저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우, 이저작물에적용된이용허락조건을명확하게나타내어야합니다. 저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다. 이것은이용허락규약 (Legal Code) 을이해하기쉽게요약한것입니다. Disclaimer
약학석사학위논문 Let-7 family 에의한 간성상세포활성화의조절 Let-7 family as Regulator of Hepatic Stellate Cell Activation 2015 년 2 월 서울대학교대학원 약학대학약물학전공 최영진
국문초록 Let-7 family 에의한간성상세포활성화의조절 간성상세포의활성화는간섬유화발생에중요한역할을한다. 간성상세포는 Transforming Growth Factor beta (TGF-β) 와 Tumor Necrosis Factor alpha, Insulin-like Growth Factor-1, Platelet Activating Factor 등과같은신호전달물질에의해활성화가촉진된다. 본연구는 Let-7 family microrna 가간성상세포의세포표면수용체발현을억제하고결과적으로간성상세포활성화를억제함을보고자하였다. 중증의간섬유화환자의간에서경증의환자에비하여 Let-7 family, 특히 Let-7a 와 Let-7f 의발현이유의적으로감소하였으며, 콜라겐면적으로대표되는섬유화의진행지표와이들 Let-7 family 의발현이역상관계로나타났다. 또한 CCl 4 처치로유도한간섬유화동물의간에서 Let-7 family 의발현이감소해있음을관찰하였다. 동물에서간세포와간성상세포를분리하여 Let-7 family 의기저발현을비교한결과, Let-7 family 는간세포보다주로간성상세포에서높게발현되어있음을확인하였다. Let-7 family 의잠재적표적단백질인표면수용체들또한간세포보다간성상세포에서더많이발현되었다. 추가적으로, 간에서분리한일차간성상세포를 12일간배양하여활성화시킬경우 Let-7 family 의발현이감소하였다. 인간유래의간성상세포주인 LX-2 와간세포주인 HepG2 를사용하여 Let-7 family 의기저발현을비교하였을때에도동물의간에서분리한일차간성상세포와간세포를비교한결과와유사하게 LX-2 세포에서더높은 Let-7 family 발현이관찰되었다. LX-2 세포에 Let-7a 를형질주입하고 TGF-β 를가했을때, TGF-β 에의해유도된표면수용체의발현이 Let-7a 에감소하였으며, 이때간성상세포활성화지표인 PAI1 또한감소되었다. TGF-β 신호전달체계의매 1
개단백질인 smad2/3의인산화역시 Let-7a 에의해억제되는것으로나타났다. 간성상세포활성화시 Let-7 family 가감소하는조절기전을밝히기위해 Let-7 family 의 maturation 을억제하는 Lin28B 의발현에대한탐구를추가적으로수행하였다. 배양활성화한일차간성상세포에서흥미롭게도 Lin28B 의발현이증가해있었다. 종합적으로, 본연구는간성상세포에주로발현되는세포표면수용체를제어할수있는 mirna 인 Let-7 family 의발견과, 그 Let-7 family 의간성상세포활성화억제에대한기전연구이다. Let-7 family 는표면수용체의발현을조절하여 smad2/3, NF- B 및 MAPK 로대표되는간성상세포활성화신호를억제하였으며, 이는간섬유화의치료적메커니즘으로활용될수있다. 주요어 : 간섬유화, 간성상세포, mirna, Let-7 family, 세포표면수용체, Transforming growth factor beta receptor 1, Platelet activating factor receptor 학번 : 2013-21619 이름 : 최영진 2
목차 List of Abbreviations 4 List of Figures 5 I. 서론 6 II. 실험재료및방법 8 1. 시약및항체...8 2. 생물정보학적분석...8 3. 일차세포의분리...9 4. 실험세포주배양...9 5. 실시간역전사중합효소연쇄반응법... 10 6. mirna 의실시간역전사중합효소연쇄반응법... 11 7. 리포터유전자분석법... 11 8. 세포분획의분리... 12 9. 면역화학적분석법... 12 10. 통계처리... 13 III. 실험결과 14 VI. 결론및고찰 34 V. 참고문헌 37 ABSTRACT 40 3
List of Abbreviations αsma ECM GF HSC IGF1R PAF PAFR PAI-1 TGF- Alpha smooth muscle actin Extracellular matrix Growth factor Hepatic stellate cell Insulin-like growth factor-1 receptor Platelet activating factor Platelet activating factor receptor Platelet-derived growth factor-1 Transforming growth factor-beta TGF- R1 Transforming growth factor-beta receptor 1 4
List of Figures Figure 1. Identification of mirna targeting cell surface membrane receptors Figure 2. Let-7 expression in hepatocyte and HSC Figure 3. Cell surface membrane receptor expression in hepatic stellate cell as putative targets of Let-7 family and their direct inhibition by Let-7 Figure 4. Role of Let-7 in TGF- -mediated hepatic stellate cell activation Figure 5. TGF- signaling pathway inhibition by Let-7 Figure 6. Inhibition of PAF-mediated hepatic stellate cell activation and signaling pathway by Let-7 Figure 7. Let-7 maturation inhibition by Lin28B during stellate cell activation 5
I. 서론 간성상세포는세포외기질 (Extracellular matrix, ECM) 단백질을생성하여간섬유화의진행에중요한역할을한다. 여러리간드들이각각의친화성높고특이적인세포표면수용체에결합하여간성상세포의생리를조절한다 (Chen et al, 2012). 현재까지활성화된간성상세포에서여러종류의세포표면수용체의유도와발현이입증되었다 (Scott L. Friedman, 2008). 이세포표면수용체들은리간드의종류에따라나눠지는데리간드의종류는크게성장인자 (Growth factor) 그리고싸이토카인 (Cytokine), 지질 (lipid mediator), 세포외기질로나누어진다. 이런각기다른종류의수용체들은특이적인신호전달체계를통해간성상세포를활성화시킨다 (Coulouarn et al, 2012). 그예로 transforming growth factor beta(tgf- ) 에의한 smad 신호의활성화와 interleukin-6에의한 STAT3신호활성화그리고 platelet derived growth factor에의한 MAPK/ERK 신호의활성화를들수있다 (Lee et al, 2011). MicroRNAs (mirnas) 는 mrna의 3 -비번역부위에상보적으로결합함으로써유전자발현을전사후과정에서조절하는작은비암호화 RNA이다. mirna 발현의조절장애는지방증, 간염그리고간섬유화를포함한간질환의중요한병인으로작용할수있다 (Wang et al, 2012). 특히간성상세포에서 mirna의이상발현은간섬유화기전의하나일수있다. 몇몇 mirna들은세포외기질의구성요소들을표적으로하여제어하는것으로알려져있다 (Christoph Roderburg et al, 2011). 그럼에도불구하고간성상세포활성화에관여하는세포표면수용체를표적으로하는 mirnas에대해서는더자세한연구가필요하다. 더욱이, 간성상세포의활성화에관여하는각기다른종류의세포표면수용체를동시에표적하여억제하는 6
mirnas 에대한것은알려진바가없다. mirnas 를이용하여간성상세포의내인 성제어시스템을회복하는것은간섬유화의회복에있어긍정적으로작용할것이 다. 본연구에서는여러종류의세포표면수용체를동시에표적하고억제하는 mirna를규명하고수용체의억제가간성상세포의활성화와간섬유화에끼치는영향을알고자한다. 생물정보학적분석방법을통해여러종류의세포표면수용체를동시에표적하는 mirna들을찾았다. 그중에서 Let-7 family는가장많은수요세포표면수용체를표적으로가지고있었다. 더나아가, 간성상세포의활성화시 Let-7 family의발현이감소되는것을관찰하였고동시에간성상세포활성화수용체의발현이증가하는것도관찰되었다. Let-7 family와간성상세포활성화수용체발현간의관계를규명하기위하여우리는여러간성상세포활성화모델을실험에사용하였다. 특히, Platelet activating factor receptor(pafr) 와 TGF- receptor I 과 Let-7 family간의관계에중점을두어실험을진행하였다. 7
II. 실험재료및방법 1. 시약및항체 Anti-platelet-activating factor receptor (PAFR), anti-transforming growth factor, beta receptor 1 (TGF- R1), anti-insulin-like growth factor 1 (IGFR1), anti-phospho Smad2, anti-phospho Smad3, anit-smad 2/3, anti-p38, antiphospho p38, anti-erk, anti-phospho ERK 그리고 anti-pai1 항체는 Cell Signaling Technology (Beverly, MA) 에서구입하였다. NK- B 항체는 Santa Cruz Biotechnology (Santa Cruz, CA) 와 R&D systems (Minneapolis, MN) 에서각각제공되었다. Horseradish peroxidase-conjugated goat anti-rabbit 과 goat antimouse IgGs 는 Zymed Laboratories (San Francisco, CA) 에서구입하였다. Human recombinant TGF-β1는 HumanZyme (Chicago, US) 에서구매하였으며 anti- -actin antibody, PAF 그리고 other reagents 는 Sigma (St. Louis, MO) 에서구입하였다. 2. 생물정보학적분석 세포표면수용체를표적으로할것으로추정되는 mirna는 TargetScan database (http://targetscan.org) 에의해선정되었다. mirna와표적간의유전자상호작용네트워크는 GeneMANIA (http://genemania.org) 에의해얻었으며 Cytoscape software에의해시각화되었다 8
3. 일차세포의분리 일차간세포와간성상세포는과거사용되었던방법에의해흰쥐에서분리하였다 (Choi IJ et al, 2010). 일차세포는 10% fetal bovine serum, 50 U/ml penicillin, and 50 µg/ml streptomycin 을포함하는 Dulbecco's modified Eagle's medium (DMEM) 에서 37 C, 5% CO 2 조건하에배양되었다. 일차세포는분리후 6-well plate 에서 7일동안배양되었다. 순도높은간성상세포 (>95%) 를얻기위해서는간으로의관류가중요하며배양시간성상세포는완전히활성화되었다. 4. 실험세포주배양 인간간성상세포주인 LX-2 세포는 Dr. S. L. Friedmann (Mount Sinai School of Medicine, NY) 으로부터제공받았다. LX-2 세포는 10% fetal bovine serum (FBS), 1% L-glutamine, 50 units/ ml penicillin 및 50 μg / ml streptomycin 이함유된 Dulbecco s modified Eagle s medium (DMEM) 에서 37 C 및 5% CO2 조건하에약 80%-90% 의 confluency 를갖도록배양하였다. 흰쥐에서간성상세포를분리하여 10% fetal bovine serum (FBS), 50 units/ ml penicillin 및 50 μg / ml streptomycin 이함유된 Dulbecco s modified Eagle s medium (DMEM) 에서 37 C 및 5% CO 2 조건하에약 80%-90% 의 confluency 를갖도록배양하였다. HepG2 세포주는 American Type Culture Collection (Rockville, MD, USA) 에서구입하였다. HepG2 세포는 10% Fetal Bovine Serum, 10mM HEPES, 50 units/ml penicillin 및 50 g/ml streptomycin 이함유된 Dulbecco s modified Eagle s medium 에서배양하였다. 9
5. 실시간역전사중합효소연쇄반응법 총 RNA는 Trizol (Invitrogen, Carlsbad, CA) 을사용하여제조사의권장방법 에따라추출하였다. 추출한 total RNA (2ug) 와 d(t)16 primer 및 AMV 역전사효 소 (reverse transcriptase) 를사용하여 cdna를합성하였다. 유전자들의상대적인 양은 SYBR Premix Ex Taq (Takara, Shiga, Japan) 과 Applied Biosystems (Foster City, CA) 의 StepOne Software v2.1을이용하여제조사의지시된방법 에 따라 Real-time RT-PCR을 수행하였다. 각 유전자는 β-actin과 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 의상대적인값으로보정 하였다. DNA 증폭에사용된 primer는다음과같다 : rat GAPDH1 (sense: 5 - TCCCTCAAGATTGTCAGCAA-3, antisense: 5 - AGATCCACAACGGATACATT-3 ); human PTAFR (sense: 5 - CTGCCCTTCTCGTAATGCTC -3, antisense: 5 - CCTGAGCTCCCCGAGAACTCA-3 ); human TGFBR1 (sense: 5 - ACGGCGTTACAGTGTTTCTG-3, antisense: 5 - GCACATACAAACGGCCTATCT-3 ); human IGF1R (sense: 5 - AGGATATTGGGCTTTACAACCTG-3, antisense: 5 - GGCTTATTCCCCACAATGTAGTT -3 ); rat Lin28a (sense: 5 - CCCGGTGGACGTCTTTGTG-3, antisense: 5 - CACTGCCTCACCCTCCTTGA- 3 ); rat Lin28b (sense: 5 - GGATCAGATGTGGACTGTGAGAGA-3, antisense: 5 - GGAGGTAGACCGCATTCTTTAGC-3 ); and human PAI1 (sense: 5 - TCGTCCAGCGGGATCTGA-3, antisense: 5 -CCTGGTCATGTTGCCTTTC-3 ); pri-let-7a (sense: 5 -GATTCCTTTTCACCATTCACCCTGGATGTT-3, 10
antisense: 5 -TTTCTATCAGACCGCCTGGATGCAGACTTT-3 ); 6. mirna 의실시간역전사중합효소연쇄반응법 세포에서추출한총 RNA (2 g) 와 miscript reverse transcription kit (Qiagen GmbH, Hilden, Germany) 를이용하여 cdna를얻었다. Precursor mirna와 mature mirna 발현량은 miscript SYBR GREEN PCR kit kit (Qiagen GmbH, Hilden, Germany) 를이용해제조사의지시된방법에따라수행하였고, 결과값은 U6의상대적인값으로보정하였다. 증폭된산물의특이성은 melting curve 분석을통하여확인하였다. DNA 증폭에사용된 primer는다음과같다 : Let-7a (5 - TGAGGTAGTAGGTTGTATAGTT -3 ); Let-7b (5 - TGAGGTAGTAGGTTGTGTGGTT -3 ); Let-7c (5 - TGATAGTAGTTGTATGGTT-3 ); Let-7d (5 AGAGGTAGTAGGTTGCATAGTT -3 ); Let-7f (5 - TGAGGTAGTAGATTGTATAGTT -3 ); Let-7g (5 - TGAGGTAGTAGTTTGTACAGTT-3 ). 7. 리포터유전자분석법 리포터유전자분석을위해 Luciferase reporter assay system을사용하였다. LX-2 세포 (1 10 6 ) 를 12 well plate에서 24시간동안배양하였다. 그후세포에 1μg의 Luc-PTAFR-3 UTR (Product ID: HmiT015524-MT01, GeneCopoeia) 와 Luc-TGFBR1 a fragment-3 UTR (Product ID: HmiT018051-MT01, GeneCopoeia), Luc-TGFBR1 b fragment-3 UTR (Product ID: HmiT018051- MT01, GeneCopoeia) 와 mir-let7a mimics또는 control mimics를 48시간동안 11
형질전환하였다. 형질전환된세포는 1% 혈청을포함한 Eagle s minimum essential medium 에서 24 시간동안배양했다. 루시퍼레이즈의활성은 dual luciferase assay kit (GeneCopoeia) 를이용하여측정하였다. 8. 세포분획의분리 배양세포의배지를제거한후 PBS 로세척하고세포를긁어모아 3000 g 에서 3 분간원심분리하였다. 상등액을제거한후단백질분해효소억제제를첨가한용해완충액 [10 mm Tris (ph 7.1), 100 mm NaCl, 1 mm EDTA, 10% glycerol, 0.5% Triton X-100, 0.5% Nonidet P-40, 1 mm dithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride] 을가하여 1 시간동안얼음위에서완전히용해한후 10,000 g 에서 10 분간원심분리하여얻은상등액을전세포추출액으로사용하였다. 단백질농도는 Bradford 정량법 (Bio-Rad protein assay kit, Bio-Rad, Hercules, CA) 을이용하여정량하였다. 9. 면역화학적분석법 획득한세포단백질을 Mighty Small II SE 250 장치 (Hoefer, Inc., San Francisco, CA) 를이용하여 sodium dodecyl sulfate-polyacrylamide gel electrophoresis 방법으로분리하였다. 시료를시료의석완충액 [63mM Tris (ph 6.8), 10% glycerol, 2% SDS, 5% mercaptoethanol, 0.0013% bromophenolblue] 에희석하여 6%, 7.5%, 9%, 12% 의젤을사용하여전기완충액 (0.12M Tris, 0.96M glycine, 0.5% SDS) 내에서전기영동하였다. 전기영동이끝난젤은전기영 12
동전달장치를이용하여전이완충액 (25mM Tris, 192mM glycine, 20% v/v methanol, ph 8.3) 내에서 190mA로 1시간동안 nitrocellulose 지에단백질을전이시켰다. 관찰하려는단백질에대한 1차항체와반응시킨후이어서 Horseraddish peroxidase (HRP) 와결합되어있는 2차항체와 1시간반응시키고 ECL chemiluminescence 시스템 (Amersham Bioscience, Buckinghamshire, UK) 을이용하여발색하였다. 10. 통계처리 One-way analysis of variance (ANOVA) 를이용하여분석하였다. 통계적으로 유의성이있는그룹에대해서는 two-tailed Student s t-test 로그룹간평균을비 교하였다. 통계적유의성은 p<0.05 또는 p<0.01 을기준으로분석하였다. 13
III. 실험결과 1. 세포표면수용체를표적하는 mirna 의규명 간성상세포의표면에는다양한종류의세포표면수용체가존재한다 (Scott L. Friedman, 2008). TargetScan (Whitehead Institute for Biological Research, Cambridge, MA) 을통한생물정보학적분석방법을이용하여간성상세포활성화를촉진하는세포표면수용체를표적하는 mirna를검색하였다. 3개이상의세포표면수용체를동시에표적하는 mirna 들로 Let-7 family 와 mir-130, mir-19, mir-30, mir-128을발견하였다 (Fig. 1A). 이중에서 Let-7 family 가가장많은 9 개의세포표면수용체를표적으로가지고있었다. 이들수용체는리간드의종류에따라 growth factor, cytokine, lipid, extracellular matrix 로구분되는 4개의그룹으로분류할수있으며, 이들을조절하는 mirna 와의상관성을네트워킹을통해도식화하였다. 특히 Let-7 family 는모든그룹의표적들을하나이상포함하는것으로확인되었다 (Fig. 1B). 14
Figure 1. Identification of mirna Targeting Cell surface membrane receptors (a) Top 5 mirnas targeting 3 or more HSC activating receptors were sorted by TargetScan 15
database (http://targetscan.org). (b) 9 different HSC activating receptors targeted by Let-7 family. 9 receptors targeted by Let-7 family were classified in to 4 different groups based on the receptor-activating ligands as shown in networks. Gene interaction network between the mirnas and targets was achieved by GeneMANIA (http://genemania.org) and visualized by Cytoscape software. 16
2. 간성상세포와간세포에서 Let-7 family 의발현 예비연구를통해중증의간섬유화환자의간에서 Let-7 family 가감소하는현상을관찰하였다 (data not shown). 이는간전체를분석한것이므로간을구성하는어떤세포에서 Let-7 family의발현이감소했는지분석해볼필요가있었다. 흰쥐의간에서분리한일차간성상세포와간세포에서 Let-7 family의발현을실시간역전사중합효소연쇄반응법을통해분석하였다. 흥미롭게도 Let-7 family 의발현은일차간세포보다일차간성상세포에서현저하게높게나타나는것을관찰할수있었다 (Fig. 1A). 인간유래의세포에서도적용되는지확인위하여인간간성상세포주와간세포주인 LX-2 와 HepG2 를이용하였다. 그결과인간세포주를이용한분석에서도일차세포를분석한것과유사한결과를얻을수있었다 (Fig. 1B). 흰쥐의일차간성상세포를 12일동안배양하여활성화시킨결과, 활성화되었을때 Let-7a 의발현이감소되는것을관찰하였으며간성상세포의활성화지표인 SMA 는활성화시증가하였다 (Fig. 1C). 17
Figure 2. Let-7 family expression in hepatocyte and hepatic stellate cell (A) Comparison between the levels of Let-7 family and mir-122 in primary hepatocyte and primary HSCs. Let-7a,b,c were significantly higher in primary HSC. Isolated primary HSCs were cultured for 1 day as well as primary hepatocyte. mirna levels were determined using qrt-pcr assays. Values represent the mean±standard error of mean (significantly different as 18
compared with control mirna treated group *P<0.05, **P<0.01). (B) Comparison between the levels of Let-7 family and mir-122 in human hepatocyte cell line HepG2 and human HSC cell line LX-2. All Let-7 family mirna levels were significantly higher in LX-2 cell line. The cells were harvested after 1 day of incubation. mirna levels were determined using qrt-pcr assays. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). (C) Comparison of Let-7a mirna levels between 0 day culture-activated primary HSCs and 12 day culture-activated primary HSCs. Let-7a mirna level was significantly decreased in 12 day culture-activated primary HSCs. Primary HSCs were culture-activated respectively for 0 day and 12 days. mrna levels were determined using qrt-pcr assays. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). 19
3. 간성상세포에서 Let-7 family 표적세포표면수용체의발현 TargetScan (Whitehead Institute for Biological Research, Cambridge, MA) 을사용한생물정보학적분석을통해 Let-7 family 는 9개의세포표면수용체를표적하고있다고추정되었다. 추정된표적들중가장많은 conserved site 를가지며 Let-7 family 와잘결합할것이라고추측되는세포표면수용체유전자는 PTAFR 와 TGFBR1, IGF1R 였다 (Fig. 3A). 12일동안배양하여활성화시킨흰쥐의일차간성상세포에서상기세포표면수용체의 mrna 발현증가를관찰하였다 (Fig. 3B) Let-7 family 가 PTAFR 과 TGFBR1 의 3 UTR 부분에직접적으로부착하여이들의 mrna 전사후발현을억제하는지관찰하기위해 PTAFR 3 UTR 벡터, TGFBRI 3 UTR 벡터와 Let-7a mimics를각각동시형질주입한후 3 UTR luciferase assay 를실시하였다. Let-7a mimics와 3 UTR 벡터는 48시간동안동시에인간간성상세포주인 LX-2에형질주입되었다. PTAFR 3 UTR 벡터의 luciferase 활성은 Let-7a에의해 40% 억제되었고 TGFBRI 3 UTR 벡터의 luciferase 활성은각각의 fragment 에서 20% 씩감소하였다 (Fig. 3C). 이는 Let- 7 family 가 PTAFR 과 TGFBR1 에직접적으로부착하여억제함을의미한다. 20
Figure 3. Cell surface membrane receptor expression in hepatic stellate cell as putative targets of Let-7 family and their direct inhibition by Let-7 (A) The putative mirnas which target the putative cell surface membrane receptor candidates and their conserved sites in hepatic stellate cell were extracted from TargetScan database (http://targetscan.org). (B) PTAFR, TGFBR1 and IGF1R genes are selected among the targets since they showed most affinity of conserved site. mrna level of these three cell surface receptor expression was analyzed in quiescent rat primary HSCs 12 day culture activated rat primary HSCs by qrt-pcr. (C) Conserved site in PTAFR 3 UTR and TGFBRI 3 UTR for Let-7 family were shown respectively. PTAFR 3 UTR has 2 8mer conserved sites and 1 7mer-m8 conserved site. TGFBRI 3 UTR has 1 8mer conserved sites and 1 7mer-1A conserved site. Luciferase activity was significantly(p<0.05) inhibited by Let-7a(10nM, 48hours) and PTAFR 3 UTR vector(1μg, 21
48hour) co-transfection. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). Luciferase activity was significantly(p<0.05) inhibited by Let-7a(10nM, 48hours) with TGFBRI a 3 UTR vector or TGFBRI b(1μg, 48hour) co-transfection. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). 22
23
4. TGF- 에의한간성상세포활성화에서 Let-7 의역할 TGF- 와같은간성상세포를활성화시키는리간드의처치는세포표면수용체의발현을증가시키며수용체에의한신호전달을활성화한다. 간성상세포에서 Let-7 family 의역할을탐구하기위해인간간성상세포주인 LX- 2에 Let-7a mimcis 를 48시간동안형질주입하였다. TGF- 처치는 LX-2 세포에서세포표면수용체의발현을증가시켰다. 그러나 Let-7a mimics 는 TGF- 처치한군과대조군모두에서세포표면수용체의발현을억제하였다 (Fig. 4A). 반대로, LX-2 세포에대한 Let-7a antisense oligonucleotide (ASO) 형질주입은세포표면수용체의발현을증가시켰다 (Fig. 4B). 그러나 Let-7a mimics 와 ASO 를형질주입한실험군모두대조군과비교하였을때세포표면수용체의 mrna 변화는나타나지않았다 (Fig. 4A,B).. 24
Figure 4. Role of Let-7 in TGF- -mediated hepatic stellate cell activation (a) Western blotting for Let-7a targeted receptors (PAFR, TGFβRI and IGF1R) was performed. LX-2 cells were transfected with control mirna or Let-7a mimics for 48hours prior to TGFβ(5ng/ml) treatment for 3 hours. mrna levels of Let-7a targeted receptors (PAFR, TGFβRI and 25
IGF1R) were determined using qrt-pcr. LX-2 cells were transfected with control mirna or Let-7a mimics for 48hours prior to TGF-β(5ng/ml) treatment for 3 hours. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). (b) Western blot assay for Let-7a targeted receptors (PAFR, TGFβRI and IGF1R) was performed. LX-2 cells were transfected with control-aso or Let-7a ASO for 48hours prior to TGF-β(5ng/ml) treatment for 3 hours. mrna levels of Let-7a targeted receptors (PAFR, TGFβRI and IGF1R) were determined using qrt-pcr. LX-2 cells were transfected with control-aso or Let-7a ASO for 48hours prior to TGF-β(5ng/ml) treatment for 3 hours. Values represent the mean±standard error of mean (significantly different as compared with control ASO treated group *P<0.05, **P<0.01). 26
5. Let-7 에의한 TGF- 신호전달의억제 활성화된 TGF- RI 는 smad2/3 의인산화를통하여신호를전달한다. Let-7a mimics형질주입에의해세포표면수용체의발현이억제되었으므로그하위신호전달체계를연구하는것이필요하다. LX-2 세포에 Let-7a mimics를형질주입한후 TGF- 를 3시간처치를하였다. TGF- 의처치는 smad2/3 의현저한인산화를유도하였으나 Let-7a mimics는 TGF- RI 의발현억제를통하여 smad2/3의인산화를막았다 (Fig. 5A). 반대로 Let-7a ASO 형질주입은 TGF- RI 의발현증가를통하여인산화된 smad2/3 를증가시켰다 (Fig. 5B). TGF- 의처치는간성상세포활성화지표인 PAI1의 mrna 발현을증가시켰다. 이때 Let-7a mimics는 PAI1의 mrna 발현을감소시켰고 Let-7a ASO 는 PAI1 mrna 의발현을증가시켰다 (Fig. 5A,B). 27
Figure 5. TGF- signaling pathway inhibition by let-7 (a) Western blot assay for TGF-β signaling (smad2/3, p-smad2, p-smad3) was performed. LX-2 cells were transfected with control mirna or Let-7a mimics for 48hours prior to TGF-β(5ng/ml) treatment for 3 hours. PAI-1 mrna level was determined using qrt-pcr. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). (B) Western blot assay for TGF-β signaling (smad2/3, p-smad2, p-smad3) and HSC activating 28
marker PAI-1 was performed. LX-2 cells were transfected with control-aso or Let-7a ASO for 48hours prior to TGF-β(5ng/ml) treatment for 3 hours. PAI-1 mrna level was determined using qrt-pcr. Values represent the mean±standard error of mean (significantly different as compared with control ASO treated group *P<0.05, **P<0.01). 29
6. Let-7에의한 PAF-mediated 간성상세포활성화와 PAF 신호전달의억제활성화된 PAFR 은 ERK 와 p38의인산화를통하여신호전달을하며 NF- B 의발현을증가시켰다. PAF 처치는세포표면수용체의발현의증가를유도하였다. 그러나 PAFR 의발현은 Let-7에의해억제되므로 PAF 에의한세포표면수용체의발현증가역시 Let-7에의해억제되었다 (Fig. 6A). 더욱이 PAFR 발현의감소는 PAF 신호전달단백질인 ERK 와 p38의발현과인산화를억제하였다. PAF 의처치는 NF- B 의발현을증가시키나이역시 Let-7에의해억제되었다 (Fig. 6B). 30
Figure 6. Inhibition of PAF medicated hepatic stellate cell activation and signaling pathway by Let-7a (a) Western blot assay for Let-7a targeted receptors (PAFR, TGFβRI and IGF1R) and HSC activation marker PAI1 is performed. LX-2 cells were transfected with control mirna or Let- 7a mimics for 48hours prior to PAF (10nM) treatment with 5% BSA for 3 hours. PAF and 5% BSA were activated for 1 hour prior to treatment. (b) Western blotting for PAF signaling protein (NF-κB, p38, p-p38, ERK, perk) was performed. LX-2 cells were transfected with control mirna or Let-7a mimics for 48hours prior to PAF (10nM) treatment with 5% BSA for 3 hours. PAF and 5% BSA were activated for 1 hour prior to treatment. 31
7. 간성상세포활성화시 Lin28B에의한 Let-7 maturation의억제 Lin28B 은오직 Let-7 family 의 maturation 단계를억제하는 mirna processing 억제조절자이다. Lin28B 의 Let-7 family 억제효과는암세포와줄기세포에서는많은연구가진행되어왔으나, 간성상세포에서는거의연구된바없다 (Seung-Kyoon Kim et al, 2014). Let-7 family 의발현은 8개의염색체에서일어나므로 Let-7 family 의동시다발적억제는전사인자에의한전사조절보다는 Lin28B 에의한전사후조절일가능성이더높다. 흰쥐의일차간성상세포를 12일동안배양하여활성화시켰을때 Lin28B 의 mrna 발현이현저히증가하였으며이를통해 Let-7 family 의 maturation 의억제로서 Let-7 family 의감소를설명할수있다 (Fig. 7A, B). 32
Figure 7. Let-7 maturation Inhibition by Lin28B during stellate cell activation (A) Comparison of Lin28B mrna levels between 0 day culture-activated rat primary HSCs and 12 day culture-activated rat primary HSCs. Primary HSCs were culture-activated respectively for 0 day and 12 days. mrna levels were determined using qrt-pcr assays. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). (B) Comparison of PAI1 mrna levels between 0 day culture-activated rat primary HSCs and 12 day culture-activated rat primary HSCs. Primary HSCs were culture-activated respectively for 0 day and 12 days. mrna levels were determined using qrt-pcr assays. Values represent the mean±standard error of mean (significantly different as compared with control mirna treated group *P<0.05, **P<0.01). 33
IV. 결론및고찰 간성상세포는건강한간에서는비활성상태로존재하나, 지속적인간손상에의해증가하는다양한매개인자에의해활성화되어세포외기질의생성을축적하며점차적으로간섬유화를야기한다 (Tiniakos et al, 2010). 그러므로간성상세포활성화신호를매개하는여러종류의세포표면수용체의발현을억제하는조절자의발견은간섬유화의효과적인예방및치료의수단으로활용할수있다 (Min, H. K. et al. 2012). 본연구에서는간성상세포활성화수용체를동시다발적으로억제할수있는조절자로써특정 mirna 를처음으로규명하였다. 생물정보학을활용한분석법을통하여이들수용체를표적으로하는 mirna 들을탐색하였으며, 그중에서도가장많은세포표면수용체를표적으로갖는 Let-7 family 에주목하였다. 중증의간섬유화환자의간에서보여지는 Let-7a 와 -7f 의발현감소및콜라겐면적으로대표되는섬유화지표와의역상관계는 Let-7 family 가간섬유화에중요한조절자로써의가능성을보여주었다 ( 예비결과 ). Lef-7 family 의감소는 CCl 4 에의한간섬유화동물모델에서도잘재현되며분리배양하여활성화시킨간성상세포에서는 Let-7a 의감소가더욱두드러졌는데, 이는간에서의 Let-7 family 의발현감소가간성상세포에서주로나타날수있음을시사한다. 간성상세포와간세포에서 Let-7 family 의중요성을검증하기위해흰쥐에서분리한일차간성상세포와간세포및인간유래의각세포주에서 Let-7 family의기저발현을비교하였다. 흥미롭게도 Let-7 family의발현은간세포보다간성상세포에서현저하게높게나타났으며, 이는 Let-7 family가간세포보다간성상세포에서중요한역할을함을의미한다. 이때간성상세포의비활성상태로유지하기위해 Let-7 family의높은발현이필수적이라고생각되었고, 그러므로 Let-7 family 34
는간성상세포의활성화를억제하는데중추적인역할을할가능성을충분히가지고있다고생각된다. TGF- 는간성상세포의표면수용체의발현및활성화를촉진하여세포외기질합성에중요한역할을한다. TGF- RI 과 II 는 TGF- 에반응하여하나의중합체를이루어세포신호를매개한다. 그러므로둘중하나의수용체발현만억제하여도신호전달을막을수있다. 본연구에서는 Let-7 에의한 TGFBRI 의전사후억제를인간간성상세포주인 LX-2 에서관찰하였다. LX-2 세포에 Let-7a 를형질주입하였을때 TGF- 에의한 SMAD2/3 의인산화가억제되었다. 또한 Let- 7a에의한 TGF RI 단백질의발현억제가 mrna 의감소를동반하지않은것으로보아 Let-7a 는 TGFBRI 의 mrna 번역억제를통한단백발현을조절로생각된다. PAF 는인지질로서간손상시주위의염증세포들을활성화시킨다 (Rui Yang et al, 2014). 간성상세포에서 PAF 의역할은많이알려진바없으나 CCl 4 에의한간경화동물모델에서 PAF 와 PAFR 의증가가관찰된것으로보아 PAF 가간성상세포의활성화에관여한다고볼수있다 (Y Yang et al, 2003). 또한 PAF 는면역세포에서 MAPK/ERK 신호를활성화하여세포의증식을촉진하는데, 간성상세포에서도역시 PAFR 과 MAPK/ERK 활성화는세포증식에기여할것이다. 인간간성상세포주에 Let-7a의형질주입시 PAF 처치에의한 PAFR 의발현과 MAPK/ERK 신호의활성화를억제하였으며간성상세포활성화지표중하나인 PAI1 역시발현이억제되었다. 그럼에도불구하고 PAF와 Let-7 family 간의직접적인관계는더자세히연구되어야할것이다. Let-7 family 기능연구는암과줄기세포에서많이연구되어왔다. 암세포에서 Let-7 family 의감소는상피-중간엽이행 (Epithelial-mesenchymal transition) 과 35
세포증식을촉진한다 (Boyerinas, B. et al, 2010). 활성화된간성상세포가간엽세포 (Mesenchymal cell) 와유사한생리를가지며높은증식능력을가지는것에비추어볼때간성상세포에서 Let-7 family의감소는암세포에서의세포생리학적변화와유사하다 (Castilho-Fernandes, A. et al, 2011). Let-7 family에는 9개의 mirnas 가속해있으며 8개의각기다른염색체에서발현된다 (Robert J. A. Frost, 2011). 각각의 Let-7 family 의 mirna 들은모두다른위치에서전사되므로각기다른전사인자가발현에관여할것이라고예상할수있다. 간섬유화시 Let-7 family 의거의모든 mirna 들이감소하였다. 공통적인전사인자가 Let-7 family의발현에관여할가능성이낮다면, Let-7 family 발현의조절은전사후조절 (Post-transcriptional regulation) 일가능성이높다. 흥미롭게도 Lin28B 단백질은 Let-7 family의 precursor 에만결합하며 precursor mirna에서 mature mirna로의이행을막는다 (Zhu, H. et al, 2011). 그러므로섬유화된간에서 Let-7 family의동시다발적감소는 Lin28B 의전사후조절일가능성이크다. 흰쥐에서분리한일차간성상세포를 12일동안배양하여활성화시켰을때 Lin28B의발현증가는이를지지하는근거가될수있다. 종합적으로, Let-7 family는간성상세포의활성화에관여하는세포표면수용체의발현을억제하며간성상세포의활성화를제어한다. 따라서 Let-7 family의발현조절을통한간성상세포의활성억제메커니즘은간섬유화예방및치료적가치가있음을시사한다. 36
V. 참고문헌 Chen, Y., S. S. Choi, G. A. Michelotti, I. S. Chan, M. Swiderska-Syn, G. F. Karaca, G. Xie, C. A. Moylan, F. Garibaldi, R. Premont, H. B. Suliman, C. A. Piantadosi and A. M. Diehl (2012). "Hedgehog controls hepatic stellate cell fate by regulating metabolism." Gastroenterology 143(5): 1319-1329 e1311-1311 Scott L. Friedman (2008). Hepatic Stellate Cells: Protean, Multifunctional, and Enigmatic Cells of the Liver Physiol rev, 2008 January ; 88(1): 125 172. doi:10.1152/physrev.00013.2007. Coulouarn, C., A. Corlu, D. Glaise, I. Guenon, S. S. Thorgeirsson and B. Clement (2012). "Hepatocyte-stellate cell cross-talk in the liver engenders a permissive inflammatory microenvironment that drives progression in hepatocellular carcinoma." Cancer Res 72(10): 2533-2542 Lee, U. E. and S. L. Friedman (2011). Mechanisms of hepatic fibrogenesis. Best Pract Res Clin Gastroenterol 25(2): 195-206. Wang, X. W., Heegaard, N. H., & Orum, H. (2012). MicroRNAs in liver disease. Gastroenterology, 142(7), 1431-1443. doi: 10.1053/j.gastro.2012.04.007 Christoph Roderburg, Gerd-Willem Urban, Kira Bettermann, Mihael Vucur, Henning Zimmermann, Sabine Schmidt, Jo rn Janssen, Christiane Koppe, Percy Knolle, Mirco Castoldi, Frank Tacke, Christian Trautwein, and Tom Luedde (2011). Micro-RNA Profiling Reveals a Role for mir-29 in 37
Human and Murine Liver Fibrosis, Hepatology, Vol. 53, No. 1, DOI 10.1002/hep.23922 Il Je Cho, Young Woo Kim, Chang Yeob Han, Eun Hyun Kim, Richard A. Anderson, Young Sok Lee, Chang Ho Lee, Se Jin Hwang, and Sang Geon Kim (2010). E-Cadherin Antagonizes Transforming Growth Factor b1 Gene Induction in Hepatic Stellate Cells by Inhibiting RhoA Dependent Smad3 Phosphorylation, HEPATOLOGY, Vol. 52, No. 6, 2010. DOI 10.1002/hep.23931 Seung-Kyoon Kim, Hosuk Lee, Kyumin Han, Sang Cheol Kim, Yoonjung Choi, Sang-Wook Park, Geunu Bak, Younghoon Lee, Jung Kyoon Choi, Tae- Kyung Kim, Yong-Mahn Han, and Daeyoup Lee (2014). SET7/9 Methylation of the Pluripotency Factor LIN28A Is a Nucleolar Localization Mechanism that Blocks let-7 Biogenesis in Human ESCs, Cell Stem Cell 15, 735 749, December 4, 2014, j.stem.2014.10.016 Tiniakos, D. G., Vos, M. B., & Brunt, E. M. (2010). Nonalcoholic fatty liver disease: pathology and pathogenesis. Annu Rev Pathol, 5, 145-171. doi: 10.1146/annurev-pathol-121808-102132 Min, H. K., Kapoor, A., Fuchs, M., Mirshahi, F., Zhou, H., Maher, J.,... Sanyal, A. J. (2012). Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease. Cell Metab, 15(5), 665-674. doi: 10.1016/j.cmet.2012.04.004 Rui Yang, Yongjun Chen, Cong Tang, Hongbo Li, Bing Wang, Qun Yan, Junbo Hu, and Shengquan Zou (2014). MicroRNA-144 suppresses 38
cholangiocarcinoma cell proliferation and invasion through targeting platelet activating factor acetylhydrolase isoform 1b, BMC Cancer 2014, 14:917 doi:10.1186/1471-2407-14-917 Y Yang, E M Nemoto, S A K Harvey, V M Subbotin, C R Gandhi (2003). Increased hepatic platelet activating factor (PAF) and PAF receptors in carbon tetrachloride induced liver cirrhosis. Gut 2004;53:877 883. doi: 10.1136/gut.2003.024893 Boyerinas, B., Park, S. M., Hau, A., Murmann, A. E., & Peter, M. E. (2010). The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer, 17(1), F19-36. doi: 10.1677/erc-09-0184 Castilho-Fernandes, A., D. C. de Almeida, A. M. Fontes, F. U. Melo, V. Picanco- Castro, M. C. Freitas, M. D. Orellana, P. V. Palma, P. B. Hackett, S. L. Friedman and D. T. Covas (2011). "Human hepatic stellate cell line (LX-2) exhibits characteristics of bone marrow-derived mesenchymal stem cells." Exp Mol Pathol 91(3): 664-672. Robert J. A. Frost and Eric N. Olson, (2011) Control of glucose homeostasis and insulin sensitivity by the Let-7 family of micrornas. PNAS, vol. 108, no. 52, 21075 21080 Zhu, H., Shyh-Chang, N., Segre, A. V., Shinoda, G., Shah, S. P., Einhorn, W. S.,... Daley, G. Q. (2011). The Lin28/let-7 axis regulates glucose metabolism. Cell, 147(1), 81-94. doi: 10.1016/j.cell.2011.08.033 39
ABSTRACT Let-7 family as Regulator of Hepatic Stellate Cell Activation Young Jin Choi Department of Pharmacology College of Pharmacy The Graduate School Seoul National University Hepatic stellate cell (HSC) activation plays a major role in liver fibrogenesis, which results in part from the activation of cell surface receptors by growth factors, cytokines, lipid mediators, and extracellular matrix components. Regulating these signaling pathways can be effective means in the treatment of liver fibrosis. MicroRNAs regulate a variety of physiological and pathological events. This study investigated the impact of Let-7 microrna family members on liver fibrosis mediated by HSC activation. Bioinformatic analyses using TargetScan algorithm enabled us to predict candidate micrornas that may affect different cell surface receptors activating HSCs. Of them, we focused on Let-7 family members because they might target a number of cell- 40
surface receptors. As an effort to find clinical relevance, the levels of Let-7 members were determined in a group of patients with fibrosis; patients with severe fibrosis showed significantly lower levels of Let-7a and -7f with greater accumulation of fibers than patients with mild disease. Let-7 members were also repressed in the liver of mice treated with carbon tetrachloride. The basal Let-7 expression was much greater in quiescent HSCs than primary hepatocytes, suggestive of the role of Let-7 in regulating HSC transdifferentiation. We found the ability of Let-7a to directly inhibit transforming growth factor beta receptor 1 (TGF-βRI) and platelet activating factor receptor (PAFR), as evidenced by 3 -UTR luciferase assays with Let-7a mimics or ASO transfection. Our results demonstrate that Let-7 family members may prevent liver fibrogenesis by inhibiting the expression of cell surface receptors including TGF-βRI and PAFR in HSCs. Keyword : Liver fibrosis, Hepatic stellate cell, Let-7 family, cell surface membrane receptor, transforming growth factor beta receptor 1, platelet activating factor receptor 41