41(3)-7(p ).fm
|
|
- 우빈 시
- 4 years ago
- Views:
Transcription
1 The Korean Journal of Microbiology, Vol. 41, No. 3, September 2005, p Copyrightc2005, The Microbiological Society of Korea Helicobacter pylori 감염의치료와 Clarithromycin 내성간의연관성 손승규 이종화 1 이정훈 이상희 * 명지대학교자연과학대학생명과학정보학부, 1 단국대학교의과대학소화기연구소 본연구를수행하기전에 H. pylori 에대한어떠한치료도받지않은 114 명의소화기궤양환자들을내시경검사를하는동안, 114 개의 H. pylori 균주를위전정부로부터분리하였다. H. pylori 를검출하기위하여 rapid urease test, SSA 와 caga 유전자의 PCR 증폭을수행하였고, CagA 발현검출을위하여 Western blot 을수행하였다. H. pylori 에감염된환자들은 omeprazole, clarithromycin (a macrolide), amoxicillin 을모두사용하는 3 제요법 (triple therapy) 으로치료하였다. 치료가중단되고 6 주후에내시경검사에서세균박멸률을측정하였다. 내성률은각각 clarithromycin 이 20.2%, amoxicillin 이 0.0% 였다. Clarithromycin 내성은 H. pylori 의 23S rrna 유전자에있는 A2142G 돌연변이에의한것이 87% 이었다. A2142G 돌연변이의 clarithromycin 의 MIC 값 (32~>256 µg/ml) 은 A2143G 돌연변이의 MIC 값 (4~128 µg/ml) 보다더높았다. Clarithromycin 에감수성을가진 H. pylori 는박멸되었으나 clarithromycin 내성을가진 H. pylori 는박멸되지않았다 (P = ). 이러한결과들은 CagA 발현에는어떠한영향도받지않았으며 H. pylori 의 clarithromycin 내성은치료실패의가장중요한이유임을제시하였다. 우선적으로실시되는생검배양에대한 H. pylori 의항생제감수성시험은감염된환자들에대한 3 제요법을선택하기이전에필히실시되어야하며국내에서 clarithromycin 에대한 1 차내성의높은빈도는 H. pylori 의감염증치료에심각한문제점을야기시켰다. Key words clarithromycin resistance, eradication rate, H. pylori, peptic ulcer, triple therapy 세계인구의 50% 가감염되어있는 Helicobacter pylori는위염, 위궤양, 십이지장궤양, 그리고위암발병에매우중요한요인이다 (9, 10, 21). 한국성인의약 60~70% 가 H. pylori에감염되어있다 (6). H. pylori 감염에대한최근의보고에의하면 (3), 기질성질환의소화기징후를갖는환자의임상적검사시에선호되는방법은생체조직검사를포함한위장의내시경검사이다. 위궤양또는십이지장궤양의환자및 H. pylori에감염된모든환자들에게항생제를투여하여 H. pylori를박멸 (eradication) 시켜서소화기궤양을치유하는것이재발을방지하기위한효과적인방법으로널리인정되었다 (3). H. pylori에감염된성인환자에게는 proton pump inhibitor (PPI, omeprazole) 와 amoxicillin(β-lactam antibiotic) 과 clarithromycin (macrolide antibiotic) 또는 metroni- dazole(5-nitroimidazole antibiotic) 을혼합한 3제요법 (triple therapy) 이추천되고있다 (5). Metronidazole 내성 (resistance) 은유럽에서 50% 이상으로높고, 박멸률 (eradication rate) 은 metroni- dazole에감수성인 H. pylori 보다 metronidazole에내성인 H. pylori에감염된성인환자에서더낮다 (1). 그리고 CagA (cytotoxin-associated gene) 를생성하는 H. pylori의존재는 H. pylori의박멸을어렵게한다 (12). 첫번째치료후에도박멸되지않고여전히감염되어잔존하는 H. pylori에대한적합한치료는배양및항생제감수성시험을병행하는내시경검사가추천되 *To whom correspondence should be addressed. Tel: (031) , Fax: (031) sangheelee@mju.ac.kr 고있다 (3). 새로운 clarithromycin에대한내성을가진 H. pylori 가어느정도로만연되어있고소화기궤양환자의치료를어느정도로어렵게하는지는불명확하지만 clarithromycin에대한내성을가진 H. pylori의만연도가 1.7% (17) 에서 23.4% (16) 로증가하고있다. 본연구는첫번째로, 치료전과후에, H. pylori에감염된소화기궤양환자들로부터분리한 H. pylori 균주에서 clarithromycin 내성의기전과이환율 (prevalence) 를분석하였다. 두번째로, 환자들에감염되어있는 H. pylori의박멸에미치는 clarithromycin 내성의영향과 H. pylori에감염된소화기궤양환자들에게적당한치료법을선택하기전에실시하는위생검배양 (gastric biopsy culture) 을이용한항생제감수성시험의유용성을재평가하였다. 모든환자들의 CagA 발현양상은 clarithromycin 내성만의효과를고찰하기위해서조사하였다. 재료및방법환자의선별 2000년 1월부터 2002년 3월까지단국대학교병원에서위장내시경검사를통해소화불량증상을겪고있는 114명의환자들을연구대상으로하였다. 모든환자들로부터동의를받았고, 환자들에대한세부적인사항은 Table 1과같다. 조직학적검사 (histology), rapid urease test(rut), H. pylori 의 26-kDa 세포표면항원 (SSA) 유전자의탐색, 그리고분리된 H. pylori의배양 177
2 178 Seung Ghyu Sohn et al. Kor. J. Microbiol Table 1. Details of 114 patients referred for endoscopy Characteristic a No. of patients Percentage of patients Age, years > Gender Male Female Indications for endoscopy Duodenal ulcer Gastric ulcer RUT 114 (positive) 100 PCR SSA 114 (positive) 100 caga 59 (positive) (negative) 48.2 a Abbreviations: RUT, rapid urease test for Helicobacter pylori detection; SSA, 26-kDa cell surface antigen gene of H. pylori; caga, cytotoxin-associated gene encoding the virulence factor of H. pylori. 을통해위또는십이지장에 H. pylori의감염여부를판단하였다. 모든환자는내시경검사를받았고생검 (biopsy) 을시료로이용하여 RUT (CLO test, Delta West Pty Ltd., Bentley, Western Australia, Australia), 조직학적검사및배양을실시하였다. 조직학적검사를위해, 생검조직을중성의포르말린 (fomalin) 에서고정시키고파라핀 (paraffin) 에담가놓았다. Giemsa (Giemsa concen- tration, Difco Laboratories, Detroit, Mi., USA) 와 hematoxylineosin으로염색하여 H. pylori를검출하였다. 환자의선별시제외기준은다음과같다. 18세이하와 90세이상의연령인환자 ; 본연구가시작된시기보다 8주전에 PPIs (omeprazole, lansoprazole, pantoprazole), H 2 -blockers (cimetidine, ranitidine, nizatidine, famotidine, roxatidine) 그리고항생제 (clarithromycin, metronidazole, amoxicillin) 로치료받은환자 ; 위장의악성종양인환자 ; 심각한다른질병을동반하는환자 ; 알러 지 (allergy) 의병력이있는환자 ; 위의외과수술을받은환자 ; 임신중이거나수유기 (lactation) 인환자 ; 알코올중독및약물중독인환자 ; corticosteroid 또는비스테로이드 (non-steroid) 계열의항염증제를상습적으로사용하는환자는실험대상에서제외하였다. 미생물학적연구방법내시경검사를하는동안생검조직으로부터 114개의 H. pylori를분리및배양하였다. 위전정부 (antrum) 의생검시료는선택배지 (Helicobacter selective agar plus 7% defibrinated horse blood, Becton Dickinson, Cockeysville, Md., USA) 에서배양되었다. 배양 plate는 100% 상대습도와 microaerobic 상태 (Campy Pak Plus, BBL, Becton Dickinson) 에서 37 o C 5~7일동안배양되었다. 분리된균주는 Brucella broth(difco Laboratories, Detroit, Mi., USA) 에배양하여 -70 o C에보관하였다. Amoxicillin(Sigma, St. Louis, Mo., USA) 과 clarithromycin(abbott Laboratories, Queensborough, UK) 의최소저해농도 (MIC) 측정은 E-test (AB Biodisk, Uppsala, Sweden) 에의해서이루어졌다. 현탁액은 McFarland no. 2의혼탁도 (turbidity) 가되게조정하였다. MIC 측정용 plate는 37 o C에서미호기성 (microaerobic) 상태로 72시간동안배양되었다. 분리된균주는 MIC값이 amoxicillin인경우는 0.5 µg/ml, clarithromycin인경우는 1.0 µg/ml 이상이면두항생제에대해서내성을가지는것으로판단하였다 (8). H. pylori ATCC 43504는 MIC 측정을위한대조구로사용되었다. H. pylori 감염여부의진단은, Mikula (7) 등의방법으로써, 분리된균주의게놈 (genome) DNA를주형 (template) 으로사용하여 H. pylori 의 SSA 유전자를증폭하는 PCR (polymerase chain reaction) 증폭법을사용하였고, 사용된 primer는 Table 2와같다. 분리된 H. pylori로부터 caga gene와 CagA protein의검출은새롭게고안된 primer (Table 2) 를이용하는 PCR 증폭법 (23) 과 Western blot kit인 Helicoblot 2.0 (Genelabs, Singapore, Republic of Singapore) 에의해수행되었다. Clarithromycin 내성기전분석 H. pylori의 23S rrna 유전자에형성되는 A2142G와 A2143G 돌연변이가 clarithromycin 내성의기전으로보고되었다 (20). Table 2. Nucleotide sequences of the oligonucleotides used for PCR amplifications and DNA sequencing Primer (orientation) a Sequence (5' 3') Position Amplicon size (bp) SSA-F b (F) TGGCGTGTCTATTGACAGCGAG SSA-R b (R) CCTGCTGGGCATACTTCACCAT 522 (SSA-F/-R) e CagA-F c (F) AGTAAGGAGAAACAATG CagA-R c (R) AATAAGCCTTAGAGTCTTTTTGGAAAT (CagA-F/-R) Cla-F d (F) AGTATTCTAAGGCGCGTGAAAG Cla-R d (R) GACCTGCATGAATGGCGTAAC 2946 (Cla-F/-R) a Orientation of each primer: F, forward; R, reverse. b Designed according to the sequence of 26-kDa cell surface antigen gene (SSA; GenBank accession no. M55507) from H. pylori. c Designed according to the sequence of cytotoxin-associated gene A (caga; GenBank accession no. AF282853) from H. pylori. d Designed according to the sequences of H. pylori 23S rrna gene (GenBank accession no. U27270) associated with clarithromycin (Cla) resistance. e Primer pair for PCR amplification.
3 H. pylori 감염 및 clarithromycin 내성 179 Vol. 41, No. 3 23S rrna 유전자의 점 돌연변이(point mutation)는 PCR-restriction fragment length polymorphism (RFLP)에 의해 분석했다. H. pylori로부터 Wizard genomic DNA purification kit에 의해 분리 된 게놈 DNA를 주형(template) DNA로 사용하였으며, 고안된 primer (Table 2)로 PCR증폭 하였다 bp의 증폭된 DNA조 각은 MboII 와 BsaI 제한효소를 이용하여 A2142G와 A2143G 돌연변이를 각각 검출하였다. PCR 증폭 산물은 자동 DNA 서열 분석기(automated DNA sequencer, ABI PRISM3100, Applied Biosystems, Weiterstadt, Germany)를 사용하여 양쪽 가닥의 DNA 서열을 직접 분석 하였다. 치료(treatment)와 치료 후 처리(follow-up) 본 연구의 대상인 모든 성인은 조직학 검사, 배양, RUT, SSA 유전자의 PCR 검출 방법을 이용하여 H. pylori 에 양성 반응을 나타내는지를 검사하였다. 대상 성인 환자들은 10일 동안 PPI인 omeprazole (20 mg twice a day [BID]), amoxicillin(1 g BID) 및 clarithromycin (500 mg BID)을 투여하였다. 치료가 끝나고 6주 후에, 임상적 증상을 검사하였고 내시경 검사를 수행하면서 얻은 생체조직을 이용하여 조직학적 검사, 세균학적 검사, 생화학적 검사 그리고 분자생물학적 검사를 수행하였다. 상기 4가지 검사 에 음성이면 H. pylori가 박멸되었음을 의미한다. 통계학적 분석 통계학적 분석을 위해서 SPSS software(version 11.5 for Windows, SPSS Inc., Chicago, Il., USA)를 이용하였다. 세균 박 Fig. 1. Representative electrophoresis of SSA (A) and caga (B) gene PCR products and Western blot analysis (C) of CagA protein expression. Lane M1 and M2, molecular weight marker 100-bp and 1kb DNA ladder, respectively; lane N: negative control (distilled water); lanes 1-3: three isolates of H. pylori A2143G mutants; lanes 4-6: three representative isolates among H. pylori wild-type; lanes 79: three representative isolates among H. pylori A2142G mutants. CagA protein was expressed in all caga gene-positive isolates (lanes 2, 3, and 6-9 of Fig. 1B). 멸률의 그룹간 차이는 chi-square test(χ test)에 의해 평가되었으 2 며 P 값이 0.05이하이면 그룹간의 관련성이 의미 있다고 판단하 을 나타내었다(Table 3). 이태리, 미국 및 캐나다 에서도 였다. amoxicillin에 대한 내성이 매우 드물게 나타났다(16). 1차 내성률 (primary resistance rate)은 20.2%이고, 2차 내성률(3제 요법이 실 결 과 소화기 궤양 환자에 감염된 H. pylori 의 특성 패인 환자에서 분리한 H. pylori 의 내성률)은 100%였다. 나이, 성별, 위궤양 또는 십이지장 궤양의 존재와 clarithromycin 내성 사이의 상호관계는 나타나지 않았다. 연구 대상 기준에 적합한 총 114명의 환자들을 선택하였다. 총 114명 중 위궤양, 십이지장 궤양 환자는 각각 64명(56.1%)과 50 Clarithromycin 내성 기전 명(43.9%)이었다(Table 1 및 Fig. 1B). Rapid urease test (RUT) 모든 H. pylori의 23S rrna 유전자 돌연변이의 분석은 PCR- 와 SSA 유전자의 PCR증폭에 관한 실험 결과에 의하면 모든 환 RFLP 방법에 의해서 수행되었다(Fig. 2). MboII에 의해 완전히 자들은 H. pylori 에 감염된 것으로 나타났다(Table 1 및 Fig. 절단된 A2142G 돌연변이는 clarithromycin에 내성인 23개의 H. 1A). caga 유전자의 PCR증폭 실험 결과에 의하면 114명의 환자 pylori 중 20개(87.0%)에서 검출되었다. Bsal에 의해 완전히 절단 들 중 59명의 환자들(51.8%)이 caga-양성 (table 1)이고 caga-양 된 A2143G 돌연변이는 clarithromycin에 내성인 23개의 H. 성인 모든 H. pylori는 CagA 단백질(128 kda, Fig. 1C)을 발현 pylori 중 3개(13.0%)에서 검출되었다(Table 3). 이러한 결과들은 시켰다. CagA-양성 환자 59명중 42명(71.2%)의 환자와 CagA-음 모든 PCR 산물(amplicons)의 DNA 서열 분석에 의하여 확증되 성 환자들 55명중 41명(74.5%)의 환자에서 H. pylori가 박멸 었다. A2142G 돌연변이인 H. pylori의 clarithromycin에 대한 (eradication)되었다(p = 0.1). MIC값(256 µg/ml)은 A2143G 돌연변이인 H. pylori의 MIC값(16 µg/ml) 보다 더 높았다(P = 0.001). Clarithromycin 내성 현황 치료 전과 후에 분리된 clarithromycin 내성(MIC > 1.0 µg/ml) Clarithromycin 내성과 H. pylori 박멸간의 연관성 인 H. pylori 는 114명의 환자중 23명(20.2%)에서 검출되었고, Clarithromycin에 내성인 H. pylori에 감염된 환자에서는 H. 분리된 모든 H. pylori는 amoxicillin (MIC<0.5 ug/ml)에 감수성 pylori가 박멸(eradication)되지 않았으나 clarithromycin에 감수성
4 180 Seung Ghyu Sohn et al. Kor. J. Microbiol Table 3. The relationship between A-to-G mutations of clarithromycin-resistant H. pylori isolates and the failed eradication after clarithromycinbased therapy against 114 patients suffering gastric or duodenal ulcer Isolate a (No.) No. of patients b No. of eradication MIC (µg/ml) b (%) failure (%) Amoxicillin Clarithromycin Wild-type (91) 91 (79.83) 0 (0.00) (S) (S) A2142G (20) 20 (17.54) 20 c (17.54) (S) 32->256 (R) A2143G (3) 3 (2.63) 3 c (2.63) (S) (R) a Sequence and PCR-RFLP analyses of the 23S rrna gene from each H. pylori isolated from each patient revealed mutations (A G) at residues 2142 and b Results presented for each isolate before treatment are same as those after treatment. c P = compared to wild-type group. Abbreviations: S, susceptible; R, resistant. Fig. 2. MboII and BsaI restriction analysis of 1,204-bp amplicons from 23S rrna gene. Lane M, molecular weight marker 100-bp DNA ladder; lanes 1-3: the BsaI-digestion products of three H. pylori A2143G mutants with two clearly distinguishable bands of 401 and 803 bp; lanes 4-6: the MboII/BsaI-digestion products of three representative isolates among H. pylori wild-type showing one band of 1,204 bp with no cleavage; lanes 7-9: the MboII-digestion products of three representative isolates among H. pylori A2142G mutants showing two fragments, respectively of 409 and 795 bp. 인 H. pylori에감염된환자에서만박멸 (eradication) 되었다. Clarithromycin에감수성인 H. pylori 감염환자에서의박멸률은 100% 이고 clarithromycin 비감수성과감수성을모두합한경우의박멸률은 79.8% 이었다. 박멸률은 79.8% 였다 (Table 3). A2142G 돌연변이그룹과 A2143G 돌연변이그룹에서의 H. pylori의박멸실패율 (eradi- cation failure rate) 은각각 100% 였다 (P = 0.001). 고찰 본연구는한국에서 clarithromycin에내성인경우는 H. pylori 를박멸하기위한치료제로는 clarithromycin가부적합하다는것과 H. pylori에감염되어소화기궤양의증상이있는환자를치료하기전에, 우선적으로실시하는, 생검에서배양된 H. pylori의항생제감수성시험의필요성을재확인하였다. 본연구에서밝혀진 clarithromycin에대한내성의빈도 (incidence) 는북동이탈리아 (1.8%)(11), 네덜란드 (1.7%)(17) 그리고독일 (3.3%)(22) 보다는높았지만중부이탈리아 (23.4%)(16) 에서보고된것과비슷하였다. Clarithromycin을사용하는 3제요법 (triple therapy) 을수행하기 전의 clarithromycin에대한내성빈도와 3제요법을수행한후의 clarithromycin에대한내성빈도는동일하였다. 이는 3제요법의실시로인하여내성이획득되지않았음을의미하며이탈리아에서의보고와유사하였다 (5). Clarithromycin에대한 H. pylori의내성은 23S rrna 유전자에서 A2142G와 A2143G의염기전위돌연변이 (transition mutation) 가발생하여리보솜 (ribosome) 에 clarithromycin이결합하는정도의감소에기인한다. 몇연구자들은가장중요한 clarithromycin 에대한 1차내성 (primary resistance) 기전이 A2143G 돌연변이임을최근보고하였다 (18). 그러나본연구에서는 A2142G 돌연변이가 1차내성의중요한기전이었다. H. pylori 게놈 (genome) 은높은유전적다양성 (genetic variability) 을나타내기때문에 (14) 한국에서의 clarithromycin에대한 1차내성기전은서양의경우와는다른양상을나타내었다. A2142G 돌연변이인 H. pylori의 clarithromycin에대한 MIC 값은 A2143G 돌연변이인 H. pylori의경우보다더높으며이런결과는 Versalovic 등 (19) 에의해보고된내용과일치하였다. Clarithromycin에대해내성인경우는치료의실패율이 100% 였다 (H. pylori의박멸률은 0%). 본연구결과와는대조적으로, 다른보고 (2) 에서는평균 55% 였다 (H. pylori의박멸률은 45%). Clarithromycin에대한높은수준의내성인경우는, Graham 등 (4) 이이미보고한바와같이, clarithromycin 투여의양을늘리거나또는치료기간을연장하는것으로는해결될수없다. 따라서, 치료약에대한내성문제가없이, H. pylori 감염을치료하고억제또는예방하는넓은의미의새로운치료법을찾아내는것이중요하다. 우리는이전에 H. pylori 감염에대한항생제치료 (antibiotic treatment) 를대신할수있는계란의난황을이용한 H. pylori 항체 (IgY-HP) 에대해서보고하였다 (13). H. pylori가인간의위암세포주 (cell line) 인 AGS에부착하는정도가 IgY-HP에의해분명하게감소하였다. Mongolian gerbil 모델에서 H. pylori 에감염된위염발생군은 IgY-HP 를경구투입할시에성공적으로치료되었다 (13). 항생제치료의실패시에는즉각적인내시경검사, H. pylori 배양그리고항생제감수성시험을수행하여야한다. 재치료 (retreatment) 시에는내성이획득된항생제는사용할수없다. 많은연구자들은재치료의어려움과제일효과적인 1차치료법의중요함을보고하였다 (5). H. pylori 박멸률은항생제감수성시험의결과를토대로항생제치료법을수행하였을때주목
5 Vol. 41, No. 3 H. pylori 감염및 clarithromycin 내성 181 할만하게향상되었다 ( 다른보고 (15) 에서는 17% 의향상그리고우리의예비결과에서는 18% 의향상을보임 ). 본연구에서는 clarithromycin-감수성인 H. pylori에감염된환자와 clarithromycin-내성인 H. pylori에감염된환자들간의 H. pylori 박멸률은현저하게다름이확인되었다. 이런결과는, 양쪽그룹에서 CagA의발현양상이유사한이유로, 병원성 (pathogenicity) 의차이에기인하지는않는것으로판단된다. 우리는또한 H. pylori에감염된환자를치료시 clarithromycin 이포함된 3제요법을선택하기전에실시하는생검배양 (biopsy culture) 의항생제감수성시험의필요성을재확인하였으며항생제감수성시험결과로부터 clarithromycin의 1차내성 (primary resistance) 이높은빈도로나타남을확인하였다. 감사의글 본연구는농촌진흥청바이오그린21사업의지원으로이루어졌으며, 이에감사드립니다. 참고문헌 1. Debets-Ossenknopp, Y.J., A.J. Herscheid, R.G. Pot, E.J. Kuipers, J.G. Kusters, and C.M. Vandenbroucke-Grauls Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxicillin, tetracycline, and trovafloxacin in The Netherlands. J. Antimicrob. Chemother. 43, Dore, M.P., G. Leandro, G. Realdi, A.R. Sepulveda, and D.Y. Graham Effect of pretreatment antibiotic resistance to metronidazole and clarithromycin on outcome of Helicobacter pylori therapy. Dig. Dis. Sci. 45, Drumm, B.S., S. Koletzko, and G. Oderda, on behalf of the European Pediatric Task Force on Helicobacter pylori Helicobacter pylori infection in children: a consensus statement. J. Pediatr. Gastroenterol. Nutr. 30, Graham, D.Y. and W.A. Qureshi Antibiotic-resistant H. pylori infection and its treatment. Curr. Pharm. Des. 15, Kalach, N., P.H. Benhamou, F. Campeotto, M. Bergeret, C. Doupont, and J. Raymond Clarithromycin resistance and eradication of Helicobacter pylori in children. Antimicrob. Agents Chemother. 45, Kim, J.H., H.Y. Kim, N.Y. Kim, S.W. Kim, J.G. Kim, J.J. Kim, J.K. Seo, J.G. Sim, I.H. Roe, H.S. Ahn, B.C. Yoon, S.W. Lee, Y.C. Lee, I.S. Chung, H.Y. Jung, W.S. Hong, and K.W. Choi Seroprevalence of Helicobacter pylori infection in asymptomatic people in Korea. Kor. J. Med. 59, Mikula, M., A. Dzwonek, K. Jagusztyn-Krynicka, and J. Ostrowski Quantitative detection for low levels of Helicobacter pylori infection in experimentally infected mice by realtime PCR. J. Microbiol. Meth. 55, National Committee for Clinical Laboratory Standards (NCCLS) Performance standards for antimicrobial susceptibility testing. Ninth informational supplement M100-S9. Villanova, PA. 9. NIH Consensus Conference Helicobacter pylori in peptic ulcer disease. NIH consensus development panel on Helicobacter pylori in peptic ulcer disease. J. Am. Med. Assoc. 272, Parsonnet, J., G.D. Friedman, D.P. Vandersteen, Y. Chang, J.H. Vogelman, N. Orentreich, and R.K. Sibley Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 325, Pilotto, A., M. Rassu, G. Leandro, M. Franceschi, and F.Di Mario Prevalence of Helicobacter pylori resistance to antibiotics in Northeast Italy: a multicentre study. Dig. Liver Dis. 32, Raymond, J., N. Kalach, M. Bergeret, P.H. Benhamou, J.P. Barbet, Gendrel, and C. Dupont Effect of metronidazole resistance on bacterial eradication of Helicobacter pylori in infected children. Antimicrob. Agents Chemother. 42, Shin, J.-H., M. Yang, S.W. Nam, J.T. Kim, N.H. Myung, W.-G. Bang, and I.H. Roe Use of egg yolk-derived immunoglobulin as an alternative to antibiotic treatment for control of Helicobacter pylori infection. Clin. Diagn. Lab. Immunol. 9, Taylor, D.E., M. Eaton, N. Chang, and S.M. Salama Construction of Helicobacter pylori genome map and demonstration of diversity at the genome level. J. Bacteriol. 174, Toracchio, S., L. Cellini, D.I. Campli, G. Cappello, M.G. Malatesta, A. Ferri, A.F. Ciccaglione, L. Grossi, and L. Marzio Role of antimicrobial susceptibility testing on efficacy of triple therapy in Helicobacter pylori eradication. Aliment. Pharmacol. Ther. 14, Toracchio, S. and L. Marzio Primary and secondary antibiotic resistance of Helicobacter pylori strains in central Italy during the years Dig. Liver Dis. 35, Tucci, A., O. Varoli, R. Corinaldesi, V. Stanghellini, S. Gasperoni, G.F. Paparo, M. Ricci-Maccarini, M. La Placa, and L. Barbara Evaluation of Helicobacter pylori sensitivity to amoxicillin and metronidazole in dyspeptic patients. Ital. J. Gastroenterol. 25, van Doorn, L.-J., Y. Glupczinski, J.G. Kusters, F. Mégraud, P. Midolo, N. Maggi-Solcà, D.M.M. Queiroz, N. Nouhan, E. Stet, and W.G.V. Quint Accurate prediction of macrolide resistance in Helicobacter pylori by a PCR line probe assay for detection of mutations in the 23S rrna gene: multicenter validation study. Antimicrob. Agents Chemother. 45, Versalovic, J., M.S. Osato, K. Spakovsky, M.P. Dore, R. Reddy, G.G. Stone, D. Shortridge, R.K. Flamm, S.K. Tanaka, and D.Y. Graham Point mutations in the 23S rrna gene of Helicobacter pylori associated with different levels of clarithromycin resistance. J. Antimicrob. Chemother. 40, Wang, G.E., M.S. Rahman, M.Z. Humayun, and D.E. Raylor. Multiplex sequence analysis demonstrates the competitive growth advantage of the A-to-G mutants of clarithromycin-resistant Helicobacter pylori. Antimicrob. Agents Chemother. 43, Warren, J.R. and B.J. Marshall Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet 1, Wolle, K., M. Nilius, A. Leodolter, W.A. Muller, P. Malfertheiner, and W. Koning Prevalence of Helicobacter pylori resistance to several antimicrobial agents in a region of Germany. Eur. J. Clin. Microbiol. Infect. Dis. 17, Xiang, Z., S. Censini, P.F. Bsyeli, Y. Chang, J.H. Vogelman, N. Orentrich, and R.K. Sibley Analysis of expression of caga and vaca virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that caga is not necessary for expression of the vacuolating cytotoxin. Infec. Immum. 63, (Received July 1, 2005/Accepted August 19, 2005)
6 182 Seung Ghyu Sohn et al. Kor. J. Microbiol ABSTRACT : Relationship between Eradication of Helicobacter pylori Infection and Clarithromycin Resistance Seung Ghyu Sohn, Jong Hwa Lee 1, Jung Hun Lee, and Sang Hee Lee * (Department of Biological Sciences, Myongji University, San 38-2 Namdong, Yongin, Kyunggido, , Korea, 1 Research Center of Gastroenterology, College of Medicine, Dankook University, Cheonan , Korea) H. pylori strains were isolated from antral biopsies taken during upper endoscopy in 114 dyspeptic patients with no previous therapy against H. pylori. Rapid urease test, PCR amplification of SSA and caga gene for H. pylori detection, and Western blot for CagA expression detection were performed. H. pylori infected patients were treated with omeprazole, clarithromycin (a macrolide), and amoxicillin. At 6 weeks after the discontinuation of therapy, the bacterial eradication rate was determined by endoscopy. The resistance rate to clarithromycin and amoxicillin was 20.2% and 0.0%, respectively. The clarithromycin resistance was mainly caused by the A2142G mutation in the 23S rrna gene of H. pylori. MICs of clarithromycin for the A2142G mutant isolates were significantly higher than MICs for the A2143G mutant isolates. H. pylori eradication was obtained in all patients with clarithromycin-susceptible isolates but not in patients with clarithromycin-resistant isolates (P = ). These results did not appear to be biased by any differences in CagA expression. The resistance of H. pylori to clarithromycin included in the therapeutic regimens is the most important reason for treatment failure. H. pylori antimicrobial susceptibility testing of the gastric biopsy culture should be performed before choosing the first triple therapy in infected patients and the increase in prevalence of clarithromycin resistance in Korea was problematic.
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationuntitled
The Korean Journal of Helicobacter and Upper Gastrointestinal Research Vol. 12, No. 2, 82-87, June 2012 http://dx.doi.org/10.7704/kjhugr.2012.12.2.82 광주전남지역에서 Helicobacter pylori 제균항생제내성률분석 Analysis of
More information대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26: 원저 임상미생물학 Helicobacter pylori 항균제감수성검사의임상적유용성 성흥섭 1 정희정 1 김미나 1 이진혁 2 울산대학교의과대학서울아산병원진단검사의학
대한진단검사의학회지제 26 권제 3 호 2006 Korean J Lab Med 2006;26:179-84 원저 임상미생물학 Helicobacter pylori 항균제감수성검사의임상적유용성 성흥섭 1 정희정 1 김미나 1 이진혁 2 울산대학교의과대학서울아산병원진단검사의학과 1, 내과 2 Clinical Usefulness of Antimicrobial Susceptibility
More informationuntitled
The Korean Journal of Gastrointestinal Endoscopy Original Article 최근 H. pylori 에대한 1 차삼제요법의연도별제균율변화와기간에따른제균율비교 백나영 * ㆍ임윤정ㆍ이종호ㆍ강지훈ㆍ박정배ㆍ이진호 동국대학교의과대학내과학교실, * 가정의학교실 Recent Eradication Rates of First-line
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationuntitled
Korean J Gastroenterol Vol. 61 No. 5, 252-258 http://dx.doi.org/10.4166/kjg.2013.61.5.252 pissn 1598-9992 eissn 2233-6869 ORIGINAL ARTICLE 제주지역에서 23S rrna 점돌연변이와관련된 Clarithromycin 내성 Helicobacter pylori
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information382 Korean J Lab Med 2010;30:381-7 성위축성위염환자가많아전정부보다는다른부위에서더높은 H. pylori 진단율을보이기도한다 [5]. 대한 H. pylori 연구회에서는가능하면전정부와체부에서각각 1개이상의조직을채취하여검사하도록권장하고있지만 [6]
Korean J Lab Med 2010;30:381-7 DOI 10.3343/kjlm.2010.30.4.381 Original Article Clinical Microbiology A Comparison Analysis on the Diagnosis of Helicobacter pylori Infection and the Detection of Clarithromycin
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationuntitled
The Korean Journal of Gastrointestinal Endoscopy Room A 소화성궤양환자에서헬리코박터제균치료의최신이슈 김나영 서울대학교의과대학분당서울대학교병원내과학교실 Issues in the Treatment of Helicobacter pylori for Peptic Ulcers Nayoung Kim, M.D. Department
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More informationuntitled
The Korean Journal of Helicobacter and Upper Gastrointestinal Research Vol. 11, No. 1, 132, June 211 헬리코박터의항생제내성 Antibiotic Resistance in Helicobacter pylori Infection 중앙대학교의과대학내과학교실 Jae G. Kim, Beom Jin
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationuntitled
대한소아소화기영양학회지 : 제 14 권제 1 호 2011 DOI: 10.5223/kjpgn.2011.14.1.45 위장관 한국인소아에서분리한 Helicobacter pylori 균주의항균제내성률 울산대학교의과대학서울아산소아청소년병원소아청소년과, * 서울아산병원진단검사의학과 김유미ㆍ이연주ㆍ오석희ㆍ성흥섭 * ㆍ김미나 * ㆍ김경모 Antimicrobial Resistance
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information<B0E6C8F1B4EBB3BBB0FAC0D3BBF3B0ADC1C E687770>
개원의와함께하는임상강좌 2011 역류성식도질환제대로이해하기 Division of Gastroenterology, Department of Internal Medicine, Kyung Hee University College of Medicine, Seoul, Korea Jae-Young Jang, M.D., PhD. 개원의와함께하는임상강좌 2011 109 최신치료
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More informationuntitled
Korean J Gastroenterol Vol. 58 No. 2, 67-73 http://dx.doi.org/10.4166/kjg.2011.58.2.67 REVIEW ARTICLE 국내 Helicobacter pylori 의제균치료 김승영, 정성우 고려대학교의과대학내과학교실 Helicobacter pylori Eradication Therapy in Korea
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More informationuntitled
The Korean Journal of Gastrointestinal Endoscopy Original Article Ecabet Sodium 의추가가 Helicobacter pylori 일차삼제요법의제균율에미치는효과 김지연ㆍ이동호 * ㆍ손준혁ㆍ김재연ㆍ권지은ㆍ박영수 * ㆍ김나영 * ㆍ신철민 * ㆍ정현채ㆍ송인성 서울대학교의과대학내과학교실, * 분당서울대학교병원내과
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationuntitled
Korean J Gastroenterol Vol. 59 No. 6, 401-406 http://dx.doi.org/10.4166/kjg.2012.59.6.401 ORIGINAL ARTICLE 헬리코박터파일로리의 3 차구제요법에서리파부틴과레보플록사신의비교 정명호, 정준원, 이상진, 하민수, 정석후, 나선영, 나병수, 박성근, 김윤재, 권광안, 고광일, 조윤정,
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationuntitled
대한내과학회지 : 제 70 권제 호 2006 궤양과소화불량환자에서헬리코박터제균율의차이 서울대학교의과대학내과학교실, 분당서울대학교병원내과 2 서승오 이동호 2 박영수 2 황진혁 2 김진욱 2 김나영 2 정현채 송인성 =Abstract= Difference in Helicobacter pylori eradication rates in patients with peptic
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More information< C0D3BBF3B0C7B0AD20C3E1B0E8C7D0BCFAB4EBC8B82DBFACBCF6B0ADC1C22E687770>
2013 년대한임상건강증진학회춘계합동학술대회 연수강좌 소강당 소화성궤양진단및치료 박영규 분당제생병원가정의학과 목차 1. 소화성궤양의정의와역학 2. 소화성궤양의병인 3. 소화성궤양의증상 4. 소화성궤양의진단 5. 소화성궤양의치료 6. 헬리코박터균과제균치료 - 조직학적인용어 소화성궤양의정의 - 위장관벽조직의결손이점막하층또는그이하까지발생한상태 - 위산과펩신으로인해발생한병변
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationuntitled
Korean J Gastroenterol Vol. 66 No. 5, 261-267 http://dx.doi.org/10.4166/kjg.2015.66.5.261 pissn 1598-9992 eissn 2233-6869 ORIGINAL ARTICLE Helicobacter pylori 이차제균치료로서 10 일순차치료와 Bismuth 를포함하는 4 제치료의효과비교분석
More information. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )
. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).
More informationuntitled
Korean J Gastroenterol Vol. 64 No. 5, 260-267 http://dx.doi.org/10.4166/kjg.2014.64.5.260 pissn 1598-9992 eissn 2233-6869 ORIGINAL ARTICLE 10 일간의동시치료가 10 일간의순차치료보다헬리코박터파일로리제균율이우월하다 김수영, 박동균, 권광안, 김경오,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
More informationApparel Purchase Behaviors and Image Preferences of Preteen Girls and Their Mothers: Considering Preteen Girls BMI and Body Image Department of Home Economics Education, Pai Chai University Assistant Professor
More information<31372DB9CCB7A1C1F6C7E22E687770>
미래지향 고령친화 주거디자인을 위한 예비노인층의 라이프스타일 특성 Characteristics of Lifestyle of the Pre-Elderly for Future Elderly-friendly Housing Design 류 혜 지 청운대학교 인테리어디자인학과 교수 Ryu hye-ji Dept. of Interior Design, Chungwoon University
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationPowerPoint 프레젠테이션
Part 1. 병인론과진단 성균관대학교의과대학내과이준행 H. pylori 는점액층에서삽니다. CO(NH 2 ) 2 urease CO 2 +2NH 3 5
More information<313020BFF8C0FA BCADC1A4BFAC2E687770>
대한내과학회지 : 제 80 권제 5 호 2011 Lansoprazole 근간 3제요법과병합투여된 Ecabet Sodium 이 Helicobacter pylori 제균율에미치는효과 한일병원내과 서정연 김민정 고규한 김동현 임대섭 전해리 Efficacy of Ecabet Sodium for Helicobacter pylori Eradication, Combined
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More informationuntitled
대한소화기내시경학회지 2008;37:161-166 Helicobacter pylori 재감염과관련된임상적요인에대한분석 서울대학교의과대학내과학교실, 간연구소, * 분당서울대학교병원내과 김재환ㆍ양효준ㆍ장은선ㆍ조은주ㆍ조현진ㆍ천재영ㆍ최종경ㆍ황성욱ㆍ이상협 * 박영수 * ㆍ황진혁 * ㆍ김진욱 * ㆍ정숙향 * ㆍ김나영 * ㆍ이동호 * ㆍ정현채ㆍ송인성 Clinical Features
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information975_983 특집-한규철, 정원호
Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information<303320C6AFC1FD303320BCBAC0E7B1D42E687770>
대한내과학회지 : 제 89 권제 2 호 2015 http://dx.doi.org/10.3904/kjm.2015.89.2.149 특집 (Special Review) - 헬리코박터파일로리감염의최신지견 헬리코박터파일로리감염의진단과치료 충남대학교의학전문대학원충남대학교병원내과 성재규 Diagnosis and Treatment of Helicobacter Pylori
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More informationHelicobacter pylori 감염의 진단 51 비침습적 방법으로는 대변항원검사, 요소호기검사와 같이 H. pylori 자체의 존재를 검사하는 직접 검사법과 H. pylori에대한 항체를 측정하는 혈청 검사, 소변 검사와 같은 간접 검사법이 있다. 검사 방법을 선
HANYANG MEDICAL REVIEWS Vol. 27 No. 2, 2007 Helicobacter pylori 감염의 진단 Diagnosis of Helicobacter pylori Infection 김주성, 강정묵 서울대학교 의과대학 내과학 교실 Joo Sung Kim, M.D., Jung Mook Kang, M.D. Department of Internal
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information歯14.양돈규.hwp
: The Korean Journal of Counseling and Psychotherapy 2003. Vol. 15, No. 3, 615-631. 1 2 3 1,410.,, ( ),., ( 69%),.,, ( ), ( ).,,.., ( ).,. :,,. :, (390-711) 21-1, : 043-649-1362 E-mail : ydk9498@hanmail.net
More information