EBV Cp 메틸화와악성림프종 175 제 1형은 EBERs와 EBNA-1만발현되는형태로버킷림프종과 EBV 관련위암종이이에해당하고, 제 2형은 EBNA-1과 LMP1은발현되나 EBNA-2 등이발현되지않는형태로서 NKTL과 PTCL은대부분제 2형이라고알려져있다. 7 제3형
|
|
- 서균 계
- 5 years ago
- Views:
Transcription
1 대한병리학회지 : 제 37 권제 3 호 2003 The Korean Journal of Pathology. 2003; 37: NK/T 세포림프종과말초 T-세포림프종에잠복감염된 Epstein-Barr Virus의 Major Latent Promoter C의메틸화분석 김지은 김영아 박성신 1 전윤경 1 이승숙 2 김철우 1 서울시립보라매병원병리과 1 서울대학교의과대학병리학교실종양면역연구센터및암연구센터 2 원자력병원병리과 접수 : 2003년 1월 25일게재승인 : 2003년 5월 29일 책임저자 : 김철우우 서울시종로구연건동 28 서울대학교의과대학병리학교실전화 : Fax: cwkim@plaza.snu.ac.kr * 본연구는보건의료기술연구개발사업 (HMP-98-M ) 의지원으로이루어졌음. Methylation Status of Epstein-Barr Virus Major Latent Promoter C in NK/T-cell Lymphoma and Peripheral T-cell Lymphoma Ji Eun Kim, Young-A Kim, SungShin Park 1, YoonKyung Jeon 1, Seung Sook Lee 2 and Chul Woo Kim 1 Department of Pathology, Seoul Municipal Boramae Hospital, Seoul; 1 Tumor Immunity Medical Research Center and Cancer Research Institute, Seoul National University College of Medicine, Seoul; 2 Department of Pathology, Korea Cancer Center Hospital, Seoul, Korea Background : Both the Natural killer/t-cell lymphoma (NKTL) and the peripheral T-cell lymphoma (PTCL) are relatively prevalent in the Asian population, and they are strongly associated with the Epstein-Barr virus (EBV). These two diseases have several common pathologic features, but show somewhat different clinical presentations. The critical point in terms of differentiating of these disease groups might be the impact of EBV in pathogenesis, and the variable gene expression of EBV regulated by a major latent C promoter (Cp). Methods : We investigated 43 cases of NKTL and 30 cases of PTCL to evaluate EBV associated characteristics. EBV in situ hybridization was performed in all of the submitted cases. In the EBV positive cases, the methylation status of Cp which drives the expression of immunodominant viral nuclear protein, was examined by sensitive methylation specific PCR using paraffin embedded tissue. Results : EBV was found in 70% (30/43) of NKTL and 43% (13/30) of PTCL. Nasal and gastrointestinal lymphomas were predominantly NKTL. All of the successfully amplified cases of EBV positive NKTL and PTCL were of methylated Cp status. Conclusion : The detection rate of EBV is high in NKTL, especially in the nasal area. The constantly methylated EBV Cp reflects the major role of Cp in regulating the EBV latency pattern and in helping EBV to avoid host immune system in both NKTL and PTCL. Key Words : Herpesvirus 4, Human-Lymphoma, T-cell-Promoter regions-methylation Epstein-Barr Virus (EBV) 는 gammaherpes virus family 에속하는 DNA virus로구강유모백반증 (oral hairy leukoplakia), 버킷림프종, 호지킨림프종, 코인두암종, 장기이식후면역증식성질환및 T 세포림프종등양성및악성종양을포함한다양한질병의병인과관련이있다. 1 말초 T-세포림프종 (peripheral T-cell lymphoma, PTCL) 과자연살해세포 /T-세포림프종 (natural killer/t-cell lymphoma, NKTL) 은 EBV 관련종양중에서도특히한국을비롯한극동아시아지역에서자주발생하는특징이있어서관심이집중되고있다. 이중비강부위에주로발생하는 NKTL은 1994년 Revised American-European classification of lymphoid neoplasm (REAL) 분류 2 에따르면혈관중심성 T-세포림프종 (angiocentric T-cell lymphoma) 으 로도불리며우리나라비호지킨림프종의 8.7% 를차지하고있고, 3 종양세포가 NK-세포와 T-세포의표지자를공유하고있는경우가많으며거의대부분증례의종양세포핵에서 EBV의게놈이관찰된다. 4 이에비해 REAL 분류및 2001년 WHO 분류 5 에따라 PTCL, unspecified로분류되는일군의질환은성숙 T 세포림프종의대부분을차지하고있으며, EBV와의관련성이 NKTL보다는낮아한국에서는약 58% 의 EBV 검출률을보이고있다. 6 이와같이 EBV와연관되어있는림프종으로면역학적특성을일부공유하고있는 NKTL과 PTCL에서 EBV가종양형성과정에서담당하고있는역할은아직명확하지않다. EBV의잠복감염형은 EBV가종양세포에잠복감염되었을때발현되는단백질의종류에따라세가지형태로분류하고있다. 174
2 EBV Cp 메틸화와악성림프종 175 제 1형은 EBERs와 EBNA-1만발현되는형태로버킷림프종과 EBV 관련위암종이이에해당하고, 제 2형은 EBNA-1과 LMP1은발현되나 EBNA-2 등이발현되지않는형태로서 NKTL과 PTCL은대부분제 2형이라고알려져있다. 7 제3형은 6가지단백이모두발현되는형으로서장기이식후면역증식성질환이이에속한다. 이렇게 EBV가면역우세항원인 EBNA-2를발현하지않고일부단백만을표현하는이유는, 세포독성 T 림프구의공격을피하기위한것으로생각된다. 8 숙주세포에서 EBV 단백질발현을조절하는것은 EBV 유전자중 BamHI-C fragment에위치한 major latency promoter인 C promoter (Cp) 이다. 이 Cp는모든 EBNAs의전사를유도함으로써 EBV 에감염된세포의성장특성과세포독성 T-림프구에대한감수성을결정하는가장중요한인자이다. 9 Cp의활성도조절은일부염기서열의메틸화에의해주로이루어진다. 9 NKTL 과 PTCL은대개제 2형잠복감염형에속한다고알려져있으나, 일부는 EBNA-2 mrna가검출된다는보고가있어 10 이들종양중일부는 Cp가활성화되어있을가능성이있다. 본연구는 Cp 활성도가 NKTL과 PTCL의진단별또는장기별차이를유발하는지알아보고자시행하였다. 재료와방법대상환자 1996년부터 2000년까지서울대학교병원및보라매병원에내원하여조직생검을받은환자중 NKTL 43예, PTCL 30예를대상으로하였다 (Table 1, 2). 환자의임상병력과나이, 성별등은병리검사의뢰서및의무기록지를참조하였다. 43예의 NKTL 환자중남자는 26명, 여자는 17명이었으며 ( 남녀비, 1.53:1), 30 예의 PTCL은남자 18명, 여자 12명이었다 ( 남녀비, 1.5:1). 진단당시환자의연령은 NKTL의경우 29세부터 79세까지 ( 평균 48.8세 ) 분포하였으며 PTCL의경우는 7세부터 71세까지 ( 평균 49.4세 ) 분포하였다. 침범된장기로는 NKTL의경우비강과코인두가가장많았다 (21예, 49%). 비강이외의침범장기로는위장관 (7예) 이가장많았으며, 그외입인두및구강 7예, 침샘 2 예, 고환, 피부, 자궁목, 간, 창자간막등이있었다. PTCL의경우는림프절병변이다수를차지하였으며 (12예, 40%), 위장관 5예, 구강 3예, 비강 2예및기타장기등이있었다. NKTL과 PTCL의진단기준은 2001년출간된 WHO 분류에기초한것이다. 5 비강 NKTL의진단은조직학적으로비정형림프구들의침윤이있고, 면역염색에서종양세포들이 CD56에양성이거나, CD56 음성이라도세포질내 CD3가약하게발현지만세포표면 CD3와 CD45RO는음성일경우에이루어졌다. 비강 NKTL은조직학적으로혈관침윤및응고괴사가관찰되는예들이대다수였다 (Fig. 1). 비강외 NKTL도위에기술한조직학적소견과 Table 1. Clinical profiles and EBV molecular data of 43 cases of NKTL Case Age (years) Sex site EBV ISH Cp 1 42 M nasal cavity negative 2 44 M skin. liver, LN negative 3 41 M oropharynx positive methyl 4 60 M testis positive methyl 5 53 F nasopharynx positive methyl 6 30 M colon positive methyl 7 50 F nasal cavity positive methyl 8 38 F nasal cavity positive methyl 9 59 M nasal cavity, colon negative F oropharynx negative M nasal cavity positive methyl F colon positive methyl M pancreas, liver, BM negative M tonsil positive methyl M nasal cavity positive methyl F nasal cavity negative M nasal cavity positive methyl F nasal cavity positive methyl M nasal cavity positive methyl F nasal cavity positive methyl M duodenum positive methyl F nasal cavity positive methyl M nasal cavity positive methyl F parotid gland, LN negative F parotid gland positive NR M liver, brain, kidney negative M small bowel positive methyl F colon, LN, BM negative F uterine cervix positive NR F nasal cavity positive methyl M cervical lymph node positive methyl F nasal cavity positive methyl F nasal cavity positive NR M nasal cavity positive methyl M hard palate positive methyl M tongue, rectum, LN negative M oral cavity, LN negative M nasal cavity positive NR F esophagus negative M uvula positive methyl M nasal cavity, rectum, lung negative M nasal cavity positive methyl M colon positive methyl NKTL, NK-T cell lymphoma; EBV ISH, EBV in-situ hybridization; Cp, C promoter; LN, lymph node; BM, bone marrow; NR, no reaction; methyl, methylated. 면역염색의기준은동일하였다. 그러나, 위장관종양인경우종양세포의 CD56 양성여부를중요시하였으며융모위축과장병증을동반하는 enteropathy-associated T-cell lymphoma를배제하였다. 비강 NKTL과비강외 NKTL 모두 T-세포수용체감마재배열 (T-cell receptor rearrangement) 은일어나지않는증례들로한정하였다. PTCL의진단은 REAL 기준에기초하여이루어졌으며, 면역염색에서 CD3나 CD45RO 양성이면서
3 176 김지은 김영아 박성신외 3 인 Table 2. Clinical profiles and EBV molecular data of 30 cases of PTCL Case Age (years) Sex site EBV ISH Cp 1 20 M disseminated positive NR 2 39 M colon positive methyl 3 55 M LN positive NR 4 60 M tonsil negative 5 68 F oral cavity positive methyl 6 42 F eyelid positive methyl 7 20 M skin negative 8 49 F skin negative 9 42 F colon positive methyl M nasal cavity, soft tissue negative M colon positive methyl F skin negative M nasal cavity positive methyl M LN negative M LN negative F LN negative M LN negative F skin negative F LN positive NR F nasal cavity negative F colon positive methyl 22 7 M soft tissue negative M stomach negative F LN positive NR M LN negative M LN negative M LN negative M LN positive NR M LN positive NR F hard palate negative PTCL, peripheral T-cell lymphoma; EBV ISH, EBV in-situ hybridization; Cp, C promoter; methyl, methylated; LN, lymph node; NR, no reaction. CD56 음성인예들에한정하였다 (Fig. 2). EBV 제자리부합화 파라핀블록에서 4 m 두께로박절한조직을 silane 도포된슬라이드에얹고탈파라핀과재함수과정을거친뒤 proteinase K로 37 항온조에서 30분간처리한후다시세척하여에탄올로탈수하였다. 다음 fluorescein-conjugated EBV oligonucleotide (cocktails of EBER 1 and 2, Dakopatts, Glostrup, Denmark) 를조직에올려커버슬라이드를덮은채 4 에서 14시간보합결합시킨뒤 TBS 완충액으로세척하였다. 검출은 DAKO ISH detection kit (K046, Dakopatts) 를사용하였는데, 먼저 1:100 으로희석한 rabbit F(ab )2 anti-fitc/ap 150 L로 30분반응시키고 TBS 완충액으로수세하였다. 그리고, 기질완충액에담그고희석한효소기질 (BCIO/NBT) 로 30분처리하여증류수로세척한후봉입하여관찰하였다. Fig. 1. NK-T cell lymphoma shows pleomorphic infiltrates with angioinvasion and zonal necrosis. Fig. 2. Peripheral T-cell lymphoma shows infiltration of atypical small lymphoid cells with vascular proliferation. 메틸화특이 PCR 20 m 두께의파라핀절편 2개를튜브에넣어탈파라핀한후 genomic DNA isolation kit (Boerhinger Mannheim, Indianapolis, USA) 를이용하여 DNA를추출하였다. 다음 bisulfite modification을거쳐중합효소연쇄반응 (PCR) 을시행하였다. 구체적인과정은다음과같다. 2-5 g의 DNA를 0.3 mol/l NaOH 용액에 37 에서 15분간변성시켰다. 매실험마다즉석에서제작한 Bisulfite solution (3.5 M sodium bisulfite 550 L/1 mm hydroquinone, ph 5.0) 을첨가하여무기질유지 (mineral oil) 를떨어뜨린뒤암소에서 55, 16시간동안반응시켰다. 다음 Wizard Clean-Up System (Promega, Madison, USA) 을사용하여염기제거및정제과정을거쳤다. 우선 DNA clean-up Resin을 1 ml 첨가하여혼합한뒤주사기를이용하여 minicolumn에통과시켜 DNA는 column에부착시킨후 80% isopropranolol 2 ml로남은 resin과염기를제거하는과정을 2-3회
4 EBV Cp 메틸화와악성림프종 177 반복하였다. 이렇게처리된 DNA를튜브에담아 13,000 G에서 2분간원침하여 resin을건조시킨뒤 의증류수 50 L 로녹였다. 다음 7.5M ammonium acetate 35 L와 100% 에탄올 170 L, salmon sperm DNA 1 L 등을첨가하여 -70 에서 15분간침전시킨 DNA를다시 70% 에탄올로수세하여건조시킨후증류수에녹여사용하였다. 이렇게준비된 DNA를이용하여 PCR을시행하였다. PCR 시동체 (primer) 는 bisulfite modification 후메틸화 DNA와비메틸화 DNA에각각선택적으로결합할수있도록제작하였으며, 11 Cp의 EBNA2 반응부위 (response element) 를증폭하도록고안하였다. 시동체의염기서열은다음과같다. 메틸화 Cp: mb3: GTCC*GAAACC*GAAC*GACTC*G (coordinate in B95-8: 10, , 23) mb4: GTAAGGC*GTAATTAATTTC*GTTC* (coordinate in B95-8: 11, , 194) 비메틸화 Cp ub3: CATCCAAAAACCAAACAACTCA (coordinate in B95-8: 10, , 723) ub4: AGTAAGGTGTAATTAATTTTGTTT (coordinate in B95-8: 11, , 194) Thermocycler (Perkin Elmer, Boston, USA) 를사용하여 94 에서 10분간초기변성시킨후, 94 30초 55 (methylated primer 경우는 58 ) 30초 72 30초주기로 35회시행하였으며, 72 에서 10분간최종연장한후결과물을 ethidium bromide 함유된 2% 우무겔에서전기영동하여확인하였다. 메틸화 Cp에대한양성대조표본은 EBV 양성버킷림프종세포주인 Raji를사용하였으며, 비메틸화 Cp에대한양성대조표본은 EBV immortalized B lymphoblastoid cell line인 B95-8을사용하였다. EBV 제자리부합화결과 결과 진단별로구분하여 NKTL은 43예중 30예 (70%) 에서 EBER 제자리부합화결과양성이었다 (Fig. 3). PTCL은 30예중 13예 (43%) 에서양성으로나타나 NKTL의 EBV 양성도가 PTCL 보다현저히높았다 (p<0.05, Table 3). EBV 양성군에서는 EBV 양성 NKTL 남자의평균연령이 51.9세로, EBV 양성 NKTL 여자의평균연령인 42.4세보다많았다 (p<0.05). 발생부위별로비강림프종과비강외림프종으로구분하였을때비강림프종에서 EBV 연관성이뚜렷이높게나타났으며 (p<0.05, Table 4), 비강림프종은대부분이 NKTL이었다. 구강을포함한소화관림프종과비소화관림프종으로구분한군간에는환자의연령, 성별, EBV 양성도등에서유의한차이를발견할수없었다. 그러나비강외림프종중에서소화관림프종과비소화관림프종을분리하였을때소화관림프종은 22예중 14예 (64%) 가 NKTL이었고비소화관림프종은 51예중 29예 (57%) 가 NKTL이었다. 이중비강을제외하면 29예중 8예 (26%) 만이 NKTL이므로소화관은비강다음으로 NKTL이호발하는장기임을알수있었고 (p<0.05), EBV 양성률도비소 Table 3. Analysis of EBV positivity between cases of NKTL and PTCL Group No Mean age (years) Sex (M:F) EBV positivity NKTL :17 30/43 (70%) PTCL :12 13/30 (43%) NS NS p<0.05 No, numbers; NKTL, natural killer/t-cell lymphoma; PTCL, peripheral T- cell lymphoma; NS, not significant. Table 4. Relationship between tumor site, clinical data and EBV positivity Mean age Group No Sex (M:F) EBV positivity (years) A1: nasal NKTL :10 17/21 (81%) A2: non-nasal NKTL :7 13/22 (59%) NS NS p=0.123 B1: nasal, total :11 18/23 (78%) B2: non-nasal, total :18 25/50 (50%) NS NS p<0.05 C1: GI NKTL :4 9/14 (64%) C2: non-gi NKTL :13 21/29 (72%) NS NS NS D1: GI, total :8 14/22 (64%) D2: non-gi, total :21 29/51 (57%) NS NS NS Fig. 3. Positive signals of EBER ISH are found in numerous tumor cell nuclei. No, number; NKTL, natural killer/t-cell lymphoma; NS, not significant; total, NKTL+PTCL; GI, gastrointestinal tract including oral cavity.
5 178 김지은 김영아 박성신외 3 인 L M U 1m 1u 2m 2u 3m 3u Fig. 4. Methylation specific PCR analysis for EBV Cp. Lane L, 100 bp marker; M, positive control of methylated Cp. (Raji) U, positive control of unmethylated Cp, (B95-8); 1m, PCR product of case 4 of NKTL by methylation specific primer; 1u, PCR product of case 4 of NKTL by unmethylation specific primer; 2, case 12 of NKTL; 3 m, case 5 of PTCL. 화관림프종보다높은경향을보였다 (p=0.09). 또한 PTCL에서는소화관을침범한증례 8예중 5예 (63%) 에서 EBV가양성으로나온데비해, 소화관외장기에서발생한증례에서는 22예중 7예에서만 (32%) EBV가연관되어있었다 (p<0.05). Cp 의메틸화양상 Cp의메틸화에관한검색은 EBER 제자리부합화에서양성으로판정된 30예의 NKTL과 13예의 PTCL을포함하여총 43 예에서메틸화특이 PCR 기법으로시행하였다. 성공적인 PCR 산물은 26예의 NKTL (87%) 과 7예의 PTCL (54%) 등 33예 (77%) 에서얻을수있었고, 진단과침범장기등에관계없이모두균일하게메틸화된 Cp만보였으며, 비메틸화산물은전혀검출되지않았다 (Fig. 4). 반복적실험에도불구하고메틸화특이 PCR에서산물이나오지않아결과판정을할수없었던 10 예 (23%) 는 4예의 NKTL과 6예의 PTCL로, PTCL에서메틸화특이 PCR의성공률이더낮았으며이중 4예가림프절이원발병소인 PTCL이었다. 고찰 EBV가 NKTL의병인과밀접한관계가있다는것은이미잘알려져있다. 특히비강주위에생기는 NKTL인경우멕시코인에게서는 90% 이상에서 EBV가검출되었고, 12 한국에서는중국과유사한분포로역시 90% 이상검출되었다. 6 본연구에서도비강 NKTL은 81% 의 EBV 양성률을보인반면, 비강외 NKTL의 EBV 양성률은 59% 로서그간의보고와어느정도일치하였다. 또한구강을포함한소화관에서는 NKTL의발생률이 PTCL보다높고소화관은비강다음으로 NKTL이호발하는장기로서, EBV 의장기또는침범경로에따른선호도가다르다는것을짐작하게하였다. 지금까지 PTCL에서 EBV의명백한침범경로는밝혀져있지않다. 그러나, 비강과소화관은모두점막층을통한 EBV의침입이가능한장기라는공통점이있 고, 구강또는비점막상피세포가 EBV의저장고역할을할가능성을생각할수있다. 특히 EBV 양성 NKTL 환자는남자가여자보다 10년정도평균연령이높았다. 이는 Huh 등 6 의결과와도일치하였는데, 면역력이나내분비계통또는환경의차이에의한것인지규명하기위해다른연구가필요할것이다. Cp 활성도의검사는 bisulfite genomic sequencing 8 또는메틸화특이제한효소를이용한 Southern 13 이주로이용되어왔으나, 이두가지방법모두예민도가떨어지고보존이잘된많은양의 DNA가필요하다는제한때문에파라핀포매조직에서는이용할수없다는단점이있다. 그에비해메틸화특이 PCR 방법을이용하면시료의양이적거나파라핀포매조직같이 DNA 가분절되어있는경우에도이용할수있어서메틸화여부를보기위해서는최적의연구방법이라할수있다. DNA 메틸화를보기위한이방법은 Herman 등 14 이발표하여소개되었다. 그원리는 sodium bisulfite를처리하면시토신이우라실로치환되지만메틸화된시토신은치환되지않는다는이치에착안하여, 메틸화된 DNA와비메틸화된 DNA에각각상보적인시동체를제작하여 PCR을시행하는방법이다. Tao 등 11 은이기법으로여러가지유형의림프증식성질환의신선동결조직에서 EBV Cp 중 EBNA-2 반응부위부근의 EBV Cp의메틸화상태를조사하였으며, 시료의제한점으로인해단지 2예의 NKTL에서 Cp가메틸화되어있음을확인하였다. 따라서본연구가현재까지가장광범위하게 NKTL과 PTCL에서의 EBV Cp의메틸화상태를조사한연구로상기질환들의특성을대표할수있다고생각되며, 파라핀조직에서결과물을얻었다는데더욱큰의의가있다. NKTL과 PTCL에서는대부분 EBNA-1과 LMP1 만발현되고 EBNA-2는발현되지않는다고알려져있다. 그러나, 일부종양세포에서 EBNA2 mrna가전사되는것이확인 되어 10 Cp 의메틸화양상이증례마다다양하게나타날것을기 대하였으나, 결국본연구에포함되었던거의모든 NKTL과 PTCL에서는균일한 Cp 메틸화를확인하였다. 이는 NKTL과 PTCL은 Cp 메틸화를통해항원성이강한 EBNA-2 등을전사하지않음으로써숙주세포로부터면역회피를이끌어내어잠복감염을유지할것이라는가설을뒷받침하는결과이다. 8,13 지금까지 Cp 메틸화에대한결과들을종합해보면다음과같다. EBV-immortalized lymphoblastoid cell line인 B95-8에서는 Cp가비메틸화되어거의모든 EBV 관련단백들이발현되는제3형잠복감염형을유지한다. 그러나장기이식후림프증식성질환과같이숙주면역이저하되어있으나, 아직림프종으로의비가역적변화가일어나지않은단계의질환에서는대부분 Cp 가비메틸화되어있거나일부는메틸화된 Cp와비메틸화된 Cp 가한환자에게서동시에존재하는양상을보였다. 호지킨림프종과버킷림프종에서는 EBV Cp의메틸화가확인된보고들이있다. 8 그외코인두암종등을포함한대부분의 EBV 관련종양에서도 Cp가메틸화되어있어 11 EBV Cp의메틸화가종양생성의핵심적단계라는주장이제기되었다. 그러나정상림프구
6 EBV Cp 메틸화와악성림프종 179 에서도약 48% 에서 Cp의메틸화가밝혀져, 15 Cp의메틸화가직접적으로종양형성에기여한다기보다는 EBV의융해성감염을잠복감염으로전환시키는역할을할가능성이더클것으로보인다. 정상면역을가진환자에서는초감염은 Cp가비메틸화된 EBV에의해발생하더라도곧잠복감염형을유지하기위해 Cp 메틸화가일어나고, 이과정이세포전환능력에는영향을주지않아일정기간후에림프종이발병할수있다는가설을세울수있다. 메틸화는세포성유전자, 특히종양억제유전자에주로발생하여종양내형성과관련이있으며, 16 EBV와같은외부 DNA에메틸화가일어나는일은매우특이하다. PCR 결과물을얻을수없었던 10예 (NKTL 4예, PTCL 6 예 ) 는 Cp의결손 (deletion) 이의심되어야생형 Cp 염기서열중흔히결손이일어나는부위 (Cp EBNA-2 반응부위 ) 전후로올리고핵산염시동체를제작하여 17 PCR을시행하였으나, 결손산물은발견되지않았다. 따라서 Cp 결손은이들종양에서거의발생하지않는것으로추정할수있었다. 메틸화특이 PCR 에서결과를얻을수없었던증례들은종양세포의수가적거나, EBER 제자리부합화에서 EBER 양성세포의수가극히적은것들이대부분이어서 bisulfite modification 도중 EBV를포함한세포의 DNA가소실되었을가능성이있다. 특히 EBV 양성세포의밀도가상대적으로높은 NKTL보다 PTCL에서메틸화특이 PCR의성공률이낮았던점이위의가능성을뒷받침하고있다. 또한 PCR 산물의크기 (512 bp, 516 bp) 가상대적으로커서비교적보존이잘된 DNA가필요한데파라핀블록에서추출한 DNA는질적으로한계가있었던것으로추정된다. 이연구를통해 NKTL과 PTCL은 EBV와밀접한관계가있으며, 그중비강 NKTL과소화관 PTCL에서특히 EBV 감염과깊이연관되어있음을확인하였다. EBV의종양단백발현을조절하는 Cp는이들종양에서거의대부분메틸화되어있음이밝혀졌고, Cp의메틸화가 EBV의잠복감염을유지하는주된기전임을시사하였다. 참고문헌 1. Gaffey MJ, Weiss LM. Association of Epstein-Barr virus with human neoplasia. Pathol Annu 1992; 1: Harris NL, Jaffe ES, Stein H, et al. A revised European-American classfication of lymphoid neoplasms: A proposal from International Lymphoma Study Group. Blood 1994; 84: Ko YH, Kim CW, Park CS, et al. REAL Classification of malignant lymphomas in the Republic of Korea: Incidence of recently recognized entities and changes in clinicopathologic features. Hematolymphoreticular study group of the Korean society of pathologists. Revised Europian-American lymphoma. Cancer 1998; 83: Chan JK. Natural killer cell neoplasm. Anat Pathol 1998; 3: Jaffe ES, Harris NL, Stein H, Vardiman JW. World health organization classification of tumours pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon; International agency for research on cancer, 2001; Huh JR, Cho KH, Heo DS, Kim JE, Kim CW. Detection of Epstein- Barr virus in Korean peripheral T-cell lymphoma. Am J Hematol 1999; 60: Chiang AKS, Tao Q, Srivastava G, Ho FCS. Nasal NK-T cell lymphomas share the same type of Epstein-Barr virus latency as nasopharyngeal carcinoma. Int J Cancer 1996; 68: Robertson KD, Manns A, Swinnen LJ, Zong JC, Gulley ML, Ambinder RF. CpG methylation of the major Epstein-barr virus latency promoter in Burkitt s lymphoma and Hodgkin s disease. Blood 1996; 88: Robertson KD, Hayward DJ, Samid D, Ambinder RF. transcriptional activation of the EBV latency C promoter following 5-azacytidine treatment: evidence that demethylation at a single CpG site is crucial. Mol Cell Biol 1995; 15: Harabuchi Y, Yamanaka N, Kataura A, et al. Epstein-Barr virus in pateints with lethal midline granuloma. Lancet 1990; 335: Tao Q, Swinnen LJ, Yang J, Srivastava G, Robertson KD, Ambinder RF. Methylation status of the Epstein-Barr virus major latent promoter C in iatrogenic B cell lymphoproliferative disease. Am J Pathol 1999; 155: Kojo SJ, Johnson E, ZaratOsorno A, et al. Cytotoxic granular protein expression, Epstein-Barr virus strain type, and latent membrane protein-1 oncogene deletions in nasal T-lymphocyte/natural killer cell lymphomas in Mexico. Mod pathol 1998; 11: Minarovits J, Minarovits-Komuta S, Ehlim-Henriksson B, Falk K, Klein G, Emberg I. Host cell phenotype-dependent methylation patterns of Epstein-Barr virus DNA. J Gen Virol 1991; 72: Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci. 1996; 93: Robertson KD, Ambinder RF. Methylation of Epstein-Barr Virus genome in normal lymphocytes. Blood 1997; 90: Counts JL, Goodman JL. Alterations in DNA methylation may play a variety of roles in carcinogenesis. Cell 1995; 83: Swaminathan S. Characterization of Epstein-Barr Virus recombinants with deletions of the BamHI C Promoter. Virology 1996; 217:
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationKISEP Head and Neck Korean J Otolaryngol 2001;44: 만성편도염에서의 Epstein-Barr Virus 의검출률과유전자형분포 최영철 1 이숙경 2 권용순 2 강진한 3 박용수 1 전은주 1 Detection Rates of
KISEP Head and Neck Korean J Otolaryngol 2001;44:1171-6 만성편도염에서의 Epstein-Barr Virus 의검출률과유전자형분포 최영철 1 이숙경 2 권용순 2 강진한 3 박용수 1 전은주 1 Detection Rates of Epstein-Barr Virus from the Chronic Tonsillitis and
More informationPowerPoint 프레젠테이션
Gastro intestinal lymphomas R3. 정세진 정의 GI lymphoma introduction 위장관및이와관련된배액부위림프절에국한, 간이나비장및기타림프절침범이없고, 단순흉부촬영상이정상, 말초혈액검사의백혈구가정상인경우. Extranodal lymphoma 69.6% GI lymphoma 29.22% Kim JM, WHO Classification
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationVery low-risk Low-risk Intermediate-risk High-risk Appendiceal mucinous tumours Mucinous adenoma Mucinou
I. Workshop 결과에대한설문조사결과 A. 종양의행태 (behavior) 코드부여에이견이있는소화기계암에대한설문조사결과 Organ or Subject Stomach Colon Diagnosis 응답자수 ( 총 240 명 ) Low grade adenoma/dysplasia 230 10 0 1 2 3 6 무응답 High grade adenoma/dysplasia
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More informationKaes017.hwp
갑상선의 Poorly Differentiated (Insular) Carcinoma Insular Carcinoma: An Aggressive Subtype of Differentiated Thyroid Neoplasms Seok-Jin Nam, M.D., Sang-Dal Lee, M.D., Hal-lin Park, M.D., Young-Ryun Oh, M.D.
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information대한진단검사의학회지제 27 권제 6 호 2007 Korean J Lab Med 2007;27:383-7 DOI /kjlm 원저 진단혈액학 세계보건기구분류에근거한악성림프종의골수침습빈도및양상 - 단일기관연구 정소연 1 장윤환 1 이진경
대한진단검사의학회지제 27 권제 6 호 2007 Korean J Lab Med 2007;27:383-7 DOI 10.3343/kjlm.2007.27.6.383 원저 진단혈액학 세계보건기구분류에근거한악성림프종의골수침습빈도및양상 - 단일기관연구 정소연 1 장윤환 1 이진경 1 홍영준 1 홍석일 1 이승숙 2 원자력의학원원자력병원진단검사의학과 1, 병리과 2 Incidence
More informationThe Korean Journal of Pathology 2006; 40: 거짓상피종증식을동반한코형 NK/T 세포림프종 - 1 예보고 - 오훈규 김정규 1 박관규 대구가톨릭대학교의과대학병리학교실 1 이비인후과학교실 Nasal Type NK/T Cell Lym
The Korean Journal of Pathology 2006; 40: 250-4 거짓상피종증식을동반한코형 NK/T 세포림프종 - 1 예보고 - 오훈규 김정규 1 박관규 대구가톨릭대학교의과대학병리학교실 1 이비인후과학교실 Nasal Type NK/T Cell Lymphoma with Pseudoepitheliomatous Hyperplasia - A Case
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information고등급원발성림프절변연부 B- 세포림프종 283 A B C D Fig. 1. (A) Primary nodal marginal zone B-cell lymphoma in the cervical lymph node shows a parafollicular infiltrati
대한병리학회지 : 제 37 권제 4 호 2003 The Korean Journal of Pathology. 2003; 37: 282-6 고등급림프종으로형질전환된원발성림프절변연부 B- 세포림프종 - 1 예보고 - 김주헌 강동욱 박미자 김진만 1 을지대학교의과대학병리학교실 1 충남대학교의과대학병리학교실 High-grade Transformation of Primary
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>
2012 개원의와함께하는임상강좌 경희대학교의과대학감염내과학교실 문수연 F/29 CC: fever, headache, multiple cervical lymph node onset) 5 days ago 1 cm sized Bilateral, mild tender, movable, soft Reactive LN with viral infection 2012 개원의와함께하는임상강좌
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information<30352EB0A3BAB4B8AE2E687770>
The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationCASE REPORT J Rhinol 2015;22(2): pissn / eissn 재발성안와주위염및급성누낭염
CASE REPORT J Rhinol 2015;22(2):107-111 http://dx.doi.org/10.18787/jr.2015.22.2.107 pissn 1229-1498 / eissn 2384-4361 www.ksrhino.or.kr 재발성안와주위염및급성누낭염으로오인된비부비동 NK/T 세포림프종 1 예 울산대학교의과대학울산대학교병원이비인후과학교실 양성경
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More informationJaneway's Immunology
Chapter 1 면역학의기초개념 (basic concepts in immunology) 2014 년도 2 학기약품면역학제 2 강 (1/31) 면역학 ( 免疫學, immunology) 정의 (definition) 감염 (infection) 에대항하는우리몸의방어 (defense) 를연구하는학문 면역반응 (immune response) 내재면역 (innate immunity)
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More informationWHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disabi
WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 2004. 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disability)..,,. (WHO) 2001 ICF. ICF,.,.,,. (disability)
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More informationCase Report Korean J Otorhinolaryngol-Head Neck Surg 2018;61(10): / pissn / eissn
Case Report Korean J Otorhinolaryngol-Head Neck Surg 2018;61(10):536-40 / pissn 2092-5859 / eissn 2092-6529 https://doi.org/10.3342/kjorl-hns.2017.00073 Various Clinical Presentation of Post-Transplant
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationCase Report Korean J Otorhinolaryngol-Head Neck Surg 2017;60(11): / pissn / eissn
ase Report Korean J Otorhinolaryngol-Head Neck Surg 2017;60(11):579-83 / pissn 2092-5859 / eissn 2092-6529 https://doi.org/10.3342/kjorl-hns.2016.16992 ase of Mucosa-ssociated Lymphoid Tissue Lymphoma
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationuntitled
제 1 세부과제 안전한 예방접종 실천을 위한 전략 및 교육, 홍보 자료 개발 제 1 장. 서 론 제 1 절. 연구의 필요성 국가적인 차원에서 예방접종 사업은 전염병 관리를 위한 가장 중요한 방역 사업 중 하나로, 대다수의 전염병 발생률은 각종 전염병의 백신이 나온 후로 현저히 감소하였으며, 인류 역사상 가장 많은 생명을 전염병으로부터 구원해주었다. 그러나,
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationStudy on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationÀå¾Ö¿Í°í¿ë ³»Áö
Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationuntitled
폐의말초T세포림프종으로진행한만성활동성 Epstein-Barr Virus 감염증 1례 부산대학교의학전문대학원소아과학교실 연규민ㆍ권경아ㆍ곽정원ㆍ박성식ㆍ박재홍ㆍ임영탁 A Case of Chronic Active Epstein-Barr Virus Infection Progressed to Peripheral T-cell Lymphoma of Lung Gyu Min
More information590호(01-11)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information대한한의학원전학회지26권4호-교정본(1125).hwp
http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More informationISSN 제 3 호 치안정책연구 The Journal of Police Policies ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE
11-1320082-000013-09 ISSN 1738-2963 2015 제 3 호 치안정책연구 The Journal of Police Policies 2015. 12 ( 제29권제3호 ) 치안정책연구소 POLICE SCIENCE INSTITUTE : 통학버스를중심으로 차례 전병주 * 최은영 ** Ⅰ. 서론 1) Ⅱ. 이론적배경 Ⅲ. 연구방법 Ⅳ. 연구결과
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information歯채민병.PDF
Patient number Sex Age Animal contact 1 F 36 No 2 F 31 Cat scratch Result of biopsy/aspiration cytology of lymph nodes Chronic granulomatous inflammation with caseation necrosis, compatible with tuberculous
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information........-55..9.30
MYONGJI ST. MARY S HOSPITAL EXCELLENT STROKE TREATMENT CENTER The president of Myongji St. Mary s Hospital M.D. HUH, CHOON WOONG Graduated from Seoul Catholic Medical College. Achived M.D. in Neurosurgeon.
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information<5B31362E30332E31315D20C5EBC7D5B0C7B0ADC1F5C1F8BBE7BEF720BEC8B3BB2DB1DDBFAC2E687770>
2016 지역사회 통합건강증진사업 안내 - 지역사회 중심 금연지원 서비스 - 2016. 3. 주요변경사항 5 1부 국가 금연정책 추진 및 현황 Ⅰ. 국가 금연정책 개요 1. 금연정책의 배경 및 필요성 11 2. 세계 금연정책 동향 20 3. 우리나라 금연정책 추진경과 24 4. 2016년도 금연정책 추진방향 31 Ⅱ. 국가 금연사업 현황 1. 흡연자 금연지원서비스
More information<323020C1F5B7CA D C1A4C0AFB3AA2DBDC5C7FCBDC42E687770>
대한내과학회지 : 제 88 권제 4 호 2015 http://dx.doi.org/10.3904/kjm.2015.88.4.469 HIV 감염인에서발생한순차적림프종 1 예 국립중앙의료원 1 내과, 2 병리과 정유나 1 이재령 1 이희숙 1 진범식 1 서창인 1 신형식 1 정은정 2 A Case of Sequential Lymphoma in an Human Immunodeficiency
More information레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
More information<38BFF93238C0CF28B1DDBFE4C0CF2920BFB9BBF3B9E8B4E72E786C7378>
[부산 ] 2009년 08월 28일 ( 金 ) 1경주 국 5(마령)1000M 발주 13:00 종합 인기도 출전 착순 출주 10 11 5 검은요정 국5 한2 암 김재섭 영준 53 3착 선행 5 5 5 15 1 6 3 0.3 주 10 랜드레이디 국5 한2 암 강형곤 현명 53 3착 선행 10 5 6.3 10 10 4 8 4 2 4 주 11 일맥상통 국5 한3 암
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information두경부 편평세포암에서 p16, Cyclin D1 단백의 발현양상 부 편평세포암에서 p16단백의 표현양상과 임상병기 및 조 4-326(BioGenex, USA), p16은 쥐 단클론 항체인 G17 직분화도에 따른 표현양상의 차이를 알아보고 cyclin D (P
KISEP Head and Neck Korean J Otolaryngol 1998;417:901-905 두경부편평세포암에서 p16, Cyclin D1 단백의발현양상 김상현 박숙아 오영석 Expression of p16 Protein and Cyclin D1 Protein in Head and Neck Squamous Cell Carcinomas Sang Hyun
More information