untitled

Size: px

Start display at page:

Download "untitled"

창원 견
4 years ago
Views:

1 Korean J Hematol Vol. 43, No. 1, March, 2008 Original Article 직접염기서열분석법을이용한한국인 Lewis 혈액형군의유전자분석 강원대학교의과대학내과학교실, 1 진단검사의학교실, 2 경원대학교가천바이오나노연구원, 3 고려대학교의과대학진단검사의학교실, 4 ( 주 ) 대한임상의학센터, 5 강원대학교의과학연구소 송서영ㆍ안성수 2 ㆍ유숙원 1,4,5 ㆍ김장수 3 ㆍ서인범 1,4,5 Evaluation of the Genotypes of the Lewis Blood Group in a Korean Population Using Direct Sequencing Seo Young Song, M.D., Seong Soo An, M.D., Ph.D. 2, Sook Won Ryu, M.D. 1,4,5, Jang Soo Kim, M.D. 3 and In Bum Suh, M.D. 1,4,5 Departments of Internal Medicine and 1 Laboratory Medicine, College of Medicine, Kangwon National University, Chuncheon, 2 Gachon Bionano Research Institute, Kyungwon University, Seongnam, 3 Department of Laboratory Medicine, College of Medicine, Korea University, Seoul, 4 Korea Clinical Medicine Center, 5 Institute of Medical Science, Kangwon National University, Chuncheon, Korea Background: The FUT2 and FUT3 genes determine the Lewis phenotype of red blood cells (RBCs). Recently, the Lewis genes, the secretor genes, and several mutations that cause Lewis negative and nonsecretor phenotypes have been identified. The purpose of this study was to analyze the gene frequency of FUT2 and FUT3 in a Korean population by comparing the use of the direct sequencing method to the use of the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method for mutation detection in the FUT2 and FUT3 genes. Methods: RBCs and peripheral blood leukocytes were obtained from 225 apparently healthy volunteers to determine the phenotype and genotype of the FUT2 and FUT3 genes. Lewis phenotypes were determined on K 3 EDTA-stablized fresh blood samples using the column agglutination method. Lewis blood group genotyping was performed by use of the direct sequencing method. For the detection of T59G, C357T, and A385T mutations, the PCR-RFLP method was performed. Results: The frequencies of the Lewis blood group phenotype were 12.4% for Le(a+b ), 70.7% for Le(a b+), 11.1% for Le(a b ) and 5.8% for Le(a+b+), respectively. Direct Sequencing of the FUT2 gene identified 92.2% C357T, 56.9% A385T, 0.4% G244A mutations and 1.8% del396. Direct Sequencing of the FUT3 gene identified 46.9% T59G, 30.4% G508A, 1.1% T202C, 1.1% C314T, 0.7% A1029G, 3.0% T1067A and 13.3% G1242A mutations. The PCR-RFLP method results were discordant in nine cases (1 case for C357T, 4 cases for A385T and 2 cases for T59G) as compared to the direct sequencing method results. Conclusion: We have determined the frequencies of FUT2 and FUT3 gene mutations in a Korean population. The use of the direct sequencing method was more accurate than the use of the PCR-RFLP method for the determination of the genotype of the FUT2 and FUT3 genes. (Korean J Hematol 2008;43:34-42.) Key Words: FUT2 gene, FUT3 gene, Lewis blood group, Phenotype, Genotype, Direct sequencing, PCR-RFLP 접수 :2007 년 10 월 24 일, 수정 :2008 년 2 월 28 일승인 :2008 년 3 월 5 일교신저자 : 서인범, 강원도춘천시효자 2 동 , 강원대학교의과대학진단검사의학교실 Tel: , Fax: bloodmd@kangwon.ac.kr 이논문은 2003 년도정부재원 ( 교육인적자원부학술연구조성사업비 ) 으로한국학술진흥재단의지원을받아연구되었음 (KRF E00119). 34 Correspondence to:in Bum Suh, M.D. Department of Laboratory Medicine, College of Medicine, Kangwon National University 192-1, Hyoja 2-dong, Chuncheon , Korea Tel: , Fax: bloodmd@kangwon.ac.kr

2 송서영외 : 한국인 Lewis 혈액형군의유전자분석 35 서 Lewis 혈액형군은 Le a 와 Le b 항원을갖고있으며타액과혈장에도존재하고혈장으로부터항원을흡수하여그표현형을획득하며적혈구외의조직에도발현하는특징을갖고있다. 1) Lewis 항원은 19p13.31 염색체에존재하는 FUT2와 FUT3 유전자에의해형성된 α(1,3/1,4)fucosyltransferase (Lewis 효소 ) 와 α(1,2)fucosyltransferase (Secretory 효소 ) 의작용에의해생성된다. 2) Lewis 혈액형군의표현형은 FUT2와 FUT3 유전자의조합에의해결정되는데, Le b 항원은 FUT2 유전자에암호화된 Secretory 효소와 FUT3 유전자에암호화된 Lewis 효소의작용에의해생성되며, Le a 항원은단지 Lewis 효소의작용에의해서만생성된다. Secretory 효소는 ABO(H) 혈액형군및 Lewis 혈액형군의항원을타액, 혈장및체액등에분비하는역할을한다. 3,4) FUT2 유전자와 FUT3 유전자가모두발현되는경우에는 Le a 항원과 Le b 항원을모두생성하지만 Le a 항원보다 Le b 항원이적혈구표면에더선택적으로흡착되기때문에 Le(a b+) 로표현되고, FUT3 유전자만발현되고 FUT2 유전자의발현이없는경우에는 Le a 항원만이생성되어 Le(a+b ) 의적혈구표현형을갖게된다. FUT3 유전자가발현되지않으면 FUT2 유전자에관계없이 Le(a b ) 의표현형이된다. 2) 최근 FUT2와 FUT3 유전자의염기서열이알려지고추가적변이부위가밝혀지면서 5-8) 중합효소연쇄반응- 제한효소절편다형성분석법 (polymerase chain reactionrestriction fragment length polymorphism, PCRRFLP) 을이용한 Lewis 혈액형군의유전형검사방법이이용되고있다. 유전자변이를검출하기위한방법으로직접염기서열분석법및 PCR-RFLP법외에 single strand conformation polymorphism (SSCP), 9) heteroduplex analysis (HA), 10) protein trucation [A1] test (PTT), 11) denaturing gradient gel electrophoresis (DGGE) 등 12) 이소개되고있는데, SSCP법과 HA는민감도가떨어지며 RFLP법은해당하는제한효소가존재해야하며, PTT, DGGE법등은민감도가높지만비용이많이들고시간및노동력이많이소모되는단점을가지고있다. 서구및동양인에서 FUT2 유전자는 C302T, C357T, C379T, A385T, G428T, C480T 변이그리고 FUT3 유전자는 T59G, T202C, C314T, G484A, G508A 변이등 5-7) 다양하게알려져있으나국내에서는일부유전자에대 론 한결과만보고되고있다. 13) 본연구에서는 Lewis 혈액형의표현형을검사하고, Lewis 혈액형을결정짓는 FUT2 및 FUT3 유전자전체를직접염기서열분석법을이용하여각유전자형의분포및빈도를알아보고자하였다. 대상및방법 1. 대상검체건강검진환자중직접항글로불린검사가음성인 225명 ( 남자 124명, 여자 101명 ) 을대상으로하였고, 평균연령은 44.6±13.7세였다. 대상군의 ABO 혈액형분포는 A, B, O, AB형이각각 67명 (36.4%), 48명 (26.0%), 53명 (28.8%), 16명 (8.7%) 이었다. 2. 방법 1) Lewis 혈액형의표현형검사대상군 225명에대하여적혈구 Lewis 혈액형의표현형검사는단클론성항체를이용한젤카드법 (DiaMed R - ID card, Diamed AG, Swiss) 을이용하여검사하였다. EDTA가포함되어있는시험관에채혈한전혈을이용하여냉장보관후 2일이내에검사를시행하였고각검사시마다양성및음성대조군을같이검사하였다. 표현형이 Le(a+b+) 로나온경우에는직접항글로불린검사를시행하여면역글로블린에의한위양성여부를확인하였다. 검사방법은브로멜린용액 (DiaMed R - ID diluent 1, Diamed AG, Swiss) 0.5mL 에전혈 50μL 를혼합하고실온에서 10분간배양하여만든 5% 적혈구부유액 10μL 를각각항-Le a [A3] 혈청과항-Le b [A4] 혈청이들어있는미세관 (DiaMed R -ID card, Diamed AG, Swiss) 에첨가한후, 10분간 ID-Centrifuge R (Diamed AG, Swiss) 를이용하여원침하고결과를판정하였다. 2) Lewis 혈액형의유전자형검사 (1) 중합효소연쇄반응및직접염기서열분석 : DNA 분리를위해 K 3 EDTA 시험관에들어있는말초혈액에서단핵구세포층을분리하여 70 o C에보관후사용하였다. DNA 추출분리는 QIAamp DNA blood mini kit (Qiagen, USA) 를이용하였다. 시발체 (primer) 는 tk1/ tk2 (FUT2) 및 sn1/sn2 (FUT3) 로 PCR을시행하였다 (Table 1). FUT2 유전자에대한 PCR 반응은 94 o C 1분, 65 o C 2분, 72 o C 2분의조건을 30회반복시행하였으며반응액은분리한 DNA 1μL, 시발체 0.2μM, dntp 200 μm, Tris-HCl 10mM (ph 8.8), KCl 50mM, MgCl 2

3 36 Korean J Hematol Vol. 43, No. 1, March, mM, gelatin 0.1mg/mL, Taq polymerase 5U을첨가하여최종반응액이 50μL가되게하였다. FUT3 유전자에대한 PCR 반응은 Gene Amp PCR System 9600 thermal cycler (Perkin Elmer, USA) 를이용하여처음 1회는 94 o C 3분, 62 o C 2분, 72 o C 3분실시후, 94 o C 60초, 62 o C 90초, 72 o C 90초의조건을 30회반복시행하였으며반응액은분리한 DNA 1μL, 시발체 0.2μM, dntp 200μM, Tris-HCl 10mM (ph 8.3), KCl 50mM, MgCl 2 1.5mM, gelatin 0.1mg/mL, Taq polymerase 5U을첨가하여전체양을 50μL 로하였다. 직접염기서열분석은 PCR 산물 (FUT2 1,153bp, FUT3 1,615bp) 과새로고안한시발체 11개및 ABI PRISM R BigDye TM Terminator Cycle Sequencing Ready Reaction Kits (Applied Biosystems, USA) 와 ABI Prism 3100 Sequencer (Applied Biosystems, USA) 를이용하여직접염기서열분석을시행하였다 (Table 2). 직접염기서열분석은 PCR 산물 (20ng/μL) 3μL, 시발체 (3.2pmo/μL) 1 μl, dntp (10mM/μL) 1μL, BigDye TM Terminator (Applied Biosystems, USA) 3μL 및증류수 2μL 로총반응액 10μL 를 95 o C 3분과 95 o C 2분, 50 o C 15초, 72 o C 1분의조건을 25회반복시행하였다. (2) 제한효소절편다형성분석법 : 직접염기서열분석을시행한후, FUT2 및 FUT3 유전자중단일염기변이가높게나타나는부위를대상으로제한효소를탐색 Table 1. Primers and PCR conditions in FUT2 and FUT3 gene Gene Name Primers (5' 3') Annealing temperature ( o C) Fragment sizes (bp) FUT2 tk1 GGGCCTCCATCTCCCAGCTAAC 65 1,153 tk2 TGCTTCTCATGCCCGGGCACTC FUT3 sn1 TAAGCAGGAGATTGTCATCAATGACC 60 1,615 sn2 GTGCAGAGAGATCATCACGGCACG Table 2. Primers for nested PCR and direct sequencing in FUT2 and FUT3 gene Gene Name Primers (5' 3') Locations (U17894, AY870341) Locations (Sec2, Le) FUT2 f GGGCCTCCATCTCCCAGCTAAC f CCTTCATCCCGGCCCAGAT ~264 2r AACGACTGGATGGAGGAGGAA f CGCTACAGCTCCCTCATCTT r TGCTTCTCATGCCCGGGCACTC 1,146 1,167 1,050 1,071 FUT3 f TAAGCAGGAGATTGTCATCAATGACC 8,382 8, f ACTGCCGACCGCAAGGTGTACC 8,725 8, r GCAGCGCTGGATCTGGTTCAA 8,832 8, f TGGTGCCTGGGCTGCCGGGA 9,542 9,561 1,097 1,116 2r TCTCTCTTACCTGGGACCTCACACGCTGGG 9,619 9,639 1,174 1,194 r GTGCAGAGAGATCATCACGGCACG 9,973 9,996 1,518 1,551 Table 3. PCR primers of the nested PCR reaction for the RFLP analysis of FUT2 and FUT3 gene Gene Primer name Primer sequences (5' 3') Annealing temperature ( o C) Product sizes (bp) FUT2 tk3 CAGGATCCCCTGGCAGAACTACCACA*TT*AA tk4 AGCAGGGGTAGCCGGTGAAGCGGACGTACT tk5 AACGACTGGATGGAGGAGGAATACCGCA*G*C tk6 AGGTCCAGGAGCAGGGGTAGCCGGTGAAG FUT3 sn3 CCATGGCGCCGCTGTCTGGCCGCC*C sn4 AGTGGCATCGTCTCGGGACACACG *Artificially changed bases to create restriction enzyme site.

4 송서영외 : 한국인 Lewis 혈액형군의유전자분석 37 하여선정하고, RFLP 분석을위한시발체를고안하여 2차 PCR 반응을시행한후, 제한효소처리후전기영동하여판독하였다. FUT2 유전자의 C357T, A385T 변이와 FUT3 유전자의 T59G 변이에대하여 PCR RFLP 를시행하였다. 2차 PCR 반응은 1차 PCR 산물 1μL, 결합반응온도및시발체외에나머지는 1차 PCR과동일하게 30회씩반응시켰다 (Table 3). 각각의 PCR을시행한후특이증폭띠를확인하고 PCR 산물 5μL 를 MspI, AseI, AluI 2.5단위와제조사가제공한반응완충액으로 37 o C에서 2시간소화시킨후, 그중일부를 4% Metaphor R agarose gel (FMC Bioproducts, USA) 에전기영동한후결과를판독하였다 (Table 4). 결과 1. Lewis 혈액형의표현형검사총 225명에대한 Lewis 표현형검사결과, Le(a b +) 70.7%, Le(a+b ) 12.4%, Le(a b ) 11.1%, Le(a +b+) 5.8% 였다. 그리고 Le(a+b+) 13명중 11명이 O형이었고 Le(a+b ) 는대부분이 A형과 B형이었으며, Le(a b+) 와 Le(a b ) 는 ABO 혈액형과관련이없었다 (Table 5). 2. Lewis 혈액형의유전자형검사 1) 직접염기서열분석직접염기서열분석결과, FUT2 유전자에서는네개의변이, 즉 C357T (92.2%), A385T (56.9%), G244A (0.4%) 및 del396 (1.8%) 변이를발견하였다. 이중 G244A와 del396변이는현재까지보고되지않은변이이다. 그리고 FUT3 유전자에서는 7개의변이를, 즉 T59G (46.9%), G508A (30.4%), T202C (1.1%), C314T (1.1%), A1029G (0.7%), T1067A (3.0%) 및 G1242A (13.3%) 변이를발견하였다 (Table 6). T202C와 C314T 변이는동양인에게서는발견되지않고주로구미인에게서발견되는변이이며, A1029G와 G1242A 변이는현재까지알려져있지않은단일염기변이이다. Lewis 표현형및유전자형검사결과는 98.2% (221/225) 일치하였고, 유전자분석으로 Le(a+b+) 와 Le(a+b ) 형은구별할수없었다 (Fig. 1, 2). 2) 제한효소절편다형성분석제한효소절편다형성분석결과 (Fig. 3, 4), FUT2 유전자에서 C357T 및 A385T의분포는각각 93.6% 및 58.7% 그리고 FUT3 유전자에서 T59G의분포는 47.2% 를보였으며, 직접염기서열분석결과와비교하면 C357T 3 예 (wild type C357T homozygote), A385T 4예 (A385T heterozygote A385T homozygote), T59G 2예 (wild Table 4. Restriction enzymes for the detection of FUT2 and FUT3 gene mutations Fragment sizes (bp) Primer Restriction Restriction Reaction Gene Mutations pairs enzyme site buffer Wild-type Mutated FUT2 tk3/4 C357T AseI AT/TAAT M tk5/6 A385T AluI AG/CT L FUT3 sn3/4 T59G MspI C/CGG M Abbreviations: M, medium concentrated reaction buffer included Tris-HCl 10mM (ph 7.5), MgCl 2 10mM, Dithiothreitol 1mM and NaCl 50mM; L, low concentrated reaction buffer included Tris-HCl 10mM (ph 7.5), MgCl 2 10mM and Dithiothreitol 1mM. Table 5. The distribution of ABO blood group and Lewis phenotype Blood group Le(a+b+) Le(a b+) Le(a+b ) Le(a b ) Total A (30.2%) B (26.7%) O (33.3%) AB (9.8%) Total (%) 13 (5.8%) 159 (70.7%) 28 (12.4%) 25 (11.1%) 225 (100%)

38 Korean J Hematol Vol. 43, No. 1, March, 2008 Table 6.

Frequency (%) FUT2 C357T 415 (92.2) W 7 (3.1) H 21 (9.3) M 197 (87.6) A385T 256 (56.9) W 58 (25.8) H 78 (34.7) M 89 (39.

4) G508A 137 (30.4) W 113 (50.2) H 87 (38.7) M 25 (11.1) T202C 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) C314T 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) T1067A 14 (3.

9) M 2 (0.9) *Total number is 450 alleles, Total number is 225 cases.

5 38 Korean J Hematol Vol. 43, No. 1, March, 2008 Table 6. The frequencies of FUT2 and FUT3 base substitutions in Korean Gene name Nucleotide substitution Allele frequency (%)* Type Frequency (%) FUT2 C357T 415 (92.2) W 7 (3.1) H 21 (9.3) M 197 (87.6) A385T 256 (56.9) W 58 (25.8) H 78 (34.7) M 89 (39.6) G244A 2 (0.4) W 223 (99.1) H 2 (0.9) M 0 (0) del396 4 (1.8) FUT3 T59G 211 (46.9) W 69 (30.7) H 101 (44.9) M 55 (24.4) G508A 137 (30.4) W 113 (50.2) H 87 (38.7) M 25 (11.1) T202C 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) C314T 5 (1.1) W 220 (97.8) H 5 (2.2) M 0 (0) T1067A 14 (3.1) W 211 (93.8) H 12 (5.3) M 1 (0.4) A1029G 3 (0.7) W 222 (98.7) H 3 (1.3) M 0 (0) G1242A 60 (13.3) W 167 (74.2) H 56 (24.9) M 2 (0.9) *Total number is 450 alleles, Total number is 225 cases. Abbreviations: W, wild-type; H, mutant heterozygotes; M, mutant homozygotes. Fig. 1. Chromatograms of direct sequencing for FUT2 gene mutations. (A) C357T heterozygote mutant. (B) G385A heterozygote mutant. (C) G244A wild type. (D) del396 mutant.

송서영외 : 한국인 Lewis 혈액형군의유전자분석 39 Fig. 2. Chromatograms of direct sequencing for FUT3 gene mutations.

Lane M-20bp DNA ladder; lane 6-wild type; lane 1,3,4,5,8-heterozygote mutants; lane 7-homozygotic

Comparison of direct sequencing and PCR-RFLP for the detection of FUT2 and FUT3 gene mutation Fig. 3.

enzyme. Lane M-20bp DNA ladder; lane 1,3-wild type; lane 2,4,5,6,7,8heterozygote mutants.

enzyme. Lane M-20bp DNA ladder; lane 1,4-wild type; lane 2,3,5,6,7,8-heterozygote mutants.

3에위치하는 FUT2(Se) 와 FUT3 (Le) 유전자에의해발현되며 FUT2 유전자는 α(1,2)- 찰 FUT2 FUT3 C357T A385T T59G 92.2% 56.9% 46.

6 송서영외 : 한국인 Lewis 혈액형군의유전자분석 39 Fig. 2. Chromatograms of direct sequencing for FUT3 gene mutations. (A) T1067A heterozygote mutant. (B) T202C heterozygote mutant. (C) G1242A heterozygote mutant. (D) C314T heterozygote mutant. Fig. 4. Electrophoresis pattern for the detection of FUT3 gene mutation (T59G) using MspI restriction enzyme. Lane M-20bp DNA ladder; lane 6-wild type; lane 1,3,4,5,8-heterozygote mutants; lane 7-homozygotic mutants. Table 7. Comparison of direct sequencing and PCR-RFLP for the detection of FUT2 and FUT3 gene mutation Fig. 3. (A) Electrophoresis pattern for the detection of FUT2 gene mutation (C357T) using AseI restriction enzyme. Lane M-20bp DNA ladder; lane 1,3-wild type; lane 2,4,5,6,7,8heterozygote mutants. (B) Electrophoresis pattern for the detection of FUT2 gene mutation (A385T) using AluI restriction enzyme. Lane M-20bp DNA ladder; lane 1,4-wild type; lane 2,3,5,6,7,8-heterozygote mutants. type T59G homozygote, T59G heterozygote wild type) 에서위양성결과를보였다 (Table 7). 고 Lewis 항원은 19p13.3에위치하는 FUT2(Se) 와 FUT3 (Le) 유전자에의해발현되며 FUT2 유전자는 α(1,2)- 찰 FUT2 FUT3 C357T A385T T59G 92.2% 56.9% 46.9% Direct sequencing (415/450) (256/450) (211/450) 93.6% 57.8% 47.2% PCR-RFLP (421/450) (260/450) (212/450) fucosyltransferase를, 그리고 FUT3 유전자는당전이효소 α(1,3/1,4)-fucosyltransferase를생성한다. Le b 항원은 FUT2와 FUT3에의해생성된당전이효소의작용에의해만들어지며 Le a 항원은단지 FUT3에의해생성된당전이효소의작용에의해만들어진다. 2) 일반적으로 Lewis 혈액형군의표현형검사는단클론성항체

7 40 Korean J Hematol Vol. 43, No. 1, March, 2008 를이용한혈구응집반응을이용하는데, 적혈구의 Lewis 표현형은나이, 임신, 3) 알코올성췌장염, 간질환등 4) 여러생리적인조건에따라변화하는것으로알려져있으며검사에이용한시약의종류및비특이적인항 -Lewis 항체등에의해잘못검사될수있다 ) 특히임신중 Le(a b+) 인산모들에서 Le b 가소실되어 Le (a b ) 처럼나타나는데이는임신중증가되는지단백에 Le b 가결합되기때문으로생각되며이때항- Le b 가나타나기도한다. 3) 항-Lewis 항체는대부분실온에서잘반응하나그중 37 o C에서도응집이관찰되는경우도있고, 보체를부착시킴으로써항글로불린검사에양성을보이기도하며용혈성수혈부작용 8) 을일으키기도하므로 Lewis 혈액형군을정확하게검사할수있는검사법이필요할것으로생각한다. Ameno 등 19) 은몇종류의상품화된항-Lewis 항체를이용한검사에서같은환자에서다른표현형으로검사될수있으므로혈청학적검사로는 Lewis 혈액형을정확히결정하기어렵다고보고한바있다. 1987년부터 Lewis 혈액형군의표현형에단클론성항체를이용하면서적혈구 Lewis 표현형검사의예민도와특이도가증가하였으며유세포분석기 (flowcytometry), 효소면역측정법, 면역형광법등을이용한표현형검사도소개되고있다. 4-6) 최근 FUT2와 FUT3 유전자의염기서열이알려지고추가적변이부위가밝혀지면서 PCRRFLP를이용한 Lewis 혈액형군의유전형검사방법에대하여논의되고있다. 20,21) FUT2 유전자와 FUT3 유전자는최근 Kukowska- Latallo 등, 22) Rouquier 등 2) 과 Kelly 등 23) 에의해분리되었으며이들은 α(1,3/1,4)fucosyltransferase 와 α(1,2) fucosyltransferase를비활성화시키는 G428A 변이와 T59G 변이를보고하였다. Kudo 등 24) 은일본인의 FUT2 유전자중 A385T 변이와 C357T 변이를추가로발견하였고 PCR-RFLP법을이용하여 FUT2 유전자에서세가지의대립유전자를발견하고각각을 Se1, Se2 그리고 sej로명명하였다. 이들은일본인에서 FUT2 유전자의비활성화를일으키는 A385T 변이는 C357T 변이와항상같이일어난다고하였다. 서구및동양인에서 FUT2 유전자는 C302T, C357T, C379T, A385T, G428T, C480T 변이그리고 FUT3 유전자는 T59G, T202C, C314T, G484A, G508A 변이등다양하게알려져있으나 5-7,25) 국내에서는일부유전자에대한결과만보고되고있다. 13) 본연구에서는직접염기서열분석결과, FUT2 유전자에서 C357T (92.2%), A385T (56.9%) 와추가로 G244A (0.4%) 및 del396 (1.8%) 변이를발견하였고, FUT3 유전자에서 T59G (46.9%), G508A (30.4%) 와 T1067A (3.1%) 변이그리고구미인에만알려진 T202C (1.0%), C314T (1.0%) 와추가로현재까지보고가안된 A1029G (0.7%) 와 G1242A (13.3%) 변이를발견하였다. Lewis 표현형및유전자형검사결과는 98.2% (221/225) 일치하였고, 유전자분석으로 Lewis (a+b+) 와 Lewis(a+b ) 형은구별할수없었다. PCR-RFLP법으로 FUT2 및 FUT3 유전자중, T59G, C357T 및 A385T 변이에대하여분석한결과, PCR- RFLP법은직접염기서열분석법과비교하여 C357T 3 예, A385T 4예, T59G 2예에서차이를보였다. PCR- RFLP법에서차이를보인것은제한효소의작용이불완전하거나잘라진산물의전기영동시판독의실수인것으로생각한다. 본연구결과한국인에서 FUT2 및 FUT3 유전자에서의단일염기변화의분포를알수있었으며, Lewis 혈액형과관련된 FUT2 및 FUT3 유전자분석결과, 현재까지알려져있지않은단일염기변이 4개와추가로동양인에서알려져있지않은단일염기변이 2개를발견하였다. 본연구결과는 Lewis 혈액형군의표현형및유전자에관한분석및 Lewis 혈액형군관련질환의연구에활용될수있을것으로생각한다. 요약배경 : Lewis 혈액형군의표현형은 FUT2 및 FUT3 유전자에의해결정된다. 본연구에서는직접염기서열분석 (direct sequencing) 을시행하여 Lewis 혈액형을결정짓는 FUT2 및 FUT3 유전자의분포를분석하고 PCR- RFLP (restriction fragment length polymorphism) 법과비교하고자하였다. 방법 : 정상인 225명을대상으로적혈구에서 Lewis 혈액형군의표현형을검사하였고, 단핵구층을이용하여 FUT2 및 FUT3 유전자를분석하였다. Lewis 혈액형군의표현형검사는젤카드법을이용하여검사하였고, 유전자검사는직접염기서열분석을시행하였으며, FUT2 유전자의 C357T, A385T 변이와 FUT3 유전자의 T59G 변이에대하여 PCR-RFLP를시행하였다. 결과 : Lewis 표현형검사결과, Le(a b+) 70.7%, Le (a+b ) 12.4%, Le(a b ) 11.1%, Le(a+b+) 5.8% 였고, 직접염기서열분석결과, FUT2 유전자에서 C357T (92.2%), A385T (56.9%) 와현재까지보고되지않은새로운 G244A (0.4%) 및 del396 (1.8%) 변이를발견하였

8 송서영외 : 한국인 Lewis 혈액형군의유전자분석 41 고, FUT3 유전자에서 T59G (46.9%), G508A (30.4%), T1067A (3.0%) 와구미인에만알려진 T202C (1.1%), C314T (1.1%) 와현재까지보고되지않은 A1029G (0.7%) 및 G1242A (13.3%) 변이를발견하였다. PCR- RFLP 및직접염기서열분석법을비교한결과, PCR RFLP법은 C357T 1예, A385T 4예, T59G 2예에서불일치하였으며그외에는직접염기서열분석결과와일치하였다. 결론 : 한국인에서 FUT2 및 FUT3 유전자에서의단일염기변화의분포를알수있었다. 또한 FUT2 및 FUT3 유전자분석법중에서직접염기서열분석법이기존의 PCR-RFLP법에비해정확함을알수있었다. 참고문헌 1) McCurley RS, Recinos A 3rd, Olsen AS, et al. Physical maps of human alpha(1,3)fucosyltransferase genes FUT3-FUT6 on chromosomes 19p13.3 and 11q21. Genomics 1995;26: ) Rouquier S, Lowe JB, Kelly RJ, Fertitta AL, Lennon GG, Giorgi D. Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H locus-related DNA restriction fragments. Isolation of a candidate for the human Secretor blood group locus. J Biol Chem 1995;270: ) Hammer L, Månsson S, Rohr T, et al. lewis phenotype of erythrocytes and Le b -active actine glycolipid in serum of pregnant women. Vox Sang 1981;40: ) Stigendal L, Olsson R, Rydberg L, Samuelsson BE. Blood group Lewis phenotype on erythrocytes and in saliva in alcoholic pancreatitis and chronic liver disease. J Clin Pathol 1984;37: ) Liu TC, Chang JG, Lin SF, et al. Lewis (FUT3) genotypes in Taiwanese, Thai, and Filipino populations. Ann Hematol 2000;79: ) Larson G, Svensson L, Hynsjӧ L, Elmgren A, Rydberg L. Typing for the human lewis blood group system by quantitative fluorescence-activated flow cytometry: large differences in antigen presentation on erythrocytes between A(1), A(2), B, O phenotypes. Vox Sang 1999;77: ) Chang JG, Yang TY, Liu TC, et al. Molecular analysis of secretor type alpha(1,2)-fucosyltransferase gene mutations in the Chinese and Thai populations. Transfusion 1999;39: ) Costache M, Cailleau A, Fernandez-Mateos P, Oriol R, Mollicone R. Advances in molecular genetics of alpha-2- and alpha-3/4-fucosyltransferases. Transfus Clin Biol 1997;4: ) Serpa J, Almeida R, Oliveira C, et al. Lewis enzyme (alpha1-3/4 fucosyltransferase) polymorphisms do not explain the Lewis phenotype in the gastric mucosa of a Portuguese population. J Hum Genet 2003; 48: ) Ogilvie EM, Fife MS, Thompson SD, et al. The -174G allele of the interleukin-6 gene confers susceptibility to systemic arthritis in children: a multicenter study using simplex and multiplex juvenile idiopathic arthritis families. Arthritis Rheum 2003; 48: ) Buono P, Pasanisi F, Nardelli C, et al. Six novel mutations in the proopiomelanocortin and melanocortin receptor 4 genes in severely obese adults living in southern Italy. Clin Chem 2005;51: ) Andersson B, Ying JH, Lewis DE, Gibbs RA. Rapid characterization of HIV-1 sequence diversity using denaturing gradient gel electrophoresis and direct automated DNA sequencing of PCR products. PCR Methods Appl 1993;2: ) Suh IB, Kim YK. Relationship of Helicobacter pylori IgG seroprevalence with Lewis (a,b) blood group phenotype/genotype. Korean J Blood Transfus 2001; 12: ) Napierala D, Garcia-Rojas X, Sam K, et al. Mutations and promoter SNPs in RUNX2, a transcriptional regulator of bone formation. Mol Genet Metab 2005; 86: ) Cowles JW, Cox A, McMican A, Blumberg N. Comparison of monoclonal antisera with conventional antisera for Lewis blood group antigen determination. Vox Sang 1987;52: ) Young WW Jr, Johnson HS, Tamura Y, et al. Characterization of monoclonal antibodies specific for the Lewis a human blood group determinant. J Biol Chem 1983;25:258: )Rouger P, Noizat-Pienne F, Le Pennec PY. Advances in the use of monoclonal antibodies for blood group testing. Transfus Clin Biol 1997;4: ) Good AH, Yau O, Lamontagne LR, Oriol R. Serological and chemical specificities of twelve monoclonal anti-le a and anti-le b antibodies. Vox Sang 1992;62: ) Ameno S, Ameno K, Kinoshita H, Tanaka N, Ijiri I. Lewis genotyping by the PCR-RFLP method in a Japanese population and its evaluation in forensic analysis. Int J Legal Med 1997;110:232-4.

9 42 Korean J Hematol Vol. 43, No. 1, March, ) Nishihara S, Narimatsu H, Iwaski H, et al. Molecular genetic analysis of the human Lewis histo-blood group system. J Biol Chem 1994;269: ) Yazawa S, Oh-kawara H, Nakajima T, Hosomi O, Akamatsu S, Kishi K. Histo-blood group Lewis genotyping from human hairs and blood. Jpn J Hum Genet 1996;41: ) Kukowska-Latallo JF, Larsen RD, Nair RP, Lowe JB. A cloned human cdna determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group alpha(1,3/1,4)fucosyltransferase. Genes Dev 1990;4: ) Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Lowe JB. Sequence and expression of a candidate for the human secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). Homozygosity for an enzymeinactivating nonsense mutation commonly correlates with the non-secrector phenotype. J Biol Chem 1995;270: ) Kudo T, Iwasaki H, Nishihara S, et al. Molecular genetic analysis of the human Lewis histo-bood group system. II. Secrector gene inactivation by a novel single missense mutation A385T in Japanese nonsecretor individuals. J Biol Chem 1996;271: )Liu Y, Koda Y, Soejima M, Uchida N, Kimura H. PCR analysis of Lewis-negative gene mutations and the distribution of Lewis alleles in a Japanese population. J Forensic Sci 1996;41:

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory