저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

Transcription

1 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우, 이저작물에적용된이용허락조건을명확하게나타내어야합니다. 저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다. 이것은이용허락규약 (Legal Code) 을이해하기쉽게요약한것입니다. Disclaimer

2 [UCI]I804: Preconditioning of SIRT1 activator improves chondrogenic differentiation potential of mesenchymal stem cell Seong Mi Choi Department of Medical Science The Graduate School, Yonsei University

3 Preconditioning of SIRT1 activator improves chondrogenic differentiation potential of mesenchymal stem cell Directed by Professor Jin Woo Lee The Master s Thesis submitted to the Department of Medical Science, the Graduate School of Yonsei University in partial fulfilment of the requirements for the degree of Master of Medical Science Seong Mi Choi December 2017

4 This certifies that the Master s Thesis of Seong Mi Choi is approved. Thesis Supervisor: Jin Woo Lee Thesis Committee Member#1: Yong-Min Chun Thesis Committee Member#2: Sung-Rae Cho The Graduate School Yonsei University December 2017

5 ACKNOWLEDEGMENTS 2015 년부터시작이된저의석사학위과정여정이드디어결실을맺는순간이되었습니다. 많은분들의도움으로인하여제가이순간을맞이할수있었던것같습니다. 우선, 석사학위과정을통하여저가많은가르침을받을수있는기회를주신이진우교수님께감사드립니다. 석사학위과정동안다사다난한일들이많이생겼었지만그때마다항상올바른길을갈수있도록일깨워주시고기회가될때마다인생에도움이되는좋은명언들을해주셔서감사합니다. 또한학문적인가르침을주시기위한따끔한충고와지적들로인하여제가한번더신중히생각할수있도록유도를해주셔서많은배움을얻을수있었습니다. 감사드립니다. 바쁘신중에도저의부족한연구계획서와결과를확인하기위해시간을내어주시고, 많은조언과토론을통해더좋은논문이될수있도록도움을주신천용민교수님그리고조성래교수님께진심으로감사드립니다. 항상연구중어려움이생길때마다많은조언을해주시고실험이잘진행되도록도움을주신김성환교수님께감사드립니다. 핵심적인부분을콕콕집어주셔서연구가성공적으로이끌어나갈수있는조언과가르침을주신박광환교수님감사합니다. 저의실험의마지막단계였던동물실험을위해바쁘신와중에도많은도움을주신박유정선생님, 황역구선생님, 심동우선생님께감사드립니다. 우리정형외과실험실에서늘저를항상지지해주고격려해주며좋은결과를마무리할수있도록많은도움을주신경미언니, 늘감사하게생각합니다. 박사과정이지만항상저의

6 말을존중해주고제가힘들때옆에서큰힘이되어준다운언니, 그리고해결하기힘들거나어려운일이있을때옆에서항상도움을주고든든한유림이, 늘격려를아끼지않고해주었던기원언니그리고옆자리에앉아서힘들지만항상밝은미소를띄고있는지현이에게고마움을전합니다. 실험실모두를항상걱정해주시고많은도움을주며격려해주시는고은애선생님과박은주선생님에게도고마움을전합니다. 제가이학위를마무리하고지금처럼성장된모습을갖출수있도록언제나저의뒤에서사랑과격려를아끼지않았던가족들, 너무감사합니다. 제가학위과정동안느끼던기쁘고힘들던모든순간들을가족과함께했습니다. 그래서마지막인이순간을가족모두가행복할수있는시간이되었으면좋겠습니다. 사랑합니다. 그리고제가일일이언급하지않아도이미저의마음을다알고있는친구들에게도큰고마움을전합니다. 사랑합니다. 학위과정중얻은배움과깨달음을통하여사회에나아가서많은사람들에게지식을공유할수있는지성인이되겠습니다. 감사합니다. 최성미드림

7 TABLE OF CONTENTS ABSTRACT 1 Ⅰ. INTRODUCTION 3 Ⅱ. MATERIALS AND METHODS 6 1. Isolation of MSCs from human bone marrow aspirates 6 2. Chemical treatment of MSCs 6 3. In vitro chondrogenic differentiation of MSCs via micromass culture method 6 4. Quantitative real-time polymerase chain reaction 7 5. Western blotting 9 6. Preparation of Hydrogel 9 7. Animal experiments Histological analysis and immunohistochemistry Statistical analysis 11 Ⅲ. RESULTS Enhanced stemness and inhibited senescence of MSCs via continuous treatment of RSV Evaluation of in vitro chondrogenic differentiation of P5-

8 RMSC Inhibition of hypertrophic maturation of RSV treated MSCs Enhanced cartilage regeneration potential in vivo Inhibition of hypertrophic maturation of cartilage 32 Ⅳ. DISCUSSION 34 Ⅴ. CONCLUSION 36 REFERENCES 38 ABSTRACT (IN KOREAN) 45

9 LIST OF FIGURES Figure 1. Long-term in vitro expansion of MSCs with or without ftreatment of RSV 12 Figure 2. Comparison of morphological change and proliferation fcapacity between P and P5 MSCs 14 Figure 3. Sustained expression of stemness markers and inhibited fexpression of senescence markers 15 Figure 4. The mrna expression level of chondrogenic markers ffin MSCs following chondrogenic differentiation 17 Figure 5. The protein expression level of chondrogenic markers in ffmscs following chondrogenic differentiation 18 Figure 6. Histological analysis of GAGs and PGs in chondrogenic fmicromass and detection of chondrogenic markers by fimmunocytochemistry 20 Figures7. seffects of RSV treatment on MSCs in hypertrophic maturation during chondrogenic differentiation 24

10 Figure 8. Expression of representative hypertrophic markers in protein level 25 Figure 9. Establishment of rabbit osteochondral defect model 26 Figure 10. Gross morphology and histological analysis of rabbit osteochondral defect sites after 8 weeks of surgery 28 Figure 11. Evaluation of cartilage regeneration potential in vivo via immunohistochemical analysis 30 Figure 12. Inhibition of hypertrophic maturation in RSV treated MSCs 33

11 LIST OF TABLES Table 1. A list of primers used for real-time PCR 8

12 Abstract Preconditioning of SIRT1 activator improves chondrogenic differentiation potential of mesenchymal stem cell Seong Mi Choi Department of Medical Science The Graduate School, Yonsei University (Directed by Professor Jin Woo Lee) Osteoarthritis (OA) is the most common degenerative disease of joints affecting more than 70% of the aged population and can gradually lead to the deterioration of extensive areas of cartilage due to the lack of regeneration capacity. The major manifestations of OA are damage to cartilage, malfunction of chondrocyte proliferation and hypertrophic maturation. There are currently several therapies for cartilage regeneration, among them cell therapy is the most frequently used, particularly with mesenchymal stem cells (MSCs). However, cell therapy necessitates long-term expansion of MSCs, in vitro, and during this process, MSCs lose their self-renewal and multipotential capacity as well as undergoing hypertrophic maturation following chondrogenic differentiation. Therefore, a new strategy to enhance chondrogenic differentiation potential and regenerate hyaline cartilage is essential. 1

13 Resveratrol (RSV), a strong SIRT1 activator, is known to play critical roles in cell survival, proliferation, and multipotency of MSCs. Our previous study confirmed that when RSV is continuously delivered to MSCs from early passage with the expression of SIRT1, MSCs maintain their self-renewal, osteogenic and adipogenic differentiation potential. However, chondrogenic differentiation potential was not confirmed. In the present study, we investigated and confirmed the chondrogenic differentiation potential of MSCs which are continuously treated with RSV. Chondrogenic markers were upregulated, when RSV was continuously delivered to MSCs compared to MSCs that were not treated with RSV. In addition, we confirmed the cartilage regeneration potential of RSV treated MSCs in vivo. A rabbit osteochondral defect model was used to evaluate the hyaline cartilage formation by MSCs treated with RSV. MSCs treated with RSV had improved delivery of RSV to MSCs maintained stemness similar to P1-MSCs as well as enhanced their multipotential differentiation capacity resulting in increased cartilage regeneration, in vivo. Key words: chondrogenic differentiation, cartilage regeneration, resveratrol, SIRT1 2

14 Preconditioning of SIRT1 activator improves chondrogenic differentiation potential of mesenchymal stem cell Seong Mi Choi Department of Medical Science The Graduate School, Yonsei University (Directed by Professor Jin Woo Lee) I. INTRODUCTION Osteoarthritis (OA) is the most prevalent age-related or posttraumatic degenerative disease of joints, affecting more than 70% of the aged population, that can gradually deterioration of extensive areas of cartilage a due to the lack of regeneration capacity. 1-4 The major incidence of OA is damage joint. The major indicators of OA are damage to cartilage, malfunction of chondrocyte proliferation and hypertrophic maturation, thus the cartilage regeneration capacity is severely impaired. 5 There are currently, several types of therapy for cartilage regeneration such as techniques for bone marrow stimulation, mosaicplasty and cell based therapies. 6 Recently, cell based therapies have become regard as the most promising prospective treatment among the various strategies. Autologous chondrocyte implantation (ACI) is the most generally used approach for cartilage regeneration 3

15 that requires the in vitro expansion of autologous chondrocytes. 7,8 There are, however, several drawbacks to implementing this technique i.e., overall complexity, cost and loss of cartilage regeneration capacity. 8,9 Hence, a cell-based therapeutic approach using mesenchymal stem cells (MSCs) has emerged most recently as a new approach to cartilage regeneration MSCs from adult tissues, with their multipotency capabilities, including chondrogenic differentiation, have been identified as a promising cell source MSCs also possess anti-inflammatory and immunosuppressive properties and it has been reported that the use of MSCs in clinical trials was highly successful in promoting cartilage regeneration without severe side effects. 17 Despite the proven efficacy of MSCs in several clinical trials, there are several problems affecting their use in clinical trials. As discussed above, these include loss of self-renewal and multi-lineage differentiation potential during in vitro expansion, hypertrophic maturation following chondrogenic differentiation Therefore, the identification of new strategies that sustain stemness of MSCs during in vitro longterm expansion and preserve chondrogenic differentiation potential and regulation of hypertrophic maturation is vitally important. Accordingly, I investigated the critical environments which can sustain the selfrenewal and multi-lineage differentiation capacities of the cells. There are several possible strategies to enhance stemness of MSCs such as genetic modification, 27 scaffolds as a carrier 27 and growth factor treatment. 28 However, these methods had some disadvantages including safety issues and poor mechanical strength of scaffolds. 27,28 Therefore, our strategy to overcome these limitations was to provide a stable environment for the MSCs to preserve stemness in MSCs. Thus, I considered the use of resveratrol (RSV; 3,5,4ʹ-hydroxystilbene), a phytoalexin made from plants damaged by environmental stress and strong activator of SIRT1, a class III histone and 4

16 deacetylase protein RSV is also known to strongly influence cell survival and proliferation enhancing the osteogenic and adipogenic differentiation potential of MSCs However, there are some negative effects of RSV on self-renewal and differentiation capacity of MSCs. 32 In our previous study, we have demonstrated that the appropriate application of RSV to MSCs could enhance self-renewal as well as the osteogenic and adipogenic potential of MSCs during long-term in vitro expansion. 37 In the present study, I have elucidated the improvement of chondrogenic differentiation potential of MSCs treated with RSV during the long-term in vitro expansion. Moreover, RSV treatment inhibited hypertrophic maturation leading to the regeneration of hyaline cartilage, in vivo. 5

17 Ⅱ. MATERIALS AND METHODS 1. Isolation of MSCs from human bone marrow aspirates Bone marrow aspirates obtained from the posterior iliac crests of ten adult donors, with approval from the Institutional Review Board of Yonsei University College of Medicine. MSCs were selected and cultured for seven days in Dulbecco s modified Eagle medium-low glucose (DMEM-LG; Gibco, Carlsbad, CA) containing 10% fetal bovine serum (FBS; Gibco) and 1% antibiotic antimycotic solution (Gibco) and incubated at 37 in 5% CO 2 humidity. MSCs were subcultured at a 1:3 ratio when they were 80% confluent. 2. Chemical treatment of MSCs Resveratrol (RSV; Sigma, St. Louis, MO) was dissolved in ethanol (EtOH) which has concentration of 1uM. The RSV is continuously treated from passage (P) 1 to P5 MSCs (P5-RMSC) and subcultured as previously described. 21,38 Since MSCs lower than P5 are considered as optimal passage for clinical application, they were cultured up to P5. 3. In vitro chondrogenic differentiation of MSCs via micromass culture method Micromass culture method was used for in vitro chondrogenic differentiation of MSCs. MSCs that are 80% confluent was harvested using 0.05% trypsin-edta (Gibco). Cells were washed, centrifuged and resuspended at density of 1 x 10 7 cells/ml, and 10 ul of the resuspended cells was dotted on the center of individual 6

18 wells of 24-well plates (1 x 10 5 cells/well). The cells were allowed to adhere at 37ºC for 2h, and then chondrogenic medium, consisting of Dulbecco s modified Eagle medium-high glucose (DMEM-HG; Gibco) supplemented with 1% antibioticantimycotic solution, 1% Insulin Transferrin Selenium-A (ITS; Invitrogen, Carlsbad, CA), 50 mg/ml ascorbic acid (Invitrogen), and 10ng/mL TGF-β3 (R&D System, Minneapolis, MN), was gently added. The chondrogenic medium was changed every 2 days during in vitro differentiation periods. 4. Quantitative real-time polymerase chain reaction Total RNAs from MSCs were isolated using Trizol (Invitrogen) following the manufacturer s instructions. For cdna reverse transcription, RNAs were reverse transcribed using an Omniscript Reverse-Transcription Kit (Qiagen, Hilden, Germany). The cdna was used in real-time polymerase chain reaction (PCR) with an SYBR Green PCR Master Mix (Applied Biosystems, London, UK). Real-time PCR was performed using an ABI7500 real-time machine by Applied Biosystems. All primers were purchased from Bioneer. The primers that have no validation were designed as following Table 1. The validated primer, SOX9 (P232240), IHH (P101104) and ALP (P324388), was purchased from Bioneer. The PCR procedure was initiated for 30 s at 95ºC, followed by 40 thermal cycles of 5 s at 95ºC and 20 s at 60ºC. SYBR fluorescence was detected during the annealing/extension phase and all real-time PCR products had a final size of 100 base pair. Values from each samples were normalized to β-actin as an internal control. 7

19 Table 1. A list of primers used for real-time PCR Gene symbol Sequence (5ʹ 3ʹ) β-actin SOX5 SOX6 COL2A1 AGGRECAN RUNX2 OSTEOCALCIN MMP13 COL1A1 COL10A1 Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse GTCCTCTCCCAAGTCCACACAG GGGCACGAAGGCTCATCATTC AGCCCCACATAAAGCGTCCAAT GGTCCTCCTCCTCCTCATCGTA AGCAGAGCCTGTGAAGTCC GGTCCTCCTCCTCCTCATCGTA GGCAATAGCAGGTTCACGTACA CGATAACAGTCTTGCCCCACTT CCTGGCCTGACATGGAGCTG GGACTGGGGGAGACCTCGAA CCCAGTATGAGAGTAGGTGTCC GGGTAAGACTGGTCATAGGACC AGCAAAGGTGCAGCCTTTGT CTTCACTACCTCGCTGCCCT GACGGGGTTTTGCCACACTG ATTGGGTGTGGTGGCTCACG GCCCTGCTGGAGAGGAAGGA ATTGGGTGTGGTGGCTCACG CCAGGACAGCCAGGCATCAA ATTGGGTGTGGTGGCTCACG 8

20 5. Western blotting For protein extraction, cell pellets were suspended in lysis buffer containing 50 mm Tris (ph 7.4), 150 mm NaCl, 1% NP-40, and 0.1% sodium dodecyl sulfate (SDS), followed by gentle pipetting and heating at 100ºC for 10 min with vortex mixing every 3 min. Lysates were centrifuged at 13,000 rpm for 10 min and supernatants were collected into new tube. To measure the concentration of proteins, we used the bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL). Prior to western blotting, 30ug protein was mixed with 5 loading dye (Pierce) and heated at 10ºC for 3 min. The protein samples were run on 10% SDS polyacrylamide gel electrophoresis (PAGE) gels. Then proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Hybond, Escondido, CA) for 90 min. Membranes were blocked within 5% skim milk (BD Biosciences, San Jose, CA) for 1h, following the incubation of primary antibodies at 4ºC overnight. Antibodies used were anti-sox9 (Millipore, Billerica, MA, 1:1,000 in 1% skim milk); anti-β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, 1:1,000 in 1% skim milk); and anti- COL2A1 (Santa Cruz Biotechnology, 1:500 in 1% BSA). Finally, membranes were developed using enhanced chemiluminescence (ECL) solution (Amersham, Buckinghamshire, UK). 6. Preparation of Hydrogel Hydrogel (Hy) was prepared as previously described. 39,40 In short, the cosolvent, consists of water and dimethylformamide within the ratio of 3:2, was added with 1- ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxysuccinimide (NHS) that activates the 3-(4-hydroxyphenyl)propionic acid (HPA) and solution was added to preheated gelatin solution. After 24h of reaction at 40 ºC, the solution was dialyzed with deionized water, filtered and lyophilized. 9

21 7. Animal experiments Twelve New Zealand white rabbits (male, kg; Doo Yeol Biotech, Seochogu, Seoul) were used for osteochondral defect model which had been previously established. 41 Briefly, the cylindrical osteochondral defect (6 mm diameter, 3 mm depth) was formed and applied with following: None (Defect), hydrogel only (Hy), Hy + P5 MSCs (Hy/MSC) and Hy+ P5 RSV-MSCs (Hy/RMSC). Each cell is applied with 2 x 10 6 cells. 8 weeks after operation, the rabbits are euthanized and defect sites are extracted for histological analysis in vitro. All animal experiments are approved by the Committee on the Ethics of Animal Experiments of Yonsei University College of Medicine (Permit No ). 8. Histological analysis and immunohistochemistry 8 weeks post-operation, the regenerated cartilage tissues were fixed for 7 days in 10% formalin. After fixation, the formalin-fixed specimens were embedded in paraffin and then paraffin blocks were sliced at a thickness of 4mm. The sections were deparaffinized, rehydrated and washed twice with PBS and stained with hematoxylin-eosin (HE) to observe the cell morphology and Masson s trichrome (MT) to assess total collagen synthesis and safranin O/fast green to detect glycosaminoglycans (GAGs). The stained samples were observed using VS120 virtual microscope (Olympus, Tokyo, Japan), and images were analyzed using OlyVIA 2.5 program (Olympus). We used O Driscoll scoring system for histological examination and the regenerated cartilage was evaluated by three independent experts using grading scale. All scores were the means of the three independent evaluations. 10

22 9. Statistical analysis Each experiment was performed in triplicate using samples more than three donors. For detection of difference between two groups are confirmed by t-test. The statistical significance of the differences among three or more groups was calculated using one-way analysis of variance (ANOVA) with Tukey s post hoc analysis. All data are presented as mean and 95% CIs of the values from different donors per group. 11

23 Ⅲ. RESULTS 1. Enhanced stemness and inhibited senescence of MSCs via continuous treatment of RSV During long-term in vitro expansin of MSCs, we have continuously treated RSV from P0 to P5 MSCs (P5-RMSC) while the other cells are cultured up to P5 without RSV treatment (P5-RSV) (Figure 1). Figure 1. Long-term in vitro expansion of MSCs with or without treatment of RSV. MSCs were isolated from bone marrow aspirates and cultured for 7 days. From P0-MSC, the cells were treated with 1uM of resveratrol up to P5. 12

24 To identify the similar stemness with P1-MSC, we compared the morphological changes between P1- and P5-MSC with and withour RSV treatment. The P5-RMSC showed similar morphology with P1-MSC whereas P5-MSC showed opposite morphology as flat and large size (Figure 2A). Also, the proliferation assay was performed to evaluate sustained proilferative capacity of P5-RMSC. As a result, the P5-RMSC had improved proliferation capacity in comparison with P5-MSC (Figure 2B). 13

25 Figure 2. Comparison of morphological change and proliferation capacity between P1 and P5 MSCs. (A) Small and spindle-like morphology of P1-MSC and large and flat morphology of P5-MSC. P5-RMSC had similar morphology with P1- MSC. (B) Proliferative potential of P5-RMSC had similar potential with P1-MSC. *p<0.05, **p<

26 Furthermore, to demonstrate the effects of RSV in cell senecence, we assessed protein level of senecence and stemness markers. When MSCs are culutred up to P5, senescence markers were upregulated whereas P5-RMSC had downregulated that had similar expression with P1-MSC (Figure 3A). The stemness markers were highly expressed in P5-RMSC which has similar expression level of P1-MSC (Figure 3B). Therefore, when resveratrol is continuously treated to MSC from P1 to P5, the stemness of MSC was upregulated while senecence was inhibited. Figure 3. Sustained expression of stemness markers and inhibited expression of senescence markers. (A) P1-MSC had low expression of senescence markers, p16, p21, and p53, whereas P5-MSC had higher expression of that. However, the P5- RMSC had decreased level of senescence marker in comparison with P5-MSC. (B) Stemness markers, NANOG, OCT4, and SOX2, showed opposite result of senescence markers. When RSV is continuously treated, P5-RMSC had similar expression of stemness markers with P1-MSC. 15

27 2. Evaluation of in vitro chondrogenic differentiation of P5-RMSC To compare enhanced chondrogenic differentiation potential of P5-RMSC, we performed micromass culture of P1-MSC, P5-MSC and P5-RMSC. The mrna level of chondrogenic markers, SOX-5,-6,-9, COL2A1, and AGGRECAN, were upregulated up to similar level with P1-MSC in P5-RMSC while P5-MSC was downregulated (Figure 4). The western blot demonstrated that protein expression level of chondrogenic markers were up-regulated up to similar level with P1-MSC in P5- RMSC while P5-MSC was down-regulated (Figure 5A and B). 16

28 Figure 4. The mrna expression level of chondrogenic markers in MSCs following chondrogenic differentiation. mrna expression level of chondrogenic markers, SOX-5,-6,-9, COL2A1, and AGGRECAN, was highly up-regulated in P5- RMSC when comparison to P5-MSC, and has similar expression level with P1-MSC on day 5. ***p <

29 Figure 5. The protein expression of chondrogenic markers in MSCs following chondrogenic differentiation. (A) Enhanced protein expression level of P5-RMSC in chondrogenic markers, SOX-9, COL2A1 and AGGRECAN on day 10. (B) Quantitative analysis of protein expression level in each group was confirmed by Image J Software Ver *p < 0.05, **p < 0.01, ***p <

30 To further demonstrate the enhanced capacity of chondrogenic differentiation of P5-RMSC, we performed the safranin O and alcian blue staining. The P5-MSC had smaller size of micromass in comparison with both P1-MSC and P5-RMSC which has larger size and higher contents of glycosaminoglycan (GAG) and proteoglycan (PG) (Figure 6A). We preformed immunocytochemistry to confirm the increased expression level of COL2A1 and AGGRECAN in P5-RMSC (Figure 6B) and the quantitative analysis of those was conducted (Figure 6C). Thus, the P5-RMSC had increased chondrogenic potential when compared with P5-MSC in concurrence with similar level of P1-MSC. 19

31 20

32 21

33 Figure 6. Histological analysis of GAGs and PGs in chondrogenic micromass and detection of chondrogenic markers by immunocytochemistry. (A) The safranin O and alcian blue staining demonstrated increased contents of GAGs and PGs, respectively, on day 14. (B) Immunocytochemistry of COL2A1 (PE; red fluorescence) and AGGRECAN (FITC; green fluorescence) showed higher expression level in P5-RMSC on day 14. DAPI is stained with nucleus (blue). (C) Quantitative analysis of COL2A1 and AGGRECAN was confirmed via Image J Software Ver **p < 0.01, ***p <

34 3. Inhibition of hypertrophic maturation of RSV treated MSCs The primary limitation to use MSCs in cartilage regeneration is their tendency to become hypertrophic maturation during chondrogenic differentiation followed by increased expression of COL10A1, matrix metalloproteinase 13 (MMP13) and alkaline phosphatase (ALP). 24,42 Thus, we investigated whether the P5-RMSC could inhibit hypertrophic maturation during in vitro chondrogenic differentiation. In mrna level of hypertrophic markers are down-regulated in P5-RMSC when compared to P5-MSC (Figure 7). Also, the western blot demonstrated the decreased protein level of hypertrophic markers (Figure 8A). Moreover, the immunocytochemistry showed decreased expression level of COL10A1, the major hypertrophic marker (Figure 8B and C). These results suggest that continuous treatment of RSV could inhibit the hypertrophic maturation during chondrogenic differentiation of MSC. 23

35 Figure 7. Effects of RSV treatment on MSCs in hypertrophic maturation during chondrogenic differentiation. Continuous treatment of RSV on MSCs had decreased expression level of hypertrophic markers following chondrogenic differentiation, on day 21. ***p<

36 Figure 8. Expression of representative hypertrophic markers in protein level. (A) Western blot analysis of hypertrophic markers, RUNX2, COL1A1 and MMP13, on day 21. (B) On day 21, immunocytochemistry determines the expression level of COL10A1 (PE; red fluorescence) and nucleus was stained with DAPI (blue). (C) Quantitative analysis of COL10A1 expression by Image J Software Ver **p <

37 4. Enhanced cartilage regeneration potential in vivo To identify whether the continuous treatment of RSV to MSCs could acquire increased cartilage regeneration capacity in vivo, we have developed osteochondral defect model (Figure 9). Figure 9. Establishment of rabbit osteochondral defect model. The size of defect is 6mm diameter and 3mm depth. 2x10 6 cells are applied onto the defect site to compare the effectiveness of P5-RMSC in cartilage regeneration. 26

38 8weeks post-operation, we observed the gross morphology of regenerated cartilage. In Hy/RMSC group, the surface of defect site was almost fully filled with cartilage-like tissue as the nearby cartilage while other groups were not fully filled with cartilage like tissue and in some parts it had lamination and cysts on the surface. Moreover, the Hy/RMSC group showed more transparent cartilage-like tissues (Figure 10A). Furthermore, we observed regenerated cartilage tissues via safranin O/fastgreen staining. The results showed enhanced GAG formation in Hy/RMSC group whereas the Hy/MSC group had slightly increased synthesis of GAG when compared to other groups (Figure 10B, upper lane). Then, we analyzed HE and MT staining to confirm the histological characteristics of newly formed cartilage in osteochondral defects. In HE stain, we observed that more chondrocyte-like cells were formed and also the there was no clustering. However, the other groups had a few chondrocyte-like cells and they formed fibrous tissues on cartilage (Figure 10B, middle lane). The MT stain demonstrated higher collagen deposition and no fibrous tissue formation on the surface of the cartilage in Hy/RMSC group in comparison with other groups (Figure 10B, bottom lane). Moreover, we performed OʹDriscoll scoring which shows the Hy/MSC groups had slightly higher score than defect or Hy group however the Hy/RMSC group had significantly higher score than other groups (Figure 11). These results suggest that the Hy/MSC group had slightly increased effects in cartilage regeneration while the Hy/RMSC group had significantly enhance cartilage regeneration. 27

39 28

40 Figure 10. Gross morphology and histological analysis of rabbit osteochondral defect sites after 8 weeks of surgery. (A) The gross morphology of osteochondral defect sites was photographed. (B) Formation of GAGs at osteochondral defect sites was evaluated by safranin O/fast green staining. GAGs were stained with cartilage tissue and fast green was stained in non-collagenous proteins (upper lane). HE stain shows the chondrocyte-like cell morphology (middle lane). MT stain demonstrates the collagen fiber formation which is stained with blue (bottom lane). (C) Quantitative histological analysis of regenerated cartilage tissue was performed via OʹDriscoll scoring system. Three independent experts assessed the cartilage regeneration and all scores were means of three independent assessments (n = 3). **p<

41 30

42 Figure 11. Evaluation of cartilage regeneration potential in vivo via immunohistochemical analysis. The effects of RSV treated MSCs in cartilage regeneration was confirmed by detecting (A) type II collagen (PE; red fluorescence) and (B) aggrecan (FITC; green fluorescence). (C) Quantitative analysis of type II collagen and aggrecan was confirmed via Image J Software Ver Hydrogel only vs. *p<0.05, **p < 0.01, ***p <

43 5. Inhibition of hypertrophic maturation of cartilage In order to identify the regeneration of hyaline cartilage, the immunohistochemistry was performed to detect expression of type X collagen, the hypertrophic marker. The Hy/RMSC group had scarce expression level of type X collagen while the defect, Hy, and Hy/MSC groups showed high expression level of that (Figure 12A and B). Consequentially, the P5-RMSC could inhibit the hypertrophic maturation in vivo, thus regenerated the hyaline cartilage. 32

44 Figure 12. Inhibition of hypertrophic maturation in RSV treated MSCs. Type X collagen (PE; red fluorescence), the hypertrophic maturation marker, was detected to confirm the inhibition of hypertrophic maturation in RSV treated MSCs. (B) Quantitative analysis of type X collagen was confirmed by Image J Software ver Hydrogel only vs. *p < 0.05, **p <

45 Ⅳ. DISCUSSION In cartilage regeneration, the MSCs are the most commonly used cell type but they have some limitations to use them. When we use MSCs as clinical application, the long-term in vitro expansion is necessary which cause the cellular senescence that leads to loss of self-renewal and multipotency. 43 In present study, I found that MSCs treated with RSV from P0 to P5 had enhanced stemness and inhibited senescence (Figure 2 and 3), simultaneously. When chondrogenic differentiation was performed, I found that P5-RMSC had increased chondrogenic differentiation potential when compared with other groups (Figure 4). Also, the expression levels of hypertrophic markers were confirmed to investigate the inhibition of hypertrophic maturation. The P5-RMSC had decreased expression level of hypertrophic markers while P5-MSC had increased hypertrophic maturation (Figure 7 and 8). After confirmation of enhanced chondrogenic differentiation of P5-RMSC in vitro, I investigated whether the P5-RMSC could enhance the hyaline cartilage regeneration in vivo. I established osteochondral defect model in rabbit and evaluated the regenerated cartilage. The histological analysis demonstrated that P5- RMSC had improved regeneration of hyaline cartilage. Typically, when the MSCs that have high potential of stemness are used in cartilage regeneration, there are several shortcomings including formation of fibrous tissue and hypertrophic maturation 44. However, in my study, I have overcome these limitations as described in Figure 7 and 8. Consequentially, the P5-RMSC had enhanced hyaline cartilage regeneration in concurrence with inhibited hypertrophic maturation because the maintenance of stemness via treatment of RSV. RSV is known to play critical roles in not only cell survival and proliferation but also enhances multipotential differentiation However, the RSV had contradictory effects when it is treated to MSCs. 32 Several studies have 34

46 demonstrated that RSV treatment could enhance multipotential differentiation 34,35 while others demonstrated that successive treatment of RSV to MSCs could increase cellular senescence. 34 Thus, in our previous study, we confirmed that when RSV is treated to MSCs at appropriate time point, they can enhance the stemness and multipotency. 37 Yoon et al. demonstrated that early passage MSCs which has high expression of SIRT1 were treated with RSV and these early passage MSCs treated with RSV could sustain the stemness. However, the late passage MSCs which has low expression of SIRT1 were treated by RSV could induce the cellular senescence. Also, other studies have treated RSV in high dose while yoon et al. confirmed the optimal concentration of RSV with consistent results of MSCs which have enhanced cartilage regeneration. Therefore, we treated 1uM of RSV from P0 to P5-MSCs. In cellular therapy, the recommendable passages for MSCs are between 3 and 5. 45,46 Generally, the MSCs at passage 1~2 have high multipotency but MSCs at passage 4~5 start to lose their multipotency. 22,47 To utilize MSCs in cellular therapy, the large numbers of cells are required for the treatment. 48 To obtain large number of cells, maintaining the stemness of MSCs is essential. Bonab et al. demonstrated that bone marrow derived MSCs lose the number of population doubling and also possess decreased telomere length as cells are subcultured. 21 Thus, I cultured MSCs up to passage 5 and obtained higher number of cells when RSV is treated (data not shown). In my study, I have used human bone marrow derived MSCs not rabbit MSCs. Since the MSCs have anti-inflammatory and immunosuppressive effects, 17 the utilization of human MSCs on rabbit osteochondral defct model did not cause any 35

47 side effects. Additionally, there are several studies using human MSCs in animal model experiments. 49,50 In my in vivo study, I have made critical size (diameter 6mm, depth 3mm) of osteochondral defects on rabbit, which is the size that was not able to self-heal. During establishing rabbit osteochondral defect model, the bone marrow from rabbit was emerged. In previous study, Gobbi et al, have demonstrated that the usage of bone marrow concentrate for cartilage regeneration was effective. 51 However, in our previous study, we have proven that the bone marrow concentrates did not have significant effects in cartilage regeneration. 41,52 Despite the presence of bone marrow concentrates, the defect and Hy groups did not regenerate cartilage. Thus, the evaluation of effectiveness of RSV treated MSCs is sufficient to compare each other without any other disturbance. Taken together, the continuous treatment of RSV on MSCs had sustained stemness which is similar to P1-MSCs. Consequently, the RSV treated MSCs had not only enhanced the chondrogenic differentiation potential but also promoted the regeneration of hyaline cartilage via maintenance of stemness. Ⅴ. CONCLUSION In summary, the treatment of RSV from P0 to P5 MSCs could enhance the stemness of MSCs and inhibited senescence of cells. Since the differentiation potential is up-regulated via continuous treatment of RSV to MSCs, they had enhanced chondrogenic differentiation potential and also inhibited hypertrophic maturation to synthesize hyaline cartilage. Furthermore, the MSCs that are continuously treated with RSV were applied onto the rabbit osteochondral defect sites. The osteochondral defect sites that had P5-RMSC transplantation showed enhanced cartilage regeneration in concurrence with formation of hyaline cartilage 36

48 which inhibited the hypertrophic maturation. In conclusion, the continuous treatment of RSV from P0 to P5 MSCs could support the environment for maintaining stemness result in enhanced chondrogenic differentiation. Thus, the methods which continuously treat RSV to MSCs can be a promising method of MSCs for cellular therapy. 37

49 REFERENCES 1. Dillon CF, Rasch EK, Gu Q, Hirsch R. Prevalence of knee osteoarthritis in the United States: arthritis data from the Third National Health and Nutrition Examination Survey J Rheumatol 2006;33: Lawrence RC, Felson DT, Helmick CG, Arnold LM, Choi H, Deyo RA, et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part II. Arthritis Rheum 2008;58: Ruan MZ, Erez A, Guse K, Dawson B, Bertin T, Chen Y, et al. Proteoglycan 4 expression protects against the development of osteoarthritis. Sci Transl Med 2013;5:176ra Yamashita A, Morioka M, Yahara Y, Okada M, Kobayashi T, Kuriyama S, et al. Generation of scaffoldless hyaline cartilaginous tissue from human ipscs. Stem Cell Reports 2015;4: Johnson K, Zhu S, Tremblay MS, Payette JN, Wang J, Bouchez LC, et al. A stem cell-based approach to cartilage repair. Science 2012;336: Madeira C, Santhagunam A, Salgueiro JB, Cabral JM. Advanced cell therapies for articular cartilage regeneration. Trends Biotechnol 2015;33: Narcisi R, Cleary MA, Brama PA, Hoogduijn MJ, Tuysuz N, ten Berge D, et al. Long-term expansion, enhanced chondrogenic potential, and suppression of endochondral ossification of adult human MSCs via WNT signaling modulation. Stem Cell Reports 2015;4: Kondo M, Yamaoka K, Tanaka Y. Acquiring chondrocyte phenotype from human mesenchymal stem cells under inflammatory conditions. Int J Mol Sci 2014;15: Schulze-Tanzil G, Mobasheri A, de Souza P, John T, Shakibaei M. Loss of chondrogenic potential in dedifferentiated chondrocytes correlates with deficient Shc-Erk interaction and apoptosis. Osteoarthritis Cartilage 2004;12:

50 10. Barry F, Murphy M. Mesenchymal stem cells in joint disease and repair. Nat Rev Rheumatol 2013;9: Ahmed TA, Hincke MT. Mesenchymal stem cell-based tissue engineering strategies for repair of articular cartilage. Histol Histopathol 2014;29: Richardson SM, Hoyland JA, Mobasheri R, Csaki C, Shakibaei M, Mobasheri A. Mesenchymal stem cells in regenerative medicine: opportunities and challenges for articular cartilage and intervertebral disc tissue engineering. J Cell Physiol 2010;222: Guilak F, Estes BT, Diekman BO, Moutos FT, Gimble JM Nicolas Andry Award: Multipotent adult stem cells from adipose tissue for musculoskeletal tissue engineering. Clin Orthop Relat Res 2010;468: Dennis JE, Merriam A, Awadallah A, Yoo JU, Johnstone B, Caplan AI. A quadripotential mesenchymal progenitor cell isolated from the marrow of an adult mouse. J Bone Miner Res 1999;14: Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284: Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997;276: Jo CH, Lee YG, Shin WH, Kim H, Chai JW, Jeong EC, et al. Intra-articular injection of mesenchymal stem cells for the treatment of osteoarthritis of the knee: a proof-of-concept clinical trial. Stem Cells 2014;32: Orozco L, Munar A, Soler R, Alberca M, Soler F, Huguet M, et al. Treatment of knee osteoarthritis with autologous mesenchymal stem cells: a pilot study. Transplantation 2013;95: Wong KL, Lee KB, Tai BC, Law P, Lee EH, Hui JH. Injectable cultured bone marrow-derived mesenchymal stem cells in varus knees with cartilage defects undergoing high tibial osteotomy: a prospective, randomized controlled clinical trial with 2 years' follow-up. Arthroscopy 2013;29:

51 20. Banfi A, Muraglia A, Dozin B, Mastrogiacomo M, Cancedda R, Quarto R. Proliferation kinetics and differentiation potential of ex vivo expanded human bone marrow stromal cells: Implications for their use in cell therapy. Exp Hematol 2000;28: Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH, Ghavamzadeh A, Nikbin B. Aging of mesenchymal stem cell in vitro. BMC Cell Biol 2006;7: Chen J, Sotome S, Wang J, Orii H, Uemura T, Shinomiya K. Correlation of in vivo bone formation capability and in vitro differentiation of human bone marrow stromal cells. J Med Dent Sci 2005;52: Li Z, Liu C, Xie Z, Song P, Zhao RC, Guo L, et al. Epigenetic dysregulation in mesenchymal stem cell aging and spontaneous differentiation. PLoS One 2011;6:e Hellingman CA, Koevoet W, Kops N, Farrell E, Jahr H, Liu W, et al. Fibroblast growth factor receptors in in vitro and in vivo chondrogenesis: relating tissue engineering using adult mesenchymal stem cells to embryonic development. Tissue Eng Part A 2010;16: Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG, et al. Premature induction of hypertrophy during in vitro chondrogenesis of human mesenchymal stem cells correlates with calcification and vascular invasion after ectopic transplantation in SCID mice. Arthritis Rheum 2006;54: Scotti C, Tonnarelli B, Papadimitropoulos A, Scherberich A, Schaeren S, Schauerte A, et al. Recapitulation of endochondral bone formation using human adult mesenchymal stem cells as a paradigm for developmental engineering. Proc Natl Acad Sci U S A 2010;107: Noth U, Steinert AF, Tuan RS. Technology insight: adult mesenchymal stem cells for osteoarthritis therapy. Nat Clin Pract Rheumatol 2008;4: Eom YW, Oh JE, Lee JI, Baik SK, Rhee KJ, Shin HC, et al. The role of growth factors in maintenance of stemness in bone marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun 2014;445:

52 29. Joe AK, Liu H, Suzui M, Vural ME, Xiao D, Weinstein IB. Resveratrol induces growth inhibition, S-phase arrest, apoptosis, and changes in biomarker expression in several human cancer cell lines. Clin Cancer Res 2002;8: Signorelli P, Ghidoni R. Resveratrol as an anticancer nutrient: molecular basis, open questions and promises. J Nutr Biochem 2005;16: Valenzano DR, Terzibasi E, Genade T, Cattaneo A, Domenici L, Cellerino A. Resveratrol prolongs lifespan and retards the onset of age-related markers in a short-lived vertebrate. Curr Biol 2006;16: Peltz L, Gomez J, Marquez M, Alencastro F, Atashpanjeh N, Quang T, et al. Resveratrol exerts dosage and duration dependent effect on human mesenchymal stem cell development. PLoS One 2012;7:e Yuan HF, Zhai C, Yan XL, Zhao DD, Wang JX, Zeng Q, et al. SIRT1 is required for long-term growth of human mesenchymal stem cells. J Mol Med (Berl) 2012;90: Dai Z, Li Y, Quarles LD, Song T, Pan W, Zhou H, et al. Resveratrol enhances proliferation and osteoblastic differentiation in human mesenchymal stem cells via ER-dependent ERK1/2 activation. Phytomedicine 2007;14: Yoon DS, Choi Y, Jang Y, Lee M, Choi WJ, Kim SH, et al. SIRT1 directly regulates SOX2 to maintain self-renewal and multipotency in bone marrow-derived mesenchymal stem cells. Stem Cells 2014;32: Caldarelli I, Speranza MC, Bencivenga D, Tramontano A, Borgia A, Pirozzi AV, et al. Resveratrol mimics insulin activity in the adipogenic commitment of human bone marrow mesenchymal stromal cells. Int J Biochem Cell Biol 2015;60: Yoon DS, Choi Y, Choi SM, Park KH, Lee JW. Different effects of resveratrol on early and late passage mesenchymal stem cells through beta-catenin regulation. Biochem Biophys Res Commun 2015;467: Ikebe C, Suzuki K. Mesenchymal stem cells for regenerative therapy: optimization of cell preparation protocols. Biomed Res Int 2014;2014:

53 39. Lee Y, Bae JW, Oh DH, Park KM, Chun YW, Sung H-J, et al. In situ forming gelatin-based tissue adhesives and their phenolic content-driven properties. J Mater Chem B 2013;1: Yoon DS, Lee Y, Ryu HA, Jang Y, Lee KM, Choi Y, et al. Cell recruiting chemokine-loaded sprayable gelatin hydrogel dressings for diabetic wound healing. Acta Biomater 2016;38: Yoon DS, Lee KM, Kim SH, Kim SH, Jung Y, Kim SH, et al. Synergistic Action of IL-8 and Bone Marrow Concentrate on Cartilage Regeneration Through Upregulation of Chondrogenic Transcription Factors. Tissue Eng Part A 2016;22: Hellingman CA, Davidson EN, Koevoet W, Vitters EL, van den Berg WB, van Osch GJ, et al. Smad signaling determines chondrogenic differentiation of bonemarrow-derived mesenchymal stem cells: inhibition of Smad1/5/8P prevents terminal differentiation and calcification. Tissue Eng Part A 2011;17: Turinetto V, Vitale E, Giachino C. Senescence in Human Mesenchymal Stem Cells: Functional Changes and Implications in Stem Cell-Based Therapy. Int J Mol Sci 2016; Mueller MB, Tuan RS. Functional characterization of hypertrophy in chondrogenesis of human mesenchymal stem cells. Arthritis Rheum 2008;58: Horwitz EM, Gordon PL, Koo WK, Marx JC, Neel MD, McNall RY, et al. Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: Implications for cell therapy of bone. Proc Natl Acad Sci U S A 2002;99: Zhao K, Lou R, Huang F, Peng Y, Jiang Z, Huang K, et al. Immunomodulation effects of mesenchymal stromal cells on acute graft-versus-host disease after hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2015;21:

54 47. Siddappa R, Licht R, van Blitterswijk C, de Boer J. Donor variation and loss of multipotency during in vitro expansion of human mesenchymal stem cells for bone tissue engineering. J Orthop Res 2007;25: Farini A, Sitzia C, Erratico S, Meregalli M, Torrente Y. Clinical applications of mesenchymal stem cells in chronic diseases. Stem Cells Int 2014;2014: Ponticiello MS, Schinagl RM, Kadiyala S, Barry FP. Gelatin-based resorbable sponge as a carrier matrix for human mesenchymal stem cells in cartilage regeneration therapy. J Biomed Mater Res 2000;52: Tuli R, Nandi S, Li WJ, Tuli S, Huang X, Manner PA, et al. Human mesenchymal progenitor cell-based tissue engineering of a single-unit osteochondral construct. Tissue Eng 2004;10: Gobbi A, Chaurasia S, Karnatzikos G, Nakamura N. Matrix-Induced Autologous Chondrocyte Implantation versus Multipotent Stem Cells for the Treatment of Large Patellofemoral Chondral Lesions: A Nonrandomized Prospective Trial. Cartilage 2015;6: Madry H, Gao L, Eichler H, Orth P, Cucchiarini M. Bone Marrow Aspirate Concentrate-Enhanced Marrow Stimulation of Chondral Defects. Stem Cells Int 2017;2017:

55 ABSTRACT (in korean) SIRT1 활성제전처리에의해증진된 중간엽줄기세포의연골분화능 < 지도교수이진우 > 연세대학교대학원의과학과 최성미 골관절염은퇴행성관절관련질병으로, 이는연골재생능력이부족하여점진적으로광범위한연골손상이발생하게된다. 골관절염의주요한세포병리학적현상은연골의손상, 연골세포증식문제, 그리고연골의비대화이다. 현재, 이를치료하기위한여러가지연골재생치료방법이진행되고있는데, 여러가지방법중세포치료제가최근주목받고있다. 세포치료제중특히중간엽줄기세포를이용한방법이가장 44

56 널리이용되고있다. 중간엽줄기세포를세포치료제로이용하기위해서는부족한세포를증식하기위한체외배양이필수적이다. 또한세포치료제로써의유효량을얻기위해서는체외에서장기간배양이불가피하다. 체외에서장기배양시, 중간엽줄기세포는자가증식력과다분화능을잃게되며또한연골로분화시연골의비대화가유발되게된다. 이와같은문제점을극복하여중간엽줄기세포의줄기세포능과연골분화능을향상시키기위한새로운전략이필요하다. Resveratrol 은강력한 SIRT1 활성제로, 중간엽줄기세포에서세포의생존, 증식력그리고다분화능에서주요한역할을한다고알려져있다. 이전연구에따르면, SIRT1 의발현이유지되고있는초기계대의중간엽줄기세포에 resveratrol 을처리하였을경우, 중간엽줄기세포의자가증식력, 골분화능그리고지방세포분화능이후기계대가되어도초기계대와유사하게유지되는것을알수있었다. 하지만이때, resveratrol 을초기계대부터지속적으로처리하였을경우연골세포로의분화능은검증되지않았다. 본연구에서는 resveratrol 을 1 계대의중간엽줄기세포부터 지속적으로처리하면서배양하였을경우중간엽줄기세포의증진된연골 세포분화능을검증하였다. 따라서, 중간엽줄기세포를 micromass culture 방법을이용하여연골분화를유도하여 real-time PCR 과 western blot 을통하여연골분화마커의발현을비교하였다. 그결과, 45

57 resveratrol 을처리해주었을경우에더높은연골분화능을유지하고있는것을확인할수있었다. 또한염색및면역염색법을이용하여분화된세포의 GAGs 와 PGs 가형성된정도를확인하고연골분화마커의발현을면역염색법을이용하여확인하였다. 또한연골세포로분화되었는지확인하기위하여연골비대화관련마커를 real-time PCR 과 western blot 을이용하여확인한결과, resveratrol 을처리한중간엽줄기세포에서는연골비대화가감소되어있는것을알수있었다. 이어서체내연골재생능을검증하기위하여토끼의골연골결손모델을확립하여, 결손부위에세포를이식하였다. 그결과를조직학적 분석을통하여확인을하였다. Resveratrol 을처리한중간엽줄기 세포는 Safranin O/ Fast green stain 을통하여형성된 GAG 를확인할수있었고, HE stain 을통해서온전한연골세포가형성된것을확인하였으며, MT stain 을통하여교원질증착을확인할수있었다. 그리고연골이재생되었는지확인하기위해, 연골분화마커와비대화마커를면역염색법을이용하여발현정도를확인결과 resveratrol 을처리한중간엽줄기세포가연골분화마커는증가되었지만반대로비대화마커는감소된것을알수있었다. 요약하면, resveratrol 을 SIRT1 이발현되고있는 1 계대의중간엽줄기세포부터지속적으로처리를하게되면, 세포치료제로주로이용하는 5 계대인중간엽줄기세포의줄기세포능과분화능이 passage 46

58 1 과유사하게유지하게됨으로써, 연골분화능이증진됨과동시에 비대화를억제하는것을체외와체내실험을통해알수있었다. 이와 같이 resveratrol 을지속적으로처리해함으로써세포의치료적 유효량을더욱빨리획득이가능하며더불어더욱효율적인연골분화가 가능한점에서골관절염의효과적인세포치료제로써의역할을할것으로 사료된다. 핵심되는말 : 연골분화, 연골재생, 레스베라트롤, SIRT1 47