|
|
- 세윤 황
- 5 years ago
- Views:
Transcription
1
2 Invasive Alien Plant Impact on Forest
3 Invasive Alien Plant Impact on Forest 2
4 Invasive Alien Plant Impact on Forest
5 4
6 5
7 6
8 7
9 Contents
10
11 10
12 11
13 12
14 13
15 14 Á.Löve
16 15
17 16
18 17
19 18
20 19
21 20
22 Invasive Alien Plan Impact on Forest 21
23 Fallopia convolvulus (L.) Á.Löve Black-bindweed, wild buckwheat 22
24 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness 23
25 Fallopia dentatoalata (F. Schmidt) Holub
26 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
27 Fallopia dumetorum (L.) Holub Copse bindweed
28 Ann ual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
29 Persicaria orientalis (L.) Spach Kiss-me-over-the-garden-gate, princess-feather
30 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
31 Rumex acetosella L. Common sheep sorrel, sheep's sorrel, red sorrel
32 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
33 Rumex crispus L. Curly dock, curled dock, yellow dock
34 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
35 Rumex obtusifolius L. Broad-leaved dock, bitter dock, butter dock
36 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
37 Phytolacca americana L. American pokeweed
38 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
39 Cerastium glomeratum Thuill. Sticky mouse-ear chickweed, clammy chickweed
40 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
41 Silene armeria L. Sweet william catchy, sweet william silene
42 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
43 Silene latifolia subsp. alba (Mill.) Greuter & Burdet Silene latifolia, white campion, bladder campion
44 Biennial or perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
45 Spergula arvensis L. Corn spurry
46 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
47 Spergularia rubra (L.) J. Presl & C. Presl Red sandspurry
48 Annual or perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
49 Chenopodium album L. Lambsquarters, white goosefoot
50 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
51 Chenopodium cifolium Sm. Fig-leaved goosefoot, small goosefoot
52 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
53 Chenopodium glaucum L. Oak-leaved goosefoot
54 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
55 Amaranthus blitum L. Purple amaranth
56 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
57 Amaranthus patulus Bertol. Smooth amaranth, smooth pigweed
58 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
59 Celosia argentea L. Plumed cockscomb, the silver cock's comb
60 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
61 Houttuynia cordata Thunb. Fish mint, liard tail, chameleon, heartleaf, shwort, bishop's weed
62 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
63 Barbarea vulgaris W.T. Aiton Bittercress, herb barbara, rocketcress
64 Biennial or perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
65 Brassica juncea (L.) Czern. Brown mustard, indian mustard, chinese mustard
66 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
67 Lepidium didymum L. Lesser swine-cress
68 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
69 Lepidium virginicum L. Least pepperwort, virginia pepperweed,
70 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
71 Sisymbrium ofcinale (L.) Scop. Hedge mustard
72 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
73 Potentilla supina var. ternata Peterm.
74 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
75 Potentilla supina L. Bushy cinquefoil
76 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
77 Amorpha fruticosa L. Desert false indigo, false indigo-bush, bastard indigo bush
78 Shrub. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
79 Lotus corniculatus L. Common bird's-foot trefoil, bird's-foot trefoil
80 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
81 Medicago lupulina L. Black medick, nonesuch, hop clover
82 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
83 Medicago polymorpha L. California burclover, toothed bur clover
84 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
85 Medicago sativa L. Alfalfa
86 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
87 Melilotus albus Medik. Bokhara clover, honey clover, white-owered sweet clover
88 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
89 Melilotus ofcinalis (L.) Lam. Yellow sweet clover, yellow melilot
90 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
91 Robinia pseudoacacia L. Black locust, false acacia
92 Tree. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
93 Trifolium dubium Sibth. Lesser trefoil, lesser hop trefoil, suckling clover
94 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
95 Trifolium pratense L. Red clover
96 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
97 Trifolium repens L. White clover, dutch clover
98 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
99 Vicia villosa Roth Hairy vetch, fodder vetch, winter vetch
100 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
101 Geranium carolinianum L. Carolina cranesbill, carolina geranium
102 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
103 Euphorbia hypericifolia L. Graceful sandmat
104 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
105 Euphorbia maculata L. Spotted spurge, prostrate spurge
106 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
107 Ailanthus altissima (Mill.) Swingle Tree of heaven, ailanthus
108 Tree. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
109 Abutilon theophrasti Medik. Velvetleaf, china jute, buttonweed
110 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
111 Hibiscus trionum L. Flower-of-an-hour, bladder hibiscus
112 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
113 Viola papilionacea Pursh Wild violet
114 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
115 Sicyos angulatus L. Oneseed bur cucumber
116 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
117 Oenothera biennis L. Evening-primrose, evening star, sun drop
118 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
119 Oenothera glazioviana Micheli Large-owered evening primrose
120 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
121 Anthriscus caucalis M. Bieb. Burr chervil
122 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
123 Diodella teres (Walter) Small Poorjoe, rough buttonweed
124 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
125 Cuscuta pentagona Engelm. Fiveangled dodder
126 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
127 Ipomoea lacunosa L. Morning glories
128 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
129 Ipomoea purpurea (L.) Roth Common morning glory, purple morning glory
130 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
131 Ipomoea cholulensis Kunth Redstar
132 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
133 Symphytum ofcinale L. Comfrey, true comfrey, quaker comfrey, boneset
134 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
135 Physalis angulata L. Angular winter cherry, balloon cherry, gooseberry, wild tomato
136 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
137 Solanum americanum Mill. American nightshade, glossy nightshade
138 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
139 Solanum carolinense L. Carolina horsenettle, bull nettle, tread-softly, apple of sodom, devil's tomato
140 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
141 Veronica arvensis L. Wall speedwell, corn speedwell, rock speedwell
142 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
143 Veronica hederifolia L. Ivy-leaved speedwell
144 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
145 Veronica persica Poir. Birdeye speedwell, large eld speedwell, winter speedwell
146 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
147 Plantago lanceolata L. English plantain, buckhorn plantain, buckhorn, lamb's tongue
148 Biennial or perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
149 Ambrosia artemisiifolia L. Common ragweed, bitterweed, carrot weed, american wormwood
150 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
151 Ambrosia trida L. Giant ragweed, great ragweed
152 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
153 Symphyotrichum pilosum (Willd.) G. L. Nesom Hairy aster, frost aster
154 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
155 Slim aster Aster subulatus var. sandwicensis (A. Gray ex H. Mann) A.G. Jones
156 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
157 Bidens frondosa L. Devil's beggarticks, devil's bootjack, pitchfork weed, tickseed sunower
158 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
159 Bidens pilosa L. Black-jack, beggar-ticks, cobbler's pegs, spanish needle
160 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
161 Carduus crispus L. Welted thistle, curly plumeless thistle
162 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
163 Cyanus segetum Hill Cornower, bachelor's button, bluebottle
164 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
165 Leucanthemum vulgare Lam. Ox-eye daisy, oxeye daisy
166 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
167 Conyza bonariensis (L.) Cronquist Flax-leaf eabane, wavy-leaf eabane, argentine eabane
168 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
169 Conyza canadensis (L.) Cronquist Horseweed, canadian horseweed
170 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
171 Conyza sumatrensis (Retz.) E. Walker Fleabane, tall eabane, white horseweed, sumatran eabane
172 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
173 Coreopsis lanceolata L. Lance-leaved coreopsis
174 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
175 Coreopsis tinctoria Nutt. Golden tickseed
176 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
177 Cosmos bipinnatus Cav. Garden cosmos, mexican aster
178 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
179 Cosmos sulphureus Cav. Sulfur cosmos, yellow cosmos
180 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
181 Crassocephalum crepidioides (Benth.) S. Moore Redower ragleaf, reweed
182 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
183 Erechtites hieraciifolius (L.) Raf. ex DC. American burnweed, pilewort
184 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
185 Erigeron annuus (L.) Pers. Annual eabane, daisy eabane, eastern daisy eabane
186 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
187 Erigeron philadelphicus L. Skevish, philadelphia daisy, frost-root, poor robin's plantain
188 Annual, biennial or perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
189 Erigeron strigosus Muhl. ex Willd. Common eastern eabane
190 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
191 Ageratina altissima (L.) R. M. King & H. Rob. White snakeroot, richweed, white sanicle, tall boneset
192 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
193 Galinsoga quadriradiata Ruiz & Pav. Shaggy soldier, hairy galinsoga, fringed quickweed
194 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
195 Galinsoga parviora Cav. Gallant soldier, potato weed
196 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
197 Gamochaeta calviceps (Fernald) Cabrera Narrowleaf purple everlasting
198 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
199 Helianthus tuberosus L. Sunroot, sunchoke, earth apple
200 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
201 Hypochaeris radicata L. Catsear, atweed, cat's-ear, hairy cat's ear, false dandelion
202 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
203 Lactuca serriola L. Prickly lettuce, milk thistle, compass plant, scarole
204 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
205 Matricaria matricarioides (Less.) Porter Pineappleweed, wild chamomile, disc mayweed
206 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
207 Senecio vulgaris L. Common groundsel
208 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
209 Solidago altissima L. Late goldenrod, goldenrod
210 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
211 Solidago gigantea Aiton Tall goldenrod, giant goldenrod, smooth goldenrod, late goldenrod
212 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
213 Sonchus asper (L.) Hill Sharp-fringed sow thistle, prickly sow-thistle
214 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
215 Sonchus oleraceus L. Common sowthistle, smooth sow thistle
216 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
217 Tagetes minuta L. Southern cone marigold, stinking roger, black mint
218 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
219 Taraxacum laevigatum (Willd.) DC. Rock dandelion
220 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
221 Taraxacum ofcinale F. H. Wigg. Common dandelion
222 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
223 Tragopogon dubius Scop. Western salsify, western goat's-beard
224 Annual or biennial Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
225 Verbesina alternifolia (L.) Britton ex Kearney Wingstem
226 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
227 Xanthium canadense Mill. Rough cocklebur, clotbur, common cocklebur, large cocklebur
228 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
229 Xanthium italicum Moretti Beach cocklebur
230 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
231 Elymus repens (L.) Gould Couch grass, common couch
232 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
233 Alopecurus pratensis L. Meadow foxtail, eld meadow foxtail
234 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
235 Andropogon virginicus L. Broomsedge bluestem, yellowsedge bluestem
236 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
237 Avena fatua L. Common wild oat
238 Biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
239 Briza minor L. Lesser quaking-grass
240 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
241 Bromus rigidus Roth Stiff brome, ripgut brome
242 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
243 Bromus secalinus L. Rye brome
244 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
245 Bromus tectorum L. Drooping brome, cheat grass
246 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
247 Bromus catharticus Vahl Rescuegrass
248 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
249 Dactylis glomerata L. Cock's-foot, orchard grass
250 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
251 Eragrostis curvula (Schrad.) Nees Weeping lovegrass, boer lovegrass
252 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
253 Festuca arundinacea Schreb. Tall fescue
254 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
255 Vulpia myuros (L.) C. C. Gmel. Annual fescue, rat's-tail fescue
256 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
257 Holcus lanatus L. Yorkshire fog, meadow soft grass, velvet grass
258 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
259 Lolium multiorum Lam. Italian rye-grass, annual ryegrass
260 Annual or biennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
261 Lolium perenne L. Perennial rye-grass, english ryegrass, winter ryegrass
262 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
263 Panicum dichotomiorum Michx. Fall panicgrass, autumn millet
264 Annual. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
265 Paspalum dilatatum Poir. Dallisgrass, sticky heads
266 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
267 Phleum pratense L. Timothy
268 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
269 Poa pratensis L. Kentucky bluegrass
270 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
271 Sorghum halepense (L.) Pers. Johnsongrass
272 Perennial. Fl.Fr. Distribution Reproduction Dispersal system Impact Invasive site on forest Usefulness
273 272
274 273
275 274
276 275
277 276
278 277
279 278
280 279
281 280
외떡잎식물 Monocotyledoneae
외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고
More information05(김창석)p fm
Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information차례
차례 표차례 優占度階級 群度階級 그림차례 - 1 - - 2 - - 3 - 표 2. 優占度階級 (Braun-Blanquet, 1964) 5 : 표본구면적의 3/4이상을덮고, 개체수는임의 4 : 1/2-3/4을덮고, 3 : 1/4-1/2을덮고, 2 : 개체수는많으나被度가낮다혹은산재하나被度는높다 ( 단1/10이다 ). + : 被度는낮고散在 r : 고립하여출현하고被度는극히낮다.
More information완료_eri hwp
Ecology and Resilient Infrastructure (2015) 2(1): 080-092 http://dx.doi.org/10.17820/eri.2015.2.1.080 http://www.kseie.or.kr/ Online ISSN: 2288-8527 ORIGINAL ARTICLE 외래식물에의한대학교정생태계의교란 Disturbance of Campus
More information2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo
2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,
More information03 .이인용( ).fm
Weed Turf. Sci. 5(3):126~135 http://dx.doi.org/10.5660/wts.2016.5.3.126 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both
More information02(이인용)p fm
Weed Turf. Sci. 4(2):85~94 http://dx.doi.org/10.5660/wts.2015.4.2.85 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information03. 이인용2(65-70).fm
Weed Turf. Sci. 5(2):65~70 http://dx.doi.org/10.5660/wts.2016.5.2.65 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both formerly
More informationStudy on the Vascular Plants Found in Nearby Island Regions of Ganghwado
Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National
More information3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa
3(1): 21~33, 2017. 6. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Park Oh, Hyun-Kyung* Choi, Yoon-Ho** You, Ju-Han*** ABSTRACT
More information04(오영주)p fm
Weed Turf. Sci. 3(4):276~283 http://dx.doi.org/10.5660/wts.2014.3.4.276 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More informationTFT 2015 04 02 03 3.57 3.98 3.36 3.68 4.06 5% 41% 3.45 3.26 0 1 2 3 4 5 47% 7.1% 13.6% 2.2% 29.3% 13.0% 10.9% 7% 0% 23.9% 24.3% 20.6% 7.5% 5.6% 23.4% 18.7% 15.8% 6.6% 7.7% 20.2% 18.6% 12.0% 19.2% 04 05
More information식료
LUNCH & DINNER I I KOREAN TABLE D'HOTE Beef Bone & Vegetable soup with Rice 20,000 and 4Kinds of side dish Boiled Ox-Tail Soup with Steamed Rice 24,000 Sliced and Marinated Beef Ribeye Barbecued on a Bulgogi
More information7.1.5 조사조건산출 의뢰인이요구하는선량을조사하기위한조사조건산출. 선량율및조사거리계산 조사방법 ( 평면조사, 회전조사 ) 결정 방사선조사 조사선량측정및조사확인서 방사선조사담당자는의뢰인이조사선량측정및조사확인서를요구할경우에는조사선량측정 및조사확인서를
7. 기타 7.1 방사선조사의뢰절차 7.1.1 방사선조사상담 방사선조사를의뢰하고자하는의뢰인은방사선조사상담자에게조사가능여부, 조사일정 등을상담 감마선전화상담 전자선전화상담 이온빔전화상담 임돈순 (063) 570-3253 이병헌 (063) 570-3255 김재호 (063) 570-3258 김동수 (063) 570-3290 권호제 (063) 570-3252 방문문의
More information1_4_제안색_16SS_이탈리아_attachment
National Color Proposal 16SS Italy 국제유행색협회(INTERCOLOR)에서 제안한 2016 Spring/Summer시즌 국가별 컬러 분석 Summer 2016 2016년 봄, 여름의 국제 유행색 결정을 위한 INTERCOLOR의 102번째 회의가 스페인 바로셀로나에서 2014년 5월 25일부터 27일, 3일에 걸쳐 진행되었다. INTERCOLOR는
More information401.fm
Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department
More informationμ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG
More information04. 이채영(71-81).fm
Weed Turf. Sci. 5(2):71~81 http://dx.doi.org/10.5660/wts.2016.5.2.71 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K
정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey
More information연세대-신규메뉴북-수정3
CHINESE BISTRO LUNCH COURSE (11:00 ~ 15:00 靑 33,000 Mushroom & Crab Meat Soup Cantonese-style Stir-Fried Seafood Deep-Fried Prawn with Spicy Chili Sauce Stir-Fried Shredded Green Bell Pepper & Beef Choice
More information뿔l 앓 醫 l활칸사 / 창간사 김 우 명 1990. 3. t 찰 즈i / 창간호 6 떠돌이 (시 ) 박 명 성 7 라 파스에서 생긴 일 이 달 호 14 아버지 만세 김 영 ;;<} 17 안타까운대면 박 명 성 21 석장의 졸엽장 임 숙 자 22 <;>!- 화 김 혜
y 헬황 뿔4 꿇훌떻 靈 옳* 창간호 1990 년 3월 저 11 권 제 1 호 외무부부인회 뿔l 앓 醫 l활칸사 / 창간사 김 우 명 1990. 3. t 찰 즈i / 창간호 6 떠돌이 (시 ) 박 명 성 7 라 파스에서 생긴 일 이 달 호 14 아버지 만세 김 영 ;;
More information(86-108).fm
Turf. Sci. 6(2):86~108 http://dx.doi.org/10.5660/wts.2017.6.2.86 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article & Turfgrass Science & Turfgrass Science was renamed from both formerly Korean
More informationuntitled
Safety Kids, send your drawing with an electrical safety tip to your local electric cooperative (address found on Page receive a prize. All entries must include your name, age, mailing address and the
More information<30322E20BABBB9AEC0FCC3BC2E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:
More information01-Megascolex(dh)
Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute
More informationfm
Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)
More information식료
BREAKFAST I 07:00~11:00 I MORNING BUFFET Adult 29,800 (07:00~10:00) Child 22,000 AMERICAN BREAKFAST 23,000 A Choice of Chilled Juice(Orange, Tomato, Pineapple) Two Eggs with Choice of Side Dish(Ham, Bacon,
More informationFind and circle the words. 1 : 머리 : 눈 : 코 : 입 : 이 : 목 : 어깨 : 귀 : 팔 : 손 : 다리 : 발 She shakes her head. Close your eyes. We smell with our nose. Open you
1 Write the words. head eye nose mouth tooth neck shoulder ear arm hand leg foot 1 Find and circle the words. 1 : 머리 : 눈 : 코 : 입 : 이 : 목 : 어깨 : 귀 : 팔 : 손 : 다리 : 발 She shakes her head. Close your eyes.
More information류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S
류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province School of Science Education, College of Education, Chungbuk
More information<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:
More information<C1A63230C8B820B4EBC7D1B9CEB1B9C5D8BDBAC5B8C0CFB5F0C0DAC0CEB4EBC0FC20BDC9BBE7B0E1B0FA20C0A5B0D4C0E7BFEB284454502DBDC3BBF3BAB0292E786C7378>
제20회 대한민국텍스타일디자인대전 DTP부문 심사결과(본상,기관장상) 순번 접수번호 이름 제목 비고 1 DTP-545 이시원 The Elegant Earth 국무총리상 2 DTP-557 권단아 아낌없이 주는 나무 지식경제부장관상 3 DTP-248 하은지 Nature Song 한국섬유산업연합회장상 4 DTP-678 김근배 향연 한국생산기술연구원장상 5 DTP-506
More information1_7_제안색_16FW_영국_attachment
National Color Proposal 16FW UK Summer 2016 국제유행색협회(INTERCOLOR)에서 제안한 2016 Fall/Winter시즌 국가별 컬러 분석 2016년 가을, 겨울의 국제 유행색 결정을 위한 INTERCOLOR의 103번째 회의가 터키 이스탄불에서 2014년 11월 19일부터 21일, 3일에 걸쳐 진행되었다. INTERCOLOR는
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics
More information1106 학원과정
02.764.0027 02.3445.0027 04 36 42 10 16 30 04 05 1961 1999 2002 2004 2009 2010 2015 06 07 10 11 1.720.000 1.540.000 1.800.000 1.620.000 12 13 1.200.000 1.080.000 1.720.000 1.540.000 1.720.000 1.540.000
More information1.서론 2.본론 1.1. 연구의 목적 누구나 어렸을 때 알록달록한 크레파스로 빨주노초파 남보를 읊어가며 무지개를 그려 본적이 있을 것이다. 대 부분의 아이들이 처음 접하게 되는 색채의 도구는 쉽고 부드럽게 그려지는 크레파스이다. 유 아동에게 있어 색채 교육의 출발점이
아동용화구의 색채비교연구 -유 아동 크레용을 중심으로- A comparative study for coloring of children's painting materials -Focusing on infants' & children's crayons- 1)이은경* / Lee, Eun-Kyung, 박연선**/Park, Yon-Sun Abstract The first
More information장기계획-내지4차
2011~2020 KOREA FOREST SERVICE 2011~2020 2011~2020 KOREA FOREST SERVICE 2011~2020 2011~2020 6 7 2011~2020 8 9 2011~2020 10 11 2011~2020 12 2011~2020 KOREA FOREST SERVICE 2011~2020 14 15 2011~2020 16 17
More informationHolland Bar Stool BL1BKAppStU Appalachian State University Logo Pendant Light with Black Finish - 120V Holland Bar Stool BL1BKArizSt-F Arizona State U
Holland Bar Stool BL1BKAppStU Appalachian State University Logo Holland Bar Stool BL1BKArizSt-F Arizona State University (Pitchfork) Logo Holland Bar Stool BL1BKArizSt-S Arizona State University (Sparky)
More information韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의
Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,
More information담양군 도래수마을의 식물상 조사 분석
담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,
More information2 이인용 이정란 김도순 박기웅 Table 1. The number of articles presented in the various sections at the 24 th Asian Pacific Weed Science Society Conference. Resear
Weed Turf. Sci. 3(1):1~5 http://dx.doi.org/10.5660/wts.2014.3.1.1 Print ISSN 2287-7924, Online ISSN 2288-3312 Mini-Review Weed & Turfgrass Science Weed & Turfgrass Science was renamed from formerly both
More informationA Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea
Journal of Asia-Pacific Biodiversity Vol. 6, No. 2 281-310, 2013 http://dx.doi.org/10.7229/jkn.2013.6.2.281 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk
More informationArctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N
다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo
More information[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp
Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,
More information양성내지b72뼈訪?303逞
Contents 성매매 예방교육 가이드북 Contents 제3부 성매매의 어제와 오늘 그리고 한국의 현주소 제4부 처벌 과 보호 의 성매매방지법 1. 성매매의 역사적 배경 및 추이 1. 성매매방지법 제정 배경 62 2. 성매매방지법 제정 취지 63 40 2. 성매매에 대한 국가별 개입 양상 42 3. 규범적 판단과 형사처벌을 기준으로 본 성매매 4. 외국의
More information0204..........1..
contents contents 01 6 7 8 02 9 10 11 12 13 03 14 15 16 17 18 19 20 21 22 23 24 25 26 27 01 30 31 32 33 34 35 36 37 02 38 39 40 41 42 43 44 45 46 03 47 48 49 50 51 52 53 54 55 56 04 57 58 59 60 61
More information..........-....33
04 06 12 14 16 18 20 22 24 26 Contents 34 38 42 46 50 54 58 62 66 70 74 78 84 88 90 92 94 96 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 01 26 27 02 28 29 30 31 32 33 34 35 36 37 38 39
More information자식농사웹완
윤 영 선 _ 지음 은혜한의원 서울시 마포구 도화1동 550 삼성프라자 308호 Tel : 3272.0120, 702.0120 진료시간 : 오전 9시 30분`~`오후 7시 점심시간 : 오후 1시`~`2시 토 요 일 : 오전 9시 30분`~`오후 3시 (일, 공휴일 휴진`/`전화로 진료 예약 받습니다) 은 혜 한 의 원 은혜한의원 CONTENTS 02 04 07
More informationchungo_story_2013.pdf
Contents 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97 99
More informationContents 12 13 15 17 70 79 103 107 20 21 24 29 128 137 141 32 34 36 41 46 47 53 55 174 189 230 240 58 61 64 1. 1. 1 2 3 4 2. 2. 2 1 3 4 3. 3. 1 2 3 4 4. 4. 1 2 3 4 5. 5. 1 2 3 1 2 3
More informationhttp://www.forest.go.kr 5 2013~2017 Contents 07 08 10 19 20 30 33 34 38 39 40 44 45 47 49 51 52 53 53 57 63 67 Contents 72 75 76 77 77 82 88 93 95 96 97 97 103 109 115 121 123 124 125 125 129 132 137
More information전반부-pdf
Contents 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
More information<4D6963726F736F667420506F776572506F696E74202D20312E20B0E6C1A6C0FCB8C15F3136B3E2C7CFB9DDB1E25F325FC6ED28C0BA292E70707478>
Contents 3 2016 4 2016 5 2016 6 2016 7 2016 8 2016 9 2016 10 2016 11 2016 12 2016 13 2016 14 2016 15 2016 16 2016 17 2016 18 2016 19 2016 20 2016 21 2016 22 2016 23 2016 24 2016 25 2016 26 2016 27 2016
More information..........- ........
Contents 24 28 32 34 36 38 40 42 44 46 50 52 54 56 58 60 61 62 64 66 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 01 02 24 25 03 04 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
More informationContents 007 008 016 125 126 130 019 022 027 029 047 048 135 136 139 143 145 150 058 155 073 074 078 158 163 171 182 089 195 090 100 199 116 121 01 01 02 03 04 05 06 8 9 01 02 03 04 05 06 10 11 01 02 03
More informationA°ø¸ðÀü ³»Áö1-¼öÁ¤
1 4 5 6 7 8 9 10 11 Contents 017 035 051 067 081 093 107 123 139 151 165 177 189 209 219 233 243 255 271 287 299 313 327 337 349 12 13 017 18 19 20 21 22 23 24 25 26 27 28 29 30 31 035 051 067 081 093
More information±¹³»°æÁ¦ º¹»ç1
Contents 2 2002. 1 116 2002. 1 2002. 1 117 118 2002. 1 2002. 1 119 120 2002. 1 2002. 1 121 122 2002. 1 2002. 1 123 124 2002. 1 2002. 1 125 126 2002. 1 2002. 1 127 128 2002. 1 2002. 1 129 130 2002. 1 2002.
More information¿¡³ÊÁö ÀÚ¿ø-Âü°í ³»Áö.PDF
Contents 01 02 03 6 04 05 7 8 9 01 10 02 03 11 04 01 12 02 13 03 04 14 01 02 03 04 15 05 06 16 07 17 08 18 01 02 03 19 04 20 05 21 06 07 22 08 23 24 25 26 27 28 29 30 31 32 33 01 36 02 03 37 38 01
More information전반부-pdf
Contents 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72
More informationMicrosoft PowerPoint - 3. 2016 하반기 크레딧 전망_V3.pptx
Contents 3 2016 4 2016 5 2016 6 2016 7 2016 8 2016 9 2016 10 2016 11 2016 12 2016 13 2016 14 2016 15 2016 16 2016 17 2016 18 2016 19 2016 20 2016 21 2016 22 2016 23 2016 24 2016 25 2016 26 2016 27 2016
More information³»Áöc03âš
08 09 27 20 32 42 contents 3 4 5 6 7 8 9 28 10 11 42 38 12 13 45 48 44 14 15 53 50 16 17 58 54 18 19 20 21 22 23 24 25 2008. 5. 27~30 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 2008. 4. 27 42 43 44
More information¾ç¼º-¾÷¹«Æí¶÷-³»¿ëÃà¼Ò4
contents 6 9 18 21 23 43 44 53 61 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62
More information전도대회자료집
1 Contents 8 10 57 4 2 63 6 17 43 12 3 4 5 7 6 7 6 8 9 10 11 12 13 14 15 16 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
More informationµ¶ÀÏÅëÀÏÁý1~2Æíq36£02Ð
CONTENTS 3 9 16 20 24 29 33 36 40 48 50 56 60 64 71 76 80 83 88 91 94 97 100 103 106 109 114 116 128 133 139 144 148 151 154 159 170 173 176 181 183 188 190 192 194 198 202 209 212 218 221 228 231 233
More information싱카이 역삼점 메뉴내지_단품음주류
XINGKAI Set Chin Set Today s Soup, Shredded Sea Cucumber and Shrimp with Beef, Fried Prawn in Chili Sauce, Fried Rice or Noodles, Dessert Myung Set Today s Soup, Fried Chicken in Garlic and Soy Sauce,
More information마음_2012._2월_진하게LLkk-777 - 복사본.hwp
마 음 바다는 웅장하다. 넓은 바다가 아무리 둘러보아도 귀퉁이가 없다. 하늘과 맞닿은 수 평선이 나타난다. 어둠을 서서히 뚫고 일어서는 거대한 용솟음이 이어진다. 철렁철렁, 넘실 넘실 거리는 파도는 새벽의 햇볕을 굽이굽이 반짝거리게 한다. 붉은 덩어리가 야금야금 제 모습을 나타낸다. 수평선의 직선이 둥그런 곡선으로 바뀌는 듯이 동그랗게 올라오는 신비의 물체에
More informationMaking a True Business Solution ANNUAL REPORT 2013 I. I. I I II. II. II II II II II II II II II II II II II II II II II III. III III III III III III III III III III III
More informationÇï·ÎÅäÀÍ1
TB Quiz Hello! TOEIC Bridge를 정독(! )한 친구라면 누구라도 풀 수 있는 퀴즈 퀴즈! 정답과 함께 Hello! TOEIC Bridge에 대한 여러분의 소중한 의견을 skolinick@toeic.co.kr로 보내 주세요. 추첨 후, 푸짐한 선물^^도 드려요! 1. TOEIC Bridge와 관계 없는 것은? ① TOEIC으로 가는 지름길
More information...100_One Hundred Hosta Cultivars.pdf
One Hundred Hosta Cultivars One Hundred Hosta Cultivars 7 Hosta 'Blue Cadet' 50 Hosta 'Grand Tiara' 79 Hosta 'Praying Hands' 108 9 Hosta 'Blue Dimples' 51 Hosta 'Guacamole' 80 Hosta 'Purple Dwarf'
More informationchoice VOL31-<1111><1167><11AF><110E><1175><11B7><1106><1167><11AB> <1100><1169><1112><116A><110C><1175><11AF>.pdf
FOR YOUR PREMIUM LIFESTYLE AUTUMN 2015 31 CONTENTS Wellness Beauty 2015 AUTUMN FOR YOUR PREMIUM LIFESTYLE Living www.abnkorea.co.kr ABN 080-080-4949 sabn www.m.abnkorea.co.kr 080-080-4950 080-080-4949
More information세종로 공영주차장 서울특별시 종로구 세종대로 189, 지하주차장 4층 D구역 계단실 앞 (서울특별시 종로구 세종로 80-1, 지하주차장 4층 D구역 계단실 앞) 종묘 공영주차장 서울특별시 종로구 종로 157, 지하주차장 4층 하층 T구역 (서울특별시 종로구 훈정동 1-
전국 급속충전소 위치 및 이용시간 안내 지역 충전소명 위치 충전타입 이용시간 GS칼텍스 삼성로점 서울특별시 강남구 삼성로 563, GS칼텍스 주유소 입구 우측 (서울특별시 강남구 삼성2동 119-18, GS칼텍스 주유소 입구 우측) 개포동공원 공영주차장 서울특별시 강남구 개포로 509, 지하주차장 1층 8구역 (서울특별시 강남구 개포동 183-2, 지하주차장
More informationBellflower* 도라지 꽃 1987 1 0 0 0 PSA O 0 0 PSA Black Rose* 검은 장미 1973 1 0 0 0 SO O 0 0 SO Bright Sunshine / Lovely Sunshine 해빛 밝아라 1-2 부 2009-2010 1 0 0
Title English Title Korean Year PMA O Main female character TS Female scientist Minor female character PSA/SO Adjutant : A Main male character PMA/O Main male character TS Male scientist Secondary male
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationuntitled
Morning Brief () 1,800 1,500 1,200 () (%) 1,400 14 1,200 () 12 () 1,000 10 900 600 300 800 600 400 200 8 6 4 2 0-300 1Q04 3Q04 1Q05 3Q05 1Q06 3Q06 0-200 0 1Q04 3Q04 1Q05 3Q05 1Q06 3Q06-2 () () (%) 6,000
More information¹é¼ŁÇ¥Áö 11³âš
KERI ANNUAL REPORT 2010 KERI ANNUAL REPORT 2010 KOREA ECONOMIC RESEARCH INSTITUTE KOREA ECONOMIC RESEARCH INSTITUTE 1 2 3 KOREA ECONOMIC RESEARCH INSTITUTE KERI CONTENTS 3 6 55 56 CONTENTS K O R E A E
More informationOctober 2014 BROWN Education Webzine vol.8 울긋불긋 가을이야기 목차 From Editor 앉아서 떠나는 여행 Guidance 그림책 읽어주는 기술 Homeschool 다양한 세계문화 알아보기 Study Trip 올 가을!풍요로운 낭만축
October 2014 BROWN Education Webzine vol.8 BROWN MAGAZINE Webzine vol.8 October 2014 BROWN Education Webzine vol.8 울긋불긋 가을이야기 목차 From Editor 앉아서 떠나는 여행 Guidance 그림책 읽어주는 기술 Homeschool 다양한 세계문화 알아보기 Study
More information