<312E20BEC6B9CCB3EBBBEA20BCF6BCDBC3BC2DBCB1BBFDB4D4B1B3C1A42E687770>
|
|
- 여원 남궁
- 4 years ago
- Views:
Transcription
1 Kor J Oral Maxillofac Pathol 2006 ; 30(1) : 1-8 아미노산수송체 LAT1 RNA interference에의한사람구강편평세포암종 KB 세포의성장억제 김창현, 홍주영, 양준기, 조현우, 김지혜, 홍민기, 신용우, 김도경 * 조선대학교치과대학구강생물학연구소, NURI project ABSTRACT The Effect of RNA Interference of Amino Acid Transporter LAT1 on the Cell Growth in the KB Human Oral Squamous Cell Carcinoma Chang-Hyun Kim, Joo Young Hong, Joon Ki Yang, Hyun Woo Cho, Jihye Kim, Minki Hong, Yong Woo Shin, Do Kyung Kim * Oral Biology Research Institute, NURI project, Chosun University College of Dentistry, Gwangju , Korea Amino acid transporters are essential for the growth and proliferation in all living cells. Among the amino acid transporters, the system L amino acid transporters are the major nutrient transport system responsible for the Na+-independent transport of neutral amino acids including several essential amino acids. The L-type amino acid transporter 1 (LAT1) is over-expressed to support cell growth in malignant tumors. The double stranded RNA-mediated RNA interference (RNAi) analysis can be in a wide variety of eukaryotes to induce the sequence-specific inhibition of gene expression. In this study, we examined the effect of LAT1 short interfering RNA (sirna) on cell growth using sirna of LAT1 in the KB human oral squamous cell carcinoma. In the RT-PCR analysis and western blot analysis, the sirna of LAT1 inhibited expressions of LAT1 mrna and protein. The uptake of [ 14 C]L-leucine was inhibited by sirna of LAT1. In the MTT assay, the sirna of LAT1 inhibited the growth of the KB cells in the time-dependent manner, indicating that the growth inhibition of KB cell by the sirna of LAT1 is induced by the blocking of neutral amino acid transport mediated by LAT1. These results suggest that the transport of neutral amino acids including several essential amino acids into the KB human oral squamous cell carcinoma is mediated mainly by LAT1. Further, the LAT1 would be a new target for the inhibition of cancer cell growth. Key words : LAT1, sirna, KB cells, Anti-cancer therapy I. 서론 살아있는모든세포는성장과분화를위해아미노산을요구한다. 아미노산이세포내의단백질, 효소, 호르몬, 신경전달물질의합성및단백질합성의기질이되는역할을하고 *Correspondence:Do Kyung Kim, Department of Oral Physiology, Chosun University College of Dentistry #375 Seosuk-dong, Dong-gu, Gwangju , Korea, Tel: , kdk@chosun.ac.kr 본논문은교육인적자원부누리사업국고보조금으로수행한과제임 (2005). 있기때문이다. 세포내에서필요한아미노산은세포막에위치하고있는아미노산수송체 (amino acid transporter) 를통해세포내로공급되는데아미노산수송체는그들이수송하는아미노산의특성에따라각각중성, 염기성및산성아미노산수송체로분류된다 1). 아미노산수송계 L은 Na+-비의존적으로중성아미노산을수송하는세포막단백질이다. 또한종양세포를포함한대부분의세포에서중성아미노산의주경로가되는아미노산수송체로알려져있으며 1,2), 상피세포의기저막측에존재하여
2 소장과신세뇨관의상피세포를통한중성아미노산흡수에중요한기능을한다고알려져있다 1) 년 Kanai 등에의해아미노산수송계 L의첫번째아형인 L-type amino acid transporter 1(LAT1) 이 rat C6 glioma 세포에서클로닝되었다 3). LAT1 은세포막을 12회관통하는단백질로서 Na+-비의존적으로 leucine, isoleucine, valine, phenylalanine, tyrosine, methionine, tryptophan 및 histidine 같은구조가큰중성아미노산을수송하는특징을가지고있다 3-5). 또한 LAT1은 4F2 heavy chain(4f2hc) 이라는세포막을 1회관통하는막단백질과 disulfied bond로결합하고있는 heterodimer 형단백질이며, LAT1 이기능을수행하기위해서는보조인자 4F2hc의존재가필수적이라는것이보고되었다 3,4,6-8). 보조인자인 4F2hc가모든정상조직에서발현이되는것과대조적으로 LAT1은뇌, 비장, 태반, 정소등발현하는부위가제한되어있다 3,4). 뿐만아니라 LAT1은악성종양세포에서과발현되며, 종양세포의계속되는성장에중요한역할을한다고보고되었다 3,4,9,10). LAT1 의클로닝후에 LAT1과구조적으로관련이있는아미노산수송계 L의두번째아형인 L-type amino acid transporter 2(LAT2) 가클로닝되었다 11-14). LAT2는구조적으로 LAT1과매우유사하며, Na+- 비의존적으로다수의필수아미노산을포함하는중성아미노산을수송한다. LAT1 이구조가큰중성아미노산만을수송하는특징을보이는반면, LAT2 는구조에관계없이중성아미노산을모두수송하는넓은기질특이성을지니고있다 12-14). 아미노산수송체 LAT1과 LAT2의특성을살펴보면아미노산수송계 L, 특히종양세포에서과발현되는 LAT1의조절을통해종양세포성장억제를위한하나의방법을제시할수있다. 종양세포에서 LAT1의활성을억제하여세포내중성아미노산의고갈을유도한다면종양세포성장억제를유도할수있을것으로사료된다. RNA interference(rnai) 란 short interfering RNA (sirna) 를이용하여특정유전자의발현을억제하는방법으로, 이중가닥 RNA(dsRNA) 가 dicer 에의해절단되어 21~23개의뉴클레오타이드의생성을통한단백질발현의억제를의미한다. 1998년 Andrew 등 15) 이예쁜꼬마선충 (Caenorhabditis elegans) 을이용한실험에서외부의이중가닥 RNA (double-stranded RNA) 를예쁜꼬마선충에게주입했을때, 상보적인세포내부의 mrna 와의간섭을통한단백질합성이억제된다는것을확인하여 RNAi 의존재를최초로증명하였다 16). RNAi 과정은크게 dicer enzyme 에의해긴이중가닥 RNA 를 sirna 로자르는과정과, 잘려진 sirna 가 RNA-induced silencing complex와결합한후세포내상보적인 mrna 에결합하는과정으로이루어진다. 이때 sirna 에의해 mrna 는절단되어특정유전자및단백질의발현이감소되게된다 17-19). 본연구의목적은중성아미노산수송체 LAT1 sirna 를이용한 RNAi 방법을통하여 LAT1 유전자와단백질발현을저해시켜사람구강편평세포암종 KB 세포성장과의상관관계를밝히고자한다. II. 재료및방법 1. 실험재료및세포실험에사용한사람구강편평세포암종 KB 세포는 American Type Culture Collection (ATCC, Rockille, MD, USA) 에서분양받아, 성장배지 (MEM + 5% FBS + 1% NEAA) 하에서배양하였다. Human LAT1 의 RNAi를위한 RNA 단편 (sirna) 은 Proligo(Boulder Location, Colorado, USA) 에주문제작하였고 (Table 1), 세포내로도입을위해 Oligofectamin(Invitrogen Life Technologies, Carlsbad, CA, USA) 을사용하였다. [ 14 C]L-leucine 은 Perkin Elmer Life Science Inc.(Boston, MA, USA) 로부터구입하여사용하였고, 아미노산및기타시약들은 analytical grade 를구입하여사용하였다. Affinity-purified anti-lat1 및 4F2hc는 Kumamoto Immunochemical Laboratory, Transgenic Inc.(Kumamoto, Japan) 로부터제공받아사용하였다 4,21). Oligo Table 1. LAT1 sirna sequence for LAT1 gene silencing LAT1 sense strand sirna LAT1 antisense strand sirna Sequence (5 3) GGAACAUUGUGCUGGCAUUTT AAUGCCAGCACAAUGUUCCTT 2. KB 세포의 seeding과 LAT1 sirna transfection KB 세포를 6 well plate 에 1 X 105cells/well 로 seed하여 8시간배양한후, FBS 가없는배지로바꾸었다. 다시 6 시간을배양하고, LAT1 의발현을저해시킬수있는최소농도인 sirna 60 pm(table 1) 을세포내로도입시켰다 18,22). 3. Total RNA 추출과역전사-중합효소연쇄반응 (RT-PCR) LAT1 sirna를세포내로도입한후, 시간별로 TRI 2
3 REAGENT kit(molecular Research Center, Inc., Ohio, USA) 를이용하여 total RNA 를추출한후, 자외선분광기 (UV spectrometer) 를이용하여 260nm에서흡광도를측정, 추출된 RNA의농도를계산하였다. cdna 를합성하기위하여 5μg의 total RNA 를 reverse-transcriptase(invitrogen Life Technologies, Carlsbad, CA, USA) 와 oligo(dt) primer를이용하여 42 에서 60분간역전사반응을시행하였다. 합성된 cdna 를 GAPDH 및 LAT1의 primer(table 2) 를이용하여중합효소연쇄반응 (PCR) 을시행하였다. PCR 반응조건은 94 에서 10분, 변성 (denaturation) 반응을 94 에서 30초, 결합 (annealing) 반응을 54~55 에서 30초, 중합 (extension) 반응을 72 에서 1분간 30주기를반복하고마지막중합반응은 72 에서 10분간연장하여반응시켰다. Primer 의 Tm 값을고려하여 LAT1의결합반응온도는 5 5, GAPDH 의결합반응온도는 54 로시행하였다. RT-PCR후 1.5% agarose gel 에서전기영동하여각각의 PCR product를확인하였다. 4. Western blot analysis KB 세포에서 LAT1 단백의발현을확인하기위하여 western blotting 방법을이용하였다. KB 세포에 protein lysis buffer(1% NP-40, 50mM Tris-Cl(pH 7.4), 120mM NaCl, 10mM EDTA, 5mM AEBSF, 100mM leupeptin, 2μg / ml aprotinin) 를넣어얼음위에서 10분간반응시킨후, Dounce homogeniger에옮겨 10회 stroke 하여세포를용해시켰다. 세포용해물을 20,000 g에서 10분간원심분리하고, 상층액을회수하여단백질을정량하였다. KB 세포의단백질 30μg을 5μl의 SDS-PAGE sample buffer(60mm Tris-HCl(pH 6.8), 2% SDS, 25% glycerol, 14.4mM 2-mercaptoethanol, 0.1% Bromophenol blue) 에넣고 3 분간 100 에서변성시킨후, SDS-polyacrylamide gel에 2시간전기영동을시행한다음 gel을 XCell IITM Blot Module(Invitrogen Life Technologies, Carlsbad, CA, USA) 에서 1시간동안 PVDF membrane에이동시켰다. Membrane 은 5% fat-free dry milk-pbst buffer(pbs, 0.05% Tween-20) 에서 4 에서 18시간동안 blocking 한후, PBST buffer로 5분간 3회세척하였다. Affinity-purified human anti-lat1 은 5% fat-free dry milk-pbs buffer 에 500배희석하였으며, 이용액에 membrane 을넣어 1시간 30분동안반응시킨후, PBST 용액에서 5분간격으로 3회세척하였다. Membrane 을 horseradish peroxidase conjugated-secondary antibody 용액에넣고상온에서 1시간동안반응시킨후, PBST 용액에서 5분간격으로 3회세척하고 Enhanced chemiluminescence(ecl) detection kit(amersham Life Sciences, Arlington Heights, IL, USA) 를사용하여 X-ray 필름 (Amersham Life Sciences, Arlington Heights, IL, USA) 에감광하였다. 5. Uptake 실험 KB 세포에 LAT1 sirna 를도입한후 LAT1의수송특성을조사하기위해 Kim 등 20) 의방법을이용하여아미노산 uptake 실험을시행하였다. 배양된 KB 세포를수집하여 24 well plate 에 1 X 105cells/well 로 seed 한후, LAT1 sirna 를도입하여각각의시간대별로 uptake를시행하였다. 세포배양 plate의성장배지를제거한뒤, Na+-free uptake 용액 (125mM choline-cl, 4.8mM KCl, 1.3mM CaCl2, 1.2mM MgSO4, 25mM HEPES, 1.2mM KH2PO4, 5.6mM glucose, ph 7.4) 을이용하여 3회세척한후 37 에서 10분간전배양하였다. 그후, 용액을 [ 14 C]L-leucine 이존재하는 uptake 용액으로교체하여 1분배양시켰으며, 반응의정지를위해 4 의같은용액으로 3회세척하였다. 세포를 0.1N NaOH 에녹여세포안으로 uptake 되어진방사능을 liquid scintillation spectrometry 로측정하였으며, 측정된방사능을 pmol/mg protein/min 으로산출하였다. 각결과의재현성을확인하기위하여 2회이상반복실험을시행하여결과를산출하였다. Table 2. Primer sequence for PCR Primer Name Sequence (5 3 ) PCR Product (bp) GAPDH (sense) GAPDH (antisense) LAT1 (sense) LAT1 (antisense) TGCATCCTGCACCACCAACT CGCCTGCTTCACCACCTTCG TTCATCGCAGTACATCGTGG CCCAGGTGATAGTTCCCGAA
4 A A B B Fig. 1. The effect of LAT1 sirna on the expression of LAT1 mrna in KB human oral squamous cell carcinoma. A, Agarose gel electrophoresis of RT- PCR product from KB cells (536 bp ; LAT1, 350 bp ; GAPDH). B, The percentage of LAT1 expression was calculated as a ratio of LAT1 sirna treated cells and untreated control cells. Lane 1:KB cells treated with 0 pm LAT1 sirna for 4 hrs. Lane 2:KB cells treated with 60 pm LAT1 sirna for 4 hrs. Lane 3:KB cells treated with 0 pm LAT1 sirna for 8 hrs. Lane 4:KB cells treated with 60 pm LAT1 sirna for 8 hrs. Lane 5:KB cells treated with 0 pm LAT1 sirna for 12 hrs. Lane 6:KB cells treated with 60 pm LAT1 sirna for 12 hrs. Lane 7:KB cells treated with 0 pm LAT1 sirna for 16 hrs. Lane 8:KB cells treated with 60 pm LAT1 sirna for 16 hrs. 6. MTT assay KB 세포에서 LAT1 sirna 에의한세포성장억제효과를관찰하기위하여 KB 세포에 LAT1 sirna 를도입한후, MTT assay 를시행하였다. 성장배지하에서배양된 KB 세포를수집하여 24 well plate 에 seed(1 103 cells/well) 하고, seeding 24시간후 LAT1 sirna 를도입하여, 각각의시간별로 MTT assay 를시행하였다. MTT assay 는 KB 세포에 MTT 용액을 37 에서 4시간처리한후, MTT 용액을제거하고 0.01N HCl 이함유된 isopropanol 로녹여내어 570nm 에서흡광도를측정하였다. 7. 통계학적검정모든실험성적은 mean±sem 으로나타내었고, 각실험군간의유의성검정은 ANOVA 후에 Student's t-test를하였다. Fig. 2. Time-dependent effect of LAT1 sirna on the expression of LAT1 protein by western blot analysis in KB cells. A Western blot analyses were performed on the membrane fractions prepared from KB cells in the presence of 2-mercaptoethanol using anti-lat1 antibodys. For LAT1, 40 kda -protein band detected. B, The percentage of LAT1 protein expression was calculated as a ratio of LAT1 sirna treated cells and untreated control cells. III. 결과 1. KB 세포에서 LAT1 sirna에의한아미노산수송체 LAT1의발현저해 KB 세포에 LAT1 sirna 를도입한후, LAT1 의발현정도를조사 비교하기위하여각각의 primer(table 2) 를이용하여 RT-PCR analysis 를시행하였으며, 그결과를이미지분석계를이용한 video-based densitometry 방법으로발현정도를수치로변환시켰다 (Fig. 1). KB 세포에 LAT1 sirna 도입 8시간부터 LAT1의 mrna 발현이현저하게감소하는것을관찰할수있었으며, 12시간에는 LAT1 mrna 발현이완전하게억제되는것을관찰할수있었다 (Fig. 1). 16시간이후에서는 LAT1 mrna 발현이되고있는것을확인할수있었으며, 이는 LAT1 sirna 단편들이소진되어더이상기능을하지못한결과라사료된다. 4
5 Fig. 3. The time-dependent inhibition of [ 14 C]L -leucine uptake by LAT1 sirna in KB cell. The [ 14 C]L-leucine uptake (10 μm) was measured for 1 min in the Na+-free uptake solution in the presence of LAT1 sirna 60 pm and expressed as a percentage of control L-leucine uptake in the absence of LAT1 sirna. Each data point represents the mean±sem for five experiments. **p<0.01 vs. control and ***p<0.001 vs. control. KB 세포에 LAT1 sirna 를도입한후, LAT1 단백질발현정도를확인하기위해 western blot analysis 를시행하였다. LAT1 sirna 도입 12시간후부터 LAT1의단백질발현이감소하는것을확인할수있었다 (Fig. 2). 2. KB 세포에서 LAT1 sirna에의한 [14C]L-leucine 수송억제 KB 세포에 LAT1 sirna를도입한후, L-leucine 수송특성을조사하기위하여, [ 14 C] 가표지된 L-leucine(10μM) uptake를 LAT1 sirna 60pM 존재하에서시행하였다. KB 세포내로 LAT1 sirna 를도입한후, 37 에서 [ 14 C] L-leucine 10 μm 이함유된 uptake 용액을이용하여 uptake 를시행한결과, LAT1 sirna 60pM 은 [ 14 C]L-leucine 10μM 의 uptake를시간-의존적으로억제하였다 (Fig. 3). 3. KB 세포에서 LAT1 sirna에의한세포성장억제 KB 세포에서 LAT1 sirna 에의한세포독성효과를조사하기위하여, 각세포에 LAT1 sirna 를도입한후 MTT assay를시행하였다. KB 세포에 4시간부터 16시간까지LAT1 sirna 60pM 을투여한결과, KB 세포의성장억제는 LAT1 sirna 처리시간에의존적임을확인할수있었다 (Fig. 4). LAT1 sirna 처리 8시간군부터통계적인의의및뚜렸한세포성장억제효과를볼수있었다 (Fig. 4). Fig. 4. The effect of LAT1 sirna on viability of KB cells. KB cells treated with 60 pm LAT1 sirna for 4~16 hours. The cell viability was determined by MTT assay. IV. 고찰 본연구에서중성아미노산수송체 LAT1 sirna 의사람구강편평세포암종 KB 세포성장에미치는영향을조사하였다. KB 세포에 LAT1 sirna 를도입한후, RT-PCR 기법을이용하여 LAT1 mrna 의발현을분석한결과, LAT1 의 mrna 발현이저해되는것을볼수있었다 (Fig. 1). Western blot 기법을이용한분석에서도 LAT1 단백질의발현이저해되는것을확인할수있었다 (Fig. 2). 본실험결과는 MDA- MB-231 사람유방암세포에서 RNAi를이용하여암세포이동에관련이있는 Hsp27 mrna의발현이저해되었다는결과 21) 와유사하였다. 따라서 KB 세포에서도중성아미노산수송에중요한 LAT1 mrna 와단백질의발현은 LAT1 sirna 절편에의해저해되었다는것을알수있었다. 한편, RNAi 의영향으로 KB 세포에서 LAT1의발현이억제됨에따라세포내중성아미노산의수송이실제억제되고있는지를확인하기위하여, 실험적으로가장많이사용되는 L-leucine 의 uptake 실험을시행하였다. KB 세포에서 L-leucine uptake는 LAT1 sirna 단편에의해통계적으로유의하게차단되었다 (Fig. 3). 본결과로서 KB 세포에서 LAT1의 sirna 에의해중성아미노산을수송하는 LAT1 단백질의발현이저해되고있다는것을확인할수있었으며, 결론적으로 LAT1의발현이저해되면세포내중성아미노산수송은억제가된다는것을확인할수있었다. RNAi 의영향으로 LAT1 mrna 와단백질의발현저해그 5
6 리고세포내중성아미노산의수송이억제되었다. 이러한세포내변화가세포성장에는어떠한영향을미치는지에대해알아보기위해 MTT assay 를시행하였다. 세포성장억제효과를위한 MTT 분석에서 LAT1 sirna 는시간의존적으로 KB 세포의성장을억제하였다 (Fig. 4). 이는시간과농도의존적으로종양세포의성장을억제시키는항암효과를지닌여러화합물들 ([6]-paradol, norcantharidin, baccatin 등 ) 에서의연구결과22-24) 와일치하는것이다. KB 세포에서는아미노산수송체 LAT1이과발현되며이를통해중성아미노산이수송되어세포성장및증식이이루어진다 26). 그러나 KB 세포에 LAT1 sirna 를도입하면, LAT1 의발현은저해가되고, 세포성장에필수적인필수아미노산을포함하는중성아미노산들의세포내고갈이유도됨으로서 KB 세포성장의억제가유도되는것으로사료된다. 결론적으로, 사람구강편평세포암종 KB 세포에서아미노산수송체 LAT1의발현저해는세포성장에필수적인 L-leucine 등중성아미노산들의세포내고갈을유도함으로서 KB 세포성장의억제를유도하는것으로사료된다. 또한본실험의결과로 LAT1의연구에 KB 세포의유용성의제시및 LAT1 억제제인 LAT1 sirna 를이용하여구강암세포의성장억제에관한또하나의방향을제시할수있을것으로사료된다. V. 결론사람구강편평세포암종 KB 세포에서아미노산수송체 LAT1 sirna 의세포성장억제에미치는효과를밝히기위하여, RT-PCR 분석, western blot 분석, uptake 분석및 MTT 분석을시행하여다음과같은결과를얻었다. 1. KB 세포에서 LAT1 sirna 는 LAT1의 mrna 와단백질의발현을저해하였다. 2. KB 세포에서 LAT1 sirna 는 L-leucine 수송을시간 -의존적으로억제시켰다. 3. KB 세포에서 LAT1 sirna 는세포성장억제를유도하였다. 4. KB 세포에서 LAT1 sirna 는세포성장에필수적인필수아미노산을포함한중성아미노산들의세포내고갈을유도함으로서세포성장억제를유도하였다. 본연구의결과로사람구강편평세포암종 KB 세포에서다 수의필수아미노산을포함한중성아미노산을수송하는 LAT1 의발현저해는 KB 세포성장의억제를유도하는것으로사료된다. 또한본실험의결과로 LAT1 sirna 를이용하여구강암세포의성장억제에관한또하나의방향을제시할수있을것으로사료된다. V. 참고문헌 1. Christensen HN. Role of amino acid transport and countertransport in nutrition and metabolism. Physiol Rev 1990; 70: Silbernagl S. Renal transport of amino acids. Klin Wochenschr. 1979; 57: Kanai Y, Segawa H, Miyamoto K, Uchino H, Takeda E, Endou H. Expression cloning and characterization of a transporter for large neutral amino acids activated by the heavy chain of 4F2 antigen (CD98). J Biol Chem 1998; 273: Yanagida O, Kanai Y, Chairoungdua A, Kim DK, Segawa H, Nii T, Cha SH, Matsuo H, Fukushima J, Fukasawa Y, Tani Y, Taketani Y, Uchino H, Kim JY, Inatomi J, Okayasu I, Miyamoto K, Takeda E, Goya T, Endou H. Human L-type amino acid transporter 1 (LAT1): characterization of function and expression in tumor cell lines. Biochim Biophys Acta 2001; 1514: Uchino H, Kanai Y, Kim do K, Wempe MF, Chairoungdua A, Morimoto E, Anders MW, Endou H. Transport of amino acid-related compounds mediated by L-type amino acid transporter 1 (LAT1): insights into the mechanisms of substrate recognition. Mol Pharmacol 2002; 61: Mastroberardino L, Spindler B, Pfeiffer R, Skelly PJ, Loffing J, Shoemaker CB, Verrey F. Amino-acid transport by heterodimers of 4F2hc/ CD98 and members of a permease family. Nature 1998; 395: Pfeiffer R, Spindler B, Loffing J, Skelly PJ, Shoemaker CB, Verrey F. Functional heterodimeric amino acid transporters lacking cysteine residues involved in disulfide bond. FEBS Lett 6
7 1998; 439: Nakamura E, Sato M, Yang H, Miyagawa F, Harasaki M, Tomita K, Matsuoka S, Noma A, Iwai K, Minato N. 4F2 (CD98) heavy chain is associated covalently with an amino acid transporter and controls intracellular trafficking and membrane topology of 4F2 heterodimer. J Biol Chem 1999; 274: Sang J, Lim YP, Panzica M, Finch P, Thompson NL. TA1, a highly conserved oncofetal complementary DNA from rat hepatoma, encodes an integral membrane protein associated with liver development, carcinogenesis, and cell activation. Cancer Res 1995; 55: Wolf DA, Wang S, Panzica MA, Bassily NH, Thompson NL. Expression of a highly conserved oncofetal gene, TA1/E16, in human colon carcinoma and other primary cancers: homology to Schistosoma mansoni amino acid permease and Caenorhabditis elegans gene products. Cancer Res 1996; 56: Kanai Y, Endou H. heterodimeric amino acid transporters: molecular biology and pharmacological relevance. Curr Drug Metab 2001; 57: Verrey F, Meier C, Rossier G, Kuhn LC. Glycoprotein-associated amino acid exchangers: broadening the range of transport specificity. Pflugers Arch 2000; 440: Pineda M, Fernandez E, Torrents D, Estevez R, Lopez C, Camps M, Lloberas J, Zorzano A, Palacin M. Identification of a membrane protein, LAT-2, that co-expressed with 4F2 heavy chain, an L-type amino acid transport activity with broad specificity for small large zwitterionic amino acids. J Biol Chem 1999; 274: Segawa H, Fukasawa Y, Miyamoto K, Takeda E, Endou H, Kanai Y. Identification and functional characterization of a Na+-independent neutral amino acid transporter with broad substrate selectivity. J Biol Chem 1999; 274: Andrew F, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double strand RNA in Caenorhabditis elegans. Nature 2000; 391: Zamore PO, Tuschl T, Sharp PA, Bartel DP. RNAi Double-stranded RNA directs the ATPase -dependent cleavage of mrna at 21 to 23 nucleotide intervals. Cell 2000; 100: Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature 2000; 404: Bernstein E, Caudy A, Hammond SM, Hannon, GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001; 409: Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Thomas T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2000;411: Kim DK, Kanai Y, Choi HW, Tangtrongsup S, Chairoungdua A, Babu E, Tachampa K. Anzai N, Iribe Y, Endou H. Characterization of the system L amino acid transporter in T24 human bladder carcinoma cells. Biochim Biophys Acta 2002: 1565: Kim DK, Yoon JH, Jeon JE, Lee SH. Expression and functional characterization of neutral amino acid transporter in Hep2 human head and neck squamous cell carcinoma. Int J Oral Biol 2004; 29: Shin KD, Lee MY, Shin DS, Lee SK, Son KH, Koh SH, Pail YK, Kwon BM, Han DC. Blocking tumor cell migration and invasion with biphenyl isoxazole derivative KRIBB3, a synthetic molecule that inhibits Hsp27. Int J Oral Biol 2005; in press. 23. Keum YS, Kim J, Lee KH, Park KK, Su고 YJ, Lee JM, Lee SS, Yoon Jh, Joo SY, Cha IH, Yook JI. Induction of apoptosis and caspase-3 activation by chemorpreventive [6]-paradol and structurally related compounds in KB cells. Cnacer Lett. 2002; 177:
8 24. Miller MC 3rd, Johnson KR, Willingham MC, Fan W. Apoptic cell death induced by baccatin III, a precursor of paclitaxel, may occur without G(2)/ M arrest. cancer cemoyher pharmacol. 1999; 44: Kok SH, Hong CY, Kuo MY, Lee CH, Lee JJ, Lou Iu, et al: Comparison of norcantharidin cytotoxic effects on oral cancer cells and normal buccal keratinocytes. Oral Oncol ;39: Yoon JH, Kim IJ, Kim H, Kim HJ, Jeong MJ, Ahn SG, Kim SA, Lee CH, Choi BK, Kim JK, Jung KY, Lee SU, Kanai Y, Endou H, Kim DK. Amino acid transport system L is differently expressed in human normal oral keratinocytes and humal oral cancer cells. Cancer Lett 2004; 222:
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information30-4.hwp
Kor J Oral Maxillofac Pathol 2006 ; 30(4) : 193202 흰쥐에서사람치아회분말과연석고매식후치유과정에서아미노산수송계 L의역할 안영재, 김수관, 윤정훈, 안상건, 김학균, 문성용, 김도경 * 조선대학교치과대학구강생물학연구소 ABSTRACT Role of Amino Acid Transport System L in the Healing
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More information슬라이드 1
LC-MS 단백질분석을위한 SDS-PAGE staining protocol 및주의할점 Proteomics Core Facility 2017.12.28 Contents LC-MS 분석의뢰용 protein SDS-PAGE staining 시주의할점 Coomassie Blue R-250 을이용한 gel staining (general protocol) Coomassie
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information<C8B2BCBABCF62DB8D4B0C5B8AEBFCDB0C7B0AD2E687770>
먹거리와 건강 황성수 인도주의실천의협의회(humandoctor.org) 황성수 의사님의 글 http://humandoctor.org/technote/main.cgi?board=whang 서적 곰탕이 건강을 말아먹는다 로도 출판되어 있음. lightworker.kr 편집 1. 이 글을 읽는 분들에게 황성수의 먹거리와 건강 을 읽는 모든 분들에게 인사드립니다.
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More informationEZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information10 (10.1) (10.2),,
Chapter 16 Precipitation Equilibria Copyright 2001 by Harcourt, Inc. All rights reserved. Requests for permission to make copies of any part of the work should be mailed to the following address: Permissions
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information특허청구의 범위 청구항 1 Na-알지네이트(Na-alginate), 합성 제올라이트(synthetic zeolite)와 분말활성탄(powdered activated carbon) 을 혼합하여 2 ~ 6 %의 CaCl 2 용액에서 경화시켜 만들어진 직경 1 ~ 5 mm의
(51) Int. Cl. (19) 대한민국특허청(KR) (12) 등록특허공보(B1) C02F 3/10 (2006.01) (21) 출원번호 10-2006-0053240 (22) 출원일자 2006년06월13일 심사청구일자 (56) 선행기술조사문헌 JP01207193 A KR1020030092674 A 2006년06월13일 (45) 공고일자 2007년10월29일
More informationChapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
More informationhwp
최종연구보고서 - 1 - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 -
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More informationChapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin
Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) Jin Hee Ahn 2008. 09. 26 한국화학연구원 KBS YTN TJB MBC 대덕 특구 기술 사업화 연구원부문 대상 2007년 12월 14일 당뇨병 치료제 개발 연구 (무병장수를 위한 신약개발연구) 생체기능조절물질개발사업단 신약연구단 화학연구원 신약연구단 글로벌 신약 글로벌 신약 전임상 후보물질의
More informationuntitled
FOR YOUR PREMIUM LIFESTYLE WINTER 2013 20 FOR YOUR PREMIUM LIFESTYLE 2013 Winter CONTENTS Wellness Beauty Living CONTENTS 2013 Winter FOR YOUR PREMIUM LIFESTYLE One for One Hyper Store [ 2074 ] 10-0394K
More information82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More informationPowerPoint 프레젠테이션
mrna (messenger RNA) : 양이가장적다 ( 전체 RNA 중 5-10% 이하 ) : mrna의염기서열은단백질의아미노산순서를지정 : 성장하는세포는수많은다른단백질을필요로함으로 mrna가만들어져단백질이합성되게한후 nucleotide가재생될수있도록분해된다 (trna, rrna도재생 ) : 5 말단의끝이 7-methyl guanosine triphosphate
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information표현의 자유
49 정보 인권과 민주주의를 위한 입법 과제 장여경* 오병일* 정민경* 1) 목 차 I. 문제 제기 1. 정보화 정책의 주요 문제점과 과제 2. 대안으로서 정보인권 II. 표현의 자유 1. 개념 2. 입법 과제 III. 프라이버시권 1. 개념 2. 입법 과제 IV. 정보문화향유권 1. 개념 2. 입법 과제 V. 정보접근권과 인터넷 망중립성 1. 개념 2. 입법
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More informationI
I II III (C B ) (C L ) (HL) Min c ij x ij f i y i i H j H i H s.t. y i 1, k K, i W k C B C L p (HL) x ij y i, i H, k K i, j W k x ij y i {0,1}, i, j H. K W k k H K i i f i i d ij i j r ij i j c ij r ij
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information특허청구의 범위 청구항 1 구제역이나 에이아이(AI) 감염에 의해 살 처분된 가축 매몰지의 붕괴나 침출수 유출에 의한 제2차 오염을 방 지하기 위한 방제방법에 있어서, 매몰지 내부에 고화제(Firming agent) 및 첨가물질이 주입되도록 통로를 형성하기 위한 천공단
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) B09B 1/00 (2006.01) C09K 17/00 (2006.01) E02D 31/00 (2006.01) (21) 출원번호 10-2011-0016170 (22) 출원일자 2011년02월23일 심사청구일자 전체 청구항 수 : 총 9 항 2011년02월23일 (11)
More informationuntitled
FOR YOUR PREMIUM LIFESTYLE CONTENTS 2014 AUTUMN FOR YOUR PREMIUM LIFESTYLE One for One [ 2074 ] 10-0394K Gift Set Business Support Tools sabn Telecom Amway TV s BEST OF NATURE. BEST OF
More informationuntitled
산업표준심의회심의 2004 12 29 F 44032004 ( ) ( ) () () () () ( ) 1966 12 23 2004 12 29 041113 ( ) ( 025097239 40). 7 5,. ICS 91.100.30 KS Reinforced spun concrete pipes F 44032004 (.) A.... KS B 5533 KS D 4 KS
More informationDV690-N_KOR_110216.indd
P/NO : MFL63266772 3 1 4 1 5 7 1 2 3 4 5 6 7 6 1 7 7 r t y u i - - - -, 7 1, 8 1 1 3 6 8 10 11 13? 12 14 15 16 17 18 a 1 b B c d e f c/v g C/V h M i Z j z k l 2 4 5 7 9 m w/s/a/d n b o p x q [ ] } r?
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More information이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월
(19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173
More informationuntitled
FOR YOUR PREMIUM LIFESTYLE SUMMER 2014 26 CONTENTS 2014 SUMMER FOR YOUR PREMIUM LIFESTYLE One for One [ 2074 ] 10-0394K Gift Set Business Support Tools sabn Telecom Amway TV TM EXACT FI T PRESSED
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More information