TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

Size: px
Start display at page:

Download "TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme"

Transcription

1 PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가 2 Agarose 구매시 Buffer 증정 추가 1 Package ( 택 1+ 택 1) 최대 40% 할인 Agarose 구매시, 50xTAE Buffer (1 L) 1 병또는 10xTBE Buffer (1 L) 1 병증정 cdna Synthesis Kit 3 종중택 1 + qpcr 5 종중택 1

2 TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polymerase 일본코타카라섬 ( 화산 ) 에서고온미생물인 Thermococcus Kodakaraensis 로부터추출하여일반적인 Taq Polymerase 보다높은신장력과정확성을가진효소 ReverTra Ace 효소의구조및기능 d Comparison of Properties with the Conventional Value for indicated Property KOD DNA Polymerase Pfu Taq Origin Archaea Archaea Bacteria Deduced molecular mas 90.0 kda 90.1 kda 93.9 kda Optimum temperature Optimum ph at Thermostability(half-life) 95,12 h/100,3.0 h 95, 6h/100, 2.9h h exonuclease activity exonuclease activity Terminal transferase activity Processivity (bases) > 300 < 20 ND Elongation rate (bases/s) 106 ~ 높은 Reverse Transcription 효율 Pfu, Taq 등일반적인 DNA Polymerase 와의신장력비교 A B C A : ReverTra Ace B : Reverse Transcriptase (Company A) C : Reverse Transcriptase (Company B) Incubation Time (sec.) KOD Pfu Taq PCR Enzyme PCR 과 Gel Loading 까지한번에가능 Quick Taq TM HS DyeMix Loading dye 까지포함되어, agarose gel 에서바로확인가능 2x master mix 로편리한사용, 높은합성효율 최대 4 Kb 까지증폭가능 Quick Taq HS DyeMix* Primers PCR-grade water 높은증폭율로범용적으로다양한 PCR 에사용가능 Blend Taq /Blend Taq -Plus- 일반 와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error rate 최대 23 Kb 까지증폭가능 M 간편하지만강력한증폭효율 2.9 kb Template : Human Genomic DNA (50 ng/50 μl reaction scale) M : 1 kb ladder 1 : Quick Taq TM HS DyeMix 2 : rtaq (Hot-start) 3 : rtaq DNA polymerse 4 : C 社 Taq 94, 2 min. 94, 30 sec. 60, 30 sec. 68, 3 min. Forward Primer : AATGGATGATTTGATGCTGTCCC Reverse Primer : ATAAGAGCTCCCAAGACTTAG Final concetration : 2 µm 40 cycles (lacking proofreading activity) Missincorporation Pausing (lacking proofreading activity) (having proofreading activity) Repairing (lacking proofreading activity) 품명 용량 Cat. No. 할인가 (VAT별도) Quick Taq TM HS DyeMix 1.25 ml x 2 (100 rxns) TODTM ,000원 Blend Taq TOBTQ ,000원 250 U (200 rxns) Blend Taq -Plus- TOBTQ ,000원 주문및상담 /

3 High Quality PCR Enzyme 높은정확도를요구하는 Cloning 에적합 KOD -Plus- / KOD -Plus- Neo Hot-start PCR로 PCR specificity 향상 PCR 반응 buffer의적정화로증폭길이, 증폭효율향상 최대 24 Kb까지증폭가능 Taq DNA Polymerase 보다 80배높은 PCR Fidelity PCR 이어려운 Crude, GC-rich Target 에최적 KOD FX / KOD FX Neo Anti-KOD antibody 를포함해 hot-start PCR 가능 Direct-PCR 가능 최대 40 Kb 까지증폭가능 KOD -Plus- Neo KOD -Plus- KOD FX Pfu DNA Polymerase Long PCR enzyme (A company) Taq DNA Polymerase Mutation frequency(number of misincorporated bases/100,000 bases) 품명용량 Cat. No. 할인가 (VAT 별도 ) KOD -Plus- TOKOD ,000 원 KOD -Plus- Neo TOKOD ,000원 200 U (200 rxns) KOD FX TOKFX ,000원 KOD FX Neo TOKFX ,000원 cdna Synthesis Kit Real-time PCR 용 cdna 합성용 Kit ReverTra Ace qpcr RT Kit / 사용목적에따라 master mix 와 kit 선택가능 RNA 를제거하는추가 RNase H treatment step 이없어 15 분내모든실험완료 RNA sample cdna 5x RT 37 15min 98 5min gdna 제거를위한 Remover 가함께포함된 Kit ReverTra Ace qpcr RT With gdna Remover 편리한 master mix 의형태 오염된 gdna 로부터생기는 error 를막을수있음 Digestion of genomic DNA (DNase Ⅰ treatment) cdna synithesis (revers transcription) RNA sample cdna (gdna-free) 4x DNA (with gdna Remover) 37 5min 5x RT Ⅱ 37 15min 98 5min 14 kb 이상의 High Quality cdna 합성용 Kit Random primer reaction : 30, 10 min ReverTra Ace -α- Kit Reverse transcription incubation : 42, 20 min Inactivation : 98, 5 min 품명용량 Cat. No. 할인가 (VAT 별도 ) ReverTra Ace qpcr RT Mix TOFSQ ,000 원 ReverTra Ace qpcr RT 200 rxns TOFSQ ,000원 ReverTra Ace qpcr RT With gdna Remover TOFSQ ,000원 ReverTra Ace -α- kit 100 rxns TOFSK ,000원

4 Agarose 구매시 Buffer 증정! 증정 Certified Agarose Powders GQT(genetic quality tested) grade DNase-free, RNase-free, DNA binding-free 의다양한 agarose Agarose 구매시, 50x TAE buffer (1 L) 1 병또는 10x TBE buffer (1 L) 1 병증정! Agarose 선택가이드 1 Kb ~ 5 Mb Kb ㅇ PFGE, FIGE 에적합 Megabase Agarose Low background 염색결과제공 큰 size의 DNA 분리확인 20 Kb 15 Kb 100 bp ~ 20 Kb... ㅇ BEST 범용적인실험에적합 Low-melt Agarose In-gel digestion, DNA prep Molecular Biology Agarose Blotting, DNA/RNA prep, enzyme treat, cloning 10 Kb 5 Kb 1 Kb 800 bp 600 bp 400 bp 200 bp 20 ~ 1,000 bp... ㅇ 10 ~ 200 bp... ㅇ 1,000 bp 이하 PCR 산물확인 PCR Low-melt Agarose In-gel application PCR Agarose 작은 size 의 DNA 조각확인 작은 PCR 산물, Primer 확인 Low Range Ultra Agarose Superior resolution 품명용량 Cat. No. 정상가 (VAT 별도 ) Certified TM Megabase Agarose 125 g BR ,500 원 500 g BR ,867,500 원 Certified TM Low-melt Agarose 125 g BR ,500 원 Certified TM Molecular Biology Agarose 500 g BR ,000 원 Certified TM PCR Low-melt Agarose Certified TM PCR Agarose 125 g BR ,000원 500 g BR ,809,000원 125 g BR ,500원 500 g BR ,052,400원 Certified TM Low Range Ultra Agarose 125 g BR ,500 원 주문및상담 / ( 주 ) 비엠에스는본사에서판매한제품에한해서비스를보장합니다. Copyrightc 2013 BMS Co., Ltd. All rights reserved. 013BM07A

5 qpcr 2x 의 Ready-to-Use Solution, Hot-start System Real-time PCR / SYBR Green Real-time PCR & -Plus- NEW Real-time PCR 에서도최대 2 Kb 까지 Target 증폭가능 KOD SYBR qpcr Mix Flexible primer setting 가능 우수한내열성으로 GC-rich 샘플에용이 Melting Curve 분석결과, 높은 Specifity 로실험의재현성을높임 Crude 샘플에서도 direct-qpcr 가능 SYBR Green Real-time PCR Amplification curve Melting curve Enzyme Amplification size Conventional (Taq based) Taq DNA Polymerase 70 ~ 150 bp (Max. 300 bp) KOD SYBR qpcr Mix KOD DNA Polymerase [exo(-) mutant] 70 bp ~ 2 kb Company A High GC Targetgets Susceptible Not susceptible Inhibition by impurities in crude samples Susceptible Not susceptible (Suitable for amplification from crude specimens) 고효율의 2x Solution THUNDERBIRD TM SYBR / Probe qpcr Mix 특허출원된 PCR enhancer 를통해합성효율대폭증대 품명 용량 Cat. No. 할인가 (VAT별도) Real-time PCR 1 ml x 5 TOQPK ,000원 SYBR Green Real-time PCR (200 rxns) TOQPK ,000원 NEW KOD SYBR qpcr Mix TOQKD ,000원 THUNDERBIRD TM qpcr SYBR Mix 1.67 ml x 3 (200 rxns) TOQPS ,000원 THUNDERBIRD TM qpcr Probe Mix TOQPS ,000원 Package ( 택 1+ 택 1) 구매시, 45 만원! 최대 40% 할인 A mrna 의 Degradation 을막아 cdna 합성효율증대 PCR Enhancer 를통해합성효율대폭증대 cdna Synthesis Kit B qpcr 품명 Cat. No. 품명 Cat. No. ReverTra Ace qpcr RT Kit ReverTra Ace qpcr RT Kit TOFSQ-101 TOFSQ Real-time PCR TOQPK-101 SYBR Green Real-time PCR TOQPK-201 ReverTra Ace qpcr RT with gdna Remover TOFSQ-301 THUNDERBIRD TM qpcr Probe Mix TOQPS-101 THUNDERBIRD TM qpcr SYBR Mix TOQPS-201 모든세트구성적용됩니다. NEW KOD SYBR qpcr Mix TOQKD-201 주문및상담 /

6 One-step RT Kit cdna 합성과 PCR 을한번에! RT-PCR Quick Thermus thermophilus HB8으로부터유래된 Tth 이용 과정이단순하고, nuclease free water까지포함되어오염에대한위험감소 낮은 Copy 에서도증폭가능한높은 Sensitivity Company A RT-PCR Quick B B 450 bp In vitro translation 결과 template human G3PDH gene 대용량 qpcr 에적합한제품으로 cdna 합성과 qpcr 을한번에! RNA-direct Real-time PCR / RNA-direct SYBR Green Real-time PCR 2x master mix 로쉽게 one-step 으로 real-time PCR 가능 간소화한실험을통해샘플오염을방지하여결과의재현성을높일수있음 높은 Sensitivity Fluorescence (F1) Cycle RNA-directTM SYBR Green Realtime PCR Company A 품명 용량 Cat. No. 할인가 (VAT별도) RT-PCR Quick 50 rxns TOPCR ,000원 RNA-direct TM Real-time PCR 0.5 ml x 5 TOQRT ,000원 RNA-direct TM SYBR Green Real-time PCR (100 rxns) TOQRT ,000원 Immunoreaction Enhancer Solution Western Blot, ELISA 용신호증폭 Buffer Can Get Signal IHC 및 Fluorescent Assay 용신호증폭 Buffer Can Get Signal Immunostain Signal-to-noise 가개선되어, signal 증폭효과 Antigen-antibody reaction 으로 sensitivity 향상 Signal 은높게, Background 는낮게도출된결과 Conventional Conventional Can Get Siganl (TBS-T) Can Get Siganl (TBS-T) Sample : Cultured bovine adrenal medulla cells 1. Control (H 2O) 2. Insulin (1 nm, stimulated for 5 min) 3. Insulin (10 nm, stimulated for 5 min) 4. Insulin (100 nm, stimulated for 5 min) p-akt p-erk1 p-erk2 품명용량 Cat. No. 할인가 (VAT 별도 ) Can Get Signal 250 ml x 2 (250 rxns) TONKB ,000 원 Can Get Signal Immunostain (Starter Set) each 5 ml TONKB ,000 원

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long 2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H

More information

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%

More information

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot 2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library

More information

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo

DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase High Quality Polymerase General PCR / Colony PCR High Fidelity PCR (80-fo 2018 TOYOBO BIG SALE 기간 : 2018년 7월 16일 ~ 9월 21일까지 TOYOBO 전제품 최대 33% SALE PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis Kit qpcr Enzyme One-Step / Two-Step Kit Immuno Enhancer High Quality Enzyme

More information

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua

2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua 2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

KOD FX Blend Taq -Plus- Crude Sample 또는 GC-rich Target과 같이 PCR이 어려운 샘플에 최적 높은 PCR 성공율 GC-rich 또는 crude sample(blood, bacteria, fungi, yeast 등)에서 높은 증폭

KOD FX Blend Taq -Plus- Crude Sample 또는 GC-rich Target과 같이 PCR이 어려운 샘플에 최적 높은 PCR 성공율 GC-rich 또는 crude sample(blood, bacteria, fungi, yeast 등)에서 높은 증폭 KOD -Plus- 높은 정확성과 증폭율로 Cloning에 적합한 PCR enzyme TOYOBO 겨울 할인 행사 Conventional PCR enzyme TOYOBO 대표 제품, KOD Polymerase란? PCR 관련 제품 20%할인 일본 코타카라섬(화산)에서 고온 미생물인 Thermococcus kodakaraensis로부터 추출한 고온 증폭 효소로

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio 20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection

More information

Western Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch

Western Blot Consumable Best Seller Protein Standards Dual Color All Blue Kaleidoscope TM Dual Xtra Prestained Ch 2018 년 4 월 16 일 ~ 6 월 15 일까지 2018 비엠에스할 인 행 사 AbD Serotec 이 Bio-Rad 와하나가되었습니다. 10,000 여종의 Primary Antibody 를검색해보세요! Western Blot 장비 & 시약 5+2 증정 Western Blot Consumable Best Seller - Protein Standards -

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

3월 온라인 교육

3월 온라인 교육 2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

Protein Gel TGX TM Stain-Free Fast Cast Acrylamide Kit Resolving, stacking gel 을별도로굳히지않고한번에 casting UV 하에단백질전체량 detection 가능 Stain-Free 란? 별도염색과정 (Coo

Protein Gel TGX TM Stain-Free Fast Cast Acrylamide Kit Resolving, stacking gel 을별도로굳히지않고한번에 casting UV 하에단백질전체량 detection 가능 Stain-Free 란? 별도염색과정 (Coo 2017 비엠에스 할인행사 행사기간 : 2017년 4월 24일 ~ 6월 23일까지 300만원이상구매시 VELP Vortexer CLASSIC Vortex mixer Protein Gel Protein 정량 / IP 시약 Antibody Western Blot Buffer 소모품 500 만원이상구매시 VWR Heat Block or Manual Pipette

More information

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li

01 Cloning AccuRapid Cloning Kit NEW 3 Gene Cloning Service 4 AccuPower Ligation PreMix 6 T4 DNA Ligase 7 Thermostable Thermus filiformis (Tfi) DNA Li Cloning DNA Amplification DNA Preparation Cloning (Cloning Kit & Gene Cloning Service) Phone: 042-930-8793 Email: genesynthesis-support@bioneer.co.kr Cloning (Ligase) Phone: 1588-9788 (ext.4->2) DNA Amplification

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

Cloning=Clontech In-Fusion Cloning

Cloning=Clontech  In-Fusion Cloning Cloning 을위한모든것 2014-06-18 다카라코리아바이오메디칼 Contents Cloning Restriction Enzyme General Restriction Enzyme QuickCut Restriction Enzyme Cloning Restriction Enzyme/Ligation TA Cloning In-Fusion Cloning TaKaRa

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein

01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification

More information

Sample Preparation SureBeads TM Magnetic Beads for Immunoprecipitation Protein A 나 Protein G 가결합된형태의 Magnetic Bead + Magnetic Rack System Centrifugati

Sample Preparation SureBeads TM Magnetic Beads for Immunoprecipitation Protein A 나 Protein G 가결합된형태의 Magnetic Bead + Magnetic Rack System Centrifugati 2016 비엠에스 연말할인행사 2016 년 10 월 17 일 ~ 12 월 16 일까지 Western Blot 장비 / 시약특별이벤트 PCR/qPCR 시약 / 소모품특별이벤트 1 Sample Preparation SureBeads Protein 정량시약류 /HOT DEAL/ Protein Marker Reverse Transcription iscript cdna

More information

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-

01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC- Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein

More information

뉴스지14호-칼라

뉴스지14호-칼라 2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7

More information

Pierce-Plus-Alpha.pdf

Pierce-Plus-Alpha.pdf Save 40% on antibodies Primary antibody 전제품 40% 할인가로만나보세요 Count on Invitrogen 42,000 antibodies highly validated primary and secondary antibodies in our portfolio and growing 4,500 primary conjugated antibodies

More information

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) + 20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time

More information

뉴스레터6호F?2??訝

뉴스레터6호F?2??訝 February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS

More information

증정 Bio-Rad 가제안하는 FAST Western Blot! FAST Western Blot 기존 acrylamide/bis solution FastCast TM TGX acrylamide solution Gel 준비 (Gel solution 준비 - casting

증정 Bio-Rad 가제안하는 FAST Western Blot! FAST Western Blot 기존 acrylamide/bis solution FastCast TM TGX acrylamide solution Gel 준비 (Gel solution 준비 - casting Bio-Rad 연말할인행사 기간 : 2015 년 10 월 19 일 ~ 12 월 18 일까지 FAST Western Blot Best Western Blot 을위한시약 & 소모품 Real-Time PCR Reagents 행사제품 400 만원이상구매시, Integra PIPETBOY ACU 증정 ( 색상랜덤 ) 증정다양한 application 에따라흡입 / 분주속도조절가능

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Bio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미

Bio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미 Bio-Rad 할인행사, 비엠에스와함께하세요! 성공적인 PCR 실험을위한 Total Solution! 기간 : 2012 년 10 월 15 일 ~12 월 14 일 Gel Documentation System 과개인용 PCR 을특별한가격으로만나보세요! 버튼클릭한번만으로이미지획득까지! Gel Doc EZ system "UV tray 포함 " 스마트한개인용 PCR

More information

성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution

성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution 성공적인 Western Blot 을위한 Total Solution 기간 : 2013 년 4 월 22 일 ~ 6 월 14 일 Mini-PROTEAN Tetra & Power Supply 구매시, 전기영동 Plastic 소모품, Acrylamide/Bis Solution TGX Gel 6 box 구매시, 전기영동장치 LaboGene tube 50 ml 1 box

More information

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다.

프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. 프로메가 2018 여름이벤트 BIG SALE 행사기간 2018년 8월 06일 ~ 9월 14일 *본 행사지에 표기된 금액은 부가세 별도 금액입니다. *단가 계약 및 입찰은 행사에서 제외됩니다. EtBr 을아직사용하신다면? 일회용 Gel extractor 를사용해보세요! 내몸은소중하니깐 ~~~ 15ul minimum elution 이가능합니다!! 프로메가 Steady

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR

More information

SMARTer Sequencing Kits for Next Generation Sequencing

SMARTer Sequencing Kits for Next Generation Sequencing Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library

More information

Chapter 11

Chapter 11 Chapter 15 RNA Polymerase II: Basal Transcription 1 Eukaryotic and bacterial RNA polymerases differ in some aspects 1. eukaryotes have three RNA polymerases, with one each specifically dedicated to rrna,

More information

Print

Print 2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection

More information

Chapter 4. Bacteria (the first microbes)

Chapter 4. Bacteria (the first microbes) - DNA 정제후클로닝을위한효소적절단과연결필요 -> restriction enzyme, ligase 가중요 1. DNA 조작효소범위 - 촉매반응에따라 5 분류 1. Nuclease : 핵산분자의절단, 단편화 2. Ligase : 핵산분자의연결 3. Polymerase : DNA 사슬합성 4. Modifying enzyme : 화학기능기의첨가, 제거 5. Topoisomerase

More information

BMS Mega Sale 행사기간 : 2015 년 5 월 29 일까지

BMS Mega Sale 행사기간 : 2015 년 5 월 29 일까지 BMS Mega Sale 행사기간 : 2015 년 5 월 29 일까지 V3 1 Separate Proteins Western Workflow 15 분 Stain-free gel 사용시, 300V, 15 분만에전기영동완료 2 Visualize Separation 1 분 UV 를조사하여 coomassie stain 없이 1 분만에이미지획득 Speed 2 시간안에실험완료

More information

Statistical Data of Dementia.

Statistical Data of Dementia. Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.

More information

³»Áö_1È£_0107L

³»Áö_1È£_0107L Copyright(c) KONIBP All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 49 50 51 52 53 54 55 56 57 58 59

More information

Celebrate DNA milestones & innovations 1953, Rosalind Franklin는 X-ray의 회전 굴절 모양에 대한 연구를 하였으며 이를 기반으로 James Watson과 Francis Crick는 DNA의 구조에 대한 논문을 발표 하

Celebrate DNA milestones & innovations 1953, Rosalind Franklin는 X-ray의 회전 굴절 모양에 대한 연구를 하였으며 이를 기반으로 James Watson과 Francis Crick는 DNA의 구조에 대한 논문을 발표 하 Celebrating 60 years in DNA Discovery 다양한 할인 혜택을 만나보세요 행사 기간 : 2013년 5월 20일부터 2013년 6월 28일까지 lifetechnologies.com/dna60 1 Celebrate DNA milestones & innovations 1953, Rosalind Franklin는 X-ray의 회전 굴절 모양에

More information

유성감속기_K_170404

유성감속기_K_170404 Precision Planetary Gearbox Precision Planetary Gearbox SAC Series SSS Series SSC Series SAS Series SSW Series SAW Series 02 SSS Series 6 ~ 11 SAS Series 12 ~ 17 SSW Series 18 ~ 23 SAW Series 24 ~ 29 SSC

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -

More information

Slide 1

Slide 1 2013 년대리점집체교육 Exiqon 2013 년 2 월 21 일 ( 목 ) 1 Agenda 1. mirna 란무엇인가? 2. LNA 기술의장점 3. Exiqon 제품 RNA 샘플추출 cdna 합성 qpcr Array Northern blot/in situ Hybridization Inhibitor 4. 주문방법 2 이것만은꼭기억해주세요! 1. mirna 가무엇이고어디에쓰이는지안다

More information

LUXEON A DS100 LUXEON A LUXEON A LED. LED. LUXEON A Tj 85 C., LUXEON A LED 3 MacAdam LED..,,,,. Tj 85 C.

LUXEON A DS100 LUXEON A LUXEON A LED. LED. LUXEON A Tj 85 C., LUXEON A LED 3 MacAdam LED..,,,,. Tj 85 C. LUXEON A DS100 LUXEON A LUXEON A LED. LED. LUXEON A Tj 85 C., LUXEON A LED 3 MacAdam LED..,,,,. Tj 85 C. ...3...3...3...3...4 LUXEON A...4 = 85 C...4...5...6...7 JEDEC...7...8...9...10...10 vs....11...12...13...14...16...18...19...20...21

More information

성공적인 Western Blot을 위한 선택! 20% 할인 + 증정 Protein Electrophoresis & Transfer System 품번 품명 행사가 (원) BR MP Tetra Cell 1.0, 10-well 1,395,000 BR165-80

성공적인 Western Blot을 위한 선택! 20% 할인 + 증정 Protein Electrophoresis & Transfer System 품번 품명 행사가 (원) BR MP Tetra Cell 1.0, 10-well 1,395,000 BR165-80 성공적인 Western Blot을 위한 선택! Protein Electrophoresis & Transfer System BR165-8001 MP Tetra Cell 1.0, 10-well 1,395,000 BR165-8025 MP Tetra Cell/PP Basic 1.0, 10-well 1,994,000 BR165-8026 MP Tetra Cell/PP

More information

김도희_HT protein expression 표준 보고서_v1.5

김도희_HT protein expression 표준 보고서_v1.5 Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX

More information

목차 1. 제품 소개... 4 1.1 특징... 4 1.2 개요... 4 1.3 Function table... 5 2. 기능 소개... 6 2.1 Copy... 6 2.2 Compare... 6 2.3 Copy & Compare... 6 2.4 Erase... 6 2

목차 1. 제품 소개... 4 1.1 특징... 4 1.2 개요... 4 1.3 Function table... 5 2. 기능 소개... 6 2.1 Copy... 6 2.2 Compare... 6 2.3 Copy & Compare... 6 2.4 Erase... 6 2 유영테크닉스( 주) 사용자 설명서 HDD014/034 IDE & SATA Hard Drive Duplicator 유 영 테 크 닉 스 ( 주) (032)670-7880 www.yooyoung-tech.com 목차 1. 제품 소개... 4 1.1 특징... 4 1.2 개요... 4 1.3 Function table... 5 2. 기능 소개... 6 2.1 Copy...

More information

02-³í´Ü1

02-³í´Ü1 Molecular and Cellular Biology News 1 Molecular and Cellular Biology News 4 2010 2 Molecular and Cellular Biology News 3 Molecular and Cellular Biology News 4 2010 4 Molecular and Cellular Biology News

More information

슬라이드 1

슬라이드 1 New PCR Instruments 2013. 2. 21 다카라코리아바이오메디칼 Agenda FAST PCR이란? New FAST PCR Instrument _ TP450 New PCR Instrument _ TP350 기기캠페인소개 PCR FAST 관련 PCR 제품관련제품 최고수준의정확성 & 최고의신장속도 ( 신장성 5sec/kb) PrimeSTAR Max

More information

슬라이드 1

슬라이드 1 LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

Chapter 11

Chapter 11 15.4 RNA polymerase II core promoter core promotor 지역은전사개시부위에서위로 40bp 아래로 40bp 에해당한다. TATA box TATAXAX consensus sequence located 25-30 bp upstream of the transcription start site initiator element (Inr)

More information

BIONEER CORPORATION Preface 본책자는포스트게놈시대의생명공학연구실의필수적인연구장비인 ExiProgen 에관한설명서입니다. ExiProgen 은무세포 transcription, translation 반응과 magnetic affinity purification 을이용하여 DNA 로부터다양한단백질들을전자동으로합성하고고순도로정제할수있어생명공학의획기적인발전을가져올수있는신개념의장비입니다.

More information

*금안1512-01-도비라및목차1~9

*금안1512-01-도비라및목차1~9 ISSN 1975-667 215. 12 215. 12 6 5 4 3 2 1 6 5 4 3 2 1 3 145 14 135 13 13 143. 14.7 1.4 9.2 1 7 45 4 35 41.4 85 76.9 76.8 3 7 8 75 125 4 4 1 25 8 6 4 2 2 15 1 5 15 15 36 35.3 36 14 13 12 11 14

More information

4 꼬부랑 이라는 말이 재미있습니다. 5같은 말이 반복이 되어서 지루합니다. 4 꼬부랑 은 굽은 모양을 재미있게 흉내 낸 말입니다. 꼬부랑 을 빼고 읽는 것보다 넣어서 읽 으면 할머니와 엿가락, 강아지의 느낌이 좀 더 실감 나서 재미가 있습니다. 국어2(예습) / 1.

4 꼬부랑 이라는 말이 재미있습니다. 5같은 말이 반복이 되어서 지루합니다. 4 꼬부랑 은 굽은 모양을 재미있게 흉내 낸 말입니다. 꼬부랑 을 빼고 읽는 것보다 넣어서 읽 으면 할머니와 엿가락, 강아지의 느낌이 좀 더 실감 나서 재미가 있습니다. 국어2(예습) / 1. 2016년 1월 2학년 시간표 < > 1주차_[국어] 국어1(예습) / 1. 아, 재미있구나! / 01월 04일 3. 다음은 꼬부랑 을 넣은 것과 뺀 것입니다. 그 느낌을 설명한 것으로 알맞지 않은 것은 무엇입 니까? 1에서 꼬부랑 할머니 는 허리가 굽은 할머니의 모습이 떠오릅니다. 2에서 꼬부랑 고갯길 은 그냥 고갯길 보다 더 많이 굽은 고갯길 같습니다.

More information

동산병원소식지-6월

동산병원소식지-6월 2016년 6월 1일 제362호 / 월간 이 / 달 / 의 / 성 / 구 Since 1899 / 제중원 117년 발행인 김권배 편집인 김희철 대구광역시 중구 달성로 56 계명대학교 동산의료원 대외협력처 홍보팀 전화 (053)250-7384 팩스 (053)250-7960 http://www.dsmc.or.kr [ 1 ] 우리 병원이 단일공 로봇시스 템 을 이용한

More information

2015학년도 고려대학교 수시모집 일반전형 논술고사

2015학년도 고려대학교 수시모집 일반전형 논술고사 2015학년도 고려대학교 수시모집 일반전형(인문계) 논술고사 1. 인문계 A 가. 출제의도 인문계 논술 A형은 더불어 사는 삶 이라는 주제를 중심으로 주제와 관계가 다 소 느슨한 제시문을 선정하였다. 제시문 1과 2는 주제와 관련하여 반성적 사유를 전개할 수 있는 사례들이다. 제시문 3은 인간의 본성에 대한 견해를 서술한 글로 써 그 글을 통해 주제와 관련된

More information

1 01 [ 01-02 ] 01. 02. 9 01 01 02 02 [ 01-05 ] 01. 02. 03. 04. 05. 10 plus 002

1 01 [ 01-02 ] 01. 02. 9 01 01 02 02 [ 01-05 ] 01. 02. 03. 04. 05. 10 plus 002 1 01 [ 01-02 ] 01. 02. 9 01 01 02 02 [ 01-05 ] 01. 02. 03. 04. 05. 10 plus 002 01 01 02 02 03 04 03 04 003 05 05 [ 06-10 ] 06. 07. 08. 09. 10. 11 plus 004 06 06 07 07 08 08 09 09 10 10 005 [ 11-15 ] 11.

More information

Nuclease (핵산 분해 효소)

Nuclease (핵산 분해 효소) 7. Nuclease ( 핵산분해효소 ) Nuclease Nuclease 란? DNA 를중합하는 DNA polymerase 와는달리핵산을분해하는효소 Nuclease 의중요성 생체내에서는항상핵산을분해하는일이일어나고있으므로생명현상을공부한다는점에서중요 실제의분자생물학실험에서 polymerase 보다더자주쓰이고있기때문에중요 Nuclease Nuclease 를실험에이용할때염두해두어야할내용

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration

Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration Title: Biacore getting started kit 를이용한 KD 값도출방법 목차 1. 실험목적 2. 실험개요와필요한시약및소모품 2.1 실험개요 2.2 필요한시약및소모품 3. 실험방법과결과 3.1 ph-scouting for pre-concentration 3.2 Immobilization 3.3 Regeneration scouting 3.4 Interaction

More information

Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiC

Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiC Conventional PCR: AllInOneCycler Real-Time PCR: Exicycler 96 Protein Synthesis and Purification: ExiProgen DNA/RNA Preparation: ExiPrep 16 Plus & ExiCracker Electrophoresis: Agaro-Power Microbial Culture:

More information

Microarray 기초 및 응용

Microarray 기초 및 응용 Microarray 기초및분석 이바이오젠 목 차 마이크로어레이기초 정의 / 분류 / 제작기술 / 원리 Gene Expression 실험분석 시료준비 RNA QC 실험분석과정 데이터분석 -2- 바이오칩 & 마이크로어레이 - 정의 1. 유리, 실리콘, 플라스틱등의매체위에생체 분자를집적하여만든것 2. 현재 DNA, 단백질, 화학물질, 유기물질등바 이오소재를집적하여만든

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison

대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison 대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:217-22 원저 진단분자유전학 실시간중합효소연쇄반응검사와아가로오스겔전기영동에의한중합효소연쇄반응물의정량검사비교 이미경 김혜련 중앙대학교의과대학진단검사의학교실 Comparison between Real-Time PCR and Agarose Gel Electrophoresis

More information

3 Gas Champion : MBB : IBM BCS PO : 2 BBc : : /45

3 Gas Champion : MBB : IBM BCS PO : 2 BBc : : /45 3 Gas Champion : MBB : IBM BCS PO : 2 BBc : : 20049 0/45 Define ~ Analyze Define VOB KBI R 250 O 2 2.2% CBR Gas Dome 1290 CTQ KCI VOC Measure Process Data USL Target LSL Mean Sample N StDev (Within) StDev

More information

À̵¿·Îº¿ÀÇ ÀÎÅͳݱâ¹Ý ¿ø°ÝÁ¦¾î½Ã ½Ã°£Áö¿¬¿¡_.hwp

À̵¿·Îº¿ÀÇ ÀÎÅͳݱâ¹Ý ¿ø°ÝÁ¦¾î½Ã ½Ã°£Áö¿¬¿¡_.hwp l Y ( X g, Y g ) r v L v v R L θ X ( X c, Yc) W (a) (b) DC 12V 9A Battery 전원부 DC-DC Converter +12V, -12V DC-DC Converter 5V DC-AC Inverter AC 220V DC-DC Converter 3.3V Motor Driver 80196kc,PWM Main

More information

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len

Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid

More information

Thermal Cycler Dice Real Time System II

Thermal Cycler Dice Real Time System II Real Time System II www.takara.co.kr 높은정량성과재현성및신속성을기반으로하는 Real Time PCR은유전자발현해석및유전자검사에최적인방법입니다. 다파장모델 (Multi-Channel) 다카라바이오에서는 Real Time PCR용시약이나프라이머 (Perfect Real Time Support System) 와함께 96 well plate

More information

<BBFDBAB8BBE7BAB0BCF6BCF6B7E1C5D7C0CCBAED2E786C7378>

<BBFDBAB8BBE7BAB0BCF6BCF6B7E1C5D7C0CCBAED2E786C7378> KB생명 수수료 지급 세부 기준 (16년 5월 기준) - 성과수수료 항목 최저 PC BC PI PB (성과수수료) (비례수수료) (성우대) (성우대) 환산 상품군 기준 환산율 230% 1회 2~12회 13~24회 25~36회 4% 4% 익월 본사수수료 본부장 97% 지점장 87% 팀장 78% 위촉FC KB 슬림업+보험 (1종 기본형) 8,304 13,584

More information

(....).hwp

(....).hwp 연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying

More information

BSC Discussion 1

BSC Discussion 1 Copyright 2006 by Human Consulting Group INC. All Rights Reserved. No Part of This Publication May Be Reproduced, Stored in a Retrieval System, or Transmitted in Any Form or by Any Means Electronic, Mechanical,

More information

슬라이드 1

슬라이드 1 유전공학 DNA 변형과조작 유전자클로닝 제한효소 (Restriction enzyme) 와연결효소 (DNA ligase) 역전사효소, 벡터 DNA 증폭 중합효소연쇄반응 (PCR) DNA 분리및분석 젤전기영동법 (Gel electrophoresis) DNA footprinting (DNA 지문 ) DNA 염기서열분석 Sanger method DNA 재조합기술 (Recombinant

More information

1

1 β β Tm = 81.5 + 16.6 (log10[na+]) + 0.41 (%G+C) 675/n [Na+] monovalent cations ( [Na+] = [K+] ) n =primer base Tm = 81.5 + 16.6 (log10[0.05]) + 0.41 (60) 675/22 = 81.5 + 16.6 ( 1.30) + 24.60

More information

Coriolis.hwp

Coriolis.hwp MCM Series 주요특징 MaxiFlo TM (맥시플로) 코리올리스 (Coriolis) 질량유량계 MCM 시리즈는 최고의 정밀도를 자랑하며 슬러리를 포함한 액체, 혼합 액체등의 질량 유량, 밀도, 온도, 보정된 부피 유량을 측정할 수 있는 질량 유량계 이다. 단일 액체 또는 2가지 혼합액체를 측정할 수 있으며, 강한 노이즈 에도 견디는 면역성, 높은 정밀도,

More information

00....

00.... Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /

More information