96 남윤권ㆍ이상윤ㆍ김은정,,, (Fernandes et al., 8; Ahi et al., 13).. (Acipenser species) (Actinopterygii) (Birstein et al., 1997). (Teleostei) (holoblastic cleav
|
|
- 용선 미
- 5 years ago
- Views:
Transcription
1 한수지 51(1), 95-16, 18 Note Korean J Fish Aquat Sci 51(1),95-16,18 러시아철갑상어 (Acipenser gueldenstaedtii) 발생시료의 RT-qPCR 분석을위한내재대조군유전자의선정 남윤권 * 이상윤 김은정 부경대학교해양바이오신소재학과 Evaluation of Candidate Housekeeping Genes for the Normalization of RT-qPCR Analysis using Developing Embryos and Prolarvae in Russian Sturgeon Acipenser gueldenstaedtii Yoon Kwon Nam*, Sang Yoon Lee and Eun Jeong Kim Department of Marine Bio-Materials and Aquaculture, Pukyong National University, Busan 48513, Korea To evaluate appropriate reference genes for the normalization of quantitative reverse transcription PCR (RT-qPCR) data with embryonic and larval samples from Russian sturgeon Acipenser gueldenstaedtii, the expression stability of eight candidate housekeeping genes, including beta-actin (ACTB), elongation factor-1a (EF1A), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), histone 2A (H2A), ribosomal protein L5 (RPL5), ribosomal protein L7 (RPL7), succinate dehydrogenase (SDHA), and ubiquitin-conjugating enzyme E2 (UBE2A), were tested using embryonic samples from 12 developmental stages and larval samples from 11 ontogenic stages. Based on the stability rankings from three statistic software packages, genorm, NormFinder, and BestKeeper, the expression stability of the embryonic subset was ranked as UBE2A>H2A>SDHA>GAPDH>RPL5>EF1A>ACTB>RPL7. On the other hand, the ranking in the larval subset was determined as UBE2A>GAPDH>SDHA>RPL5>RPL7>H2A>EF1A>AC TB. When the two subsets were combined, the overall ranking was UBE2A>SDHA>H2A>RPL5>GAPDH>EF1A> ACTB>RPL7. Taken together, our data suggest that UBE2A and SDHA are recommended as suitable references for developmental and ontogenic samples of this sturgeon species, whereas traditional housekeepers such as ACTB and GAPDH may not be suitable candidates. Key words: Russian sturgeon, Acipenser gueldenstaedtii, RT-qPCR assay, normalization control, reference genes 서론 PCR (quantitative reverse transcription-pcr; RT-qPCR),. RNA (template) (reference gene) (normalization) (Udvardi et al., 8)., (housekeeping gene) (Bustin et al., 9).,, RTqPCR (Taylor et al., 13; Yuan et al., 14; Lee and Nam, 16)., (Jaramillo et al., 17). Korean J Fish Aquat Sci 51(1) 95-16, February 18 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 5 January 18; Revised 24 January 18; Accepted 25 January 18 *Corresponding author: Tel: Fax: address: yoonknam@pknu.ac.kr Copyright 18 The Korean Society of Fisheries and Aquatic Science 95 pissn: , eissn:
2 96 남윤권ㆍ이상윤ㆍ김은정,,, (Fernandes et al., 8; Ahi et al., 13).. (Acipenser species) (Actinopterygii) (Birstein et al., 1997). (Teleostei) (holoblastic cleavage), ( ), (blastomeres). (pronephros) (Bolker, 1993; Cooper and Virta, 7; Park et al., 13a).,, (swimming behavior), (rheotaxis), (phototaxis) (Gisbert and Williot, 1997; Gisbert and Ruban, 3; Park et al., 13b).,. (Acipenser gueldenstaedtii), RT-qPCR. 재료및방법 실험어류, 인공수정및발생시료확보 2. luteinizing hormone-releasing hormone analog (LHRH-a; Sigma-Aldrich, St. Louis, MO, USA) 8 g/kg, g/kg, ( 24-3 ), 24 3 (Park and Chapman, 5) 1:1. 1, 1:1 mating. Fuller s earth (Dettlaff et al., 1993), 12. ( h post fertilization; HPF), 1 (2.2 HPF), 5-6 (7.5 HPF), (9.2 HPF), ( HPF), 7% (28.5 HPF), (33.5 HPF), (4 HPF), (56 HPF), (73.5 HPF), (95 HPF), (1 HPF) , (-8 )., (19 ) (1 m 2 m.3 m; W D H) ( 8 ) (Artemia nauplii) 11 (1 day post hatching; 1 DPH 11 DPH ) 후보유전자및프라이머디자인 1 next generation sequencing (NGS) ( transcriptome ). 1, 8. 8 beta-cytoskeletal actin (ACTB), elongation factor-1 alpha (EF1A), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), histone 2A (H2A), ribosomal protein L5 (RPL5), ribosomal protein L7 (RPL7), succinate dehydrogenase (SDHA) ubiquitin conjugating enzyme E2 (UBE2A), RT-qPCR primer
3 러시아철갑상어발생시료의 RT-qPCR 분석용내재대조군유전자 97 RT-PCR RT-PCR. ( mers), G+C content (45-6%), melting temperature (55-65 ) (15- bp) 2-3 primer PCR (PCR efficiency; E). PCR (E) cdna Light Cycler 48 realtime PCR system, 94% PCR. PCR 1.5% (agarose gel) (ethidium-bromide; Et-Br). Table 1. RNA 분리, cdna 합성및 RT-qPCR 분석 TriPure Reagent (Roche Applied Science) 1 total RNA RNeasy Plus Mini Kit (Qiagen Hilden, Germany), DNA RNase-Free DNase. total RNA MOPS-formaldehyde gel 28S rrna 18S rrna. Total RNA Libar S7 (Biochrom Ltd., UK) (26 nm/28 nm 26 nm/23 nm) Total RNA cdna RNA 2 g oligo-d(t) primer ( mers; Bioneer, Korea) random primer (random nonamers; Takara Bio Inc., Japan) (reverse transcription), omniscript RT kit (Qiagen). nanodrop 1 (Thermo Fisher Scientific, USA), DNase free water 4, cdna 2 L qpcr. PCR light cycler 48 System (Roche Applied Science) SYBR green I master (roche applied science) 95, , melting curve. cdna 3. 유전자발현안정성평가 2 33 ( ) Table 1. Summarized information on the housekeeping gene candidates and qpcr assay primers used in the present study Gene Description Accession no. Primers (5 -to-3 ) Amplicon size (bp) PCR efficiency (%) ACTB Beta-cytoskeletal actin KR EF1A Elongation factor-1 alpha KR GAPDH Glyceraldehyde 3-phosphate dehydrogenase MG H2A Histone 2A KP RPL5 Ribosomal protein L5 MG72283 RPL7 Ribosomal protein L7 MG SDHA Succinate dehydrogenase MG UBE2A Ubiquitin conjugating enzyme E2 MG TCCCTGGAGAAGAGCTATGA ACAGGTCCTTACGGATGTCA ACAACATGCTGGAGACCAGT CGATACCGCCAATCTTGTAG GGCTAAGCGTGTCATCATCT GTCATGAGACCCTCAACGAT CTCGTGCTAAGGCAAAGACT CAGGATTTCAGCAGTCAGGT AAGGAGTTCAACGCAGAGGT ATAGCAGCATGAGCCTTGGT TCAGACTTCGCCAGATCTTC CAGAGGAATACGCTGCTTGT GGAGTTTGTGCAGTTCCATC ACAACATCTCGAGAGGCAAG CTCTTCCTCGCATCATAAGG CCCAGGTATGGTACATTTGC
4 98 남윤권ㆍ이상윤ㆍ김은정 3 (biological replication) 198 cdna (template), cdna 3 qpcr (technical replication) 594 quantification cycle (raw Cq data). cdna (technical replication) (median Cq),. genorm, NormFinder BestKeeper., genorm stability value (M; cutoff=1.5) pairwise (V; cutoff=.15), M (Hellemans et al., 7). NormFinder PCR efficiency Cq (relative quantity) (Andersen et al., 4), BestKeeper coefficient of determination Cq (geometric mean) P (Pfaffl et al., 4). (embryonic subset), (larval subset). 결과 qpcr 의 Cq 데이터패턴 PCR % PCR (Schmittgen and Livak, 8; Doak and Zaïr, 12), melting curve (data not shown). (embryonic subset) 8 Cq, ACTB.1 (mean) Cq ( =.34), 7 EF1A 39.7 Cq ( =39.35). H2A RPL7 4 (GAPDH, RPL5, SDHA UBE2A). Cq, H2A Cq, UBE2 SDHA. EF1A Cq (Fig. 1). (larval subset) Cq, Cq value Cq value Cq value Embryonic subset ACTB EF1A GAPDH H2A RPL5 RPL7 SDHA UBE2A Larval subset ACTB EF1A GAPDH H2A RPL5 RPL7 SDHA UBE2A Total ACTB EF1A GAPDH H2A RPL5 RPL7 SDHA UBE2A Fig. 1. Expression profiles (Cq values) of eight housekeeping gene candidates in embryonic and larval subsets, and also in combined set. In the box plot, the lower and upper boundaries of each box indicate the 25 th and 75 th percentiles, respectively. Whiskers above and below the box are the 9 th and 1 th percentiles, respectively. A black line within the box indicates the median value. The red line indicated by arrow head within the box is the mean value. ACTB, beta-cytoskeletal actin; EF1A, elongation factor-1 alpha; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H2A, histone 2A; RPL5, ribosomal protein L5; RPL7, ribosomal protein L7SDHA, succinate dehydrogenase; SDHA, succinate dehydrogenase; UBE2A, Ubiquitin conjugating enzyme E2.
5 러시아철갑상어발생시료의 RT-qPCR 분석용내재대조군유전자 99 (Cq ). Cq ( Cq ) GAPDH, RPL7 ACTB, H2A Cq. ACTB ( =16.3) RPL7 ( =16.4), GAPDH ( =18.51) EF1A ( =35.56). Cq, ACTB, EF1A, GAPDH RPL7, H2A (Fig. 1). (subsets) Cq, 8 ACTB RPL7, EF1A., GAPDH Cq RPL7, EF1A, ACTB, RPL5, H2A (Fig. 1). 발생배에서의유전자발현안정성평가 3, 3. genorm SDHA UBE2A, ACTB RPL7. NormFinder GAPDH RPL5 1 2 genorm ACTB RPL Best- Keeper H2A UBE2, RPL7 EF1A. 3, UBE2A (geomean of ranking value; GRV 2.) H2A (GRV=2.29), ACTB (GRV=6.84) RPL7 (GRV=7.). GRV 8 UBE2>H2A >SDHA>GAPDH>RPL5>EF1A>ACTB>RPL7 (Fig. 2). 자어발달과정에서의유전자발현안정성평가 11, genorm NormFinder,, BestKeeper. genorm SDHA UBE2A M ( ) RPL7 ACTB. genorm SDHA/UBE2A>EF1A>H2A>RPL5>GAPDH>RPL7 >ACTB. NormFinder RPL5>GAPDH>H2A>SD HA>UBE2>EF1A>RPL7>ACTB, 1 2, 4 5. BestKeeper RPL7 GAPDH, 7 4. H2A 5. BestKeeper RPL7> GAPDH>UBE2A>ACTB>H2A>SDHA>EF1A>RPL5. GRV UBE2A (GRV=2.47)>GAPDH>S DHA>RPL5>RPL7>H2A>EF1A>ACTB (GRV=6.35) (Fig. 3). 전체시료 ( 발생배및자어발달 ) 에서의유전자발현안정성평가 11. genorm, SDHA/UBE2A, ACTB RPL7 (SDHA/UBE2A>EF1A>H2A>RPL5>GAPDH>RPL7>A CTB). NormFinder GAPDH RPL5, genorm RPL7 ACTB (GAPDH>RPL5>SDHA>U BE2A>H2A>EF1A>RPL7>ACTB). BestKeeper H2A 2 3 UBE2A
6 1 남윤권ㆍ이상윤ㆍ김은정 genorm 25 NormFinder Stability value (M) Stability value SDHA UBE2A EF1A H2A RPL5 GAPDH RPL7 ACTB GAPDH RPL5 H2A UBE2A SDHA EF1A RPL7 ACTB Most stable Least stable Most stable Least stable SD [±Cq] BestKeeper Geomean of ranking value H2A UBE2A SDHA GAPDH ACTB RPL5 RPL7 EF1A. UBE2A H2A SDHA GAPDH RPL5 EF1A ACTB RPL7 Most stable Least stable Most stable Least stable Fig. 2. Expression stability rankings of eight housekeeping genes in embryonic subset as addressed by genorm, NormFinder and Best- Keeper programs. The overall ranking of each gene based on the geomean of ranking values from the three software programs are also provided. ACTB, beta-cytoskeletal actin; EF1A, elongation factor-1 alpha; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H2A, histone 2A; RPL5, ribosomal protein L5; RPL7, ribosomal protein L7SDHA, succinate dehydrogenase; SDHA, succinate dehydrogenase; UBE2A, Ubiquitin conjugating enzyme E2. (H2A>UBE2A>SDHA>RPL5>ACTB>EF1 A>RPL7>GAPDH). GRV UBE2A (GRV=2.)>SDHA (2.8)>H2A (2.71)>RPL5 (3.42)>GAPDH (3.63)>EF1A (4.76)>ACTB (6.84)>RPL7 (7.) UBE2A SDHA, ACTB RPL7 (Fig. 4). 고찰 8 (ACTB), (EF1A), (GAPDH), (chromatin) (H2A), (RPL5 RPL7), (SDHA), (UBE2A) Cq,. Cq (Cq ). GAPDH, RPL7 EF1A, (Dettlaff et al., 1993; Park et al., 13b). ACTB (organ differentiation) (larval
7 러시아철갑상어발생시료의 RT-qPCR 분석용내재대조군유전자 Stability value (M) genorm Stability value NormFinder SDHA UBE2A EF1A H2A RPL5 GAPDH RPL7 ACTB RPL5 GAPDH H2A SDHA UBE2A EF1A RPL7 ACTB Most stable Least stable Most stable Least stable SD [±Cq] BestKeeper Geomean of ranking value RPL7 GAPDHUBE2A ACTB H2A SDHA EF1A RPL5. UBE2A GAPDH SDHA RPL5 RPL7 H2A EF1A ACTB Most stable Least stable Most stable Least stable Fig. 3. Expression stability rankings of eight housekeeping genes in larval subset as addressed by genorm, NormFinder and BestKeeper programs. The overall ranking of each gene based on the geomean of ranking values from the three software programs are also provided. ACTB, beta-cytoskeletal actin; EF1A, elongation factor-1 alpha; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H2A, histone 2A; RPL5, ribosomal protein L5; RPL7, ribosomal protein L7SDHA, succinate dehydrogenase; SDHA, succinate dehydrogenase; UBE2A, Ubiquitin conjugating enzyme E2. morphogenesis) ACTB (Reece et al., 1992; Reisler and Egelman 7)., H2A Cq,. H2A, oligo-dt random 7 random priming cdna, Cq (López and Samuelsson, 8). UBE2A H2A ACTB RPL7, Cq profile. UBE2A H2A ACTB RPL7. Cq ACTB RPL7 (onset of neurulation) ( 8 ), 7-9. (embryonic body) (pronephros), (head), (somite) (S-heart)
8 12 남윤권ㆍ이상윤ㆍ김은정 6 5 genorm 14 1 NormFinder Stability value (M) 4 3 Stability value SDHA UBE2A EF1A H2A RPL5 GAPDH RPL7 ACTB GAPDH RPL5 SDHA UBE2A H2A EF1A RPL7 ACTB Most stable Least stable Most stable Least stable BestKeeper SD [±Cq] Geomean of ranking value H2A UBE2A SDHA RPL5 ACTB EF1A RPL7 GAPDH. UBE2A SDHA H2A RPL5 GAPDH EF1A ACTB RPL7 Most stable Least stable Most stable Least stable Fig. 4. Expression stability rankings of eight housekeeping genes in the combined dataset including both embryonic and larval subsets. Stability ranking of each gene in genorm, NormFinder and BestKeeper programs were used to calculate geomean of ranking values. ACTB, beta-cytoskeletal actin; EF1A, elongation factor-1 alpha; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H2A, histone 2A; RPL5, ribosomal protein L5; RPL7, ribosomal protein L7SDHA, succinate dehydrogenase; SDHA, succinate dehydrogenase; UBE2A, Ubiquitin conjugating enzyme E2. (Dettlaff et al., 1993; Park et al., 13a),,, ACTB RPL7. EF1A, RPL5, GAPDH, ACTB RPL7., ( ) RT-qPCR,, (glycolysis) UBE2A H2A. GRV, UBE2A. UBE2A GAPDH SDHA (GRV=2.88 ),,, (Park et al., 13b). RPL5, RPL7 H2A GRV ( ), RPL5 RPL7, GRV
9 러시아철갑상어발생시료의 RT-qPCR 분석용내재대조군유전자 13. H2A Cq,. ACTB EF1A ACTB. 4 DPH 5 DPH 8-9 DPH., 4-5 DPH, 8-9 DPH pigment plug (, ) (Dettlaff et al., 1993).. Cq, UBE2A (genorm 1, NormFinder 4 BestKeeper 2 ). UBE2A Arctic charr Salvelinus alpinus (Ahi et al., 13) Atlantic halibut Hippoglossus hippoglossus (zygotic transcription ) (Øvergård et al., 1),. UBE2A SDHA genorm 1, NormFinder 3, BestKeeper 3 UBE2A. GRV 3 H2A, H2A BestKeeper. SDHA H2A,.,, (Souza et al., 13; Luchsinger et al., 14; Yan et al., 14; Omondi et al., 15; Steinhauser et al., 17)., (RPL5/7, EF1A, GAPDH, ACTB), GAPDH,., RT-qPCR ACTB, GAPDH RPL.,. ACTB,., Arctic charr S. alpinus (Ahi et al., 13) Atlantic halibut H. hippoglossus (Fernandes et al., 8) ACTB, European seabass Dicentrarchus labrax (Mitter et al., 9), Senegalese sole Solea senegalensis (Infante et al., 8), Atlantic halibut (Infante et al., 8) ACTB. GAPDH RT-qPCR, GAPDH (Fernandes et al., 8; Infante et al., 8; Mitter et al., 9; García-Fernández et al., 16)., 2 GAPDH paralogs isoform (Cho et al., 8; Kim and Nam, 8; Lee et al., 13), GAPDH isoform, GAPDH paralog isoform (Infante et al., 8). RPL5 RPL7 (Zhang and Hu, 7; Lόpez-Landavery et al. 14; Lee and Nam,
10 14 남윤권ㆍ이상윤ㆍ김은정 16),. Atlantic halibut ribosomal protein S4 (RPS4), ribosomal protein L13 (RPL13), RPL7, RPL7 (Øvergård et al., 1)., RPL7,,., RT-qPCR ACTB, GAPDH RPL, UBE2A SDHA. H2A ( ) GAPDH ( ).. 사사 (16).. References Ahi EP, Guðbrandsson J, Kapralova KH, Franzdóttir SR, Snorrason SS, Maier VH and Jónsson ZO. 13. Validation of reference genes for expression studies during craniofacial development in Arctic charr. PLoS One 8, e doi.org/1.1371/journal.pone Andersen CL, Jensen JL and Ørntoft TF. 4. Normalization of real-time quantitative reverse transcription-pcr data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64, org/1.1158/ can Birstein VJ, Hanner R and DeSalle R Phylogeny of the Acipenseriformes: cytogenetic and molecular approaches. Environ Biol Fishes 48, org/1.123/a: Bolker JA The mechanism of gastrulation in the white sturgeon. J Exp Zool 266, jez Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J and Wittwer CT. 9. The MIQE guidelines: minimum information for publication of quantitative realtime PCR experiments. Clin Chem 55, org/1.1373/clinchem Cho YS, Lee SY, Kim KH and Nam YK. 8. Differential modulations of two glyceraldehyde 3-phosphate dehydrogenase mrnas in response to bacterial and viral challenges in a marine teleost Oplegnathus fasciatus (Perciformes). Fish Shellfish Immunol 25, fsi Cooper MS and Virta VC. 7. Evolution of gastrulation in the rayfinned (Actinopterygian) fishes. J Exp Zool B Mol Dev Evol 38, Dettlaff TA, Ginsburg AS and Schmalhausen OI Sturgeon Fishes- Developmental Biology and Aquaculture. Springer- Verlag, Berlin Heidelberg, Germany, Doak SH and Zair Z. 12. Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis. In: Genetic toxicology: principles and methods, methods in molecular biology. Parry JM and Parry EM, eds. Springer, New York, U.S.A., org/1.17/ _13. Fernandes JMO, Mommens M, Hagen Ø, Babiak I and Solberg C. 8. Selection of suitable reference genes for realtime PCR studies of Atlantic halibut development. Comp Biochem Physiol B 15, cbpb García-Fernández P, Castellanos-Martínez S, Iglesias J, Otero JJ and Gestal C. 16. Selection of reliable reference genes for RT-qPCR studies in Octopus vulgaris paralarvae during development and immune-stimulation. J Invert Pathol 138, Gisbert E and Ruban GI. 3. Ontogenic behavior of Siberian sturgeon, Acipenser baerii: a synthesis between laboratory tests and field data. Environ Biol Fishes 67, doi.org/1.123/a: Gisbert E and Williot P Larval behaviour and effect of the timing of initial feeding on growth and survival of Siberian sturgeon (Acipenser baerii) larvae under small scale hatchery production. Aquaculture 156, org/1.116/s (97)86-. Hellemans J, Mortier G, De Paepe A, Speleman F and Vandesompele J. 7. qbase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 8, R19. doi.org/1.1186/gb r19. Infante C, Matsuoka MP, Asensio E, Cañavate JP, Reith M and Manchado M. 8. Selection of housekeeping genes for gene expression studies in larvae from flatfish using real-time
11 러시아철갑상어발생시료의 RT-qPCR 분석용내재대조군유전자 15 PCR. BMC Mol Biol 9, Jaramillo ML, Ammar D, Quispe RL, Guzman F, Margis R, Mazari EM and Müller YMR. 17. Identification and evaluation of reference genes for expression studies by RT-qPCR during embryonic development of the emerging model organism, Macrobrachium olfersii. Gene 598, Kim KY and Nam YK. 8. Evolutionary history of two paralogous glyceraldehyde 3-phosphate dehydrogenase genes in teleosts. J Fish Sci Tech 11, org/1.5657/fas Lee SY, Kim DS and Nam YK. 13. Genomic organization, tissue distribution and developmental expression of glyceraldehyde 3-phosphate dehydrogenase isoforms in mud loach Misgurnus mizolepis. Fish Aquat Sci 16, Lee SY and Nam YK. 16. Evaluation of reference genes for RT-qPCR study in abalone Haliotis discus hannai during heavy metal overload stress. Fish Aquat Sci 19, doi.org/1.1186/s z. López MD and Samuelsson T. 8. Early evolution of histone mrna 3 end processing. Bioinformatics 14, doi.org/1.1261/rna Luchsinger C, Arias ME, Vargas T, Paredes M, Sánchez R and Felmer R. 14. Stability of reference genes for normalization of reverse transcription quantitative real-time PCR (RTqPCR) data in bovine blastocysts produced by IVF, ICSI and SCNT. Zygote 22, S Lόpez-Landavery EA, Portillo-Lόpez A, Gallardo-Escárate C and Río-Portilla MAD. 14. Selection of reference genes as internal controls for gene expression in tissues of red abalone Haliotis rufescens (Mollusca, Vetigastropoda; Swainson, 1822). Gene 549, gene Mitter K, Kotoulas G, Magoulas A, Mulero V, Sepulcre P, Figueras A, Novoa B and Sarropoulou E. 9. Evaluation of candidate reference genes for QPCR during ontogenesis and of immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp Biochem Physiol B 153, Omondi BA, Latorre-Estivalis JM, Oliveira IHR, Ignell R and Lorenzo MG. 15. Evaluation of reference genes for insect olfaction studies. Parasit Vectors 22, org/1.1186/s x. Øvergård AC, Nerland AH and Patel S. 1. Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes. BMC Mol Biol 11, doi.org/1.1186/ Park CH and Chapman FA. 5. An extender solution for the short-term storage of sturgeon semen. North Am J Aquacult 67, Park CH, Lee SY, Kim DS and Nam YK. 13a. Embryonic development of Siberian sturgeon Acipenser baerii under hatchery conditions: an image guide with embryological descriptions. Fish Aquat Sci 16, org/1.5657/fas Park CH, Lee SY, Kim DS and Nam YK. 13b. Effects of incubation temperature on egg development, hatching and pigment plug evacuation in farmed Siberian sturgeon Acipenser baerii. Fish Aquat Sci 16, FAS Pfaffl MW, Tichopad A, Prgomet C and Neuvians TP. 4. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: Best- Keeper Excel-based tool using pair-wise correlations. Biotechnol Lett 26, B:BILE Reece KS, McElroy D and Wu R Function and evolution of actins. Evol Biol 26, _1. Reisler E and Egelman EH. 7. Actin structure and function: what we still do not understand. J Biol Chem 282, Schmittgen TD and Livak KJ. 8. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3, Souza AFD, Brum IS, Neto BS, Berger M and Branchini G. 13. Reference gene for primary culture of prostate cancer cells. Mol Biol Rep 4, s Steinhauser CB, Wing TT, Gao H, Li X, Burghardt RC, Wu G, Bazer FW and Johnson GA. 17. Identification of appropriate reference genes for qpcr analyses of placental expression of SLC7A3 and induction of SLC5A1 in porcine endometrium. Placenta 52, placenta Taylor DA, Thompson EL, Nair SV and Raftos DA. 13. Differential effects of metal contamination on the transcript expression of immune- and stress-response genes in the Sydney rock oyster, Saccostrea glomerata. Environ Pollut 178, Udvardi MK, Czechowski T and Scheible WR. 8. Eleven golden rules of quantitative RT-PCR. Plant Cell, Yan X, Dong X, Zhang W, Yin H, Xiao H, Chen P and Ma XF. 14. Reference gene selection for quantitative real-time PCR normalization in Reaumuria soongorica. PLoS One 12, e Yuan M, Lu Y, Zhu X, Wan H, Shakeel M, Zhan S, Jin BR and Li J. 14. Selection and evaluation of potential reference
12 16 남윤권ㆍ이상윤ㆍ김은정 genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) using reverse transcription quantitative PCR. PLoS One 9, e Zhang Z and Hu J. 7. Development and validation of endogenous reference genes for expression profiling of medaka (Oryzias latipes) exposed to endocrine disrupting chemicals by quantitative real-time RT-PCR. Toxicol Sci 95,
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationISO17025.PDF
ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (
More information........
Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationSMARTer Sequencing Kits for Next Generation Sequencing
Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information<28C3D6C1BE29312DC0CCBDC2BEC62E687770>
한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information16-기06 환경하중237~246p
Study on Jointing System of Airport Concrete Pavement Considering Environmental Loading The environmental load on concrete pavement can be categorized into temperature and moisture loads which include
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: (LiD) - - * Way to
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.353-376 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.353 (LiD) -- * Way to Integrate Curriculum-Lesson-Evaluation using Learning-in-Depth
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationÀ±½Â¿í Ãâ·Â
Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
More informationBSC Discussion 1
Copyright 2006 by Human Consulting Group INC. All Rights Reserved. No Part of This Publication May Be Reproduced, Stored in a Retrieval System, or Transmitted in Any Form or by Any Means Electronic, Mechanical,
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 18, No. 11 : 2593~2599 Nov. 2014 오픈소스 모바일 UI컴포넌트 선정 절차 프레임워크 손효정 1 이민규 2 성백민
More information2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2
(Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More informationⅠ. Introduction 우리들을 둘러싸고 잇는 생활 환경속에는 무수히 많은 색들이 있습니다. 색은 구매의욕이나 기호, 식욕 등의 감각을 좌우하는 것은 물론 나뭇잎의 변색에서 초목의 건강상태를 알며 물질의 판단에 이르기까지 광범위하고도 큰 역할을 하고 있습니다. 하
색 이론과 색채관리 Ⅰ. Introduction( 일반색채 이론) Ⅱ. 색의 표현 ⅰ) 색상 ⅱ) 명도 ⅲ) 채도 ⅳ) 색의 종류 ⅴ) 색의 삼원색 ⅵ) 색의 사원색 Ⅲ. 색의 전달 ⅰ) 변천과정 ⅱ) Color space Ⅳ. 색의 재현 ⅰ) 가법 혼합 ⅱ) 감법 혼합 ⅲ) C.C.M System Ⅴ. 색의 관리 ⅰ) 목적 ⅱ) 적용범위 ⅲ) 색차계 ⅳ)
More information슬라이드 1
IT Driving Your Business Innovation-Accelerating ILM Driving Your Business Innovation-Accelerating ILM I. I (Social Responsibility Chain) () (),,.. 3 I 4 I.. - -,. - -.. - - 5 I Enron: ranked 6th in 02
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information보고서_pdf로.hwp
9:30-10:00 10:00-10:10 INTRODUCTION 10:10-11:40 ISSUES IN DIETARY ASSESSMENT IN COHORT STUDIES Alan Kristal (Fred Hutchinson Cancer Research Center, U.S.A.) Developing adiet questionnaire for alarge cohort
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>
양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator
More informationA 001~A 036
4 3 2 0 8 91 0 1 2 3 4 5 6 08 09 00 01 02 03 04 18 19 10 29 20 22 23 39 30 31 32 33 48 49 40 41 59 50 69 1 2 3 4 1 2 3 4 1 4 7 10 13 1 2 3 4 5 6 rev. C C r C a f h f h L h h nrpm f h f n L C 3 P L
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More informationITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot
2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library
More informationHigh Resolution Disparity Map Generation Using TOF Depth Camera In this paper, we propose a high-resolution disparity map generation method using a lo
High Resolution Disparity Map Generation Using TOF Depth Camera In this paper, we propose a high-resolution disparity map generation method using a low-resolution Time-Of- Flight (TOF) depth camera and
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information레이아웃 1
Disability & Employment 11. 8. 제1권 제호(통권 7호) pp.97~118 중증장애인직업재활지원사업수행시설의 효율성비교* 양숙미 남서울대학교 사회복지학과 부교수 전동일 가톨릭대학교 박사과정 요 약 본 연구는 직업재활시설의 중증장애인 직업재활지원사업에 대한 효율성을 평가하여 효 율적인 운영방안을 제시하는데 목적이 있다. 본 연구를 위해
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a
조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형
More information제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상
6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김
More information160106_STEPI_Insight_179호(정기철,김석관_외)rp.hwp
2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 2015. 12. 1. 제179호 개인 유전체 기반 맞춤 의료 현황과 발전과제 정기철 김석관 김승현 이명화 목 차 < 요 약 > Ⅰ. 개인 유전체 기반 맞춤 의료 7 Ⅱ. 맞 춤 의료 기 술 현 황과 시 사 점 10 Ⅲ. 맞춤 의료 조직 및 비즈니스모델 현황과 시사점 16 Ⅳ.
More informationPCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error
TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More information03신경숙내지작업
57~82 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 A Study on the Educational Use of Dolmen Construction Technology Kyung-sug Shin (Research Centre of Dolmens in Northeast Asia)
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information03.Agile.key
CSE4006 Software Engineering Agile Development Scott Uk-Jin Lee Division of Computer Science, College of Computing Hanyang University ERICA Campus 1 st Semester 2018 Background of Agile SW Development
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *
, 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information