Microsoft Word - 2-김영부.doc

Size: px
Start display at page:

Download "Microsoft Word - 2-김영부.doc"

Transcription

1 Journal of Bacteriology and Virology Vol. 37, No. 2 p 설사환자에서분리한장출혈성대장균과장병원성대장균의 Enterocyte Effacement 관련 LEE 유전자의병원형특성 부산대학교의과대학미생물학교실 박도훈 문지영 김영부 * Pathotypic Characterization of Enterocyte Effacement-related LEE Genes in EHEC and EPEC Isolated from Diarrheal Patients Do-Hun Park, Ji-Young Moon and Yung-Bu Kim * Department of Microbiology and Immunology, College of Medicine, Pusan National University, Pusan , Korea Received : December 12, 2006 Accepted : April 5, 2007 Attaching and effacing Escherichia coli (AEEC) cause enteric infections in humans and animals. Attaching indicates the intimate attachment of bacteria to the enterocyte, and effacing relates to the localized effacement of brush border microvilli. Enteropathogenic (EPEC) and enterohemorrhagic Escherichia coli (EHEC) infections are characterized by the formation of attaching and effacing (AE) lesion on the intestinal epithelial cells. Therefore, they are often grouped together as AEEC. Development of multiplex PCR allowed us to type five of the most important genes implicated in the formation of the AE lesion. A total of 60 AEEC strains isolated from diarrheal patients were investigated by multiplex PCR for the presence of the insertion site of locus of enterocyte effacement (LEE) and LEE-related (eae, tir, espa, espb, and espd) genes. Associating the results of LEE genes typing in the AEEC strains, three different pathotypes are determined: eae γ -tir γ -espa γ -espb γ -espd γ (O157:H7), eae β -tir β -espa β -espb β -espd β (O26:H11), and eae α -tir α -espa α -espb α -espd α (O55:H6). These results indicate that AEEC are a heterogenous groups of organisms. Key Words: AEEC, LEE, Attaching and effacing, Multiplex PCR 서 대장균은정상장관세균무리를형성하는중요한균종이며대부분은비병원성이지만특수한병원인자를획득한대장균은사람의장관이나요로에서감염증을일으킨다. 이와같은병원성대장균은광의로장관병원성대장균과요로병원성대장균 (uropathogenic E. coli) 으로구분된다. 장관병원성대장균은감염과병리학적기전에의해장병원성대장균 (enteropathogenic E. coli, EPEC), 장침투성대장균 (enteroin- * 교신저자 : 김영부 , 부산광역시서구아미동 1 가 10 번지, 부산대학교의과대학미생물학교실 Phone: , Fax: , ybkim@pusan.ac.kr 론 vasive E. coli, EIEC), 장독소생성대장균 (enterotoxigenic E. coli, ETEC), 장출혈성대장균 (enterohemorrhagic E. coli, EHEC), 장응집성대장균 (enteroaggregative E. coli, EAEC) 으로분류하고있다. EHEC는설사와출혈성대장염그리고용혈요독증후군 (hemolytic uremic syndrome; HUS) 의주요한병원체로부착- 소멸적손상 (attaching and effacing, A/E) 병변으로숙주의장관점막에부착하여병변을일으키는것외에베로독소 (verotoxin, VT) 혹은시가독소 (shigatoxin, Stx) 를생성한다 (37). EHEC의혈청형에는 O157 이외에도여러가지혈청형이알려져있지만, 모든 EHEC 균주가독성이강한시가독소를생산하는것은아니기때문에균의시가독소생산여부를검사해야한다. 또한시가독소를생산하는대장균에서도 Stx1만을생산하는것과 Stx2만을생산하는것그리고모두를동시에생산하는것으로분류하고있 69

2 70 박도훈, 문지영, 김영부 는데, 실제로어느시가독소를생산하느냐에따라서병원성의정도에차이가있다 (21). 이처럼병원성은다르지만장관상피세포의세포질막에부착하여장관의미세융모를소멸시키고, actin을세균정착부위아래에축적시켜세포골격을변화시키는 A/E의특징적인장관병변현상을나타내므로 (16,19), 이들을 "attaching and effacing E. coli (AEEC)" 라부르며 EHEC에속하는일부의혈청형군과 EPEC의혈청형들에서볼수있다 (27,32). 이와같은 A/E 병변에필수적인유전자인 eae 유전자는 LEE (locus of enterocyte effacement) 로알려져있는 35.5 kb의염색체상의병원성섬 (pathogenicity island, PAI) 에위치하고있으며, 94~97 kda 크기의외막단백질인 intimin을지령한다 (26). LEE는 intimin 외에도제3형분비계 (type III secretion system, TTSS) 와그것에의해분비되는 Tir (translocated intimin receptor), Esp (EPEC-secreted protein) 등병원성에관련된여러종류의단백질을지령하고있으며, 사람에서분리된 EPEC 균주인 E2348/69 O127:H6에서 selc (selenocystyl trna locus) 유전자에삽입되어클론된염기서열이처음으로보고되었다 (11,15,35). 이러한 LEE는 41 open reading frame 을가지고 5가지주요한 operon 즉, LEE 1, LEE 2, LEE 3, LEE 4 및 LEE 5로구성되어있으며 (36), 기능적으로 3가지영역으로나눌수있다 (32). LEE의왼쪽부분인 LEE 1~ 3은 TTSS를지령하고있으며, 단백질 EspA (24~25 kda), EspB (37 kda), EspD (39~40 kda) (24,25) 그리고 Tir 단백질의분비에관여하는유전자 (esc와 sep) 를보유하며 (29), Esp 단백질의정상적인분비에필수적인 SepL는 EHEC 균주 EDL933에특징적이다 (33). 또한 LEE의중간부분인 LEE 5는 adhesin intimin, Tir chaperone, Tir를지령하는 tir-cest-eae operon을가지며, 94 kda 외막단백질즉, intimin을지령하는 eae 유전자와숙주세포막으로이동되어숙주세포막에결합하는 intimin 수용체인 Tir를지령하는 tir 유전자로인하여숙주세포에세균의견고한부착을촉진시킨다 (40). LEE의오른쪽부분인 LEE 4는 A/E 병변에필요한단백질 SepL, EspA, EspD, EspB, CesD2, EscF, EspF 그리고기능이확실하 지않은 Orf19를지령하는 espa, espd, espb 등의유전자로구성된다 (34). LEE는 EHEC O157에잘보존되어있으며, 현재 LEE 염기배열에 type III 분비유전자가잘보존되어있는대장균의혈청형 O127:H6 (15), O157:H7 (40), O26:H - (GenBank accession No. AJ277443) 와 O15:H - (43) 에대한 LEE 영역의뉴클레오티드염기배열의전체가밝혀졌으나, LEE 4 와 LEE 5 유전자에서변이가보고되고있으며, LEE 4 영역의유전적변이는 EPEC와 EHEC의몇가지의혈청형에서만조사되고있다. 이에본연구에서는 LEE 관련유전자에대해환자에서분리된 AEEC 균주를대상으로혈청형을살펴보고, 각각의특이적인 multiplex PCR을실시하여 Stx1, Stx2의검출및 Stx2 의유전자형을확인하였다. 또한 selc에서의 LEE 삽입여부와 LEE 관련유전자인 eae, tir, espa, espb와 espd의보유현황및변이체에대한유전학적특징 ( 병원형 ) 을비교검토하였다. 따라서병원성대장균의신속하고정확한분리동정을가능하게하고이를바탕으로사람이나동물에서분리된병원성대장균의분자역학적조사나 AEEC 감염증제어를위한대책을수립하는데기초적자료를마련하고자하였다. 재료및방법 1. 균주 1996년부산대학교병원소아과의 HUS 환자대변과임상가검물에서분리된 EHEC 2균주와 Kyoto 대학동남아시아연구센터의 Mitsuaki Nishibuchi 교수로부터분양받은일본에서유행한 EHEC 20균주, 그리고일본 Kyushu 의과대학세균학교실에서분양받은대장균중병원성대장균면역혈청의 O군혈청으로확인이가능한 EHEC 22균주와 EPEC 14균주를대상으로실험에이용하였다 (3). Stx (stx1, stx2) 양성대조균주로 EDL933을사용하였다 (Table 1). 2. O 및 H 혈청형검사 O 및 H 혈청형검사를위하여병원성대장균에대한면 Table 1. E. coli strains tested in this study and their sources No. of strains Sources (Reference) Characteristics 2 PNUH EHEC, isolated from stools of HUS patients in PNUH 20 CSEAS EHEC, provided by Dr. Nishibuchi 22 KUH EHEC, provided by Dr. Yoshida 14 KUH EPEC, provided by Dr. Yoshida 1 (33) EDL933, positive control of Stx Abbreviations. PNUH, Pusan National University Hospital; CSEAS, Center for Southeast Asian Studies Kyoto University; KUH, Kyushu University Hospital; Stx, shigatoxin

3 AEEC 의 LEE 관련유전자의병원형 71 Table 2. PCR primers used in the study Primer set Primer name Sequences (5' 3') Target gene Location within gene A LP30 CAGTTAATGTCGTGGCGAAGG stx1 213~232 LP31 CACCAGACAATGTAACCGCTG 559~538 LP43 ATCCTATTCCCGGGAGTTTACG stx2 295~316 LP44 GCGTCATCGTATACACAGGAGC 881~859 B Stx2c-a GCGGTTTTATTTGCATTAGT stx2c 1186~1205 Stx2c-b AGTACTCTTTTCCGGCCACT 1309~1290 SLT2vB1 ATGAAGAAGATGTTTATAGCG stx2e 1176~1196 SLT2vB2 TCAGTTAAACTTCACCTGGGC 1439~1419 C Stx2d-a GGTAAAATTGAGTTCTCTAAGTAT stx2d 1221~1244 Stx2d-b CAGCAAATCCTGAACCTGACG 1395~ AGATTGGGCGTCATTCACTGGTTG stx2f 519~ TACTTTAATGGCCGCCCTGTCTCC 946~923 Amplicon (bp) Reference (GenBank accession no.) (JM19473) (X07865) (M59432) (M36727) (AF043627) (AJ010730) 역혈청 (Denka Seiken Co., Ltd., Tokyo, Japan) 을사용하였다. O 항원군의형별은생균및가열한균 (100, 1시간또는 121, 15분 ) 을사용하여슬라이드글라스응집반응을이용하여검사하였고, H 형별은시험균주를반유동우무배지에서 2~3회통과시킨후, H 항원군혈청을사용하여시험관내응집법으로실시하였다 (30). 3. 환자유래 AEEC의 stx 유전자의검출및아형 (subtype) 검사 Multiplex PCR법에이용한 stx 독소유전자형별실험은 Table 2의 primers와조건에따라 Osek (38) 의방법으로실시하였으며, 3가지 primer set을사용하여 PCR을시행하였다. A set는 Stx 변이체인 stx1과 stx2 유전자를사용하였고, B set는 Stx2의변이유전자들인 stx2c와 stx2e, 그리고 C set는다른 Stx 2 변이유전자인 stx2d와 stx2f가동시에확인되도록구성하였다. DNA 추출은가열법으로실시하였으며, 유전자증폭은 Thermal cycler PTC-100 (MJ Research Inc., Waltham, MA, USA) 에서 94 에서 5분간반응시킨후 94 /1분, 53 /1분, 72 /1분의과정을 30회실시하고마지막으로 53 에서 5분간반응시켰다. PCR 증폭산물은 molecular weight marker (100 bp ladder: TaKaRa Biomedicals, Otsu, Japan) 와함께 2% agarose gel에전기영동하여 ethidium bromide (EtBr) 로염색한후자외선하에서위치를확인하였다. 4. 환자유래 AEEC의 LEE 존재확인환자유래 AEEC의 selc 유전자상에 LEE의삽입여부를확 인하기위하여 Table 3의 K255, K260 및 K261 primers 를사용하여 McDaniel 등 (35) 의방법에따라 multiplex PCR을실시하였다. 실험균주에서위와같이가열하여 DNA를추출하였다. Thermal cycler (MJ Research Inc.) 에서 94 에서 5 분간반응시킨후 92 /2분, 50 /2분, 72 /3분의과정을 30 회실시한후 72 에서 5분간반응시켰다. PCR 증폭산물은 molecular weight marker (100 bp plus ladder: Bioneer Co., Seoul, Korea) 와함께 2% agarose gel에서전기영동한후, EtBr로염색하여자외선하에서 DNA 단편의위치를확인하였다. 이때 LEE 말단에위치한 K255와 LEE의 downstream primer인 K260을사용하여 418 bp에서증폭되는경우는 LEE가 selc 에삽입된것을나타내며, K260과 LEE의삽입으로절단된 ORF O394에위치한 K261 primer에의하여 527 bp에서증폭되는경우는 LEE가삽입되지않은온전한 selc 유전자를가지는것으로분석하였다. 5. 환자유래 AEEC의 LEE 관련유전자의검출환자유래 AEEC의 LEE 관련유전자인 eae, tir, espa, espb 및 espd 유전자들확인하여 pathotype을확인하기위하여 Goffaux 등 (19) 과 China 등 (10) 의방법에따라 Table 3의 primers를사용하여 multiplex PCR을실시하였다. 유전자증폭은 Thermal cycler PTC-100 (MJ Research Inc.) 에서 espa 유전자의경우 94 에서 5분간반응시킨후 94 /30초, 48 / 30초, 72 /30초의과정을 30회실시하였고, espb, espd, eae 그리고 tir 유전자의경우 94 에서 5분간예비가열한후 94 /30초, 50 /30초, 72 /30초의과정을 30회실시하였다.

4 72 박도훈, 문지영, 김영부 Genes and subtypes Table 3. PCR primers for the detection of LEE-related genes in AEEC Strains (accession number) Sequences of the deduced primers a (5'-3') Annealing temperature ( ) Amplicon (bp) Disrupted selc E2348/69 (GenBank AF031372) K260: GAGCGAATATTCCGATATACTGGTT K255: GGTTGAGTCGATTGATCTCTGG Intact selc E2348/69 (GenBank AF031372) K260: GAGCGAATATTCCGATATACTGGTT K261: CCTGCAAATAAACACGGCGCAT eae type α E2348/69 (EMBL X60439) B73: TACTGAGATTAAGGCTGATAG B138: GACCAGAAGAAGATCCG eae type β EDL933 (EMBL Z11541) B73: TACTGAGATTAAGGCTGATAG B74: AGGAAGAGGGTTTTGTGT eae type γ 193 (GenBank AF043226) B73: TACTGAGATTAAGGCTGATAG B137: TGTATGTCGCACTCTGAT tir type α E2348/69 (GenBank AF022236) B139: CRCCKCCAYTACCTTCACG B152: CGCTAACCTCCAAACCAT tir type β EDL933 (GenBank AF07134) B139: CRCCKCCAYTACCTTCACG B141: GTCGGCAGTTTCAGTTTCAT tir type γ 95ZG1 (GenBank AF070068) B139: CRCCKCCAYTACCTTCACG B140: GATTTTTCCCTCGCCACTG espa type α E2348/69 (GenBank Z54352) B163: TGAGGCATCTAARGMGTT B165: GCTGGCTATTATTGACC espa type β EDL933 (GenBank Y13068) B163: TGAGGCATCTAARGMGTT B164: ATCACGAATACCAGTTACCG espa type γ RDEC-1 (GenBank U80908) B163: TGAGGCATCTAARGMGTT B166: TGCCTTTCTTATTCTTGTCG espb type α E2348/69 (GenBank AF022236) B148: GCCGTTTTTGAGAGCCG B151: TCCCCAGGACAGATGAGA espb type β EDL933 (GenBank Y13068) B148: GCCGTTTTTGAGAGCCG B150: GCACCAGCAGCCTTTGG espb type γ RDEC-1 (GenBank U80796) B148: GCCGTTTTTGAGAGCCG B149: CTTTCCGTTGCCTTAG espd type α E2348/69 (GenBank AF022236) B186: CGAAGAACAACAAAAAGCC B188: ACAGCAAAAGCAGAAACCT espd type β E22 (GenBank AF054421) B186: CGAAGAACAACAAAAAGCC B187: GCAGAGGTCGTAAATCCAT espd type γ EDL933 (GenBank AF071034) B186: CGAAGAACAACAAAAAGCC a R = A+G, K = T+G, Y = C+T, M = A+C B189: CTGCCGCTTTCTCAACGAC

5 AEEC 의 LEE 관련유전자의병원형 73 Table 4. Serotypes of AEEC used in this study A B Strains Sources No. of isolates Serotypes EHEC PNUH 2 O157:H7 CSEAS 20 O157:H7 KUH 13 O157:H7 3 O157:H - 2 O157:H45 2 O26:H11 2 O111:H - EPEC KUH 6 O55:H7 3 O55:H10 2 O55:H6 1 O55:H - 2 O111:H12 EHEC (EDL933) Control strain 1 O157:H7 PCR 증폭산물 10 µl를 molecular weight marker (100 bp plus ladder: Bioneer) 와함께 2% agarose gel에서전기영동하여자외선하에서확인하였다. 결 1. 환자유래 AEEC 의혈청형 국내의 HUS 환자와임상가검물에서분리된 2균주는모두 O157:H7이었으며, Kyoto 대학에서분양받은 20균주도모두 O157:H7로확인되었다. 또한일본 Kyushu 대학에서분리된 EHEC 균주 22균주와 EPEC 14균주를대상으로하여혈청형별을실시한결과, EHEC의경우 O157:H7이 13균주로가장많았고, O157:H - 와 O157:H45는각각 3균주와 2균주로서대부분이 O157로형별되었으며, 이외에 O26:H11과 O111:H - 도각각 2균주씩확인되었다. 반면 EPEC는 12균주가 O55로가장많았으며 O55:H7 (6균주), O55:H10 (3균주), O55:H6 (2 균주 ), O55:H - (1균주) 의순으로나타났고, 나머지 2균주는 O111:H12로형별되었다 (Table 4). 2. 환자유래 EHEC의시가독소 (Stx) 의검출및유전자형검사 환자유래 AEEC 균주를대상으로하여 Stx의생성능및변이체를확인한결과, 한국의 HUS 환자와임상가검물에서분리된 O157:H7 균주는모두 Stx1만검출되었고, 일본 Kyoto 대학에서분양받은 O157:H7 20균주의경우 13균주는 과 Figure 1. stx genes obtained from AEEC strains by multiplex PCR A C. A: lane M, 100 bp plus ladder (molecular weight markers); lane 1, control strains EDL933 (stx1 +, stx2 + ); lane 2, EHEC O1157:H - strain (stx1 -, stx2 + ); lane 3, EHEC O111:H - strain (stx1 +, stx2 - ); lane 4, EPEC O55:H - strain (stx1 -, stx2 - ). B: lane N, 100 bp ladder (molecular weight markers); lane 1, E. coli EDL933 (stx2e -, stx2f + ); lane 2, EHEC O1157:H - strain (stx2e -, stx2f + ). Stx1과 Stx2를모두보유하는반면, 나머지 7균주는 Stx2만보유하였으며, Stx2 유전자의아형은모두 Stx2f로확인되었다. 또한 Kyushu 대학의 EHEC 22균주중 O157:H7과 O157: H - 14균주가 Stx2를보유하였고아형은 Stx2f로나타났으며, 이중 6균주는 Stx1과동시에확인되었다. 나머지 8균주에서는 O26:H11과 O111:H - 4균주가 Stx1만을보유하였으며, 특히 O157:H7과 O157:H45 각각 2균주에서 Stx를보유하지않는것으로나타났다. 이처럼 EHEC 균주의 Stx 검출과 Stx2 아형을살펴본결과, Stx2 유전자만보유하거나 Stx1과동시에모두보유하는균주들은대부분 O157:H7 균주로높은병원성을나타내고있음을보여주었다 (Fig. 1). 3. LEE 관련염기배열의존재 AEEC의 LEE 관련염기배열의존재를조사하기위하여 PCR법으로 LEE의 insertion site를결정하여확인한결과, 국내와 Kyoto 대학의 O157:H7 균주는모두 selc에 LEE의삽입을나타내는 418 bp에서양성이었으며, Kyushu 대학의경우 30주가 418 bp에서양성이었고, 나머지 6균주는 LEE가 selc 이외의염색체에삽입된것을나타내는 527 bp에양성을나타내었다 (Fig. 2). 4. LEE 관련유전자의검출및병원형검사 Multiplex PCR을사용하여환자유래 AEEC의 eae, tir, espa, espb 그리고 espd 유전자를검출하고각각의변이체들을확인한결과, 대부분의 AEEC 균주에서 LEE 관련유전자들이검출되었으나, EPEC 4균주 (O55:H -, O55:H10) 에서는전혀검출되지않았다. 특히 Stx를보유하지않는 EHEC의경우에서는 O157:H45에서 espa와 espd 유전자가관찰되지않았으며, espb 유전자의경우 EHEC에서는모두관찰되는반면,

6 74 박도훈, 문지영, 김영부 EPEC 균주에서는 O55:H6 균주를제외하고는전혀나타나지않았고, espd 유전자의경우 O111:H12 와 O111:H - 에서도나타나지않았다. 또한각 LEE 관련유전자들의변이체를확인해본결과, 한국의 HUS 환자와일본의 Tokyo 대학에서분리한 EHEC O157:H7의경우모두 γ형으로나타난반면, Kyushu 대학의경우도대부분이 γ형으로가장많았으나, O157:H45와 O55:H6의경우는모두 α형으로확인되었다. O111:H - 의경우도 eae 유전자만 γ형이고나머지는 α형으로 나타났으며, O26:H11 은모두 β형으로확인되었다 (Table 5). 또한병원형은크게 3가지로분류되었으며, 특히 EHEC O157:H7 및 O157:H - 는모두 eae γ -tir γ -espa γ -espb γ -espd γ 의유전자형으로가장많이나타났다. 그리고 EHEC O26:H11의경우는 eae β -tir β -espa β -espb β -espd β 의유전자형이었고, EPEC O55:H6에서는모두 eae α -tir α -espa α -espb α -espd α 의유전자형을나타내었다. 또한시가독소를보유하지않는 O157:H45의경우 eae α -tir α -espa - -espb α -espd - 의유전자형을보였고, EPEC O55:H7은모두 eae γ -tir γ -espa γ -espb - -espdγ를 EPEC O111:H12 의경우는 eae γ -tir γ -espa γ -espb - -espd - 의유전자형을나타내었다. 이처럼대부분의균주가 eae와 tir, 그리고 espa와 espb 유전자에서동종의조합을보여주었으나, 특이하게 EHEC O111:H - 균주의 eae γ -tir α -espa α -espb α -espd - 의유전자형에서는상이한연관성을나타내기도하였다 (Table 5). 고 찰 Figure 2. Multiplex PCR to distinguish an intact selc locus from one disrupted by LEE. Primers K255 and K260 are predicted to produce a 418 bp amplicon in strains containing a LEE-disrupted locus. Primers K261 and K260 produced the 527 bp amplicon in strains indicating an intact selc locus. Lane M, 100 bp plus ladder (molecular weight markers); lane 1, E. coli EDL933 (stx1 +, stx2 +, control strains); lane 2, EHEC strain (O111:H - ). 개발도상국에서 EPEC는유아설사증의주요한원인균으로, 소장점막의상피세포에부착증식함으로써장염을일으키며주요한혈청형은 O55, O86, O111, O126 등이다. EHEC 은주로혈청형 O157, O26, O111, O113, O146 등이보고되고있으며, 특히어린이와노인에게있어서 HUS를일으키고장관에장착후 Stx를생산하여장관상피세포와신장상피세포에장애를일으킨다 (22). 이러한 EHEC는베로독소생성대장균혹은시가독소생성대장균 (verotoxin or shigatoxinproducing E. coli, VTEC or STEC) 으로명명되기도하며, Stx Table 5. Presence and typing of LEE-related genes in AEEC strains a No. of Strains Sources selc disrupted by LEE Pathotype strains Serotype EHEC PNUH yes eae γ -tir γ -espa γ -espb γ -espd γ 2 O157:H7 CSEAS yes eae γ -tir γ -espa γ -espb γ -espd γ 20 O157:H7 KUH yes eae γ -tir γ -espa γ -espb γ -espd γ 16 O157:H7, O157:H - yes eae α -tir α -espa - -espb α -espd - 2 O157:H45 yes eae β -tir β -espa β -espb β -espd β 2 O26:H11 no eae γ -tir α -espa α -espb α -espd - 2 O111:H - EPEC KUH yes eae γ -tir γ -espa γ -espb - -espd γ 6 O55:H7 no ND 3 O55:H10 yes eae α -tir α -espa α -espb α -espd α 2 O55:H6 no ND 1 O55:H - yes eae γ -tir γ -espa γ -espb - -espd - 2 O111:H12 EHEC (EDL933) Control strain yes eae γ -tir γ -espa γ -espb γ -espd γ 1 O157:H7 a ND, not detected; no amplification in PCR with primers used in this study

7 AEEC 의 LEE 관련유전자의병원형 75 의생성은 stx 유전자를갖고있는용원세균파지 (lysogenic bacteriophage) 의감염으로전달된다 (44). 특히 Stx2가 Stx1 의독소보다강하다고보고되고있고, 대부분의사람에서일으키는중증질병의증상들은 Stx2만을생성하거나동시에생성되는것으로나타난다 (37). 본연구에서는일본 Kyushu 대학병원에서분리된 AEEC 36균주를대상으로혈청형과 Stx의생성능을확인한결과, 22균주의 EHEC에서는혈청형 O157이 18균주로가장많이나타났고, O26과 O111 등도각각 2균주씩확인되었으며, 14균주의 EPEC에서는대부분이 O55 (12균주) 로나타났고나머지 2균주는 O111 로확인되었다. 이들의 Stx의생성능은 EPEC를제외한 EHEC에서만특징적으로나타나는결과를보여주었으나, 이중 O157:H7 2 균주와 O157:H45 2균주에서는 Stx를생성하지않았다. 또한국내의 O157:H7과일본의 Kyoto 대학에서분양받은 O157: H7에서는모두양성으로나타났으며, 병원성이강한 O157 의경우대부분의균주들이 Stx1과 Stx2를동시에검출되거나병원성이강한 Stx2가주로나타났고, Stx2의경우주로 Stx2f의아형을가지는것으로나타났다. AEEC의병원성기전은최근의연구에의하면장관조직에 A/E lesion이라고부르는특징적인장애를일으키는것과 A/E lesion의형성에 eae라고부르는염색체성유전자가관여한다고보고되었다 (22). EPEC가보유하는 eae 유전자는국재성부착에관련하는 BFP를지령하는 EAF (E. coli adherence factor) plasmid와더불어 A/E 병변에관계하는유전자의하나이며, EPEC나대부분의 EHEC가보유하지만혈청형에따라서 eae 유전자의상동성이다르고 (18) ETEC나 EIEC에서는검출되지않는것으로알려져있다 (26). 이는 McDaniel 등 (35) 과 Perna 등 (40) 에의하여사람에서분리된 EPEC 균주 E2348/69와 EHEC 균주 EDL933에서 A/E 병변의형성에관여하는약 40개의유전자들이염색체상의 LEE 에존재하고있음이밝혀졌고, EPEC, EHEC 외에도 Hafnia alvei, Citrobacter rodentium을비롯하여 A/E 병변을야기하는모든장관병원체에보존된 PAI로부착소 (intimin), TTSS, Tir 및 Esp 등병원성에관련된여러가지 effector를지령하는유전자를포함하고있다 (35). 경구감염된 AEEC가소장에도달한후 BFP를매개로장관상피세포 (enterocyte) 에부착하는초기부착 (initial adherence) 을시작으로 TTSS와그것에서분비되는단백질에의해세균과숙주세포사이에가교구조또는숙주세포막상에작은 pore를형성하여균체내의 effector들을숙주세포내로이동시킨다. 이러한미세구조장치는흡사주사바늘로주입하는것과같다고하여 needle 복합체 (needle complex) 라고묘사되기도한다. 따라서세균부착부위에서미세융모 (microvilli) 의소멸이일어나는 A/E 병변과함께세균이부착된하부는세포골격형성에관여하 는여러가지인자즉, actin, α-actinin, myosin light chain, ezrin 및 talin의축적으로상피세포가기둥다리구조 (pedestallike structure) 의형성을유도하여세포막 actin 구조의붕괴를일으킨다 (16,31). 이시기에견고한후기부착 (intimate adherence) 이성립되며 A/E 병변의형성에직접관여하는 effector는 Tir인것으로밝혀졌다 (11). 이처럼 A/E 병변의작용기전이나관련인자들이밝혀지면서 LEE에관련된병원성단백질들의구조와특징들에대한연구들도활발히진행되었다 (7,17). 비록사람에서분리된 EHEC 혈청형 O157:H7 (35,40) 과토끼에서분리된 EPEC 균주 RDEC-1 혈청형 O15 (28) 와몇종류의소에서분리된 AEEC (20) 에서삽입위치 (insertion site) 와길이의차이가보고되고있지만, 모두사람에서분리된 EPEC 균주 E2348/ 69와관련있는 LEE를보유하고있으며, 사람에서분리된 EPEC, EHEC 그리고토끼에서분리된 EPEC 균주로부터 eae, tir와 esp 유전자의변이체의염기서열이보고되었다 (15, 39,40). 또한개에서분리된 EPEC (6) 와소에서분리된 EHEC (9) 의 eae도밝혀졌으며, 토끼와소에서분리된균주의 eae 유전자는 δ형, 사람에서분리된균주의 eae 유전자변이체는 α, β, γ 그리고 δ형으로 PCR과유전자 probe으로분류되고있다 (5). 이와같은 intimin의다양성은혈청형에따른연관성을나타내기때문에계통발생학적으로형성되며, China 등 (10) 과 Goffaux 등 (19) 의연구에서는 eae 뿐만아니라 tir와 esp 유전자들에대해서도 α, β 그리고 γ의유형분석을위한 multiplex PCR법을개발하여소와사람에서분리된 AEEC 에대한병원형을비교하였다. 본연구는환자에서분리된 AEEC 균주에서 PCR법을통하여 LEE 염기배열의존재를확인하고 LEE 관련유전자들의보유현황과변이체에대한검토를실시하였다. 그결과국내및 Kyoto 대학의모든 O157:H7 균주와 Kyushu 대학의대부분균주에서 LEE가염색체상의 selc 유전자에위치하고있음이확인되었으나, EHEC O111:H - 와 EPEC O55:H - 및 O55:H10 균주의경우 LEE가 selc 유전자이외의염색체상에위치하고있음을알수있었다. 또한 multiplex PCR법에의하여 LEE에위치한여러가지유전자 (eae, tir, espa, espb 및 espd) 의변이체를검출하여혈청형에따른병원형도확인할수있었다. 먼저 LEE 관련유전자들이대부분의 AEEC 균주에서검출되었으며특히 O157:H7을비롯하여 O26:H11 과 O55:H6에서모든유전자들을보유하는것으로나타났다. 또한 O55:H7의경우 espb 유전자를제외한나머지유전자를보유하며, espd 유전자의경우 O111에서는전혀나타나지않았다. 또한 LEE 관련유전자들의변이체를확인해본결과 eae와 tir 유전자는 eae γ 와 tir γ 형이가장많았으며, esp 유전자의경우, espa γ 와 espb γ 형이주로관찰되었다. 이처럼

8 76 박도훈, 문지영, 김영부 intimin을지령하는 eae 유전자와 intimin 수용체를지령하는 tir 유전자사이의연관성은주로동종의조합 (homologous combination) 으로나타났으나간혹 H항원이형별되지않은 O111 균주의경우상이한 eae γ 와 tir α 의결과를보여주었고, espa와 espb 유전자사이의유형들이확실하게일치하는것을확인할수있었다. 이러한유전자간의조합은 China 등 (10) 과 Goffaux 등 (19) 의연구에서도보고되었으며, 최근국내의김등 (2) 의연구에서도확인되었다. 더불어 LEE 관련유전자들의변이체에대한병원형은크게 3가지즉, O157: H45를제외한대부분의 O157 균주에서 eae γ -tir γ -espa γ -espb γ - espd γ 의유형을보여주었고, O26:H11과 O55:H6의경우는각각 eae β -tir β -espa β -espb β -espd β 및 eae α -tir α -espa α -espb α -espd α 의유전자형을나타내었다. 이러한결과는 Goffaux 등 (19) 의결과로알려진개와고양이에존재하는 3가지병원형과사람에서분리된 AEEC 분리주에서역시발견된병원형의결과와일치하며, China 등 (10) 의연구에서보고한소에서분리된 AEEC 분리균주에서얻어진결과와도일치하였다. 이는사람에서분리된균주의 LEE의여러가지구성요소가소에서분리된 AEEC에서도같이구성되어있는것으로사료되며, LEE에관련된다른병원성단백질유전자의다양성들이계통발생학적인연관성을가지고있음을보여주고있다 (39). 한편 O111:H - 균주에서 eae γ -tir α -espa α -espb α -espd - 의유형을나타내었으나, O111:H12의경우는 eae γ -tir γ -espa γ - espb - -espd - 의유전자형을보여주어혈청형과의상관관계에대한연구의필요성도제기되고있다. 최근세균감염증은항생제의발달로일시적으로극복되었으나, 면역력이저하된숙주에서야기되는기회감염증이나항생제다제내성균에의한감염증의증가로인하여항생제에의존하지않고병원세균을제압하는방법의개발이주목되고있다. 특히살모넬라, Yersinia, EHEC O157을포함한병원성대장균등많은그람음성병원균이외에기도감염균, 백일해균을포함한 Erwinia속세균등식물병원균에서도 TTSS의구조물을이용하여사람을비롯한동물, 식물등고등진핵생물에병원인자를효율적으로이동시키는것이밝혀졌으며, 자연환경과같은숙주외환경에서는 TTSS가균체표층에는발현하지않으나설혹발현되어도분비활성이정지된다 (12). 더불어대장균에의해생성된표면단백질에대한숙주의면역성에대한연구들이진행되면서최근김등 (1) 및손과 Gannon (4) 의보고에의하면숙주에대한 intimin의면역성이상당히높음을알수있으며, Donnenberg 등 (12~ 14) 의일련의연구결과에서처럼 intimin을이용한대장균 O157:H7의백신개발가능성을제시하고있다. 실제로병원세균의 TTSS를유전적으로결손시켜불활성화시키면병원성은극히약해져잃게되며, 이분비장치를갖는병원세균 은병원성을발휘할수없으므로예방이가능할것이다. 이러한감염증제어를위한 TTSS의구조나기능의해석은병원세균에특이적으로작용하는약제의개발을위하여 TTSS 나 effector에대한항체의이용이나약제및백신의개발등과같은연구가세계적으로매우활발하게수행되고있으며세균의 TTSS 발현에관여하는 quorum sensing의매개체인자가유도인자 (autoinducer) 효소를저해하는약제의개발도 TTSS의발현을특이적으로제어하는하나의방법일것이다. 따라서여러가지병원세균에보존되어있는 TTSS의구성단백질의구조나사람과동물유래의병원성단백질유전자의다양성들을연구함으로서 TTSS를표적으로하는병원세균의예방법이나치료법을개발하여다른병원세균의제어에도다양하게응용될수있다고사료된다. 참고문헌 1) 김도균, 이상래, 김정우 : 장출혈성대장균 O157:H7 유래재조합 intimin의발현과그의면역반응효과. 동물자원지 46: , ) 김선희, 송현제, 정재근, 하동룡, 류필열, 이종빈 : 광주지역에서분리된장병원성대장균의표현형및유전자형특성에관한연구. J Bac Virol 36: , ) 김영부 : 설사환자에분리한장관출혈성대장균 O157: H7의병원인자와 Arbitrarily-primed polymerase chain reaction의형별. J Bac Virol 31: , ) 손원근, Gannon VP: Escherichia coli O157:H7 intimin의 expression 및 C-terminal 부위의특징. Kor J Vet Publ Hlth 25: , ) Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G: Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol 36: , ) An H, Fairbrother JM, Dubreuil D, Harel J: Cloning and characterization of the eae gene from a dog attaching and effacing Escherichia coli strain FEMS Microbiol Lett 148: , ) Boerlin P, Chen S, Colbourne JK, Johnson R, De Grandis S, Gyles C: Evolution of enterohemorrhagic Escherichia coli hemolysin plasmids and the locus for enterocyte effacement in shiga toxin-producing E. coli. Infect Immun 66: , ) Cebula TA, Payne WL, Feng P: Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their

9 AEEC 의 LEE 관련유전자의병원형 77 shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J Clin Microbiol 33: , ) China B, Devrin AC, Jacquemin E, Pirson V, Mainil J: Heterogeneity of the eae genes in attaching/effacing Escherichia coli from cattle: comparison with human strains. Res Microbiol 150: , ) China B, Goffaux F, Pirson V, Mainil J: Comparison of eae, tir, espa and espb genes of bovine and human attaching and effacing Escherichia coli by multiplex polymerase chain reaction. FEMS Microbiol Lett 178: , ) Donnenberg MS, Lai LC, Taylor KA: The locus of enterocyte effacement pathogenicity island of enteropathogenic Escherichia coli encodes secretion functions and remnants of transposons at its extreme right end. Gene 184: , ) Donnenberg MS, Tacket CO, James SP, Losonsky G, Nataro JP, Wasserman SS, Kaper JB, Levine MM: Role of the eaea gene in experimental enteropathogenic Escherichia coli infection. J Clin Invest 92: , ) Donnenberg MS, Tacket CO, Losonsky G, Frankel G, Nataro JP, Dougan G, Levine MM: Effect of prior experimental human enteropathogenic Escherichia coli infection on illness following homologous and heterologous rechallenge. Infect Immun 66: 52-58, ) Donnenberg MS, Tzipori S, McKee ML, O'Brien AD, Alroy J, Kaper JB: The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J Clin Invest 92: , ) Elliott SJ, Wainwright LA, McDaniel TK, Jarvis KG, Deng YK, Lai LC, McNamara BP, Donnenberg MS, Kaper JB: The complete sequence of the locus of enteroycte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol Microbiol 28: 1-4, ) Finlay BB, Rosenshine I, Donnenberg MS, Kaper JB: Cytoskeletal composition of attaching and effacing lesions associated with enteropathogenic Escherichia coli adherence to HeLa cells. Infect Immun 60: , ) Gannon VP, Rashed M, King RK, Thomas EJ: Detection and characterization of the eae gene of Shiga-like toxinproducing Escherichia coli using polymerase chain reaction. J Clin Microbiol 31: , ) Giron JA, Donnenberg MS, Martin WC, Jarvis KG, Kaper JP: Distribution of the bundle-forming pilus structural gene (bfpa) among enteropathogenic Escherichia coli. J Infect Dis 168: , ) Goffaux F, China B, Janssen L, Mainil J: Genotypic characterization of enteropathogenic Escherichia coli (EPEC) isolated in Belgium from dogs and cats. Res Microbiol 151: , ) Goffaux F, Mainil J, Pirson V, Charlier G, Pohl P, Jacquemin E, China B: Bovine attaching and effacing Escherichia coli possess a pathogenesis island related to the LEE of the human enteropathogenic E. coli strain E2348/69. FEMS Microbiol Lett 154: , ) Gyles CL: Escherichia coli cytotoxins and enterotoxins. Can J Microbiol 38: , ) Honda T: Factors influencing the development of hemolytic uremic syndrome caused by enterohemorrhagic Escherichia coli infection: from a questionnaire survey to in vitro experiment. Pediatr Int 41: , ) Imberechts H, De Greve H, Lintermans P: The pathogenesis of edema disease in swine. Vet Microbiol 31: , ) Jarvis KG, Giron JA, Jerse AE, McDaniel TK, Donnenberg MS, Kaper JB: Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci USA 92: , ) Jarvis KG, Kaper JB: Secretion of extracellular proteins by enterohemorrhagic Escherichia coli via a putative type III secretion system. Infect Immun 64: , ) Jerse AE, Yu J, Tall BD, Kaper JB: A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci USA 87: , ) Kaper JB, Elliott S, Sperandio V, Perna NT, Mayhew GF, Blattner FR: Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In: Kaper JB, O'Brien AD (Eds.): Escherichia coli O157:H7 and Other Shiga Toxin- Producing E. coli Strains. American Society for Microbiology, Washington, DC , ) Karaolis DKR, McDaniel TK, Kaper JB, Boedeker EC: Cloning of the RDEC-1 locus of enterocyte effacement (LEE) and functional analysis of the phenotype on Hep-2 cells. Adv Exp Med Biol 412: , ) Kenny B, DeVinney R, Stein M, Reinscheid DJ, Frey EA, Finlay BB: Enteropathogenic (EPEC) E. coli transfers its receptor for intimate adherence into mammalian cells. Cell 91: , 1997.

10 78 박도훈, 문지영, 김영부 30) Kim YB, Okuda J, Matsumoto C, Morigaki T, Asai N, Watanabe H, Nishibuchi M: Isolation of an Escherichia coli O157:H7 strain producing Shiga toxin 1 but not Shiga toxin 2 from a patient with hemolytic uremic syndrome in Korea. FEMS Microbiol Lett 166: 43-48, ) Knutton S: Attaching and effacing E. coli. In: Gyles CL. (Ed.), Escherichia coli in Domestic Animals and Humans. CAB International, Wallingford , ) Knutton S: Cellular responses to enteropathogenic Escherichia coli infection. Biosci Rep 15: , ) Kresse AU, Beltrametti F, Muller A, Ebel F, Guzman CA: Characterization of SepL of enterohemorrhagic Escherichia coli. J Bacteriol 182: , ) Lai LC, Wainwright LA, Stone KD, Donnenberg MS: A third secreted protein that is encoded by the enteropathogenic Escherichia coli pathogenicity island is required for transduction of signals and for attaching and effacing activities in host cells. Infect Immun 65: , ) McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB: A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc Natl Acad Sci USA 92: , ) Mellies JL, Elliott SJ, Sperandio V, Donnenberg MS, Kaper JB: The Per regulon of enteropathogenic Escherichia coli: identification of a regulatory cascade and a novel transcriptional activator, the locus of enterocyte effacement (LEE)-encoded regulator (Ler). Mol Microbiol 33: , ) Nataro JP, Kaper JB: Diarrhoeagic Escherichia coli. Clin Microbiol Rev 11: , ) Osek J: Development of a multiplex PCR approach for the identification of Shiga toxin-producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol 95: , ) Paton AW, Mannig PA, Woodrow MC, Paton JC: Translocated intimin receptor (Tir) of Shiga-toxigenic Escherichia coli isolates belonging to serogroups, O26, O111, and O157 react with sera from patients with hemolytic-uremic syndrome and exhibit marked sequence heterogeneity. Infect Immun 66: , ) Perna N, Mayhew GF, Posfai G, Elliott S, Donnenberg MS, Kaper JB, Blattner FR: Molecular evolution of a pathogenicity island from enterohemorrhagic Escherichia coli O157:H7. Infect Immun 66: , ) Schmidt H, Scheff J, Morabito S, Caprioli A, Wieler LH, Karch H: A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl Environ Microbiol 66: , ) Wang G, Clark CG, Rodgers FG: Detection of Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J Clin Microbiol 40: , ) Zhu C, Agin TS, Elliott SJ, Johnson LA, Thate TE, Kaper JB, Boedeker EC: Complete nucleotide sequence and analysis of the locus of enterocyte effacement from rabbit diarrheagenic Escherichia coli RDEC-1. Infect Immun 69: , ) Zweifel C, Blanco JE, Blanco M, Blanco J, Stephan R: Serotypes and virulence genes of ovine non-o157 Shiga toxin-producing Escherichia coli in Switzerland. Int J Food Microbiol 95: 19-27, 2004.

Microsoft Word - 3-김민지.doc

Microsoft Word - 3-김민지.doc Journal of Bacteriology and Virology 2009. Vol. 39, No. 2 p.79 95 DOI 10.4167/jbv.2009.39.2.79 Molecular Genetic Characterization of Shiga Toxin-producing E. coli Isolated from Diarrhea Patients and Cattle

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Chapter 26

Chapter 26 11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5

More information

mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

untitled

untitled 대한내과학회지 : 제 70 권제 5 호 2006 Non-O157 장출혈성대장균불현성감염증집단유행 광주광역시보건위생과, 광주광역시보건환경연구원 2, 질병관리본부역학조사과 3, 질병관리본부장내세균과 4 박성훈 김선희 2 서진종 2 기혜영 2 김민지 2 서계원 2 이동한 3 최연화 3 임동진 3 허영주 3 조성학 4 이복권 4 =Abstract= An outbreak

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Compar

대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Compar 대한진단검사의학회지 : 제 22 권제 5 호 2002 Korean J Lab Med 2002; 22: 331-5 임상미생물학 Escherichia coli O157 의산처리후배양법과증균후 PCR 법의비교 백인기 한태희 인제대학교의과대학상계백병원진단검사의학과 Comparison of Detection of Escherichia coli O157 Between

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

임상병리검사과학회지 : 제 28 권제 1 호 장관출혈성대장균 0157 : H7 가톨릭의대강남성모병원임상병리과 ljl- 져주 : ï 0 ~ Enterohaemorrhagic E. coli 0157 : H7 Park, Jeong Jun Dept. of Clini

임상병리검사과학회지 : 제 28 권제 1 호 장관출혈성대장균 0157 : H7 가톨릭의대강남성모병원임상병리과 ljl- 져주 : ï 0 ~ Enterohaemorrhagic E. coli 0157 : H7 Park, Jeong Jun Dept. of Clini 임상병리검사과학회지 : 제 28 권제 1 호 1996. 장관출혈성대장균 0157 : H7 가톨릭의대강남성모병원임상병리과 ljl- 져주 : ï 0 ~ Enterohaemorrhagic E. coli 0157 : H7 Park, Jeong Jun Dept. of Clinical Pathology, Kangnam St. Mary s Hospital, The Catholic

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d

Table 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d 연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

System Biology Core

System Biology Core System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Effects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

Special Issue

Special Issue Special Issue Trends of Bacterial Zoonoses in Humans in Korea Chul Soon Choi, D.V.M. Department of Microbiology ChungAng University College of Medicine Email : cschoi@cau.ac.kr Abstract Out of national

More information

A

A 2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770> C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보

항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보 Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT

More information

Fluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College

More information

Apparel Purchase Behaviors and Image Preferences of Preteen Girls and Their Mothers: Considering Preteen Girls BMI and Body Image Department of Home Economics Education, Pai Chai University Assistant Professor

More information

ºÎÁ¤¸ÆV10N³»Áö

ºÎÁ¤¸ÆV10N³»Áö case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads

More information

278 경찰학연구제 12 권제 3 호 ( 통권제 31 호 )

278 경찰학연구제 12 권제 3 호 ( 통권제 31 호 ) 여성경찰관의직업윤리의식결정요인분석 * An Analysis of Determinantal Factors Influencing Professional Ethical Standards of South Korean Police Women 신문희 ** 이영민 *** Ⅰ. 서론 Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과 Ⅴ. 결론 Ⅰ. 서론 278 경찰학연구제 12

More information

Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정

Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정 Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,.

Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,. PanGen Biotech Inc. INVESTOR RELATIONS 2015 Disclaimer IPO Presentation,., Presentation,. Presentation..,,,,, E..,.,,. Pangen BIOTECH INVESTOR RELATIONS 2015 Prologue Chapter 01. Chapter 02., Chapter 03.,

More information

untitled

untitled Korean J Clin Microbiol Vol. 13, No. 2, June, 2010 DOI: 10.5145/KJCM.2010.13.2.85 A Case of Verotoxin-producing Escherichia coli O157:H7 with Hemorrhagic Colitis in an Infant, Diagnosed by Multiplex PCR

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

<B8F1C2F72E687770>

<B8F1C2F72E687770> 제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus)

한수지 47(5), , 2014 Original Article Kor J Fish Aquat Sci 47(5), ,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus) 한수지 47(5), 556-561, 2014 Original Article Kor J Fish Aquat Sci 47(5),556-561,2014 MPN 및 H-NS 유전자를표적으로하는 PCR assay 를병용한장염비브리오 (Vibrio parahaemolyticus) 의정량 김태옥 박권삼 * 군산대학교식품생명공학과 Quantification of Vibrio

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>

<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770> 버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자

More information

특허청구의 범위 청구항 1 앵커(20)를 이용한 옹벽 시공에 사용되는 옹벽패널에 있어서, 단위패널형태의 판 형태로 구성되며, 내부 중앙부가 후방 하부를 향해 기울어지도록 돌출 형성되어, 전면이 오 목하게 들어가고 후면이 돌출된 결속부(11)를 형성하되, 이 결속부(11

특허청구의 범위 청구항 1 앵커(20)를 이용한 옹벽 시공에 사용되는 옹벽패널에 있어서, 단위패널형태의 판 형태로 구성되며, 내부 중앙부가 후방 하부를 향해 기울어지도록 돌출 형성되어, 전면이 오 목하게 들어가고 후면이 돌출된 결속부(11)를 형성하되, 이 결속부(11 (51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) E02D 29/02 (2006.01) E02D 17/20 (2006.01) E02B 3/14 (2006.01) (21) 출원번호 10-2010-0089517 (22) 출원일자 2010년09월13일 심사청구일자 (56) 선행기술조사문헌 JP2006037700 A* KR100920461

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * The Mediating Eff

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI:   * The Mediating Eff Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.159-177 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.159 * The Mediating Effects of Self-esteem on the Relationship between Social

More information

19(1) 02.fm

19(1) 02.fm Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부 大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah

More information

72 순천향의과학 : 제14권 2호 2008 Fig.1. Key components of the rehabilitation evaluation of patients with the rheumatic diseases. The ICF provides a good frame

72 순천향의과학 : 제14권 2호 2008 Fig.1. Key components of the rehabilitation evaluation of patients with the rheumatic diseases. The ICF provides a good frame Journal of Soonchunhyang Medical Science 14(2) p.71~82 December 2008 71 류마티스 관절염의 재활치료 오 기 영 순천향 대학교 의과대학 재활의학교실 Rehabilitation Interventions for the Patient with Rheumatoid Arthritis Ki-Young Oh Department

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

보도자료 장내미생물유전자의장관련감염질환유도원리규명 - 항생제오용으로발생하는장관련감염질환의진단및치료에기여

보도자료 장내미생물유전자의장관련감염질환유도원리규명 - 항생제오용으로발생하는장관련감염질환의진단및치료에기여 보도자료 장내미생물유전자의장관련감염질환유도원리규명 - 항생제오용으로발생하는장관련감염질환의진단및치료에기여 . 1. 연구의필요성 항생제의복용은장내미생물군집변화와더불어미생물에의해생산되는대사산물의 변화, 세균신호전달물질의감소등을유발하여인체의장면역시스템을약화 시키며다양한질병의원인이될수있다고알려져있다. 입원환자의항생제치료과정중발생하는의료관련감염병인클로스트리디움디피실 감염증

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 93~116 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 12 2016. 06. 20 2016. 06. 26 ABSTRACT e-

More information

untitled

untitled 210 Ji Youn Sung. PMQR Genes among CTX-M-14 Producing E. coli ORIGINAL ARTICLE Korean J Clin Lab Sci. 2016, 48(3):210-216 http://dx.doi.org/10.15324/kjcls.2016.48.3.210 pissn 1738-3544 eissn 2288-1662

More information

12.077~081(A12_이종국).fm

12.077~081(A12_이종국).fm J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and

More information

분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김

분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김 목 분 기 보 고 서...1 대표이사 등의 확인...2 I. 회사의 개요...3 1. 회사의 개요...3 2. 회사의 연혁...4 3. 자본금 변동사항...7 4. 주식의 총수 등...9 5. 의결권 현황...10 6. 배당에 관한 사항 등...10 II. 사업의 내용...12 III. 재무에 관한 사항...30 IV. 감사인의 감사의견 등...34 V. 이사의

More information