한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification o

Size: px

Start display at page:

Download "한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification o"

보희 장
4 years ago
Views:

1 한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification of a Sea Anemone (Cnidaria: Anthozoa: Actiniaria) Obtained in Gijang, Busan Sang Joon Yoo and Do-Hyung Kim* Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea In this study, we tried to identify a sea anemone collected from the coast of Gijang, Busan. The anemone was morphologically similar to species belonging to the genus Anthopleura, but its morphological characteristics did not allow for confirmed identification to species level. Multiple genes from mitochondrial cytochrome oxidase III, 12S and 16S rrna, and nuclear 18S and 28S rrna, were amplified for multilocus sequence typing (MLST) analysis using genomic DNA extracted from the sampled anemone and a different primer set. Based on the MLST analysis, the anemone obtained in this study was identified as Anthopleura artemisia. Also, the sequence of internal transcribed spacer-2 was most closely related to A. artemisia, indicating that this single region might be useful for anemone identification. This study shows significance of molecular identification for sea anemones, and will be helpful in studies of sea anemone identification using genotyping-by-sequencing. Key words: Sea anemone, Actiniaria, Molecular identification, Anthopleura artemisia, Multilocus sequence typing 서론 (order Actiniaria) (Cnidaria) (class Anthozoa) (Daly et al., 2008)., - (benthic-pelagic coupling) (Daly et al., 2008). 1,200 (synapomorphy) (Rodriquez et al., 2015). (column) (tentacle), (mesenteries) (Reft and Daly, 2012). (dinoflagellate) (Reft and Daly, 2012). Stephenson (1922) Endocoelantheae, Nynantheae Protantheae 3, Carlgren (1949) Ptychodactiaria 4. Nynantheae 1,100, 3 (Daly et al., 2008; 2010; Rodriguez and Daly, 2010; Rodriguez et al., 2012). Calgren (1949), (Fautin et al., 2013). (genus). (Daly et al., 2008) (Daly et al., 2010). 1962, (Anthopleura) Anthopleura japonica, A. midori, A. pacifica (Song, 1984) A. kurogane (Song, 1992),. Korean J Fish Aquat Sci 50(4) , August 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 7 June 2017; Revised 14 July 2017; Accepted 27 July 2017 *Corresponding author: Tel: Fax: address: dhkim@pknu.ac.kr Copyright 2017 The Korean Society of Fisheries and Aquatic Science 447 pissn: , eissn:

2 448 유상준ㆍ김도형,,,. (stark), (column), (pedal disk) (actinopharynx) 재료및방법 말미잘시료의채집 (N35, 15 ; E129, 14 ). 35, 18 o C, ph 8.1 (Artificial seawater, Kent, USA). Genomic DNA 의분리및 PCR Genomic DNA, (tentacle column),, ( g),, 1.5 ml DNeasy Blood and Tissue Kit (Qiagen Corporation, Santa Clarita, CA) DNA. 1 lysis Geller and Walton (2001) Rodriguez and Daly (2010; 2014). DNA (Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014) (mtdna) Cytochrome oxidase III (COIII), 12S rrna (12S) 16S rrna (16S) (nrdna) 18S rrna (18S) 28S rrna (28S). MyCycler (Bio-rad, Hercules, CA) PCR. internal transcribed spacer-2 (ITS2) PCR. primer PCR Table 1. PCR 1 µl 1% Mpid-2 plus (Takara, Japan) 25 AccuPrep TM PCR Purification Kit (Bioneer, Korea) Table 1. Primer sets and PCR conditions used in this study Set No Target region Cytochrome oxidase III (mtdna) 12S rrna (mtdna) 16S rrna (mtdna) Internal transcribed spacer-2 (nrdna) 18S rrna (nrdna) 28S rrna (nrdna) Marker Sequence (5ˊ-3ˊ) Cycling Profile Reference COIII-F COIII-R ANTMT12S-F ANTMT12S-R ANEM16SA ANEM16SB CATTTAGTTGATCCTAG- GCCTTGACC (95 C for 2 m) CAAACCACATCTACAAAAT- GCCAATATC AGCCACACTTTCACTGAAA- CAAGG GTTCCCYYWCYCTYACYAT- GTTACGAC CACTGACCGTGATAATG- TAGCGT CCCCATGGTAGCTTTTATTCG [(95 C for 30 s)(46 C for 45s)(72 C for 1 m)] x 30 (95 C for 4 m) [(94 C for 30 s)(50 C for 1 m)(72 C for 2 m)] x 4 [(94 C for 30 s)(55 C for 1 m)(72 C for 2 m)] x 30 (95 C for 2 m) [(95 C for 30 s)(60 C for 30s)(72 C for 1 m)] x 30 itsd GTGAATTGCAGAACTCCGTG (95 C for 7 m) (94 C for 45 s)(52 C for 45 s) (72 C for 45 s) x 35 ITS-2rev2 CCTCCGCTTACTTATATGCTT ss5 ss3z GGTGATCCTGCCAGTAGT- CATATGCTTG (95 C for 2 m) AGCACTGCGTCAGTCG- GAATATTCACCGG LSU D1-D2 fw1 AGCGGAGGAAAAGAAACTA (95 C for 5 m) LSU D1-D2 rev1 TACTAGAAGGTTCGATTAGTC [(95 C for 1 m)(54 C for 1 m)(72 C for 2 m)] x 30 [(94 C for 30 s)(45 C for 1 m)(65 C for 12 m)] x 30 (72 C for 10 m) Geller and Walton, 2001 Chen et al., 2002 Geller and Walton, 2001 Stat et al., 2009 Pochon and Ruth, 2010 Rowan et and Powers, 1991 Geller and Walton, 2001 Sonnenberg et al, 2007

, 2004)을 이용하여 동일한 크기로 정렬(alignment)하였다(Table 2). 각 유전자의 길이는 Table 2 (Parsimony informative characters)에 나타내었다.

3 449 말미잘의 분자생물학적 동정 을 이용하여 정제 하였으며, ABI Prism 3730 xl DNA Analyzer (PE Applied Biosystems, USA)를 사용하여 sequencing을 실 시 하였다. 염기서열 수집 및 분석 현재 데이터베이스에 있는 것과 이번 연구에서 나온 염기서 열을 분석하기 NCBI 데이터베이스로부터 5개 유전자(COIII, 12S, 16S, 18S 및 28S) 염기서열이 모두 존재하는 44개의 속 을 대표하는 각 종의 염기서열을 수집하였으며(Table 2), 이를 MUSCLE 프로그램(Robert et al., 2004)을 이용하여 동일한 크기로 정렬(alignment)하였다(Table 2). 각 유전자의 길이는 Table 2 (Parsimony informative characters)에 나타내었다. 본 연구에서 얻어진 염기서열을 포함하여 45종의 각 유전자 염기 서열을 MEGA 7을 이용하여 결합하였으며(concatenated sequence), Kimura 2-parameter로 1,000번의 bootstrap value를 샘플링을 하여 계통수(Neighbor-Joining tree)를 작성하였다. Table 2. Results of parsimony analysis of each data set and concatenated sequence Marker or data set Marker # Parsimony un-aligned Informative Characters (% informative) length COIII (mtdna) (91.11%) 12S rrna (mtdna) (88.13%) 16S rrna (mtdna) (98.25%) 18S rrna (nuclear) (94.67%) 28S rrna (nuclear) (74.75%) concatenated sequence (5 target genes) (88.37%) 결과 및 고찰 본 연구의 채집 말미잘은 조간대에서 부착 생활을 하기 위해 발판(pedal disc)이 잘 발달 했으며, 무게 6.6 g과 지름 2.2 cm의 크기(Fig. 1)로 촉수 주변으로 소낭(marginal spherules)이 관 찰 되었다. 또한 몸통(column) 상부 쪽으로부터 수직 열로 발 달 된 돌기(stark)가 도드라졌으며, 5줄의 원형으로 배치된 촉수 는 가장 안쪽의 원에서 촉수 2개씩, 12쌍으로 구성되어 육방산 호아강(Hexacorallia)의 특징을 잘 나타내었다. 형태와 서식지 로 볼 때, 국내 해변에서 흔하게 발견되는 꽃해변말미잘류(Anthopleura)로 판단되었다. 특히 형광 녹색을 띄는 몸체와 돌기 의 색은 Song (1984; 1992)에 의해 보고 된 풀색꽃해변말미잘 (Anthopleura midori)의 특징을 나타내었으나, 촉수가 자색으 로 기존 보고된 풀색해변꽃말미잘과는 차이가 있었다. 이러한 형태학적 특징은 국내 미 보고 종인 Anthopleura artemisia 와도 매우 유사하여 한 종으로 특정할 수는 없었다. 1958년 Uchida 와 Muramatsu (1958)에 의해 명명된 A. midori는 현재 World register of marine species (WoRMS, 등재되어 있지 않고 synonym으로 A. anjunae Den Hartog and Vennam (1993)라는 종명이 수용되고 있는 것 을 확인할 수 있다. 그러나 현재 NCBI에는 A. anjunae의 염기 서열은 없고 모두 A. midori의 것만 등재되어 있어 본 연구에서 도 이 종의 염기서열을 비교하는데 사용하였다. 일반적으로 말미잘의 4개 아목(suborder)의 분류 기준은 각 아목의 형태학적으로 특징이 이용되어 왔다. 예를 들어 장막 섬모(Mesenteric filament)의 경우 아목, Endocoelantheae와 Nynantheae에 특징적으로 존재하지만, Protantheae와 Ptychodacteae에는 없다. 또한 장막의 특이적인 배열은 Endocoelantheae와 Ptychodacteae에서만 보이는 특징이다(Calgren et 1cm Fig. 1. Sea anemone Anthopleura artemisia used in this study.

4 450 유상준ㆍ김도형 al., 1949). 1,100 Nynantheae. Rodriguez et al. (2014) Calgren Nynantheae. sequencing mtdna COIII, 12S 16S nrdna 18S 28S Identity. 5 Anthopleura Actinia Identity ( 93% 89%) (Fig. 2). NCBI Anthopleura 21, 4 (mtdna COIII, 12S, 16S nrdna 18S) 6 (A. artemisia, A. handi, A. elegantissima, A. rosea, A. kurogane, A. midori), Identity 99%, 97%, 97%, 97%, 95% 95% A. artemisia. ITS2 (342 bp) Anthopleura artemisia, Anthopleura atodi, Anthopleura rosea Anthopleura handi 99, 83, 83 92% Identity, 5 A. artemisia Identity. Pochon et al. (2001) ITS2. ITS2,. Stoletzki and Schierwater (2005) ITS2, Condylactis gigantea C. aurantiaca ITS2. ITS2, 5 Anthopleura artemisia Anthopleura. NCBI ITS2 Anthopleura 4 (A. artemisia, A. atodi, A. rosea Hormathia armata Antholoba achates Kadosactis Antarctica Phellia gausapata Calliactis parasitica Actinoscyphia plebeian Andvakia boninensis Amphianthus spp. Actinauge richardi Cereus pedunculatu Bathyphellia australis Haloclava product Hormosoma scotti Stomphia didemon Stomphia selaginella Nematostella vectensis Edwardsia japonica Edwardsia elegans Alvinactis chessi Edwardsia timida Antipodactis awii Diadumene cincta Haliplanella ineata Metridium senile Sagartia troglodytes Cactosoma spp. Anthosactis pearseae Sagartiogeton aceratus Verrillactis paguri Aiptasia pulchella Bartholomea annulata Paranthus niveus Epiactis lisbethae Bunodactis verrucosa Dactylanthus antarcticus Bunodosoma grandis Anthopleura elegantissima Actinia fragacea Stichodactyla gigantea Heteractis magnifica Macrodactyla doreenensis Urticina coriacea Isosicyonis striata Metedwardsia akkeshi Sea anemone sampled in this study Fig. 2. Parsimony tree of concatenated sequences (mitochondrial COIII, 12S and 16S, and nuclear 18S, and 28S rrna gene) obtained in this study. Species epithets are given only for genera represented by more than one species. Bootstrap values more than 50 are shown.

5 말미잘의분자생물학적동정 451 A. handi). (Daly et al., 2008)., (Daly et al., 2008)., (e.g., Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014). 12S, 16S COIII 18S 28S 5,. Eernisse and Kluge (1993) 5, (e.g., Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014). cytochrome subunit I gene (COI) (interspecific variability) (Shearer et al., 2002; Flot et al., 2013). Keshavmurthy et al. (2013) COI, Stylophora. (Flot et al., 2008). (genus level).. A. artemisia.,., 18S rdna (Gilan et al, 2015)..,. 5 house-keeping gene Anthopleura NCBI A. artemisia. Song (1984; 1992) (Anthopleura midori), WoRMS, A. artemisia.. 사사 (2015 ). References Carlgren O A survey of the Ptychodactiaria, Corallimorpharia and Actiniaria. Almqvist Wiksells boktr 1, Chen CA, Wallace CC and Wolstenholme J Analysis of the mitochondrial 12S rrna gene supports a two-clade hypothesis of the evolutionary history of scleractinian corals. Mol Phylogenet Evol 23, Daly M, Chaudhuri A, Gusmao L and Rodriguez E Phylogenetic relationships among sea anemones (Cnidaria: Anthozoa: Actiniaria). Mol Phylogenet Evol 48, Daly M, Gusmao LC, Reft AJ and Rodriguez E Phylogenetic signal in mitochondrial and nuclear markers in sea anemones. Integrat Comparat Biol 50, /icb/icq081. Flot JF, Licuanan WY, Nakano Y, Payri C, Cruaud C and Tillier S Mitochondrial sequences of Seriatopora corals show little agreement with morphology and reveal the duplication of a trna gene near the control region. Coral Reefs 27, Flot JF, Dahl M and André C Lophelia pertusa corals from the Ionian and Barents seas share identical nuclear ITS2 and near-identical mitochondrial genome sequences. BMC Res Notes 6, Geller JB and Walton ED Breaking up and getting together: evolution of symbiosis and cloning by fission in sea anemones (genus Anthopleura). Evolution 55, doi.org/ / (2001)055[1781:buagte]2.0.co;2. Gilan AF, Pegah J and Arash S Morphology and phylogeny of the sea anemone Stichodactyla haddoni (Cnidaria: Anthozoa: Actiniaria) from Chabahar Bay. Turk J Zool 39, Hellberg and Michael E No variation and low syn-

6 452 유상준ㆍ김도형 onymous substitution rates in coral mtdna despite high nuclear variation. BMC Evol Biol 6, / Keshavmurthy S, Yang S, Alamaru A, Chuang Y, Pichon M, Obura D, Fontana S, De Palmas S, Stefani F, Benzoni F, MacDonald A, Noreen AME, Chen C, Wallace CC, Pillay RM, Denis V, Amri AY, Reimer JD, Mezaki T, Sheppard C, Loya Y, Abelson A, Mohammed MS, Baker AC, Mostafavi PG, Suharsono BA and Chen CA DNA barcoding reveals the coral laboratory-rat, Stylophora pistillata encompasses multiple identities. Sci Rep 3, org/ /srep Pochon X, Pawlowski J, Zaninetti L and Rowan R High genetic diversity and relative specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid foraminiferans. Mar Biol 139, s Pochon X and Ruth DG A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai i. Mol phylogenet evol 56, Reft A and Daly M Morphology, distribution, and evolution of apical structure of nematocysts in Hexacorallia. J Morphol 273, Rodriguez E and Daly M Phylogenetic relationships among deep-sea and chemosynthetic sea anemones: Actinoscyphiidae and Actinostolidae (Actiniaria: Mesomyaria). PLoS ONE 5, e Rodriguez E, Barbeitos M, Daly M, Gusmao LC and Haussermann V Toward a natural classification: phylogeny of acontiate sea anemones (Cnidaria, Anthozoa, Actiniaria). Cladistics 1, x. Rodriguez, E, Barbeitos MS, Brugler MR, Crowley LM, Grajales A, Gusmao L and Daly M Hidden among sea anemones: the first comprehensive phylogenetic reconstruction of the order Actiniaria (Cnidaria, Anthozoa, and Hexacorallia) reveals a novel group of hexacorals. PLoS One 9, e96998, Rowan R and Powers DA A molecular genetic classification of zooxanthellae and the evolution of animal-algal symbioses. Science 251, Shearer TL, Van OSL, Romano G and Wörheide Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Mol Ecol 11, j x x. Song JI A systematic study on the Korean Anthozoa 8. Actiniaria (Hexacorallia). J Korean Res Instit Better Liv 34, 69. Song JI Systematic study on Anthozoa from the Korea Strait in Korea: subclasses Zoantharia and Ceriantipatharia. Anim Syst Evol Divers 8, Sonnenberg, Rainer, Arne WN and Diethard T An evaluation of LSU rdna D1-D2 sequences for their use in species identification. Front zool 4, 6. Stat M, Pochon X, Cowie R and Gates RD Specificity in communities of Symbiodinium in corals from Johnston Atoll. Mar Ecol Prog Ser 386, org/ /meps Stephenson TA On the classification of Actiniaria. Part III. Definitions connected with the forms dealt with in Part II. Q J Microscop Sci 66, Stoletzki N and Schierwater B Genetic and color morph differentiation in the Caribbean sea anemone Condylactis gigantea. Mar Biol 147, s y.

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory