DBPIA-NURIMEDIA
|
|
- 소녀 목
- 6 years ago
- Views:
Transcription
1 Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural Science, Kyonggi University, Suwon 16227, Korea (Received 20 November 2015; Revised 27 November 2015; Accepted 27 November 2015) Abstract Deformed Wing Virus (DWV) is one of viral pathogens in honeybee and caused a wing deformity and a premature death of honeybee. In this study, capsid protein VP1, capsid protein VP1-VP3 complex, RNA dependent RNA Polymerase (RdRP) and C3G peptidase (C3G) originated from DWV were successfully over-expressed using E. coli expression system, respectively. Each recombinant proteins using pet32a(+) or pmal-c2 system was purified using affinity-column chromatography under optimum expression conditions, Four specific proteins in this study would be use as antigens to generate specific antibodies against DWV. Especially, recombinant RdRP and recombinant C3G might be useful materials to studies on enzymatic analysis and inhibitory assay of DWV. Key words: Deformed wing virus, DWV, RdRP, C3G Peptidase, VP1, VP3 Deformed Wing Virus(DWV) (Apis mellifera L.),, (Varroa destructor) (Anderson, D.L. and J.W.H. Trueman, 2002; Bailey, L. and B.V. Ball, 1991; Ball, B.V. and M.F. Allen, 1989; Ball et al., 1988). DWV,, RNA(positive single strand RNA), Retrovirus, (DNA) DNA ("no DNA-stage"),, RNA (negative single strand RNA), ( RNA). RNA RNA (RdRP; RNA dependent RNA Polymerase) RNA "no DNA- *Corresponding author. bsyoon@kyonggi.ac.kr 359
2 360 stage", DWV RNA RNA, RNA RNA( ). DNA DNA ( ), DNA RNA ( ), RNA DNA ( ), RdRP., C3G Peptidase RNA, mrna polypeptide,. polypeptide (VP1, VP3 ), (Non-structural proteins; RdRP, C3G), C3G /, polypeptide 6 polypeptide. DWV DWV, Ultra-rapid Real-time PCR(Lim et al., 2013), Ultra-Fast High-Performance PCR(Lim, 2013), Real Time PCR(Lee et al., 2005), Loop-mediated Isothermal Amplification (LAMP; No et al., 2010).,. Immunochromatography, /. DWV 2 (VP1 VP3) 2 (RdRP C3G). 4, DWV. 2, DWV. DWV (Apis mellifera L.), DWV RT-PCR. RNA 3 Total RNA Extraction kit(intron Bio Inc., Korea) 1ml lysis buffer 200µl Chloroform (Daejung Inc., Korea), MagNA Lyser Green Beads (Roche, Switzerland) 6,000RPM 60. Total RNA Extraction kit(intron bio, Korea), RNA OD 260nm, Reverse Transcription, RNA ( 70 C ). RNA 3,000ng cdna. 3,000ng RNA 100pmol oligo-dt 65 C 10., ice 5, 100mM DDT, 10mM dntp( 2.5mM), RNase inhibitor, Rocket Script Reverse Transcriptase (10,000U), 5X reaction buffer 42 C 60. GenBank DWV (Accession
3 Table 1. Information of deformed wing virus (DWV) specific protein primer set Target Primer name Sequence Reference DWV VP1 F GGGGGATCCTTAATAGTAGGTTATGTGCCT DWV VP1 R GGGGTCGACATTCAAAATCTTGAACATGCG DWV VP1 vp3 F GCGGGATCCGGATCTGYTTCCGAYCAAAT DWV DWV VP1 vp3 R DWV RdRp F AGAGTCGACCGCAATAGGGCCCTCAGGCA GGGGGATCCCAGTTAATGAGGAAAAAGGG This study DWV RdRp F TCGGTCGACTGAGTCCAATTCGTCGTTCC DWV polyc3g F GCGGGATCCACTAAGCCTCAGGGATCAA DWV polyc3g R AGAGTCGACAGCTAGCTTTGCATCCACT Fig. 1. The genetic map of Deformed Wing Virus and basic strategy of molecular cloning for DWV VP1 / DWV VP1 VP3 using pmal C2 vector. Fig. 2. The genetic map of DWV and strategy of molecular cloning for DWV Peptidase C3G / RdRP using pet32a or pmal vectors. No. JX ) ( BLAST. 361
4 362 oligonucleotide (Bionics, Korea) (Table 1). cdna, primer DWV PCR. PCR, 2.5U Taq DNA Polymerase(GeneClone, Korea), 2.5mM dntps, 10 PCR buffer(25mm MgCl 2 ), 10pmol primer set, PCR 94 C 5 pre-denaturation, 94 C 30, 58 C 30, 72 C 1 1cycle, 35cycle, 72 C 10 post-extension. PCR, PCR pbluexcm vector(gene Clone, Korea) T-vector cloning. DNA DNA (SolGent, Korea), DNA,, vector pet32a(+) (Novagen, Germany) pmal- C2(NEB, UK) Expression vector (Fig. 1, Fig. 2).. 37 C 150RPM 6. 50ml, 3,000RPM 15min, 4 C, S750-4B rotor (Union 32R, Hanil Inc., Korea), tube 40ml PBS 2 washing,, 10ml PBS. VCX 500 (Sonic & Materials Inc., USA) S&M 1000 rode, 40% Amplitude, pulse on 0.5 sec, pulse off 0.5 sec, running time 1min 30sec,. 4 C 3,000RPM 15 S750-4B rotor (Union 32R, Hanil Inc., Korea),., 5 probe buffer, 99 C 10, 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). DWV DNA GenBank DWV (Accession No. JX ), DWV-VP1, DWV-VP1-VP3, DWV-polyC3G, DWV- RdRP. pmal-c2 vector pet32a vector,. Escherichia coli BL21(DE3). (5ml) 1/25 Sub-culture OD isopropyl-1-thio-β-d-galactopyranoside (IPTG) 0.6mM SDS-PAGE (pmal-dwv-vp1, pmal-dwv-vp1-vp3, pmal- DWV-polyC3G, pmal-dwv-rdrp, pet32a-dwvpolyc3g). pet32a-dwv-polyc3g, N- C- His tagging, Ni + column(his trap HP, 1ml, GE Healthcare, USA). His trap HP AKTA Start system(ge Healthcare, USA), 20ml His-washing solution(20mm sodium phosphate, 0.5M NaCl, 40mM imidazole, ph 7.4) flow rate 0.5ml/min system, His trap HP His-washing solution UV-detector
5 . 10ml flow rate 0.5ml/min system (His trap HP ), 10ml His-washing solution. 10ml His-Elution solution(20mm sodium phosphate, 0.5M NaCl, 500mM imidazole, ph 7.4), UV detector, 1ml fraction collector. fraction UV detector, 3ml(3 fraction) 5ml(5 fraction),. pmal-dwv-vp1, pmal-dwv-vp1-vp3, pmal- DWV-polyC3G, pmal-dwv-rdrp, N- Maltose binding protein(mbp),, Maltose MBP Column(MBP trap HP, 1ml, GE Healthcare, USA). MBP trap HP AKTA Start system(ge Healthcare, USA), 20ml MBP-washing solution(20mm Tris-HCl, 200mM NaCl, 1mM EDTA, ph 7.4) flow rate 0.5ml/min system, MBP trap HP MBP-washing solution UV-detector. 10ml flow rate 0.5ml/min system (MBP trap HP ), 10ml MBP-washing solution. 10ml MBP-Elution solution(20mm Tris- HCl, 200mM NaCl, 1mM EDTA, 10mM maltose, ph 7.4), UV detector, 1ml fraction collector. MBP-trap fraction UV detector, 3ml(3 fraction) 5ml(5 fraction),. DWV cdna primer (Table 1) PCR. PCR T-vector cloning, pbx-dwv,. pbx-dwv clone primer DWV Complete sequence(accession No. JX ), DWV Capsid protein VP1 (GenBank accession No. KP ) GB- JX %(791/818), 100% (Fig. 3, Fig. 7). Capsid protein VP1+VP3 (GenBank accession No. KP ), GB-JX %(1145/1167), 99% (Fig. 4, Fig. 8)., DWV RdRP (RNA dependent RNA polymerase) (GenBank accession No. KP ) GB-JX %(832/863), 99% (Fig. 5, Fig. 9)., DWV C3G(C3G peptidase), GB-JX % (828/828), 99% (Fig. 6, Fig. 10). 363
6 364 Fig. 3. DNA sequence homology between JX and pbx DWV VP1. JX is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 97% (791/818) homology between nucleotide sequences of pbx DWV VP1 (GenBank accession No. KP ) and of JX
7 Fig. 4. DNA sequence homology between JX and pbx DWV VP1 VP3. JX is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 98% (1145/1167) homology between nucleotide sequences of pbx DWV VP1 VP3 (GenBank accession No. KP ) and of JX
8 366 Fig. 5. DNA sequence homology between JX and pbx DWV RdRP. JX is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 96% (832/863) homology between nucleotide sequences of pbx DWV RdRP (GenBank accession No. KP ) and of JX
9 Fig. 6. DNA sequence homology between JX and pbx DWV polyc3g. JX is complete nucleotides of DWV deposited in GenBank. Alignment analysis was revealed 100% (828/828) homology between nucleotide sequences of pbx DWV polyc3g and of JX
10 368 Fig. 7. Amino acid sequence homology between JX and pbx DWV VP1. The deduced amino acid sequences based on pbx DWV VP1 (GenBank accession No. KP ) was aligned with the deduced amino acid sequences on of JX The homology between both amino acid sequences was calculated as 100% (273/273). Fig. 8. Amino acid sequence homology between JX and pbx DWV VP1 VP3. The deduced amino acid sequences based on pbx DWV VP1 VP3 (GenBank accession No. KP ) was aligned with the deduced amino acid sequences on of JX The homology between both amino acid sequences was calculated as 99% (388/389).
11 Fig. 9. Amino acid sequence homology between JX and pbx DWV RdRP clone. The deduced amino acid sequences based on pbx DWV RdRP (GenBank accession No. KP ) was aligned with the deduced amino acid sequences on of JX The homology between both amino acid sequences was calculated as 99% (286/287). Fig. 10. Amino acid sequence homology between JX and pbx DWV polyc3g clone. The deduced amino acid sequences based on pbx DWV polyc3g was aligned with the deduced amino acid sequences on of JX The homology between both amino acid sequences was calculated as 99% (273/276). DNA DWV, 4 vector system pet32a(+) pmal-c2 subcloning. 5, DNA (pdraw32) 369
12 370 M N M N M N M N M 1 2 M 1 2 M 1 2 M N M 1 2 M 1 2 Fig. 11. Expression of DWV proteins depends on IPTG concentr ation. All recombinant DNA in E. coli BL21 was cultured until OD600 reach to 0.6 and induced by IPTG to express recombinant DWV proteins. Bacterial cell was collected at 6 hours after induction, respectively. Panel A. pmal DWV VP1, Panel B. pmal DWV VP1 VP3, Panel C. pmal DWV RdRp, Panel D. pmal DWV polyc3g, and Panel E. pet32a DWV polyc3g. Lane M was protein size marker (T&I). Lane N were cultures without IPTG induction. Lanes 1 to 5 were induced culture with 0.1, 0.3, 0.6, 1.0 and 2 mm of IPTG, final concentration, respec tively. pmal-dwv-vp1, 75kDa; pmal-dwv- VP1-VP3, 93kDa; pmal-dwv-polyc3g, 81kDa; pmal-dwv-rdrp, 81kDa;, pet32a-dwv-polyc3g, 50kDa (Fig. 11). IPTG 0.1~0.3mM, (DWV-VP1, -VP1-VP3, RdRP, C3G) pmal vector MBP., pet vector C3G (Fig. 11E). pet32a-dwv-polyc3g Ni + column, pmal-dwv-vp1, pmal-dwv- VP1-VP3, pmal-dwv-rdrp pmal-dwv-polyc3g MBP column. 12% SDS-PAGE Fig. 12. The purifications of recombinant DWV proteins. Panel A. pmal DWV VP1, Panel B. pmal DWV VP1 VP3, Panel C. pmal DWV RdRp, Panel D. pmal DWV polyc3g, Panel E. pet32a DWV polyc3g. Lane M in each panel was protein size marker (T&I). Lane 1 of each panel were total proteins from each culture induced IPTG, lane 2 of each panel were affinity column purif ied recombinant proteins from each culture. (Fig. 12). Bradford assay, pmal-dwv-vp1, pmal- DWV-VP1-VP3, pmal-dwv-polyc3g, pmal-dwv- RdRP, pet32a-dwv-polyc3g 2.71mg/ml(total 8.13mg of recombinant protein /125ml culture), 4.71mg/ml(total 14.13mg of recombinant protein/125ml culture), 2.07mg/ml(total 6.21mg of recombinant protein/125ml culture), 2.57mg/ml(total 7.71mg of recombinant protein/125ml culture), 1.04mg/ml(total 3.12mg of recombinant protein/125ml culture). DWV(Deformed Wing Virus), 2013 (Center for Honeybee disease control) 3 (Yoo et al., 2014). DWV,,.,
13 ,. DWV, VP1, VP3, RdRP, C3G DNA,. RdRP(RNA dependent RNA polymerase) DWV,,,, positive-rna( ) negative RNA( ), negative RNA( ) positive RNA( ). RdRP, RNA (interference; RNAi), (FMDV; Foot-and-Mouth Disease Virus) (MERS-CoV; Middle East Respiratory Syndrome Coronavirus) RdRP,.. DWV-RdRP RdRP., C3G(C3G peptidase) polyprotein 1 DWV,,. DWV,., VP1 VP3, /, (epitope). immunochromatography,. VP1 VP3, ( ). Anderson, D. L. and J. W. H. Trueman Varroa jacobsoni (Acari:Varroidae) is more than one species. Exp. Appl. Acarol. 24: Bailey, L. and B. V. Ball Honey bee pathology, 2nd ed. Academic Press, London, England. Ball, B. V. and M. F. Allen The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with the parasitic mite Varroa jacobsoni. Ann. Appl. Biol. 113: Ball, B. V Varroa jacobsoni as a virus vector. In: Cavalloro, R. (Ed.), Present Status of Varroa tosis in Europe and Progress in the Varroa Mite Control. OYce for OYcial Publications of the European Communities, Luxembourg pp Lee, H. M, D. B. Lee, S. H. Han, M. L. Lee, Y. K. Lim, B. S. Yoon Identification of Deformed Wing Virus from the Honeybee in Korea and Establishment of PCR Detection Method. J. Apicul 20: Lim, H. Y Development of Novel Rapid Detection Method for Deformed Wing Virus (DWV) using Ultra Fast High Performance PCR (UF HP PCR). J. Apicul. 28: Lim, H. Y., B. S. Yoon Rapid and Sensitive detection of 371
14 372 Deformed Wing Virus (DWV) in Honeybee using Ultra rapid Real time PCR. J. Apicul 28: No, J. N., Nguyen Van Phu, M. S. Yoo, Y. H. Park, B. S. Yoon Simple and Rapid Method for Detection of Deformed Wing Virus (DWV) by Loop mediated Isoth ermal Amplification (LAMP). J. Apicul. 25: Yoo, M. S., Y. H. Kim, N. H. Kim, H. N. Jung, Thi B., Reddy K., S. C. Jung, S. W. Kang Molecular Detection of Honeybee Disease in Apis mellifera and Apis cerana in Korean apiaries, The 29th Conference of the Apicultural Society of Korea, 2013, page 66.
DBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31() : 133~1 (1) Development of a Detection Method against 11 Major Pathogens of Honey Bee using Amplification of Multiplex PCR and Specific DNA-chip Ji-Hee Wang,
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information발간등록번호
발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationSMARTer 시리즈
SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과
한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과
한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과
한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic
More informationPowerPoint 프레젠테이션
Glutathione Excellose handbook - Purification of GST fusion proteins - Looking for more detail Purification protocol? - Glutathione Excellose Spin Kit - Glutathione MiniExcellose - Glutathione Excellose
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과
한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationPCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error
TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information슬라이드 제목 없음
물리화학 1 문제풀이 130403 김대형교수님 Chapter 1 Exercise (#1) A sample of 255 mg of neon occupies 3.00 dm 3 at 122K. Use the perfect gas law to calculate the pressure of the gas. Solution 1) The perfect gas law p
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information(....).hwp
연구기관 한국식품연구원 농림부 연구기관 한국식품연구원 농림부 Analytical Semi-preparative Solution A 1) Solution B 2) Mixing Spreading Coating medium Corona treated OPP 3) film Casting Drying
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information01 Automated Protein Expression and Purification: ExiProgen Selection Guide 3 Protein Synthesis Kit ExiProgen EC Protein Synthesis Kit 4 ExiProgen EC-
Automated Protein Expression and Purification: ExiProgen TM Manual Protein Expression and Purification: AccuRapid TM & MagListo TM Preparation of Template DNA for Protein Expression Protein Service Protein
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information김도희_HT protein expression 표준 보고서_v1.5
Production of Recombinant Proteins For Further Information, Please Contact Neurogenex Co., Ltd. Biotechnology Incubating Center "Golden Helix" Seoul Natl' Univ. Seoul 151-744, Korea TEL 82-2-875-8998 FAX
More information02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information01 Automated Protein Expression and Purification Using ExiProgen Selection Guide 267 ExiProgen EC Protein Synthesis Kit 268 ExiProgen EC-Maxi Protein
Automated Protein Expression and Purification Using ExiProgenTM Manual Protein Expression and Purification Preparation of Template DNA for Protein Expression Protein Service Protein Expression and Purification
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More information<5B31362E30332E31315D20C5EBC7D5B0C7B0ADC1F5C1F8BBE7BEF720BEC8B3BB2DB1DDBFAC2E687770>
2016 지역사회 통합건강증진사업 안내 - 지역사회 중심 금연지원 서비스 - 2016. 3. 주요변경사항 5 1부 국가 금연정책 추진 및 현황 Ⅰ. 국가 금연정책 개요 1. 금연정책의 배경 및 필요성 11 2. 세계 금연정책 동향 20 3. 우리나라 금연정책 추진경과 24 4. 2016년도 금연정책 추진방향 31 Ⅱ. 국가 금연사업 현황 1. 흡연자 금연지원서비스
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme 20% 2+1 cpcr Enzyme cdna Synthesis 2+1 cdna Synthesis kit High Qua
2019 TOYOBO BIG SALE 기간 : 2019년 7월 1일 ~ 9월 11일까지 최대 33% SALE qpcr Enzyme PCR Enzyme cpcr Enzyme cdna Synthesis cdna Synthesis kit High Quality Enzyme Immuno Enhancer Cloning One-Step kit Can Get Signal
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information,126,865 43% (, 2015).,.....,..,.,,,,,, (AMA) Lazer(1963)..,. 1977, (1992)
, -,,,.,,,. 6.. (LIRUIYAO),, E-mail : ruiyao24@hotmail.com :,, 26 E-mail : taehee@khu.ac.kr 2014 1400 180 6.. 2014 6,126,865 43% (, 2015).,.....,..,.,,,,,,. 1963 (AMA) Lazer(1963)..,. 1977, 1990. (1992)
More information<303720C7CFC1A4BCF86F6B2E687770>
1) < 論 文 > 라이프스타일 세분화를 통한 실버타운 수요자 분석 133 주택연구 제15권 4호 2007. 12/15(4) : 133~160 Housing Studies Review Vol. 15, No. 4 : 133~160 접수일 : 2007. 7. 9, 심사일 : 2007. 7. 16, 심사완료일 : 2007. 8. 29 라이프스타일 세분화를 통한 실버타운
More information(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection)
SERVICE MANUAL (Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) 12 (Storage Bins) 12 (Ice Machine)
More informationSelection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More information歯140김광락.PDF
2001 / Separation of Hydrogen Isotopes/Helium Using Gas Chromatography,,,, 150 196 C / He, H 2 D 2 Abstract In the hydrogen isotope facility and the fuel cycle of the fusion reactor, an effective means
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot
2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationePapyrus PDF Document
Trans. of the Korean Hydrogen and New Energy Society(2013. 4), Vol. 24, No. 2, pp. 136~141 DOI: http://dx.doi.org/10.7316/khnes.2013.24.2.136 흡기관 분사식 수소 SI기관의 희박과급 적용에 관한 연구 이광주 1 ㆍ이종구 1 ㆍ이종태 2 1 성균관대학교
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information02이용배(239~253)ok
A study on the characteristic of land use in subcenter of Seoul. - Cases of Yeongdeungpo and Kangnam Ok Kyung Yuh* Yong-Bae Lee**,. 2010,,..,.,,,,.,,.,,.,,,, Abstract : This study analyzed the land use
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information