241 pissn : , eissn : Original Article J Korean Orthop Assoc 2015; 50:
|
|
- 봉기 자
- 5 years ago
- Views:
Transcription
1 241 pissn : , eissn : Original Article J Korean Orthop Assoc 2015; 50: 재조합골형성단백 -2 가가토의관절연골결손의연골하골재형성및연골치유에미치는영향 이석하 이승준 이종수 안재성 * 건국대학교의학전문대학원건국대학교병원정형외과학교실, * 충남대학교의학전문대학원충남대학교병원정형외과학교실 Influence of Recombinant Human Bone Morphogenetic Protein-2 on the Remodeling of Subchondral Bone and Cartilage Healing in the Articular Cartilage Defect of the Rabbit Suk Ha Lee, M.D., Ph.D., Seoung-Joon Lee, M.D., Ph.D., Jong Soo Lee, M.D., and Jaesung Ahn, M.D.* Department of Orthopedic Surgery, Konkuk University Medical Center, Konkuk University School of Medicine, Seoul, *Department of Orthopedic Surgery, Chungnam National University Hospital, Chungnam National University School of Medicine, Daejeon, Korea Purpose: The purpose of this study is to evaluate the effects of recombinant human bone morphogenetic protein-2 (rhbmp-2) after microfracture on the remodeling of subchondral bone and cartilage healing in a model of full-thickness articular cartilage injury in a rabbit. Materials and Methods: A full thickness articular cartilage defect of 6 3-mm-size was created in the trochlear groove of the right femur in 24 rabbits. The defect was left empty in six rabbits, and microfracture was done in 18 rabbits. After microfracture, no treatment was done in six rabbits, defect was filled with fibrin glue in six rabbits, and with fibrin glue and rhbmp-2 in six rabbits. The effect of rhbmp-2 after microfracture was evaluated based on histological analysis and real-time polymerase chain reaction (PCR) for analysis of collagen type at 8 weeks after surgery. Results: The score of histological grade scale of six rabbits in which the defect was filled with fibrin glue and rhbmp-2 was better than that of others and real-time PCR also showed a higher amount of collage type 1 and collage type 2 in these six rabbits. Conclusion: We consider that fibrin glue and rhbmp-2 after microfracture may accelerate cartilage healing in an articular cartilage defect and maybe helpful in healing the articular cartilage defect into more closely native hyaline cartilage. Key words: articular cartilage defect, microfracture, bone morphogenetic protein-2 서론 골형성단백 (bone morphogenetic protein, BMP) 은 1965 년에 Urist 1) 에의해처음으로보고되었으며, Bostrom 등 2) 은 BMP-2, Received October 2, 2014 Revised February 6, 2015 Accepted March 7, 2015 Correspondence to: Seoung-Joon Lee, M.D., Ph.D. Department of Orthopedic Surgery, Konkuk University Medical Center, Konkuk University School of Medicine, Neungdong-ro, Gwangjin-gu, Seoul , Korea TEL: FAX: lsjmd@kuh.ac.kr *This paper was supported by Konkuk University in BMP-4가내연골성및막성골절치유에관여한다는것을밝혔다. 이후에 BMP-2를이용한골재형성실험연구들이보고되었으며 3-5) 현재 BMP-2는골결손이있는부위에골이식대체물로상품화되어임상적으로이용되고있다. BMP-2는골유도작용이외에도관절연골의당단백합성을자극하여관절연골의복원을유도하는작용이있으며, 이러한 BMP-2 의특성을이용하여관절연골의복원을시도하는실험연구결과들이보고되고있으나 6,7) 염증성관절의관절연골에서는 BMP-2 단독으로관절연골의복원을유도하지못하는것으로알려져있다. 8) 본연구는 BMP-2의특성을이용하여관절연골의전층결손부위에미세골절 (microfracture) 을한후 BMP-2를충전하여 BMP-2가관절 The Journal of the Korean Orthopaedic Association Volume 50 Number Copyright 2015 by The Korean Orthopaedic Association This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 242 Suk Ha Lee, et al. 연골치유에미치는영향을알아보고자한다. 대상및방법 1. 실험재료및방법몸무게가평균 3.5 kg (3.5±0.24 kg) 인생후 3-6개월된수컷가토 (New Zealand white rabbit; Jung-Ang Lab Animal Inc., Seoul, Korea) 24마리의우측슬관절을대상으로하였으며내측관절도달법을이용하여가토의대퇴골의연골을노출시킨후에대퇴골의슬개골구에 3 mm 지름의드릴을이용하여세로 6 mm, 가로 3 mm로연골결손을만든후 15번수술칼을이용하여이부위에연골하골의손상이없게조금씩연골을제거하여연골전층결손을만들었다. 총 24마리중 18마리에서는연골전층결손부위에 mm의얇은 Kirschner 강선을이용하여미세골절을하였다 (Fig. 1A, 1B). 2. 실험군설정및처치 24마리의가토의슬관절을 6마리씩무작위배당하여 6마리는슬관절에연골전층결손을만든후에다른처치를하지않고대조군으로하였으며, 다른 18마리는연골전층결손부위에미세골절을하였다. 연골결손부위에미세골절을만든 18마리중 6마리는다른처치를하지않았고다른 6마리의연골결손부위에는섬유성아교 (Green-plast; Korea Green Cross Co., Yongin, Korea) 0.1 ml를충전하였고, 남은 6마리는연골전층결손부위에 0.1 ml 섬유성아교와 recombinant human bone morphogenetic protein-2 (rhbmp-2; R&D systems Inc., Minneapolis, MN, USA) 3 mg 을주 사기에혼합하여연골결손부위를충전하였다 (Fig. 1C). 실험후감염을예방하기위하여겐타마이신 (gentamycin; Kyung Dong Pharm Co., Seoul, Korea) 6 mg/kg을실험후 3일동안투여한후 8 주간동일한조건으로사육하였다. 실험 8주째에각가토를희생시킨후내측관절도달법을이용하여슬관절의실험부위를노출한후에슬관절의연골에손상이가지않게조심스럽게슬관절주위의연부조직을제거한후에실험부위를포함한대퇴골의과상부를채취하였다. 동일하게처치된실험군 6마리중 3마리는현미경분석을위하여, 다른 3마리는조직성분분석을위하여사용되었다. 3. 결과분석 1) 현미경관찰각표본을 10% 중성포르말린에 3일간고정하고탈석회용액 (decalcifying agent, Calci-Clear Rapid; National Diagnostics, Atlanta, GA, USA) 으로탈석회화과정을거친후파라핀에포매하여 6 mm 의두께로절제하여조직표본을만들었다. H&E 염색을하고, 글리코스아미노글리칸존재여부를보기위해 alcian blue염색을하여광학현미경에서관찰하였다. 조직학적등급을판정하기위하여 Pineda 등 9) 이제안한방법을사용하였다. 2) 재생된조직의성분분석콜라겐 1형과 2형의정량분석을위하여 real-time polymerase chain reaction (real-time PCR) (LightCycler 1.5 Instrument; Roche Diagnostics, Basel, Switzerland) 을이용하였는데, 15번수술칼을이용하여연골결손부위에재생된조직을주변조직과경계부 A B C Figure 1. Experiment photographs. (A) A 3 6 mm defect is made at the intercondylar notch of rabbit s femur with a 3 mm diameter drill hole (1 2 mm thickness) without subchondral bone damage. (B) Microfracture (arrows) is made with a fine K-wire. (C) The defect (dashed arrow) is filled with fibrin glue and recombinant human morphogenetic protein-2. Table 1. Summary of Real-Time Polymerase Chain Reaction Collagen type Forward primer Reverse primer Universal probe 1 agggagagcctggtgacaa gaagaccttgcaatccgttg #72, Cat. No acagcaggttcacctataccg cccacttaccggtgtgtttc #46, Cat. No
3 243 Influence of rhbmp-2 on the Healing of Articular Cartilage 위에서잘라내어 real-time PCR에사용할조직을준비하였고각콜라겐의상대적정량을비교하기위하여가토의실험부위가아닌반대측슬관절의슬개구부위에서정상관절연골을채취하였다. 1형콜라겐의정량분석을위하여 Universal ProbeLibrary probe (#72, cat.no ; Roche Diagnostics) 을사용하였고 503에서 521 위치에있는 agggagagcctggtgacaa 서열의 primer를사용하였다. 2형콜라겐의정량분석을위하여 Universal ProbeLibrary probe (#46, cat.no ; Roche Diagnostics) 과 578에서 598 위치에있는 acagcaggttcacctataccg 서열의 primer를사용하였고 real-time PCR은 45회 cycle을시행하였다 (Table 1). 3) 통계분석각실험군의 Pineda 점수와콜라겐정량결과를 PASW Statistics ver. 18 (IBM Co., Armonk, NY, USA) 프로그램을이용하여 Kruskal-Wallis test로분석하였고 p<0.05의결과를통계적으로유의한것으로하였다. 결과 1. 현미경관찰 1) 조직염색 H&E 염색결과, 연골결손부위를섬유성아교와 rhbmp-2로충전한실험군의연골결손부위는주변경계연골과비슷한두께의연골이형성되었으며, 연골하골조직에서도골재형성이되었으며주위정상연골하골과비슷한두께로재형성되었다 (Fig. 2). Alcian blue 염색결과, 섬유성아교와 rhbmp-2로충전한실험군의연골결손부위가뚜렷이염색되었으며, 연골의배열이일정하게정렬되어연골조직과연골하골조직이명확하게구분되었다 (Fig. 3). 2) Pineda의조직학적등급미세골절후에섬유성아교와 rhbmp-2를충전한실험군에서 4.00±0.00점으로가장낮은점수를보였다 (p<0.05). 섬유성아교 A A B B C C Figure 2. Photographs of H&E stain ( 40). (A) Cartilage defect only. (B) Treatment with microfracture. (C) Treatment with microfracture and fibrin glue. (D) Treatment with microfracture, fibrin glue, and recombinant human bone morphogenetic protein-2 (rhbmp-2). The defect filled with fibrin glue and rhbmp-2 demonstrated more cartilagenous tissue and replacement of subchondral bone. The arrows indicate the boundary between the preexisting articular cartilage and the repair tissues. RC, repair cartilage; NC, normal cartilage. D Figure 3. Photographs of Alcian blue stain ( 40). (A) Cartilage defect only. (B) Treatment with microfracture. (C) Treatment with microfracture and fibrin glue. (D) Treatment with microfracture, fibrin glue, and recombinant human bone morphogenetic protein-2 (rhbmp-2). These findings demonstrated the presence of greater amounts of hyaline cartilage in the group treated with microfracture, fibrin glue and rhbmp-2. The arrows indicate the boundary between the preexisting articular cartilage and the repair tissues. RC, repair cartilage; NC, normal cartilage. D
4 244 Suk Ha Lee, et al. Table 2. Histological Scores of Articular Cartilage Defect Category Variable Filling of Integration Staining of Cellular Architecture Architecture Reformation Total Bone repair defect at margin matrix morphology within defect of surface of tidemark score CD 1.66± ± ± ± ± ± ± ± ±3.05 CD+MF 0.33± ± ± ± ± ± ± ± ±2.08 CD+MF+FG 0.02± ± ± ± ± ± ± ± ±1.45 CD+MF+FG+rhBMP 0.00± ± ± ± ± ± ± ± ±2.10 p-value Values are presented as mean±standard deviation. The score for defects treated with rhbmp-2 was significantly different (p<0.05) from that for the other defects. CD, cartilage defect; MF, microfracture; FG, fibrin glue; rhbmp, recombinant human morphogenetic protein Collagen type 1 Collagen type 만충전한실험군과섬유성아교와 rhbmp-2 를충전한실험군의 조직등급각항목을비교하였을때 Pineda 의조직등급에기재되 어있는여덟가지항목중 integration at margin, staining of matrix, cellular morphology, bone repair, reformation of tidemark 의다섯 가지항목에서섬유성아교와 rhbmp-2 를충전한실험군이더낮 은점수를보였다 (p<0.05; Table 2). 2. 재생된조직의성분분석 Figure 4. Results of real-time polymerase chain reaction in each group. Group filled with fibrin glue and recombinant human morphogenetic protein-2 after microfracture demonstrated a higher amount of collagen type 1 and collagen type 2. Real-time PCR 을이용한콜라겐의정량분석은정상연골의콜 라겐성분에대한상대적정량방법으로, 정상연골의콜라겐정 량을 1 이라는절대값으로하고각각의결과를상대적정량값을 표시하였다. 연골결손만만든실험군의콜라겐 1 형은평균 0.5± 0.03, 콜라겐 2 형은평균 0.5±0.03 였으며, 연골결손부위에미세 골절을한실험군의콜라겐 1 형은평균 3.98±0.2, 콜라겐 2 형은 평균 0.95±0.36 이었다. 연골결손부위에미세골절후섬유성아 교를충전한실험군의콜라겐 1 형은평균 1.42±0.17, 콜라겐 2 형 은평균 0.84±0.05 였고연골결손부위에미세골절후섬유성아 교와 rhbmp-2 를충전한실험군의콜라겐 1 형은평균 3.92±0.12, 콜라겐 2형은평균 8.82±0.41이었다 (Fig. 4). 이들값을 Kruskal- Wallis test를이용하여검정한결과, 콜라겐 1형과 2형모두에서차이를보였고, 이는통계적으로유의하였다 (p<0.05). 고찰 관절연골은불충분한혈액공급을갖고있는조직으로관절연골에손상이발생하였을경우에관절연골의재생및복원이어렵다고알려져있다. 10) 관절연골이부분손상되었을경우에는손상부위에연골모세포의접근이불가능하기때문에자연치유가되지않으나관절연골의전층손상에서는연골하골조직의노출로골수줄기세포가손상부위에접근할수있어서연골의재형성이가능하다고알려져있다. 11,12) 이런특성을고려하여, Steadman 등 13) 이인위적으로연골결손부위에연골하골조직을노출시킨후에여러개의구멍을만들어서연골결손부위로골수줄기세포가도달할수있게하여연골의재형성을촉진시키는미세골절기법을소개한이후로슬관절및족관절의관절연골병변에대하여임상적으로많이사용되고있다 ) 그러나장기간의추시관찰에서미세골절후에재형성된연골부위는관절연골의초자연골성분이아닌섬유연골조직으로복원되며, 이섬유연골은초자연골보다물리적으로약하기때문에퇴행성변화가빨리발생하는문제점들이보고되고있다. 17,18) 최근에는이러한조직학적문제를극복하기위하여 transforming growth factor (TGF)-P, fibroblast growth factor (FGF)-2, bfgf 같은성장인자등을이용한조직공학의연구가진행되고있다. 7,19,20) BMP 중에 BMP-7이미세골절과상호작용하여관절연골이초자연골로치유되는것을촉진한다고보고되었으며, 21) BMP-2는염증성관절의관절연골에서는 interleukin-1 (IL-1) 의반작용때문에 BMP-2 단독으로는관절연골의복원을유도하지못하는것으로알려져있으나, 8) IL-1의영향이없는환경에서연골과골표지자의표현을유도하는것으로알려져있으며, 생체내에서도연골과골형성을유도하는것으로알려져있다. 22,23) 본연구는관절연골전층결손부위에 BMP-2의투여가관절
5 245 Influence of rhbmp-2 on the Healing of Articular Cartilage 연골의재생과연골하골조직의재형성을유도할수있는지를알기위하여실험을시행하였다. 본연구에서는관절연골결손부위에서재생정도및재생의질을평가하기위하여 Pineda의조직등급 9) 을사용하였으며, 이는 8개의항목에대하여각각의점수를책정하여연골조직의재생정도를판정하는방법으로, 총점이 0 점 ( 정상연골 ) 에서 31점 ( 재생이안된연골 ) 으로총점이높아질수록연골의재생이불완전함을의미한다. Pineda 조직등급의총점수를각실험군별로비교하였을때미세골절후섬유성아교와 rhbmp-2를같이충전한실험군이 5.00±0.00으로가장낮은점수를보였으며이는 rhbmp-2가연골의재생을정상연골에보다가깝게촉진하는것으로해석할수있다. 연골하골조직이불완전하게재형성이되었을때에는연골하골조직이본연의강성보다더경직되어충격흡수의역할이소실되며, 불충분한혈관공급을형성하여관절연골에충분한혈액공급을하지못하게되고, 연골하골조직에서연골의재형성에영향을미치는 insunlin-like growth factor-1, TGF-1 등이유리되어관절연골의복원을억제되거나골관절염으로진행된다 ) 따라서, 관절연골결손의복원에서연골하골조직의재형성도연골의복원및골관절염으로진행을억제하는데중요한역할을한다. 본연구에서 rhbmp-2를충전한실험군의 Pineda 조직등급의각항목을분석한결과, 연골하골조직의재배치항목과 tidemark의재형성항목에서다른항목에비교하여낮은점수를보였는데, 이는 rhbmp-2의골유도의특성때문인것으로판단된다. 즉 rhbmp-2는연골아세포의분화를촉진할뿐아니라골아세포의분화를동시에촉진하여미세골절만을한다른군보다빨리골의재형성을유도한것으로판단된다. 본연구에서관찰된연골하골의재형성은재생된연골이보다확고히연골하골조직과유착을이뤄서연골조직이물리적외력에더저항력을가질수있게도움을줄수있을것으로생각되며충분한혈액공급및골관절염유발인자들의유리억제를통하여연골복원에도도움을줄수있을것으로생각된다. Real-time PCR로재생된조직의콜라겐의정량분석을한결과, 연골결손만만든실험군에서는콜라겐 1형및 2형이모두낮게나왔는데이는연골결손부위에복원이잘되지않아서콜라겐 1형및 2형이모두낮게검출되는것으로판단되며, 섬유성아교와 rhbmp-2를충전한실험군에서는콜라겐 1형이 3.92, 콜라겐 2형이 8.82로높게나왔는데, 이는 1군과는달리왕성한복원이이루어지고있음을나타낸다. 특히콜라겐 2형은다른군보다상대적으로높게검출되어재생된관절연골이초자연골에가깝게재생되었다는것으로해석할수있다. 따라서관절연골의결손부위에미세골절만을한경우보다는 rhbmp-2를투여하는것이초자연골형성을촉진할수있을것으로판단된다. 다만제섬유성아교와 rhbmp-2를충전한실험군에서콜라겐 1형이다른군에비하여많이검출된이유는조직의치유가왕성하게진행되어 콜라겐 1형이많이검출된것으로판단된다. Real-time PCR의결과에서예상과는달리, 섬유성아교만을충전한실험군의콜라겐 1형은 0.84, 콜라겐 2형은 1.42로미세골절만을만든 2군에비하여콜라겐 1형과 2형모두낮게검출되어섬유성아교가치유과정을저해하는결과를보였다. 조직의특성에따라섬유성아교의작용에대한논란이있기때문에 27-30) 본연구에서는섬유성아교를단독으로사용하였을경우와 rhbmp-2를혼합하여사용하였을경우에발생할수있는실험결과를비교하기위하여섬유성아교를사용하였다. 섬유성아교는일종의매개체로많이사용되고있는데혈관이풍부한조직에서는섬유성아교가 fibrin clot의형성을억제하여치유과정을저해하며, 인대또는연골같이혈관이약한부위에서는섬유성아교와성장인자를같이투여하면손상된조직의재생을촉진시킬수있다고알려져있다 ) 본연구에서섬유성아교를단독으로사용하였을때에보인낮은콜라겐형성은섬유성아교가미세골절부위에서 fibrin clot이형성되는것을오히려억제하여치유과정을저해하는것으로생각할수도있으나 Pineda 점수에서는섬유성아교를사용한경우에더좋은점수를보인것을감안할때, 본연구의제한점인실험개체수부족에따른데이터오류도고려해야할것으로생각된다. 그러나섬유성아교와 rhbmp-2를충전한실험군의콜라겐의정량분석결과를봤을때, 섬유성아교와성장인자를같이투여할경우에는섬유성아교가성장인자를전달하기위한매개체로작용하여조직의치유과정을촉진하는것으로판단된다. 본연구는실험개체수가충분하지않다는큰제한점이있다. 총 24마리로각군별로배정된개체수가 6마리이며, 이를다시조직분석에 3마리씩, 콜라겐정량분석에 3마리씩할당하였기때문실험결과를분석하고통계적의의를부여하는것에제한이있을수있다. 또한 real-time PCR을이용한콜라겐의정량분석시에 house keeping 유전자를통한유전자들의 mrna level을보정하지못한실험적약점으로본연구의실험값에대한절대적신뢰성이부족하다는약점이있다. 그리고실험기간이 8주로비교적짧아서 rhbmp-2의효과시점과장기효과에대한분석이부족하다는제한점이있다. 다만본연구는연골전층결손부위에서 rhbmp-2가단기간에결손부위재생에미치는영향을분석하는데의의가있을수있으며, 앞서기술한실험적약점을보정하여장기효과에대한분석을위한실험등이추가적으로필요할것으로생각된다. 결론 본연구에서는 BMP 중상용화되어쉽게이용할수있는 rhbmp- 2를연골결손부위에충전하여연골결손부위에서연골의재생을보다효과적으로촉진하는결과를얻을수있었으며, 미세골
6 246 Suk Ha Lee, et al. 절후섬유성아교와 rhbmp-2는관절연골결손부위에서연골치유를촉진시키고초자연골에근접하게연골이치유되게도움을줄수있을것으로생각된다. CONFLICTS OF INTEREST The authors have nothing to disclose. REFERENCES 1. Urist MR. Bone: formation by autoinduction. Science. 1965; 150: Bostrom M, Lane JM, Tomin E, et al. Use of bone morphogenetic protein-2 in the rabbit ulnar nonunion model. Clin Orthop Relat Res. 1996;327: Jones AL, Bucholz RW, Bosse MJ, et al; BMP-2 Evaluation in Surgery for Tibial Trauma-Allgraft (BESTT-ALL) Study Group. Recombinant human BMP-2 and allograft compared with autogenous bone graft for reconstruction of diaphyseal tibial fractures with cortical defects. A randomized, controlled trial. J Bone Joint Surg Am. 2006;88: Boyne PJ, Lilly LC, Marx RE, et al. De novo bone induction by recombinant human bone morphogenetic protein-2 (rh- BMP-2) in maxillary sinus floor augmentation. J Oral Maxillofac Surg. 2005;63: McKay WF, Peckham SM, Badura JM. A comprehensive clinical review of recombinant human bone morphogenetic protein-2 (INFUSE Bone Graft). Int Orthop. 2007;31: Siebert CH, Schneider U, Sopka S, Wahner T, Miltner O, Niedhart C. Ingrowth of osteochondral grafts under the influence of growth factors: 6-month results of an animal study. Arch Orthop Trauma Surg. 2006;126: Siebert CH, Miltner O, Weber M, Sopka S, Koch S, Niedhart C. Healing of osteochondral grafts in an ovine model under the influence of bfgf. Arthroscopy. 2003;19: Wim B, Peter M, Scharstuhl A, Henk M. Tissue engineering, cells, scaffolds, and growth factors. Clin Orthop Relat Res. 2001;391: Pineda S, Pollack A, Stevenson S, Goldberg V, Caplan A. A semiquantitative scale for histologic grading of articular cartilage repair. Acta Anat (Basel). 1992;143: Mankin HJ. The response of articular cartilage to mechanical injury. J Bone Joint Surg Am. 1982;64: Buckwalter JA. Articular cartilage: injuries and potential for healing. J Orthop Sports Phys Ther. 1998;28: Wei X, Gao J, Messner K. Maturation-dependent repair of untreated osteochondral defects in the rabbit knee joint. J Biomed Mater Res. 1997;34: Steadman JR, Rodkey WG, Singleton SB, Britts KK. Microfracture technique for full-thickness chondral defects: technique and clinical results. Oper Tech Orthop. 1997;7: Steadman JR, Briggs KK, Rodrigo JJ, Kocher MS, Gill TJ, Rodkey WG. Outcomes of microfracture for traumatic chondral defects of the knee: average 11-year follow-up. Arthroscopy. 2003;19: Blevins FT, Steadman JR, Rodrigo JJ, Silliman J. Treatment of articular cartilage defects in athletes: an analysis of functional outcome and lesion appearance. Orthopedics. 1998;21: Steadman JR, Rodkey WG, Rodrigo JJ. Microfracture: surgical technique and rehabilitation to treat chondral defects. Clin Orthop Relat Res. 2001;391 Suppl:S Frisbie DD, Trotter GW, Powers BE, et al. Arthroscopic subchondral bone plate microfracture technique augments healing of large chondral defects in the radial carpal bone and medial femoral condyle of horses. Vet Surg. 1999;28: Steadman RJ, Rodkey WG, Singleton SB, et al. Microfracture procedure for treatment of full-thickness chondral defects: technique, clinical results, and current basic science status. In: Harner CD, Vince KG, Fu FH, ed. Techniques in knee sur gery. Philadelphia: Lippincott Williams & Wilkins; Kang SW, Bada LP, Kang CS, et al. Articular cartilage regeneration with microfracture and hyaluronic acid. Biotechnol Lett. 2008;30: Ishii I, Mizuta H, Sei A, Hirose J, Kudo S, Hiraki Y. Healing of full-thickness defects of the articular cartilage in rabbits using fibroblast growth factor-2 and a fibrin sealant. J Bone Joint Surg Br. 2007;89: Kuo AC, Rodrigo JJ, Reddi AH, Curtiss S, Grotkopp E, Chiu M. Microfracture and bone morphogenetic protein 7 (BMP-7) synergistically stimulate articular cartilage repair. Osteoarthritis Cartilage. 2006;14: Katagiri T, Yamaguchi A, Ikeda T, et al. The non-osteogenic mouse pluripotent cell line, C3H10T1/2, is induced to differentiate into osteoblastic cells by recombinant human bone morphogenetic protein-2. Biochem Biophys Res Commun. 1990;172:295-9.
7 247 Influence of rhbmp-2 on the Healing of Articular Cartilage 23. Thies RS, Bauduy M, Ashton BA, Kurtzberg L, Wozney JM, Rosen V. Recombinant human bone morphogenetic protein-2 induces osteoblastic differentiation in W stromal cells. Endocrinology. 1992;130: Li B, Aspden RM. Mechanical and material properties of the subchondral bone plate from the femoral head of patients with osteoarthritis or osteoporosis. Ann Rheum Dis. 1997;56: Conaghan PG, Vanharanta H, Dieppe PA. Is progressive osteoarthritis an atheromatous vascular disease? Ann Rheum Dis. 2005;64: Shibakawa A, Yudoh K, Masuko-Hongo K, Kato T, Nishioka K, Nakamura H. The role of subchondral bone resorption pits in osteoarthritis: MMP production by cells derived from bone marrow. Osteoarthritis Cartilage. 2005;13: Thomopoulos S, Soslowsky LJ, Flanagan CL, et al. The effect of fibrin clot on healing rat supraspinatus tendon defects. J Shoulder Elbow Surg. 2002;11: Lusardi DA, Cain JE Jr. The effect of fibrin sealant on the strength of tendon repair of full thickness tendon lacerations in the rabbit Achilles tendon. J Foot Ankle Surg. 1994;33: Stemberger A, Blümel G. Fibrinogen-fibrin conversion and inhibition of fibrinolysis. Thorac Cardiovasc Surg. 1982; 30: Schlag G, Redl H. Fibrin sealant in orthopedic surgery. Clin Orthop Relat Res. 1988;227:
8 248 pissn : , eissn : Original Article J Korean Orthop Assoc 2015; 50: Suk Ha Lee, et al. 재조합골형성단백 -2 가가토의관절연골결손의연골하골재형성및연골치유에미치는영향 이석하 이승준 이종수 안재성 * 건국대학교의학전문대학원건국대학교병원정형외과학교실, * 충남대학교의학전문대학원충남대학교병원정형외과학교실 목적 : 관절연골전층결손이있는가토모델에서재조합골형성단백-2가가토의관절연골결손의연골하골재형성및연골치유에미치는영향을분석하고자한다. 대상및방법 : 24마리의수컷가토의우측대퇴골활차구에 6 3 mm의전층연골결손을만든후에 24마리중 6마리는더이상처치를하지않았으며, 18마리는결손부위에미세골절을하였다. 미세골절한 18마리중 6마리는다른처치를하지않았고다른 6마리는결손부위에섬유성아교를충전하였으며남은 6마리에는결손부위에섬유성아교와재조합골형성단백-2를충전하였다. 수술 8주째에조직학등급점수와 real-time polymerase chain reaction 을이용한콜라겐의성분분석으로미세골절부위에충전된재조합골형성단백-2가관절연골의치유에미치는효과를분석하였다. 결과 : 연골결손부위를섬유성아교와재조합골형성단백-2로충전한 6마리에서조직학적등급점수가더좋았으며, 콜라겐 1형과 2형도더많이검출되었다. 결론 : 미세골절후섬유성아교와재조합골형성단백-2는관절연골결손부위에서연골치유를촉진시키고초자연골에근접하게연골이치유되게도움을줄수있을것으로생각된다. 색인단어 : 관절연골결손, 미세골절, 골형성단백 -2 접수일 2014 년 10 월 2 일수정일 2015 년 2 월 6 일게재확정일 2015 년 3 월 7 일책임저자이승준서울시광진구능동로 120-1, 건국대학교의학전문대학원건국대학교병원정형외과학교실 TEL , FAX , lsjmd@kuh.ac.kr * 이논문은 2009 학년도건국대학교의지원에의하여연구되었음. 대한정형외과학회지 : 제 50 권제 3 호 2015 Copyright 2015 by The Korean Orthopaedic Association This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
( ) Jkra076.hwp
Vol. 11, No. 4, December, 2004 Objective: Ultrasonography (USG) of joints has a unique position for the diagnosis of joint diseases. Bone surface, cartilage, periarticular soft tissue and their pathologic
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information001-학회지소개(영)
Review Article Randomization, What is the Proper Method? Jin Ho Hong, M.D., Jae Chul Yoo, M.D. Shoulder & Sports medicine, Department of Orthopedic Surgery, Samsung Medical Center Purpose: Among the numerous
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information03-이기석/68-79
= Abstract = Effect of Curettage and DBM-CaSO4 Graft for the Treatment of Ischemic Necrosis of the Capital Femoral Epiphysis in Immature Pigs Ki Seok Lee, M.D., Sun-Yong Kim, M.D., In Ho Choi, M.D.* Department
More information1611-01제호
발 행 인 : 안 성 모 편 집 인 : 이 원 균 대한치과의사협회 발행 홈페이지:www.kda.or.kr 주2회발행(월 목) 2008년 1월 21일 (월) 1966년 12월 15일 창간 The Korean Dental Association News 제1611호 구강보건정책관 설치 추진위 출범 알 림 범치과계 단체장 참여 첫 회의 치과 의료계 전담부서인 보건
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information스포츠과학 143호 내지.indd
https simtk.org,, sanghyuk0620@kspo.or.kr.... 48 SPORT SCIENCE . 33 55% 1 2 Iwamoto and Takeda 2003 3 1 3.......?... 4 SPORT SCIENCE 1. 2 3 12 16 3 6.. 5 strain gauge. 1970. 6 1) Brukner, P., Bradshaw,
More informationI 서론 치과용 임플란트는 Brånemark 등1의 골유착 (osseointegration) 발견 이후 끊임없는 발전 을 거듭해 왔다. Brånemark 등 1 이 밝혀낸 골 유착은 임플란트의 표면과 living bone 사이에 연조직 층 의 생성이 없이 직접 골조직이
ISSN 1229-5418 ; 17(4): 268~274 임플란트 드릴링 시 발생하는 열과 그 원인에 대한 분석 한선희 1, 김병국 2, 김범익 2 1 서울대학교 치의학대학원 치주과학교실, 2 오스템임플란트연구소 Temperature Measurement during Implant-site Preparation Seon-Hee Han 1, Byoung Kook
More information00)14-1목차1~3
Effect of the bovine collagen matrix on bone formation in rat calvarial and mandibular defects Jeong-Ho Yun 1, Jee-Hee Jung 2, Jin-Woo Kim 2, Chang-Sung Kim 2, Seong-Ho Choi 2, Kyoo-Sung Cho 2 1 Department
More information<342EBEC8BCBABFAD2CB9DAC7E2C1D82E687770>
大 韓 癩 學 會 誌 : 第 41 卷, 第 1 號 2008 Korean Leprosy Bulletin, Vol. 41, No. 1, June, 2008 마비성 하안검 외반증에 대한 lateral tarsal strip의 재조명 안성열 성형외과의원 1), 제일병원 피부과 2) 안성열 1), 박향준 2) - Abstract - Reappraisal of the
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information109~120 õÃʾàħ Ä¡·á
109 DOI : 10.3831/KPI.2010.13.3.109 Received : 10. 08. 13 Revised : 10. 09. 06 A Case Study Of Patients With Knee Joint Pain Treated With Rubiae Radix Pharmacopuncture Accepted : 10. 09. 07 Key Words:
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information슬라이드 1
Examination of the Knee 기능해부학 functional anatomy Knee joint 의구성 - distal of femur + med, lat epicondyle of tibia - meniscus : fibroscartliage : knee joint에내, 외측에부착된연골륜 : 외측 < 내측, 내측이외상받기쉽다 http://www.eorthopod.com/images/contentimages/knee/knee_anatomy/knee_anatomy01.jpg
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationSpecial Issue Rehabilitation of Running Injuries Ki Un Jang, M.D. Department of Rehabilitation Medicine Hallym University College of Medicine Hangang
Rehabilitation of Running Injuries Ki Un Jang, M.D. Department of Rehabilitation Medicine Hallym University College of Medicine Hangang Sacred Heart Hospital Email : jangkiun@hanmail.net Abstract Running
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
More information975_983 특집-한규철, 정원호
Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information........-55..9.30
MYONGJI ST. MARY S HOSPITAL EXCELLENT STROKE TREATMENT CENTER The president of Myongji St. Mary s Hospital M.D. HUH, CHOON WOONG Graduated from Seoul Catholic Medical College. Achived M.D. in Neurosurgeon.
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /
,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;
More information00)14-1목차1~3
The effect of MBCP TM bone regeneration in osteoporosis induced rats Won Hee Kim, Jeong Kyung Kang, Jae Jun Ryu Dept.of esthetic restorative dentistry, Graduate School of Clinical Dentistry, Korea University
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationuntitled
ISSN 1225-1682 (Print) ISSN 2287-9293 (Online) 대한골절학회지제 29 권, 제 3 호, 2016 년 7 월 J Korean Fract Soc 2016;29(3):200-205 http://dx.doi.org/10.12671/jkfs.2016.29.3.200 Case Report 성인환자에서발생한동측의대퇴골간부골절에동반된전십자인대대퇴골부착부견열골절
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information04-07도현수
대 한 외 상 학 회 지 Vol. 19, No. 2, December, 2006 원 저 임상실습과정 의과대학생을 대상으로 카데바 모델을 이용한 단순 봉합술 교육의 효율성 충남대학교 의과대학 응급의학교실 Abstract 도현수 민진홍 홍승우 한상균 김인수 유@ 승 이진웅 김승환 유인술 Evaluation of the Educational Efficacy of
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou
제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuous vs single injection, interscalene vs supraclavicular approach 의정부성모병원
More information종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 정복이 안된 상태로 치료 시에는 추후 지속적인 족부 동통의 원인이 되며, 이런 동통으로 인해 종골에 대해 구제술이나 2차적 재건술이 필요할 수도 있다. 2) 경종골 거주상 관절 탈구는 외국 문헌에 증례
CSE REPORT 대한족부족관절학회지 제16권 제4호 2012 J Korean Foot nkle Soc. Vol. 16. No. 4. pp.270-275, 2012 종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 인제대학교 의과대학 일산백병원 정형외과 차성무 장보훈 서진수 Treatment of Talonavicular Subluxation
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information<31352DC0CCB1E2BAB42DBFF8C0FA2DBFCF2D E687770>
大韓膝關節學會誌ㆍ第 18 卷ㆍ第 2 號 Volume 18, Number 2, December 2006 슬관절연골병변에대한관절경과일상적 MRI 의비교 = 국문초록 = 한림대학교의과대학한림대성심병원정형외과학교실, 영상의학교실 * 이기병ㆍ고성혜 * ㆍ권덕주ㆍ서규남ㆍ이남규 목적 : 연골을평가하기위한 MRI 촬영기법이포함되지않은일상적슬관절 MRI가연골병변에대하여어느정도예측가능한지관절경과비교하고분석하여,
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More informationThe Journal of the Korean Society of Fractures Vol.11, No.3, July, 1998 Department of Orthopaedic Surgery, College of Medicine Chungnam National Unive
The Journal of the Korean Society of Fractures Vol11, No3, July, 1998 Department of Orthopaedic Surgery, College of Medicine Chungnam National University Hospital, Taejon, Korea and Taejon Sungshim General
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 3~30 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 01. 08 2016. 01. 09 2016. 02. 25 ABSTRACT
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationOriginal Article J Korean Orthop Assoc 2010; 45: doi: /jkoa 거골의연골병변에대한관절경적치료 Arthroscopic Treatment for Carti
Original Article J Korean Orthop Assoc 2010; 45: 433-439 doi:10.4055/jkoa.2010.45.6.433 www.jkoa.org Arthroscopic Treatment for Cartilage Lesions of the Talus 곽희철 김주용 최장석 김창완 김정한 박대현인제대학교의과대학정형외과학교실부산백병원
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationDBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 273~299 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 24 2016. 06. 26 ABSTRACT e-
More informationFluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College
More informationMicrosoft PowerPoint - 발표자료(KSSiS 2016)
Sang Jun Kim, MD, PhD Application of 3D Printing in the Orthotic Fields Hallux Valgus, Charcot Marie Tooth, ADL Kit, Foot Insole, Wrist Pain, Foot Drop Development of Automated Program for Ankle Foot Orthosis
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More information