0C75FC7F6C8B25FB9D75FB1D8BAB9B9E6BEC85F F332E302E687770>

<392E5FB8B8BCBAC6F3BCE2BCBAC6F3C1FAC8AF5FC4A1B7E1C1A65FB0B3B9DFC0C75FC7F6C8B25FB9D75FB1D8BAB9B9E6BEC85F F332E302E687770> 만성폐쇄성기도질환혁신신약개발전략 포항공과대학교생명과학과김윤근 1. 서론 최근 WHO에서는 2020년에인간의수명과삶의질을결정하는 4대질환군을지정하였는데, 이중에하나가기도폐색에의한호흡곤란을특징으로하는만성폐쇄성기도질환 (chronic obstructive airway disease) 이다. 만성폐쇄성기도질환은가역적인기도폐색을특징으로하는천식 (asthma) 과비가역적인기도폐색을특징으로하는만성폐쇄성폐질환

More information

노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa

노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa 소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.atb.knrrc.or.kr http://aging.pharm.pusan.ac.kr/ Content

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information