241 pissn : 1226-2102, eissn : 2005-8918 Original Article J Korean Orthop Assoc 2015; 50: 241-248 http://dx.doi.org/10.4055/jkoa.2015.50.3.241 www.jkoa.org 재조합골형성단백 -2 가가토의관절연골결손의연골하골재형성및연골치유에미치는영향 이석하 이승준 이종수 안재성 * 건국대학교의학전문대학원건국대학교병원정형외과학교실, * 충남대학교의학전문대학원충남대학교병원정형외과학교실 Influence of Recombinant Human Bone Morphogenetic Protein-2 on the Remodeling of Subchondral Bone and Cartilage Healing in the Articular Cartilage Defect of the Rabbit Suk Ha Lee, M.D., Ph.D., Seoung-Joon Lee, M.D., Ph.D., Jong Soo Lee, M.D., and Jaesung Ahn, M.D.* Department of Orthopedic Surgery, Konkuk University Medical Center, Konkuk University School of Medicine, Seoul, *Department of Orthopedic Surgery, Chungnam National University Hospital, Chungnam National University School of Medicine, Daejeon, Korea Purpose: The purpose of this study is to evaluate the effects of recombinant human bone morphogenetic protein-2 (rhbmp-2) after microfracture on the remodeling of subchondral bone and cartilage healing in a model of full-thickness articular cartilage injury in a rabbit. Materials and Methods: A full thickness articular cartilage defect of 6 3-mm-size was created in the trochlear groove of the right femur in 24 rabbits. The defect was left empty in six rabbits, and microfracture was done in 18 rabbits. After microfracture, no treatment was done in six rabbits, defect was filled with fibrin glue in six rabbits, and with fibrin glue and rhbmp-2 in six rabbits. The effect of rhbmp-2 after microfracture was evaluated based on histological analysis and real-time polymerase chain reaction (PCR) for analysis of collagen type at 8 weeks after surgery. Results: The score of histological grade scale of six rabbits in which the defect was filled with fibrin glue and rhbmp-2 was better than that of others and real-time PCR also showed a higher amount of collage type 1 and collage type 2 in these six rabbits. Conclusion: We consider that fibrin glue and rhbmp-2 after microfracture may accelerate cartilage healing in an articular cartilage defect and maybe helpful in healing the articular cartilage defect into more closely native hyaline cartilage. Key words: articular cartilage defect, microfracture, bone morphogenetic protein-2 서론 골형성단백 (bone morphogenetic protein, BMP) 은 1965 년에 Urist 1) 에의해처음으로보고되었으며, Bostrom 등 2) 은 BMP-2, Received October 2, 2014 Revised February 6, 2015 Accepted March 7, 2015 Correspondence to: Seoung-Joon Lee, M.D., Ph.D. Department of Orthopedic Surgery, Konkuk University Medical Center, Konkuk University School of Medicine, 120-1 Neungdong-ro, Gwangjin-gu, Seoul 143-729, Korea TEL: +82-2-2030-7616 FAX: +82-2-2030-7369 E-mail: lsjmd@kuh.ac.kr *This paper was supported by Konkuk University in 2009. BMP-4가내연골성및막성골절치유에관여한다는것을밝혔다. 이후에 BMP-2를이용한골재형성실험연구들이보고되었으며 3-5) 현재 BMP-2는골결손이있는부위에골이식대체물로상품화되어임상적으로이용되고있다. BMP-2는골유도작용이외에도관절연골의당단백합성을자극하여관절연골의복원을유도하는작용이있으며, 이러한 BMP-2 의특성을이용하여관절연골의복원을시도하는실험연구결과들이보고되고있으나 6,7) 염증성관절의관절연골에서는 BMP-2 단독으로관절연골의복원을유도하지못하는것으로알려져있다. 8) 본연구는 BMP-2의특성을이용하여관절연골의전층결손부위에미세골절 (microfracture) 을한후 BMP-2를충전하여 BMP-2가관절 The Journal of the Korean Orthopaedic Association Volume 50 Number 3 2015 Copyright 2015 by The Korean Orthopaedic Association This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
242 Suk Ha Lee, et al. 연골치유에미치는영향을알아보고자한다. 대상및방법 1. 실험재료및방법몸무게가평균 3.5 kg (3.5±0.24 kg) 인생후 3-6개월된수컷가토 (New Zealand white rabbit; Jung-Ang Lab Animal Inc., Seoul, Korea) 24마리의우측슬관절을대상으로하였으며내측관절도달법을이용하여가토의대퇴골의연골을노출시킨후에대퇴골의슬개골구에 3 mm 지름의드릴을이용하여세로 6 mm, 가로 3 mm로연골결손을만든후 15번수술칼을이용하여이부위에연골하골의손상이없게조금씩연골을제거하여연골전층결손을만들었다. 총 24마리중 18마리에서는연골전층결손부위에 0.762 mm의얇은 Kirschner 강선을이용하여미세골절을하였다 (Fig. 1A, 1B). 2. 실험군설정및처치 24마리의가토의슬관절을 6마리씩무작위배당하여 6마리는슬관절에연골전층결손을만든후에다른처치를하지않고대조군으로하였으며, 다른 18마리는연골전층결손부위에미세골절을하였다. 연골결손부위에미세골절을만든 18마리중 6마리는다른처치를하지않았고다른 6마리의연골결손부위에는섬유성아교 (Green-plast; Korea Green Cross Co., Yongin, Korea) 0.1 ml를충전하였고, 남은 6마리는연골전층결손부위에 0.1 ml 섬유성아교와 recombinant human bone morphogenetic protein-2 (rhbmp-2; R&D systems Inc., Minneapolis, MN, USA) 3 mg 을주 사기에혼합하여연골결손부위를충전하였다 (Fig. 1C). 실험후감염을예방하기위하여겐타마이신 (gentamycin; Kyung Dong Pharm Co., Seoul, Korea) 6 mg/kg을실험후 3일동안투여한후 8 주간동일한조건으로사육하였다. 실험 8주째에각가토를희생시킨후내측관절도달법을이용하여슬관절의실험부위를노출한후에슬관절의연골에손상이가지않게조심스럽게슬관절주위의연부조직을제거한후에실험부위를포함한대퇴골의과상부를채취하였다. 동일하게처치된실험군 6마리중 3마리는현미경분석을위하여, 다른 3마리는조직성분분석을위하여사용되었다. 3. 결과분석 1) 현미경관찰각표본을 10% 중성포르말린에 3일간고정하고탈석회용액 (decalcifying agent, Calci-Clear Rapid; National Diagnostics, Atlanta, GA, USA) 으로탈석회화과정을거친후파라핀에포매하여 6 mm 의두께로절제하여조직표본을만들었다. H&E 염색을하고, 글리코스아미노글리칸존재여부를보기위해 alcian blue염색을하여광학현미경에서관찰하였다. 조직학적등급을판정하기위하여 Pineda 등 9) 이제안한방법을사용하였다. 2) 재생된조직의성분분석콜라겐 1형과 2형의정량분석을위하여 real-time polymerase chain reaction (real-time PCR) (LightCycler 1.5 Instrument; Roche Diagnostics, Basel, Switzerland) 을이용하였는데, 15번수술칼을이용하여연골결손부위에재생된조직을주변조직과경계부 A B C Figure 1. Experiment photographs. (A) A 3 6 mm defect is made at the intercondylar notch of rabbit s femur with a 3 mm diameter drill hole (1 2 mm thickness) without subchondral bone damage. (B) Microfracture (arrows) is made with a fine K-wire. (C) The defect (dashed arrow) is filled with fibrin glue and recombinant human morphogenetic protein-2. Table 1. Summary of Real-Time Polymerase Chain Reaction Collagen type Forward primer Reverse primer Universal probe 1 agggagagcctggtgacaa gaagaccttgcaatccgttg #72, Cat. No. 04688953001 2 acagcaggttcacctataccg cccacttaccggtgtgtttc #46, Cat. No. 04688066001
243 Influence of rhbmp-2 on the Healing of Articular Cartilage 위에서잘라내어 real-time PCR에사용할조직을준비하였고각콜라겐의상대적정량을비교하기위하여가토의실험부위가아닌반대측슬관절의슬개구부위에서정상관절연골을채취하였다. 1형콜라겐의정량분석을위하여 Universal ProbeLibrary probe (#72, cat.no. 04688953001; Roche Diagnostics) 을사용하였고 503에서 521 위치에있는 agggagagcctggtgacaa 서열의 primer를사용하였다. 2형콜라겐의정량분석을위하여 Universal ProbeLibrary probe (#46, cat.no. 04688066001; Roche Diagnostics) 과 578에서 598 위치에있는 acagcaggttcacctataccg 서열의 primer를사용하였고 real-time PCR은 45회 cycle을시행하였다 (Table 1). 3) 통계분석각실험군의 Pineda 점수와콜라겐정량결과를 PASW Statistics ver. 18 (IBM Co., Armonk, NY, USA) 프로그램을이용하여 Kruskal-Wallis test로분석하였고 p<0.05의결과를통계적으로유의한것으로하였다. 결과 1. 현미경관찰 1) 조직염색 H&E 염색결과, 연골결손부위를섬유성아교와 rhbmp-2로충전한실험군의연골결손부위는주변경계연골과비슷한두께의연골이형성되었으며, 연골하골조직에서도골재형성이되었으며주위정상연골하골과비슷한두께로재형성되었다 (Fig. 2). Alcian blue 염색결과, 섬유성아교와 rhbmp-2로충전한실험군의연골결손부위가뚜렷이염색되었으며, 연골의배열이일정하게정렬되어연골조직과연골하골조직이명확하게구분되었다 (Fig. 3). 2) Pineda의조직학적등급미세골절후에섬유성아교와 rhbmp-2를충전한실험군에서 4.00±0.00점으로가장낮은점수를보였다 (p<0.05). 섬유성아교 A A B B C C Figure 2. Photographs of H&E stain ( 40). (A) Cartilage defect only. (B) Treatment with microfracture. (C) Treatment with microfracture and fibrin glue. (D) Treatment with microfracture, fibrin glue, and recombinant human bone morphogenetic protein-2 (rhbmp-2). The defect filled with fibrin glue and rhbmp-2 demonstrated more cartilagenous tissue and replacement of subchondral bone. The arrows indicate the boundary between the preexisting articular cartilage and the repair tissues. RC, repair cartilage; NC, normal cartilage. D Figure 3. Photographs of Alcian blue stain ( 40). (A) Cartilage defect only. (B) Treatment with microfracture. (C) Treatment with microfracture and fibrin glue. (D) Treatment with microfracture, fibrin glue, and recombinant human bone morphogenetic protein-2 (rhbmp-2). These findings demonstrated the presence of greater amounts of hyaline cartilage in the group treated with microfracture, fibrin glue and rhbmp-2. The arrows indicate the boundary between the preexisting articular cartilage and the repair tissues. RC, repair cartilage; NC, normal cartilage. D
244 Suk Ha Lee, et al. Table 2. Histological Scores of Articular Cartilage Defect Category Variable Filling of Integration Staining of Cellular Architecture Architecture Reformation Total Bone repair defect at margin matrix morphology within defect of surface of tidemark score CD 1.66±0.57 2.33±0.57 2.66±0.57 3.66±1.15 2.66±1.15 2.66±0.57 2.66±0.57 3.33±0.57 21.66±3.05 CD+MF 0.33±0.57 1.33±0.57 2.33±0.70 2.33±0.57 1.66±0.57 1.66±0.57 2.33±0.57 1.66±0.57 13.66±2.08 CD+MF+FG 0.02±0.04 1.08±0.60 1.24±0.86 1.12±0.98 1.24±1.16 1.72±0.90 1.68±0.94 1.63±1.27 7.68±1.45 CD+MF+FG+rhBMP 0.00±0.00 1.00±0.47 0.83±0.81 0.71±0.36 1.12±1.24 1.50±0.85 0.40±0.05 0.42±0.76 4.50±2.10 p-value 0.062 0.0374 0.0387 0.0258 0.0863 0.0603 0.0406 0.0285 0.0158 Values are presented as mean±standard deviation. The score for defects treated with rhbmp-2 was significantly different (p<0.05) from that for the other defects. CD, cartilage defect; MF, microfracture; FG, fibrin glue; rhbmp, recombinant human morphogenetic protein-2. 10 9 8 7 6 5 4 3 2 1 0 Collagen type 1 Collagen type 2 0.5 0.5 1 3.98 0.95 만충전한실험군과섬유성아교와 rhbmp-2 를충전한실험군의 조직등급각항목을비교하였을때 Pineda 의조직등급에기재되 어있는여덟가지항목중 integration at margin, staining of matrix, cellular morphology, bone repair, reformation of tidemark 의다섯 가지항목에서섬유성아교와 rhbmp-2 를충전한실험군이더낮 은점수를보였다 (p<0.05; Table 2). 2. 재생된조직의성분분석 1.42 0.84 3.92 8.82 Figure 4. Results of real-time polymerase chain reaction in each group. Group filled with fibrin glue and recombinant human morphogenetic protein-2 after microfracture demonstrated a higher amount of collagen type 1 and collagen type 2. Real-time PCR 을이용한콜라겐의정량분석은정상연골의콜 라겐성분에대한상대적정량방법으로, 정상연골의콜라겐정 량을 1 이라는절대값으로하고각각의결과를상대적정량값을 표시하였다. 연골결손만만든실험군의콜라겐 1 형은평균 0.5± 0.03, 콜라겐 2 형은평균 0.5±0.03 였으며, 연골결손부위에미세 골절을한실험군의콜라겐 1 형은평균 3.98±0.2, 콜라겐 2 형은 평균 0.95±0.36 이었다. 연골결손부위에미세골절후섬유성아 교를충전한실험군의콜라겐 1 형은평균 1.42±0.17, 콜라겐 2 형 은평균 0.84±0.05 였고연골결손부위에미세골절후섬유성아 교와 rhbmp-2 를충전한실험군의콜라겐 1 형은평균 3.92±0.12, 콜라겐 2형은평균 8.82±0.41이었다 (Fig. 4). 이들값을 Kruskal- Wallis test를이용하여검정한결과, 콜라겐 1형과 2형모두에서차이를보였고, 이는통계적으로유의하였다 (p<0.05). 고찰 관절연골은불충분한혈액공급을갖고있는조직으로관절연골에손상이발생하였을경우에관절연골의재생및복원이어렵다고알려져있다. 10) 관절연골이부분손상되었을경우에는손상부위에연골모세포의접근이불가능하기때문에자연치유가되지않으나관절연골의전층손상에서는연골하골조직의노출로골수줄기세포가손상부위에접근할수있어서연골의재형성이가능하다고알려져있다. 11,12) 이런특성을고려하여, Steadman 등 13) 이인위적으로연골결손부위에연골하골조직을노출시킨후에여러개의구멍을만들어서연골결손부위로골수줄기세포가도달할수있게하여연골의재형성을촉진시키는미세골절기법을소개한이후로슬관절및족관절의관절연골병변에대하여임상적으로많이사용되고있다. 14-16) 그러나장기간의추시관찰에서미세골절후에재형성된연골부위는관절연골의초자연골성분이아닌섬유연골조직으로복원되며, 이섬유연골은초자연골보다물리적으로약하기때문에퇴행성변화가빨리발생하는문제점들이보고되고있다. 17,18) 최근에는이러한조직학적문제를극복하기위하여 transforming growth factor (TGF)-P, fibroblast growth factor (FGF)-2, bfgf 같은성장인자등을이용한조직공학의연구가진행되고있다. 7,19,20) BMP 중에 BMP-7이미세골절과상호작용하여관절연골이초자연골로치유되는것을촉진한다고보고되었으며, 21) BMP-2는염증성관절의관절연골에서는 interleukin-1 (IL-1) 의반작용때문에 BMP-2 단독으로는관절연골의복원을유도하지못하는것으로알려져있으나, 8) IL-1의영향이없는환경에서연골과골표지자의표현을유도하는것으로알려져있으며, 생체내에서도연골과골형성을유도하는것으로알려져있다. 22,23) 본연구는관절연골전층결손부위에 BMP-2의투여가관절
245 Influence of rhbmp-2 on the Healing of Articular Cartilage 연골의재생과연골하골조직의재형성을유도할수있는지를알기위하여실험을시행하였다. 본연구에서는관절연골결손부위에서재생정도및재생의질을평가하기위하여 Pineda의조직등급 9) 을사용하였으며, 이는 8개의항목에대하여각각의점수를책정하여연골조직의재생정도를판정하는방법으로, 총점이 0 점 ( 정상연골 ) 에서 31점 ( 재생이안된연골 ) 으로총점이높아질수록연골의재생이불완전함을의미한다. Pineda 조직등급의총점수를각실험군별로비교하였을때미세골절후섬유성아교와 rhbmp-2를같이충전한실험군이 5.00±0.00으로가장낮은점수를보였으며이는 rhbmp-2가연골의재생을정상연골에보다가깝게촉진하는것으로해석할수있다. 연골하골조직이불완전하게재형성이되었을때에는연골하골조직이본연의강성보다더경직되어충격흡수의역할이소실되며, 불충분한혈관공급을형성하여관절연골에충분한혈액공급을하지못하게되고, 연골하골조직에서연골의재형성에영향을미치는 insunlin-like growth factor-1, TGF-1 등이유리되어관절연골의복원을억제되거나골관절염으로진행된다. 24-26) 따라서, 관절연골결손의복원에서연골하골조직의재형성도연골의복원및골관절염으로진행을억제하는데중요한역할을한다. 본연구에서 rhbmp-2를충전한실험군의 Pineda 조직등급의각항목을분석한결과, 연골하골조직의재배치항목과 tidemark의재형성항목에서다른항목에비교하여낮은점수를보였는데, 이는 rhbmp-2의골유도의특성때문인것으로판단된다. 즉 rhbmp-2는연골아세포의분화를촉진할뿐아니라골아세포의분화를동시에촉진하여미세골절만을한다른군보다빨리골의재형성을유도한것으로판단된다. 본연구에서관찰된연골하골의재형성은재생된연골이보다확고히연골하골조직과유착을이뤄서연골조직이물리적외력에더저항력을가질수있게도움을줄수있을것으로생각되며충분한혈액공급및골관절염유발인자들의유리억제를통하여연골복원에도도움을줄수있을것으로생각된다. Real-time PCR로재생된조직의콜라겐의정량분석을한결과, 연골결손만만든실험군에서는콜라겐 1형및 2형이모두낮게나왔는데이는연골결손부위에복원이잘되지않아서콜라겐 1형및 2형이모두낮게검출되는것으로판단되며, 섬유성아교와 rhbmp-2를충전한실험군에서는콜라겐 1형이 3.92, 콜라겐 2형이 8.82로높게나왔는데, 이는 1군과는달리왕성한복원이이루어지고있음을나타낸다. 특히콜라겐 2형은다른군보다상대적으로높게검출되어재생된관절연골이초자연골에가깝게재생되었다는것으로해석할수있다. 따라서관절연골의결손부위에미세골절만을한경우보다는 rhbmp-2를투여하는것이초자연골형성을촉진할수있을것으로판단된다. 다만제섬유성아교와 rhbmp-2를충전한실험군에서콜라겐 1형이다른군에비하여많이검출된이유는조직의치유가왕성하게진행되어 콜라겐 1형이많이검출된것으로판단된다. Real-time PCR의결과에서예상과는달리, 섬유성아교만을충전한실험군의콜라겐 1형은 0.84, 콜라겐 2형은 1.42로미세골절만을만든 2군에비하여콜라겐 1형과 2형모두낮게검출되어섬유성아교가치유과정을저해하는결과를보였다. 조직의특성에따라섬유성아교의작용에대한논란이있기때문에 27-30) 본연구에서는섬유성아교를단독으로사용하였을경우와 rhbmp-2를혼합하여사용하였을경우에발생할수있는실험결과를비교하기위하여섬유성아교를사용하였다. 섬유성아교는일종의매개체로많이사용되고있는데혈관이풍부한조직에서는섬유성아교가 fibrin clot의형성을억제하여치유과정을저해하며, 인대또는연골같이혈관이약한부위에서는섬유성아교와성장인자를같이투여하면손상된조직의재생을촉진시킬수있다고알려져있다. 27-30) 본연구에서섬유성아교를단독으로사용하였을때에보인낮은콜라겐형성은섬유성아교가미세골절부위에서 fibrin clot이형성되는것을오히려억제하여치유과정을저해하는것으로생각할수도있으나 Pineda 점수에서는섬유성아교를사용한경우에더좋은점수를보인것을감안할때, 본연구의제한점인실험개체수부족에따른데이터오류도고려해야할것으로생각된다. 그러나섬유성아교와 rhbmp-2를충전한실험군의콜라겐의정량분석결과를봤을때, 섬유성아교와성장인자를같이투여할경우에는섬유성아교가성장인자를전달하기위한매개체로작용하여조직의치유과정을촉진하는것으로판단된다. 본연구는실험개체수가충분하지않다는큰제한점이있다. 총 24마리로각군별로배정된개체수가 6마리이며, 이를다시조직분석에 3마리씩, 콜라겐정량분석에 3마리씩할당하였기때문실험결과를분석하고통계적의의를부여하는것에제한이있을수있다. 또한 real-time PCR을이용한콜라겐의정량분석시에 house keeping 유전자를통한유전자들의 mrna level을보정하지못한실험적약점으로본연구의실험값에대한절대적신뢰성이부족하다는약점이있다. 그리고실험기간이 8주로비교적짧아서 rhbmp-2의효과시점과장기효과에대한분석이부족하다는제한점이있다. 다만본연구는연골전층결손부위에서 rhbmp-2가단기간에결손부위재생에미치는영향을분석하는데의의가있을수있으며, 앞서기술한실험적약점을보정하여장기효과에대한분석을위한실험등이추가적으로필요할것으로생각된다. 결론 본연구에서는 BMP 중상용화되어쉽게이용할수있는 rhbmp- 2를연골결손부위에충전하여연골결손부위에서연골의재생을보다효과적으로촉진하는결과를얻을수있었으며, 미세골
246 Suk Ha Lee, et al. 절후섬유성아교와 rhbmp-2는관절연골결손부위에서연골치유를촉진시키고초자연골에근접하게연골이치유되게도움을줄수있을것으로생각된다. CONFLICTS OF INTEREST The authors have nothing to disclose. REFERENCES 1. Urist MR. Bone: formation by autoinduction. Science. 1965; 150:893-9. 2. Bostrom M, Lane JM, Tomin E, et al. Use of bone morphogenetic protein-2 in the rabbit ulnar nonunion model. Clin Orthop Relat Res. 1996;327:272-82. 3. Jones AL, Bucholz RW, Bosse MJ, et al; BMP-2 Evaluation in Surgery for Tibial Trauma-Allgraft (BESTT-ALL) Study Group. Recombinant human BMP-2 and allograft compared with autogenous bone graft for reconstruction of diaphyseal tibial fractures with cortical defects. A randomized, controlled trial. J Bone Joint Surg Am. 2006;88:1431-41. 4. Boyne PJ, Lilly LC, Marx RE, et al. De novo bone induction by recombinant human bone morphogenetic protein-2 (rh- BMP-2) in maxillary sinus floor augmentation. J Oral Maxillofac Surg. 2005;63:1693-707. 5. McKay WF, Peckham SM, Badura JM. A comprehensive clinical review of recombinant human bone morphogenetic protein-2 (INFUSE Bone Graft). Int Orthop. 2007;31:729-34. 6. Siebert CH, Schneider U, Sopka S, Wahner T, Miltner O, Niedhart C. Ingrowth of osteochondral grafts under the influence of growth factors: 6-month results of an animal study. Arch Orthop Trauma Surg. 2006;126:247-52. 7. Siebert CH, Miltner O, Weber M, Sopka S, Koch S, Niedhart C. Healing of osteochondral grafts in an ovine model under the influence of bfgf. Arthroscopy. 2003;19:182-7. 8. Wim B, Peter M, Scharstuhl A, Henk M. Tissue engineering, cells, scaffolds, and growth factors. Clin Orthop Relat Res. 2001;391:244-50. 9. Pineda S, Pollack A, Stevenson S, Goldberg V, Caplan A. A semiquantitative scale for histologic grading of articular cartilage repair. Acta Anat (Basel). 1992;143:335-40. 10. Mankin HJ. The response of articular cartilage to mechanical injury. J Bone Joint Surg Am. 1982;64:460-6. 11. Buckwalter JA. Articular cartilage: injuries and potential for healing. J Orthop Sports Phys Ther. 1998;28:192-202. 12. Wei X, Gao J, Messner K. Maturation-dependent repair of untreated osteochondral defects in the rabbit knee joint. J Biomed Mater Res. 1997;34:63-72. 13. Steadman JR, Rodkey WG, Singleton SB, Britts KK. Microfracture technique for full-thickness chondral defects: technique and clinical results. Oper Tech Orthop. 1997;7:300-4. 14. Steadman JR, Briggs KK, Rodrigo JJ, Kocher MS, Gill TJ, Rodkey WG. Outcomes of microfracture for traumatic chondral defects of the knee: average 11-year follow-up. Arthroscopy. 2003;19:477-84. 15. Blevins FT, Steadman JR, Rodrigo JJ, Silliman J. Treatment of articular cartilage defects in athletes: an analysis of functional outcome and lesion appearance. Orthopedics. 1998;21:761-7. 16. Steadman JR, Rodkey WG, Rodrigo JJ. Microfracture: surgical technique and rehabilitation to treat chondral defects. Clin Orthop Relat Res. 2001;391 Suppl:S362-9. 17. Frisbie DD, Trotter GW, Powers BE, et al. Arthroscopic subchondral bone plate microfracture technique augments healing of large chondral defects in the radial carpal bone and medial femoral condyle of horses. Vet Surg. 1999;28:242-55. 18. Steadman RJ, Rodkey WG, Singleton SB, et al. Microfracture procedure for treatment of full-thickness chondral defects: technique, clinical results, and current basic science status. In: Harner CD, Vince KG, Fu FH, ed. Techniques in knee sur gery. Philadelphia: Lippincott Williams & Wilkins; 2001. 23-31. 19. Kang SW, Bada LP, Kang CS, et al. Articular cartilage regeneration with microfracture and hyaluronic acid. Biotechnol Lett. 2008;30:435-9. 20. Ishii I, Mizuta H, Sei A, Hirose J, Kudo S, Hiraki Y. Healing of full-thickness defects of the articular cartilage in rabbits using fibroblast growth factor-2 and a fibrin sealant. J Bone Joint Surg Br. 2007;89:693-700. 21. Kuo AC, Rodrigo JJ, Reddi AH, Curtiss S, Grotkopp E, Chiu M. Microfracture and bone morphogenetic protein 7 (BMP-7) synergistically stimulate articular cartilage repair. Osteoarthritis Cartilage. 2006;14:1126-35. 22. Katagiri T, Yamaguchi A, Ikeda T, et al. The non-osteogenic mouse pluripotent cell line, C3H10T1/2, is induced to differentiate into osteoblastic cells by recombinant human bone morphogenetic protein-2. Biochem Biophys Res Commun. 1990;172:295-9.
247 Influence of rhbmp-2 on the Healing of Articular Cartilage 23. Thies RS, Bauduy M, Ashton BA, Kurtzberg L, Wozney JM, Rosen V. Recombinant human bone morphogenetic protein-2 induces osteoblastic differentiation in W-20-17 stromal cells. Endocrinology. 1992;130:1318-24. 24. Li B, Aspden RM. Mechanical and material properties of the subchondral bone plate from the femoral head of patients with osteoarthritis or osteoporosis. Ann Rheum Dis. 1997;56:247-54. 25. Conaghan PG, Vanharanta H, Dieppe PA. Is progressive osteoarthritis an atheromatous vascular disease? Ann Rheum Dis. 2005;64:1539-41. 26. Shibakawa A, Yudoh K, Masuko-Hongo K, Kato T, Nishioka K, Nakamura H. The role of subchondral bone resorption pits in osteoarthritis: MMP production by cells derived from bone marrow. Osteoarthritis Cartilage. 2005;13:679-87. 27. Thomopoulos S, Soslowsky LJ, Flanagan CL, et al. The effect of fibrin clot on healing rat supraspinatus tendon defects. J Shoulder Elbow Surg. 2002;11:239-47. 28. Lusardi DA, Cain JE Jr. The effect of fibrin sealant on the strength of tendon repair of full thickness tendon lacerations in the rabbit Achilles tendon. J Foot Ankle Surg. 1994;33:443-7. 29. Stemberger A, Blümel G. Fibrinogen-fibrin conversion and inhibition of fibrinolysis. Thorac Cardiovasc Surg. 1982; 30:209-14. 30. Schlag G, Redl H. Fibrin sealant in orthopedic surgery. Clin Orthop Relat Res. 1988;227:269-85.
248 pissn : 1226-2102, eissn : 2005-8918 Original Article J Korean Orthop Assoc 2015; 50: 241-248 http://dx.doi.org/10.4055/jkoa.2015.50.3.241 www.jkoa.org Suk Ha Lee, et al. 재조합골형성단백 -2 가가토의관절연골결손의연골하골재형성및연골치유에미치는영향 이석하 이승준 이종수 안재성 * 건국대학교의학전문대학원건국대학교병원정형외과학교실, * 충남대학교의학전문대학원충남대학교병원정형외과학교실 목적 : 관절연골전층결손이있는가토모델에서재조합골형성단백-2가가토의관절연골결손의연골하골재형성및연골치유에미치는영향을분석하고자한다. 대상및방법 : 24마리의수컷가토의우측대퇴골활차구에 6 3 mm의전층연골결손을만든후에 24마리중 6마리는더이상처치를하지않았으며, 18마리는결손부위에미세골절을하였다. 미세골절한 18마리중 6마리는다른처치를하지않았고다른 6마리는결손부위에섬유성아교를충전하였으며남은 6마리에는결손부위에섬유성아교와재조합골형성단백-2를충전하였다. 수술 8주째에조직학등급점수와 real-time polymerase chain reaction 을이용한콜라겐의성분분석으로미세골절부위에충전된재조합골형성단백-2가관절연골의치유에미치는효과를분석하였다. 결과 : 연골결손부위를섬유성아교와재조합골형성단백-2로충전한 6마리에서조직학적등급점수가더좋았으며, 콜라겐 1형과 2형도더많이검출되었다. 결론 : 미세골절후섬유성아교와재조합골형성단백-2는관절연골결손부위에서연골치유를촉진시키고초자연골에근접하게연골이치유되게도움을줄수있을것으로생각된다. 색인단어 : 관절연골결손, 미세골절, 골형성단백 -2 접수일 2014 년 10 월 2 일수정일 2015 년 2 월 6 일게재확정일 2015 년 3 월 7 일책임저자이승준서울시광진구능동로 120-1, 건국대학교의학전문대학원건국대학교병원정형외과학교실 TEL 02-2030-7616, FAX 02-2030-7369, E-mail lsjmd@kuh.ac.kr * 이논문은 2009 학년도건국대학교의지원에의하여연구되었음. 대한정형외과학회지 : 제 50 권제 3 호 2015 Copyright 2015 by The Korean Orthopaedic Association This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.