<333820C0CCB9CEC8A32DC1F8C7C7BCB6C0AFB8F0BCBCC6F7BFA1BCAD20B4EBBAB9C7C7C3DFC3E2B9B02E687770>
|
|
- 준호 지
- 4 years ago
- Views:
Transcription
1 Journal of the Korea Academia-Industrial cooperation Society Vol. 14, No. 4 pp , 진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 이민호 1, 김형진 2, 정현아 3, 이영근 4* 1 오비엠랩, 2 피코스텍, 3 대전대학교한의과대학, 4 대전보건대학교 Stimulation of the Extracellular Matrix Production in Dermal Fibroblasts by Areca catechu Extract Min-Ho Lee 1, Hyung-Jin Kim 2, Hyun-Ah Jung 3 and Young-Keun Lee 4* 1 OBM LAB, 2 PICOSTECH, 3 Oriental Medical College, Daejeon University 4 Department of Cosmetic Science, Daejeon Health Science College 요약교원질을비롯한세포외기질의생합성을통해피부장력과탄력등피부특성을제공하는진피섬유모세포는피부노화와함께활성이감소되어주름형성의이유가된다. 따라서젊고건강한피부를유지하기위해서는진피섬유모세포의활성화가큰의미를지닌다. 본연구에서는대복피에탄올추출물이진피섬유모세포의세포외기질합성에미치는영향을 ELISA, Western blot analysis 및 RT-PCR 등의 in vitro 평가법으로측정하였다. ELISA와 western blot analysis에서대복피추출물은제1형교원질, fibronectin, transforming growth factor-β1 (TGF-β1) 의생성을촉진시켰고, RT-PCR에서는 COL1A1, TGF-β1, keratinocyte growth factor (KGF), insulin growth factor (IGF)-1의유전자발현을증가시켰다. 이상의결과로부터대복피추출물은진피섬유모세포에서세포외기질의생성을촉진시키는천연소재인것으로판단되었다. Abstract Dermal fibroblasts produce the many components of the extracellular matrix (ECM) that are needed to maintain connective tissue integrity and repair tissue injuries. This study investigated the effects of Areca catechu extract (ACE) on dermal fibroblast cell activation. Cultured human dermal fibroblasts were treated with ACE, and then ECM production was determined by ELISA, Western blot and RT-PCR. ACE significantly accelerated the production of type 1 collagen, fibronectin, and transforming growth factor (TGF)-β1 by ELISA and type 1 collagen by Western blot assay. ACE also increased the gene expression of COL1A1, TGF-β1, keratinocyte growth factor (KGF) and insulin growth factor (IGF)-1. These results suggest that ACE has the potential to stimulate ECM production and that it might be suitable for maintaining skin texture. Key Words : Areca catechu, Dermal fibroblast, Extracellular matrix 1. 서론 피부는바깥쪽에서부터표피, 진피및피하지방층의세개의층으로구성되어있다. 진피는피부의대부분을차지하며피부의장력, 탄력성, 유연성등의피부특성을제공한다. 이러한피부특성은진피섬유모세포 (dermal fibroblast cell) 에의해만들어지는교원섬유 (collagen fiber), 탄력섬유 (elastic fiber), 기질 (dermal matrix) 등에의해결정된다 [1]. 사람의피부는나이가들어가면서피부장력과유연성감소되고주름이발생하게되는데, 이는섬유모세포의활성저하에기인한세포외기질의합성감소및분해증가에의해발생되는결체조직 (connective 본논문은중소기업청에서지원하는 2012년도산학연공동기술개발사업 (No. C ) 의연구수행으로인한결과물임을밝힙니다. * Corresponding Author : Young-Keun Lee(Daejeon Health Sciences College) Tel: ykleeb@hit.ac.kr Received January 29, 2013 Revised February 25, 2013 Accepted April 11,
2 한국산학기술학회논문지제 14 권제 4 호, 2013 tissue) 의붕괴에서비롯된다 [2]. 진피섬유모세포는피부조직유지뿐아니라상처치유과정에도중요한역할을한다. 피부에상처가발생하면섬유모세포는세포증식과이동을통해손상된피부를복구하고, 다양한세포외기질합성하며, transforming growth factor (TGF)-β와같은세포조절물질과 epidermal growth factor (EGF), keratinocyte growth factor (KGF), vascular endothelial growth factor (VEGF), platelet derived growth factor (PDGF), insulin growth factor (IGF) 등의세포성장인자를분비해상처치유과정에관여한다 [3-5]. 따라서건강한피부조직의유지를위해서는진피섬유모세포의활성이중요한것으로인식되고있으며, 이에따라학계와산업계를중심으로진피세포의활성화연구가활발히진행되고있다 [6-8]. 대복피는야자과 (Palmae) 에속하는빈랑 (Areca catechu Linne) 의과피를말한다. 빈랑의씨인빈랑자의경우소화계 [9] 와신경계 [10] 에미치는영향과유효성분인 arecoline에대한연구 [11] 등이활발히진행된반면, 그과피인대복자에대한연구는 α-naphthylisothiocyanate 에의해유도된랫드의간손상에유효하다는보고 [12] 가있을뿐으로피부세포와관련된연구는찾아보기힘든실정이다. 본연구는대복피에탄올추출물이사람의피부에서분리해배양한진피섬유모세포를자극해교원질을비롯한세포외기질합성과상처치유에효과적인지의여부를검증하여, 이를화장품천연소재로서의활용가능성을검토코자하였다. 2. 실험재료및방법 2.1 시료 본연구에사용한대복피는대전대학교한의과대학에서제공받아사용하였다. 입수한대복피 500 g을분쇄한후천연물추출기에넣고 95% ethyl alcohol을 1:10 weight/volume으로가하여상온에서 5일간추출하였다. 추출한약재는 filter paper를사용해고형분을제거하고, rotary evaporator를이용해감압농축시켜대복피에탄올추출물 (Areca catechu extract, 이하 ACE라약함 ) 을제조하였다. 2.2 세포배양본연구에사용한진피섬유모세포는충남대피부과학연구실에서제공받아사용하였다 [13]. 세포배양은 10% fetal bovine serum과 penicillin/streptomycin이첨가된 Dulbeco s modified Eagle s medium ( 이상 Gibco BRL, USA) 을사용하였으며 37, 5% CO2 incubator에서배양하였다. 본연구의모든실험은 5 12 계대의세포주를이용하였다. 2.3 세포독성실험농도선정을위한세포독성실험은 MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) 법으로실시하였다 [14]. 2.4 Collagen 합성촉진효능 Enzyme-linked immunosorbent assay (ELISA) 제1형교원질정량은 Takara Bio (Japan) 에서구입한 ELISA kit를사용하였으며, 제조사에서제공한실험법에준하여평가를실시하였다 Western blot analysis 세포배양액을제거하고, Proprep solution (Intron, 한국 ) 을사용하여세포를용해시킨후 Bradford protein assay kit (Bio-Rad, USA) 를이용해총단백질량을측정하고 SDS-polyacrylamide gel electrophoresis를실시하였다. 결과물을 nitrocellulose membrane 으로옮긴후 primary antibody를가하여 4 에서 18시간반응시키고, peroxidase-conjugated secondary antibody를첨가해실험결과를확인하였다. 본연구에사용한 primary antibody 로는 collagen type 1 α 1 (Santa Cruz, USA) 과 actin (Sigma, USA) 을사용하였다 [8]. 2.5 TGF-β1 과 fibronectin 정량 TGF-β1과 fibronectin 정량을위한 ELISA kit는 R&D 시스템 (USA) 과 American Diagnostica (USA) 에서각각구입하였으며, 각제조사에서제공한실험법에준하여 TGF-β1과 fibronectin을각각정량하였다. 2.6 Reverse transcriptase polymerase chain reaction (RT-PCR) Total RNA 2 μg을취하여 M-MLV reverse transcriptase (ELPIS Biotech, 한국 ) 을이용해 complementary DNA를제조하고, 이를활용해 PCR를실시하였다 [15]. 본연구에사용한 primer set은 Table 1과같다. 1858
3 진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 [Table 1] Nucleotide sequence of primers. Name Primer Expected Size (bp) COL1A1 GGAGGGAATCACTGGTGCTA 309 AGGGGGAAAAACTGCTTTGT TGF-β1 KGF FGF-1 IGF-1 Cyclophilin TTCACCAGCTCCATGTCGAT CCTGCCACAGATCCCCTATT ACACACAACGGAGGGGAAAT GCCATAGGAAGAAAGTGGGC AGCCCACAGAGCCTGAATTT CAGGAAGGACAAAAGGGAGC GATTCTCCTGCCTCAGCCTC TAAGAGGGAACACATGGGCA CAGCCACCCAACGTTTACTT GAACTGGCTGCCATTGGTAT 2.7 세포이동 (cell migration) 세포단층 (cell monolayer) 에 scratch를가하면주변의세포들은세포증식과이동을통해손상된부위를복구하게된다. 즉세포이동은세포증식과함께창상치유과정에서큰의미를갖는다 [16]. 본연구에서는실험물질에의한세포이동촉진여부를평가하기위해진피섬유모세포세포단층에 p200 pipet tip으로 scratch를가해빈공간을만들고, 혈청을포함하지않은배지를가해 24시간배양하며실험군의세포이동정도를 inverted microscope를이용해대조군과비교하였다. 3.2 세포외기질합성촉진효과세월의흐름에발생하는내인성노화 (intrinsic aging) 와자외선등에의한광노화 (photoaging) 등으로구분되는피부노화의대표적인현상중하나는진피세포에서생합성되는기질단백질의감소이다 [17]. 이러한사실은나이든사람의피부에서는세포외기질의합성이현저하게감소함에서확인된다 [2]. 따라서젊고건강한피부유지에유용한소재의발굴을위해서는진피섬유모세포의활성화효능이큰의미를지닌다. 본연구에서는우선 ACE가세포외기질의합성에미치는영향을평가하였다. ELISA 결과 ACE는 25 μg / ml에서제1형교원질의생합성을 37%, 50 μg / ml에서 fibronectin과 TGF-β1의합성을각각 43% 와 42% 증가시켰다 (Fig. 2A, B, C). Western blot analysis에서도 ACE는세포내의제1형교원질합성을촉진시켜 ELISA 결과와일치하였다 (Fig. 2D). 또한 RT-PCR 에서도 ACE는 3. 실험결과및고찰 3.1 세포독성 ACE는본연구에서설정한최고실험농도인 50 μg / ml 까지세포독성을보이지않았다 (Fig. 1). [Fig. 1] Cytotoxicity of Areca catechu extract (ACE) on dermal fibroblast cells determined by MTT assay. [Fig. 2] Effect of Areca catechu extract (ACE) on collagen production in dermal fibroblasts. Cells were treated with ACE at the indicated concentrations for 2 days. The conditioned medium was collected, and the amounts of secreted (A) procollagen type 1, (B) fibronectin, and (C) transforming growth factor-β1 (TGF-β1) were measured by enzyme linked immunosorbent assay (ELISA). Results are shown as a percentage of a control±standard deviation (*p<0.05 vs. control). (D) Cellular proteins were harvested and the protein level of collagen type 1 α 1 was verified using western blot analysis. (E) The expression levels of the COL1A1 and TGF-β1 genes were determined using reverse transcription-polymerase chain reaction (RT-PCR). 1859
4 한국산학기술학회논문지제 14 권제 4 호, 2013 COL1A1와 TGF-β1의유전자의발현을증진시켜 (Fig. 2E), ACE는 RNA와단백질수준모두에서제1형교원질과 TGF-β1의생합성을촉진시키는효능을보였다. 제1 형교원질과 fibronectin은피부결체조직을구성하는주요요소이다. 교원질은진피섬유모세포에서전교원질 (procollagen) 의형태로합성되어효소분해과정등을거쳐다양한유형의교원질로만들어진다. 사람의피부를구성하고있는대표적인교원질은제1형으로전체교원질의 80% 를차지하며피부장력과창상치유에중요한역할을한다 [1]. Fibronectin은진피에서섬유모세포와세포외지질사이의상호작용에관여하는다기능성 glycoprotein이다 [18]. TGF-β는주요세포외기질의합성을조절하는물질로보고되어있다 [19, 20]. TGF-β는세포내에서 TGF-β receptor에결합해 serine/threonine kinase activity를활성화시켜연쇄적인신호전달반응을유도하고, 최종적으로세포증식과분화, 세포외기질합성과상처치유과정에관여한다 [21]. 따라서추가적인분자생물학적기전연구를통해밝히겠지만, ACE는 TGF-β1과관련된일련의세포신호전달체계를통해세포외기질의합성을촉진하는작용을하는것으로생각되었다. 3.3 In vitro wound healing 효과교원질, fibronectin 및 TGF-β1 생합성촉진은모두세포외지질강화와함께상처치유과정과도밀접한관련이있다 [4,22]. TGF-β 신호전달계는상처부위에서 re-epithelization, wound contraction, extracellular matrix deposition, remodeling 등에작용하는것으로보고되었으며 [23], 동물실험에서도 TGF-β1은상처치유를가속화하였다 [24]. Fibronectin 역시상처치유과정에서혈소판응집, 상피세포이동및분화, collagen matrix assembly, wound contraction 과정에작용한다 [18]. 진피섬유모세포도상처치유과정에도중요한역할을한다. 지혈및염증단계 (hemostasis and inflammation), 증식단계 (proliferation), 성숙단계 (remodeling) 로진행되는복잡한상처치유과정에서진피섬유모세포는증식단계에활발한세포분열과이동으로손상된부위를복원하고재구성하는데작용한다 [22]. 많은성장인자도상처치유과정에역할을하는데 EGF, KGF, FGF, VEGF, PDGF, IGF 등이대표적이다 [4]. 이에본연구에서는 ACE가이들성장인자에미치는영향을평가하기위해 RT-PCR를실시하였으며, 그결과 KGF와 IGF-1의유전자발현이 ACE 처리에의해증가됨을확인하였다 (Fig. 3). IGF-1은 in vitro 실험에서섬유모세포와각질세포의증식과이동을촉진하고, 동물실험에서도상처치유에도움을주는것으로알려져있으며 [25], KGF는상처치유과정의초기와 대량생산되며, 동물의상처치유에도움을준다는연구결과 [26] 를고려할때 ACE는상처치유에도움을줄수있는소재인것으로생각되었다. [Fig. 3] Dermal fibroblasts were treated with Areca catechu extract (ACE) at the indicated concentrations for 2 days. The levels of expression of keratinocyte growth factor (KGF), fibroblast growth factor (FGF)-1, insulin growth factor (IGF)-1 genes were verified by reverse transcription-polymerase chain reaction (RT-PCR). ACE에의해생성이촉진된 TGF-β, fibronectin, IGF-1 은모두상처치유과정에서세포이동을촉진하는것으로알려져있다. 이에본연구에서는마지막실험으로 ACE가상처치유에도움을주는지의여부를실험실적으로검증하기위해 ACE가진피섬유모세포성장과이동에미치는영향을평가하였다. In vitro 상처치유실험중직접적이고경제적인평가법으로인정받고있는 cell scratch assay[16] 로세포이동촉진효과를평가한결과, ACE를처치한실험군은대조군에비해 scratch wound가빠르게회복되어 ACE가창상치유에유용한물질임을확인할수있었다 (Fig. 4). 그러나 ACE는섬유모세포의증식에는영향을미치지못했다 (data 생략 ). [Fig. 4] Effect of Areca catechu extract(ace) on cell migration. Confluent monolayers of dermal fibroblast cells were wounded using a pipette tip, and the monolayer cells were treated with ACE at the indicated concentrations. The areas of cell-free wounds were photographed in inverted microscope after 24 h treatment. 1860
5 진피섬유모세포에서대복피추출물의세포외기질합성촉진효과 4. 결론 본연구는대복피에탄올추출물 (ACE) 이진피섬유모세포의활성화에미치는영향을검증하기위해실시하였다. ELISA 실험에서 ACE는진피섬유모세포를자극해 25 μg / ml에서제1형교원질의생합성을 37%, 50 μg / ml에서 fibronectin과 TGF-β1의합성을각각 43% 와 42% 증가시켰다. Western blot analysis에서도 ACE 처리군은제 1형교원질단백질생성이농도의존적으로증가되어 ELISA와일치된결과를보였다. RT-PCR에서는 COL1A1, TGF-β1, KGF 및 IGF-1 등세포외기질생합성및상처치유와관련된유전자의발현도증가되었다. 또한 in vitro scratch assay에서 ACE 처리군은대조군에비해 scratch wound가빠르게회복되는현상을보였다. 이상의결과를종합하면 ACE는진피섬유모세포에서세포외기질의합성및상처치유를도움을주는우수한기능성화장품소재인것으로판단된다. References [1] KDA Textbook Editing Board. Dermatology (5th Ed.). p.11-33, Ryo Moon Gak, [2] J. Uitto. Connective tissue biochemistry of the aging dermis. Age-related alterations in collagen and elastin. Dermatologic Clinics, 4, , [3] T. Kanzaki, N. Morisaki, R. Shiina, Y. Saito. Role of transforming growth factor-beta pathway in the mechanism of wound healing by saponin from Ginseng Radix rubra. Br J Pharmacol, 125, , DOI: [4] C. P. Kiritsy, A. B. Lynch, S. E. Lynch. Role of growth factors in cutaneous wound healing: a review. Crit Rev Oral Biol Med, 4, , [5] K. Haukipuro, J. Melkko, L. Risteli, M. Kairaluoma, J. Risteli. Synthesis of type I collagen in healing wounds in humans. Ann Surg, 213, 75-80, DOI: [6] Y. Kishimoto, N. Saito, K. Kurita, K. Shimokado, N. Maruyama, A. Ishigami. Ascorbic acid enhances the expression of type 1 and type 4 collagen and SVCT2 in cultured human skin fibroblasts. Biochem Biophys Res Commun, 430, , DOI: [7] M, D. Adil, P. Kaiser, N. K. Satti, A. M. Zargar, R. A. Vishwakarma, S. A. Tasduq. Effect of Emblica officinalis (fruit) against UVB-induced photo-aging in human skin fibroblasts. J Ethnopharmacol, 132, , DOI: [8] M. H. Jin, S. G. Park, Y. L. Hwang, M. H. Lee, N. J. Jeong, S. S. Roh, Y. Lee, C. D. Kim, J. H. Lee. Cedrol enhances extracellular matrix production in dermal fibroblasts in a MAPK-dependent manner. Ann Dermatol, 24, 16-21, DOI: [9] M. Kumar, A. Kannan, R. K. Upreti. Effect of betel/areca nut (Areca catechu) extracts on intestinal epithelial cell lining. Vet Hum Toxicol, 42, , [10] N. S. Chu. Effects of Betel chewing on the central and autonomic nervous systems. J Biomed Sci, 8, , DOI: [11] S. H. Lee, S. Y. Kim, K. H. Son, S. J. Kang, S. Y. Chang, J. H. Park, K. S. Lee. Isolation and quantitative determination of arecoline from Arecae semen. Kor J Pharm, 32, 39-42, [12] S. Ohata, N. Sato, S. H. Tu, M. SHinoda. Protective effect of Taiwan crude drugs on experimental live injuries. Yakugaku Zasshi, 113, , [13] S. S. Roh, M. H. Lee, Y. L. Hwang, H. H. Song, M. H. Jin, S. G. Park, C. K. Lee, C. D. Kim, T. J. Yoon, J. H. Lee. Stimulation of the extracellular matrix production in dermal fibroblasts by velvet antler extract. Ann Dermatol, 22, , DOI: [14] M. H. Lee, C. D. KIm, H. J. Ahn. Evaluation of surfactant cytotoxicity potential by neutral red utake assay, MTT assay and cell protein assay. Korean J Toxiciol, 10, , [15] Y. W. Wang, J. H. Ren, K. Xia, S. H. Wang, T. F. Yin, D. H. Xie, L. H. Li. Effect of mitomycin on normal dermal fibroblast and HaCat cell: an in vitro study. J Zhejiang Univ Sci B, 13, , DOI: [16] C. C. Liang, A. Y. Park, J. L. Guan. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc, 2, , DOI: [17] J. H. Chung. Photoaging in Asians. Photo- dermatol Photoimmunol Photomed, 19, , DOI: [18] L. F. Brown, D. Dubin, L. Lavigne, B. Logan, H. F. Dvorak, L. Van de Water. Macrophages and fibroblasts express embryonic fibronectins during cutaneous wound healing. Am J Pathol, 142, , [19] R. A. Ignotz, J. Massagué. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular 1861
6 한국산학기술학회논문지제 14 권제 4 호, 2013 matrix. J Biol Chem, 261, , [20] K. J. Rolfe, J. Richardson, C. Vigor, L. M. Irvine, A. O. Grobbelaar, C. Linge. A role for TGF-beta1-induced cellular responses during wound healing of the non-scarring early human fetus? J Invest Dermatol, 127, , DOI: [21] J. Massagué, Y.G. Chen. Controlling TGF-beta signaling. Genes Dev, 14, , [22] R. F. Diegelmann, M. C. Evans. Wound healing: an overview of acute, fibrotic and delayed healing. Front Biosci, 9, , DOI: [23] M. Martinez-Ferrer, A. R. Afshar-Sherif, C. Uwamariya, B. Crombrugghe, J. M. Davidson, N. A. Bhowmick. Dermal transforming growth factor-beta responsiveness mediates wound contraction and epithelial closure. Am J Pathol, 176, , DOI: [24] T. A. Mustoe, G. F. Pierce, A. Thomason, P. Gramates, M. B. Sporn, T. F. Deuel. Accelerated healing of incisional wounds in rats induced by transforming growth factor-b. Science, 237, , DOI: [25] E. Emmerson, L. Campbell, F. G. Davies, N. L. Ross, G. S. Ashcroft, A. Krust, P. Chambon, M. J. Hardman. Insulin-like growth factor-1 promotes wound healing in estrogen-deprived mice: new insights into cutaneous IGF-1R/ERα cross talk. J Invest Dermatol, 132, , DOI: [26] G. P. Marti, P. Mohebi, L. Liu, J. Wang, T. Miyashita, J. W. Harmon. KGF-1 for wound healing in animal models. Methods Mol Biol, 423, , DOI: 이민호 (Min-Ho Lee) [ 정회원 ] 생명과학, 피부과학 1983 년 8 월 : 중앙대학교대학원생물학과 ( 이학사 ) 1985 년 8 월 : 중앙대학교대학원생물학과 ( 이학석사 ) 1988 년 9 월 ~ 2006 년 5 월 : LG 생활건강기술원책임연구원 2006 년 10 월 ~ 현재 : ( 주 ) 오비엠랩연구소장 김형진 (Hyung-Jin Kimg) [ 정회원 ] 화장품, 화학공학 1985 년 2 월 : 한양대학교화공학과 ( 공학사 ) 1998 년 2 월 : 충북대학교공업화학과 ( 공학석사 ) 1984 년 12 월 ~ 2005 년 1 월 : LG 생활건강화장품연구소팀장 2006 년 3 월 ~ 현재 : ( 주 ) 피코스텍대표이사 정현아 (Hyun-Ah Jung) [ 정회원 ] 한의학, 생명과학 2003 년 2 월 : 대전대학교한의과대학한의학과 ( 한의학석사 ) 2007 년 2 월 : 대전대학교한의과대학한의학과 ( 한의학박사 ) 2009 년 3 월 ~ 현재 : 대전대학교한의과대학한의학과교수 이영근 (Young-Keun Lee) [ 정회원 ] 1984 년 2 월 : 부산대학교화학공학과 ( 공학사 ) 1996 년 2 월 : 충북대학교공업화학과 ( 공학석사 ) 2005 년 2 월 : 충북대학교화학공학과 ( 공학박사 ) 1984 년 12 월 ~ 2004 년 4 월 : LG 생활건강화장품연구소팀장 2008 년 3 월 ~ 현재 : 대전보건대학교화장품과학과교수 화장품, 화학공학 1862
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information(Establishment and Management of Proteomics Core Facility)
(Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information歯111
2003. 3 4 1 Co n t e n t s 02 05 08 12 14 16 18 22 26 2 8 3 1 33 36 4 0 4 2 44 2003. 3 4 2 3 4 5 6 7 8 9 10 11 12 13 14 15 b o d y? 16 17 b o d y? 18 19 20 21 22 P h i l i p p i n e s 23 24 25 26 27 28
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부
大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah
More informationuntitled
대한화상학회지제 11 권제 1 호 22 Journal of Korean Burn Society Vol. 11, No. 1, 22-26, 2008 ph 변화가섬유아세포증식에미치는영향 김영석ㆍ황용석ㆍ노태석ㆍ유원민ㆍ탁관철 1 연세대학교의과대학영동세브란스병원성형외과학교실, 1 인체조직복원연구소 The Effect of ph on the Fibroblast Growth
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More informationSeating clinic
피부의구조및상처의 치유기전 국립재활원재활의학과 김동아 피부의구조 피부의구조 표피 (epidremis) 진피 (dermis) 피하조직 (subcutaneous tissues) 표피부속기 : 모발 (hair), 한선 (sweat gland), 조갑 (nail) 피지선 (sabaceous gland) 1. 표피 (Epidermis) 피부의가장바깥층재생과탈락을반복하는중층편평상피층두께
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More informationV V V α Azam, M. Z. M. & Park, Dong-Ho (2012). The relationship between Digit Ratio(2D:4D) and Physical Fitness in Children. Journal of Korean Society of Living Environmental System, 19(1), 101-110.
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information*2007BT..........
BT 정보 교육 최신 BT 공개특허 이처영 Experimental Biology 2007 Meeting을 다녀와서 전희진 제4회 ASM Conference on Biofilm 참관기 김재은 BT News 정보 교육 최신 BT 공개특허 5T국제특허법률사무소 이처영박사 1. 미생물 발명의 명칭 출원인 발명자 공개번호 숙신산 생산이 증가된 돌연변이 대장균 균주 라이스
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More informationSeating clinic
피부의구조및상처의 치유기전 국립재활원사회복귀지원과장 김동아 피부의구조 표피 (epidremis) 진피 (dermis) 피하조직 (subcutaneous tissues) 표피부속기 : 모발 (hair), 한선 (sweat gland), 조갑 (nail) 피지선 (sabaceous gland) 1. 표피 (Epidermis) 피부의가장바깥층재생과탈락을반복하는중층편평상피층두께
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 93~116 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 12 2016. 06. 20 2016. 06. 26 ABSTRACT e-
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationChapter 14
5 주 Gycoysis 5.1 Gycoysis의일반적특징 Gycoysis - Gucose가 degradation 과정을거쳐두개의 pyruvate를형성하는과정. - 이때발생하는 free energy는 ATP와 NADH로보존됨. - Gucose 2 Pyruvate - ADP phosphoryation을통하여, ATP 형성 - NAD + 로 hydride ion
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports
Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction
More information<342EBEC8BCBABFAD2CB9DAC7E2C1D82E687770>
大 韓 癩 學 會 誌 : 第 41 卷, 第 1 號 2008 Korean Leprosy Bulletin, Vol. 41, No. 1, June, 2008 마비성 하안검 외반증에 대한 lateral tarsal strip의 재조명 안성열 성형외과의원 1), 제일병원 피부과 2) 안성열 1), 박향준 2) - Abstract - Reappraisal of the
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More informationKIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information077~088 해계 유침과 전침이
loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide
More information<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
More information化學科
Department of Life Sciences 1 2 3 학과명 전공분야 생명과학세미나 1, 2 생명과학세미나 3, 4 생명과학최신동향 1, 2 과목명학점 ( 시간 ) 코드이수구분 각 1(1) 각 1(1) 각 1(1) LIS901, 902 LIS903, 904 LIS911, 912 기초공통기초공통기초공통 생명과학과 생화학 생화학 1, 2( 영강 ) 고급생화학
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: A Study on the Opti
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.127-148 DOI: http://dx.doi.org/11024/pnuedi.27.4.201712.127 A Study on the Optimization of Appropriate Hearing-impaired Curriculum Purpose:
More information