A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea

Size: px
Start display at page:

Download "A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea"

Transcription

1 Journal of Asia-Pacific Biodiversity Vol. 6, No , A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk Hwang, Jong-Cheol Yang*, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Division of Forest Biodiversity and Herbarium, Korea National Arboretum, Pocheon, Gyeonggi , Korea Abstract: This study aims to investigate the flora of 15 islands in Yeonggwang, Shinan, and Mokpo of the Jeollanamdo province and the distribution of major plants in order to use the results as fundamental data for studies on plants in islands. Field surveys were performed 25 times from 2004 to 2010 to investigate the flora in these regions. A total of 793 taxa including 123 families, 421 genera, 695 species, 2 subspeices, 88 varieties, and 8 forms was found. Korean endemic plants including Hepatica insularis and Galium koreanum were 6 taxa. 25 taxa of rare plants including Trachomitum lancifolium, Daphne kiusiana, and Centranthera cochinchinensis var. lutea were confirmed 120 taxa floristic special plant species were confirmed; 11 taxa of the fifth class, four taxa of the fourth class, 28 taxa of the third class. 78 taxa of naturalized plants were confirmed. Keywords: endemic plants, rare plants, floristic special plants, and naturalized plants Introduction Yeonggwang is located in the north western seashore of the Jeollanamdo province, to which the Noryeong Mountains extend: Goseong, Taecheong, and Jangam mountains in the east make boundaries with Jangseong; in the west, there is the Chilsan sea in the Yellow sea; Hampyeong in the south; and Gochang in the north. It includes a total of 62 islands; its total area is km 2. Shinan is located on the north western sea adjacent to the Muan peninsula and was separated from Muan. It is composed of a total of 1,004 islands including Jaewondo, Maehwado, and Jido (73 inhabited islands and 931 uninhabited islands): there are Mokpo and Haenam in the east; Muan in the north; Jindo in the south. Its total area is km 2. Mokpo is located in the end of the south of the Muan peninsula: there is the Ipam mountain in the east; Udal mountain in the west; Yangeul, Daebak, and Jijeok mountains in the north; and tidelands such as Yeonbyeon, Bukhang, Daebandong, Baekryeondong, and Gatbawy beach at the mouth of the Yeongsan river in the south. These tidelands have been used as farms, residential quarters, and plant sites since it was easy to reclaim land owing to settled halophytes as sediments have been continuously accumulated and seawater decreased. Mokpo includes a total of 13 islands and its total area is km 2. We investigated three regions in Yeonggwang including *To whom correspondence should be addressed. Tel: ; Fax: yangun@forest.go.kr Songido, 11 regions in Shinan including Aphaedo, and Dallido in Mokpo: they are located at the latitude 34 o 44'31"~35 o 24'35" and the longitude 125 o 58'06"~ 126 o 30'14" (Fig. 1). These regions is in the northwest of Jeollanamdo and belong to the South Seashore region by plant geographics as suggested by Lee and Yim (2002). The weather of these regions surrounded by the ocean is an oceanic climate in the Temperate Zone: fogs frequently occur by the southwestern wind that is wet and warm in summer, and the average humidity is more than 80%; it is cold and dry due to the Siberian high pressure in winter. The average temperature in Yeonggwang for six years from 2005 to 2010 was 13.8 o C: the highest temperature was 18.3 o C and the lowest temperature is 10.0 o C; the rainfall in a year was 1,237.8 mm (Yeonggwang Country office, 2011). The average temperature in Shinan was 13.9 o C: the highest temperature was 27.9 o C and the lowest temperature was 2.3 o C; the rainfall was 1,171.0 mm (Shinan Country office, 2011). The average temperature in Mokpo was 13.9 o C: the highest temperature was 18.1 o C and the lowest temperature was 10.5 o C; the rainfall was 1,171.0 mm (Mokpo Municipal office 2010, Table 1). Kim (1984) reported the flora including 109 families, 334 genera, and 526 taxa in Heuksangundo, Shinan; h and Kim (1995) reported the flora including 95 families, 257 genera, and 346 taxa in Gohado, Mokpo; Im and Hong reported the flora of 380 taxa in a total of 50 islands that belong to Jido, Jeungdo, and Imjado in Shinan; Yim (2001) reported the flora including 37 families, 74 genera, and 84

2 282 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Fig. 1. Map of investigated regions in this study. Table 1. The annual mean temperature and precipitation in Yeonggwang, Shinan, and Mokpo for the recent 6 years( ) Region taxa in Chilsando, Yeonggwang. Recently, Park (2003) reported the flora of 712 taxa in 32 islands in Yeonggwang, Shinan, Jindo, and Wando; Jeong et al.(2011) reported 768 taxa in 17 islands in Shinan. Some of these studies, however, did not suggest sample evidences and it was still insufficient for data on the overall distribution of vascular plants in islands of Jeollanamdo because most investigated regions were some large islands or uninhabited islands. We investigated the flora of vascular plants based on sample evidences for major islands in Jeollanamdo where vegetation is regarded to be good in order to understand plant geographical peculiarity and importance of the investigated places and the distribution of major endemic and rare plants for conservation of species diversity and collection of fundamental data. Methods Temperature ( o C) Yearly mean Maximum Minimum Precipitation (mm) Yeonggwang ,237.8 Shinan ,171.0 Mokpo ,171.0 Field surveys were performed 25 times for 34 days from ctober in 2004 to September in 2010 to investigate the flora of vascular plants in islands of Jeollanamdo (Table 2). For the precision of results, objects that have reproductive organs such as flowers, fruits, and spores were collected. All collected objects were assigned with numbers and dry specimens were made to make their lists after identification of taxa using illustrated guides (Lee 1980, 2003, Lee 1996a, 1996b). The GPS information on the distribution was obtained and specimens were stored in the specimen room (KH) in Korea National Arboretum. Scientific names and countries were denoted according to Korean Plant Name Index (Korea Forest Service 2012). Endemic plants were classified according to h et al. (2005), and rare plants according to National Arboretum (2008), and specific plants according to Ministry of Environment (2006). We referred Park (1995, 2001, and 2009) and Lee et al. (2011) to see the status of naturalized plants. Results Investigations on flora Based on evidences of 4,225 samples, vascular plants in islands of Jeollanamdo include a total of 123 families, 421 genera, 695 species, 2 subspeices, 88 varieties, 8 forms, and 793 taxa: 27 taxa of pteridophytes including 15 families (3.4%), 9 taxa of gymnosperms including 3 families (1.1%), 506 taxa of dicotyledons in angiosperms including 89 families (63.8%), and 251 taxa of monocotyledons in angiosperms including 16 families (31.7%) (Table 3, Appendix). Aphaedo had the most rich flora with 69 families, 191 genera, and 287 taxa, and followed by Songido with 76 families, 205 genera, and 272 taxa (Table 4). Evergreen trees such as Camellia japonica and Euonymus japonicus were dominant in Aphaedo, Shinan; Juniperus rigida and Machilus thunbergii were dominant in Songido, Yeonggwang; Lindera glauca and Machilus thunbergii were dominant in Dallido, Mokpo. Endemic plants Endemic plants found in survey regions were 6 taxa including Hepatica insularis and Galium koreanum except for Forsythia koreana that had been introduced (Table 5): it J. ASIA-PACIFIC BIDIVERSITY

3 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 283 Table 2. The dates and routes of investigations No. Date Routes in islands in the west of Jeollanamdo. The mountain behind the dock - The Mannyeon Temple - The Marshes on the Simok beach - Igok-ri Mt. Dochodo 1 ct Yongdang south-facing slope Bigeumdo The Seosan temple surrounding - The Hanuneom beach - The Hansan headbay 2 Apr Jido Mt. Duryu - Samam mountaintop 3 May Aphaedo Garyong-ri Mt. Geum - Songgong-ri Mt. Songgong 4 May Amtaedo Gidong-ri Mt. Seungbong - Garyong-ri Mt. Geum Jaeundo The Baekgil beach surrounding - Yucheon-ri Mt. Dubong in the Domyeong temple valley 5 May Jaeundo Jaeun-myeon Yucheon-ri 6 May Bigeumdo Gwangdae-ri the Seongji mountain fortress surrounding - Yongso-ri the Myeongsasimni beach 7 Jun Dochodo ryu-ri the Simok beach surrounding - ryu-ri Mt. bong 8 Aug Imjado Dochan-ri the Daegwang beach surrounding - Iheugam-ri Mt. Daedun 9 Aug Jeungdo Jeungdong-ri Sanjeong mountaintop 10 Sep Aphaedo Songgong-ri Mt. Songgong - Songgong-ri Mt. Songgong Songgong wetlands 11 ct Anjwado Dae-ri Mt. Hudong - Eupdong-ri Mt. An 12 ct Dochodo ryu-ri Simok beach surrounding Bigeumdo Gwangdae-ri Seongji mountain fortress surrounding 13 Sep Aphaedo Songgong-ri wetlands ecology of world 14 Sep Aphaedo Songgong-ri Mt. Songgong - Songgong-ri Songgong pot-planting park 15 Sep Aphaedo Songgong-ri Mt.. Songgongsan wetlands ecology - Songgong-ri Mt. Songgong - Ildeung rock surrounding - Songgong-ri Surak reservoir Imjado Mt. Geomun - Mt. Samhak - Bulgapje - Mt. Daedunsan - The Daegwang beach Jeungdo Daejo-ri Sanjeong mountaintop - Jeungdong-ri Jangseong reservoir Jido Jeongam Marshes - Taecheon-ri Mt. Bonghwang 16 Apr Maehwado Maehwa branch school - Mokje hill - Cheongdol - Mt. Maehwa Aphaedo Bongnyong-ri Mt. Daema - Songgong-ri Mt. Songgong Nagwoldo Down-nagwoldo - Dang hill-upnagwoldo - Dal rock Anmado Anmado - Saeteo - Jageundangneommeo - Gwangamdock Songido Keun village - Yanggol - Mujangdeung - Songi branch school 17 Apr Jido Seondo-ri Seonchi branch school - Judong reservoir - Mt. Daedeok 18 May Imjado Imja-myeon Mt. Bulgap - Mt. Beong - ctagonal Pavillion - Imjado the Daegwang beach 19 Jun Songido Keun village - Yanggol - Mujangdeung - Songi branch school 20 Jun Nagwoldo Down-nagwoldo - Dangneomeo - Sangnagwoldo - Dal rock 21 Jun Jaewondo Jaewondo Jaewon-ri - Mt. Bongthe dock Jeungdo Jeungdong-ri - Tongsagoljae - Dontaebong Dallido Dal-dong - Dalli branch school - Mt. Sajae 22 Jun Maehwado Maehwa branch school - Mokje hill - Cheongdol - Mt. Maehwa Jeungdo Jeungdo - Daejo-ri - Sanjeongbong Aphaedo Songgong-ri Mt. Songgong - Aphaedo Mt. Bunmae in the beach Jido Jeongam - Bong-riGitdaebong Anmado Anmado - Saeteo - Jageundangneommeo - Gwangamthe dock 23 Sep Songido Keun villige - Yanggol - Mujangdeung - Songi branch school Nagwoldo Down-nagwoldo - Dangneomeo-Upnagwoldo - Dal rock 24 Sep Jaewondo Jaewondo Jaewon-ri - Mt. Bongthe dock 25 Sep Maehwado Maehwa branch school - Mokje hill - Cheongdol - Mt. Maehwa Dallido Dal-dong - Dalli branch school - Mt. Sajae Table 3. Summary on the floristics of the Western Sea of Jeollanamdo Taxa Family Genus Species Subspecies Variety Form Total Ratio (%) Pteridophyte Gymnospermae Angiospermae Dicotyledoneae Monocotyledoneae Total occupies 0.8% of investigated plants in Korea. Hepatica insularis among these plants was known to inhabit in forests of deciduous trees in mountains in Jejudo (Nakai 1937). Recently, it was known to be in islands of the South J. ASIA-PACIFIC BIDIVERSITY

4 284 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Table 4. The number of vascular plants in each survey site of the Western Sea of Jeollanamdo Located Family Genus Species Subspecies Variety Form Total Songido Yeonggwang-gun Nagwoldo Anmado Aphaedo Jaewondo Maehwado Jeungdo Bigeumdo Shinan-gun Dochodo Jido Jaeundo Imjado Anjwado Amtaedo Mokpo-si Dallido Total Table 5. List of the endemic plants in the Western Sea of Jeollanamdo No. Family name Taxa Appearance area 1 Ranunculaceae Hepatica insularis Nakai Anmado, Aphaedo, Imjado, Jaewondo, Jido 2 Aristolochiaceae Asarum glabrata (C.S. Yook & J.G. Kim & J. Nam) B.U.h Imjado, Jido 3 Rosaceae Prunus ishidoyana Nakai Songido 4 Rubiaceae Galium koreanum (Nakai) Nakai Songido 5 Caprifoliaceae Weigela subsessilis (Nakai) L.H. Bailey Amtaedo, Jaewondo, Jeungdo sea and in Daegu that is an inland as well as Byeonsan and Deokjeokdo in the Yellow sea (Kim and Lee 1994). Rare plants Among rare plants designated by Korea Forest Service, a total of 25 taxa of them were found: three critically endangered species (CR) including Salomonia oblongifolia and Trachomitum lancifolium were found; endangered species (EN) were four taxa including Albizia kalkora found in Dallido, Maehwado, and Aphaedo, and Daphne kiusiana found in Bigeumdo; vulnerable species (VU) were 10 taxa including Ilex cornuta in Maehwado, Imjado, and Jeungdo, and Syneilesis aconitifolia and Bletilla striata in Maehwado; least concerned species were 8 taxa including Potentilla discolor and Chionanthus retusus in Dallido and Aphaedo, and Utricularia racemosa in Maehwado, Aphaedo, and Imjado (Fig. 2, Table 6). Salomonia oblongifolia, a critically endangered species found in Aphaedo, is distributed at marsh places in mountains. However, it is likely to damage its habitats due to frequent artificial interference such as installation of wooden fences for conservation of marshy places and construction of parks. As Bletilla striata, a vulnerable species found in Dallido, inhabits mostly around roads in mountains or rocks near the seashore, it is likely to destroy its habitats by artificial damages around roads that are easy to approach. Fig. 2. A. Utricularia bifida L. (V, VU); B. Sparganium erectum L. (V, VU); C. Bletilla striata (Thunb.) Rchb.f. (V, VU) J. ASIA-PACIFIC BIDIVERSITY

5 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 285 Table 6. List of the rare plants designated by Korea Forest Service in the Western Sea of Jeollanamdo No. Family name Taxa Appearance area Degree 1 Polygalaceae Salomonia oblongifolia DC. Aphaedo 2 Apocynaceae Trachomitum lancifolium (Russanov) Pobed. Aphaedo CR (3 taxa) 3 Lentibulariaceae Utricularia pilosa Makino Aphaedo 4 Droseraceae Drosera peltata var. nipponica (Masam.) hwi Dochodo 5 Leguminosae Albizia kalkora (Roxb.) Prain Dallido, Maehwado, Aphaedo 6 Thymelaeaceae Daphne kiusiana Miq. Bigeumdo 7 Compositae Hololeion maximowiczii Kitam. Aphaedo 8 Leguminosae Millettia japonica (Siebold & Zucc.) A. Gray Bigeumdo 9 Aquifoliaceae Ilex cornuta Lindl. & Paxton Maehwado, Imjado, Jeungdo 10 Labiatae Mosla japonica (Benth.) Maxim. Aphaedo 11 Scrophulariaceae Centranthera cochinchinensis var. lutea (H. Hara) H. Hara Aphaedo 12 Lentibulariaceae Utricularia bifida L. Aphaedo 13 Compositae Syneilesis aconitifolia (Bunge) Maxim. Dochodo, Maehwado 14 Sparganiaceae Sparganium erectum L. Bigeumdo 15 Bletilla striata (Thunb.) Rchb.f. Dallido 16 rchidaceae Calanthe discolor Lindl. Aphaedo 17 Pogonia japonica Rchb. f. Dochodo 18 Rosaceae Potentilla discolor Bunge Dallido, Aphaedo 19 Violaceae Viola albida Palib. Nagwoldo 20 Umbelliferae Glehnia littoralis F.Schmidt ex Miq. Bigeumdo 21 leaceae Chionanthus retusus Lindl. & Paxton Songido, Anmado 22 Boraginaceae Lithospermum arvense L. Nagwoldo, Anmado 23 Lentibulariaceae Utricularia racemosa Wall. Maehwado, Aphaedo, Imjado 24 Iridaceae Iris ensata var. spontanea (Makino) Nakai, Russian iris Aphaedo 25 Gramineae Phacelurus latifolius (Steud.) hwi Dallido, Songido, Jaewondo EN (4 taxa) VU (10 taxa) LC (8 taxa) Floristic special plants Total 120 taxa of floristic special plant species designated by the Ministry of Environment was found in the survey regions: 11 taxa including Juniperus chinensis var. procumbens, Albizia kalkora, Utricularia racemosa, and Bletilla striata that are distributed in the southern seashore belong to the fifth class; four taxa including Polygonum bellardii found in Dochodo and Trachomitum lancifolium found in Aphaedo belong to the fourth class; 28 taxa including Boehmeria nivea var. nipononivea found in Nagwoldo, Anmado, and Songido, and Kadsura japonica found in Nagwoldo, and Stauntonia hexaphylla found in Songido, and Mitchella undulata, Aletris spicata found in Jeungdo and Nagwoldo belong to the third class (Fig. 3, Table 7); five taxa belong to the second class; and 71 taxa belong to the first class. Specially preserved species in forests Four taxa were found in the survey regions among specially preserved species in forests designated by Korea Forest Service in 2012: Albizia kalkora was found in Dallido of Mokpo, in the seashore of Aphaedo in Shinsan, and Maehwado; Salvia chanryoenica was found in the Songgong mountain in Aphaedo, Shinan; Bletilla striata was found in Daldong, Dallido, Mokpo; Calanthe discolor was found in the Keum mountain in Aphaedo, Shinan. Fig. 3. A. Salomonia oblongifolia DC. (IV, CR); B. Trachomitum lancifolium (Russanov) Pobed. (IV, CR); C. Utricularia pilosa Makino (V, CR). J. ASIA-PACIFIC BIDIVERSITY

6 286 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Table 7. The list of fifth to third class of specific plants designated by the Ministry of Environment. Family name Taxa Class Cupressaceae Juniperus chinensis var. procumbens (Siebold) Endl. Saururaceae Houttuynia cordata Thunb. Droseraceae Drosera peltata var. nipponica (Masam.) hwi Leguminosae Albizia kalkora (Roxb.) Prain, Millettia japonica (Siebold & Zucc.) A. Gray V (11 taxa) Lentibulariaceae Utricularia bifida L., U. pilosa Makino, U. racemosa Wall. Sparganiaceae Sparganium erectum L. rchidaceae Bletilla striata (Thunb.) Rchb.f., Calanthe discolor Lindl. Polygonaceae Polygonum bellardii Alloni, Salomonia oblongifolia DC. Apocynaceae Trachomitum lancifolium (Russanov) Pobed. IV (4 taxa) Cyperaceae Cladium chinense Nees Salicaceae Salix rorida Laksch. Urticaceae Boehmeria nivea var. nipononivea (Koidz.) W.T.Wang Schisandraceae Kadsura japonica (L.) Dunal Lardizabalaceae Stauntonia hexaphylla (Thunb.) Decne. Rosaceae Raphiolepis indica var. umbellata (Thunb.) hashi, Spiraea chinensis Maxim. Leguminosae Lespedeza juncea (L.f.) Pers. Meliaceae Melia azedarach L. Aquifoliaceae Ilex cornuta Lindl. & Paxton, I. integra Thunb. Rhamnaceae Sageretia theezans (L.) Brongn. Thymelaeaceae Daphne kiusiana Miq. Cucurbitaceae Trichosanthes kirilowii var. japonica (Miq.) Kitam. III (28 taxa) Ericaceae Vaccinium bracteatum Thunb. Rubiaceae Mitchella undulata Siebold & Zucc. Boraginaceae Bothriospermum secundum Maxim. Verbenaceae Callicarpa mollis Siebold & Zucc., Verbena officinalis L. Labiatae Salvia japonica Thunb. Campanulaceae Wahlenbergia marginata (Thunb.) A.DC. Alismataceae Alisma orientale (Sam.) Juz. Liliaceae Aletris spicata (Thunb.) Franch., Asparagus oligoclonos Maxim. Gramineae Diarrhena fauriei (Hack.) hwi, Elymus mollis Trin., Glyceria acutiflora Torr., Polypogon monspeliensis (L.) Desf. Cyperaceae Carex laticeps C.B. Clarke ex Franch. Naturalized plants Naturalized plants found in the survey regions were 17 families and 78 taxa including Spergula arvensis, Malva neglecta, and Briza minor: it occupied 9.8% of all the investigated plants (Fig. 4, Table 8). The most frequently found family was Gramineae (22 taxa) that occupied 28% of entire naturalized plants, and followed by compositae (16 taxa). Few Spergula arvensis were found on ridgelines in the Songgong mountain, Shinan. Phytolacca esculenta was found in Daldong, Shinan that is a medicinal plant originated from China. This species is occasionally seen in regions such as Jejudo since it has expanded by bumps like small ripples. Although its distribution regions are not wide, it is necessary to consider its potential dangers. Paspalum distichum var. indutum was found in Dallido, Fig. 4. A. Hypochaeris radicata L.; B. Briza minor L.; C. Bromus unioloides H.B.K. J. ASIA-PACIFIC BIDIVERSITY

7 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 287 Table 8. The list of naturalized plants in the Western Sea of Jeollanamdo Family name Taxa Total Polygonaceae Fallopia dentatoalata (F.Schmidt) Holub, F. dumetorum (L.) Holub, Rumex acetosella L., R. crispus L., R. obtusifolius L. 5 Phytolaccaceae Phytolacca americana L. 1 Caryophyllaceae Cerastium glomeratum Thuill., Spergula arvensis L. 2 Chenopodiaceae Chenopodium album L., C. ficifolium Smith 2 Amaranthaceae Amaranthus blitum L., A. patulus Bertol., A. retroflexus L., A. viridis L. 4 Saururaceae Houttuynia cordata Thunb. 1 Cruciferae Brassica juncea (L.) Czern., Coronopus didymus (L.) Smith, Lepidium apetalum Willd., L. virginicum L., Thlaspi arvense L. 5 Leguminosae Amorpha fruticosa L., Medicago lupulina L., M. polymorpha L., Melilotus suaveolens Ledeb., Robinia pseudoacacia L., Trifolium campestre Schreb., T. repens L., Vicia villosa Roth 8 Euphorbiaceae Euphorbia supina Raf. 1 Malvaceae Abutilon theophrasti Medicus, Malva neglecta Wallr. 2 nagraceae enothera biennis L. 1 Rubiaceae Diodia teres var. hirsutior Fernald & Griseb. 1 Convolvulaceae Cuscuta pentagona Engelm., Ipomoea hederacea Jacq., Quamoclit coccinea Moench 3 Solanaceae Datura stramonium var. chalybea Koch., Physalis angulata L. 2 Scrophulariaceae Veronica arvensis L., V. persica Poir. 2 Compositae Ambrosia artemisiifolia L., Aster subulatus Michx., A. subulatus var. sandwicensis A.G.Jones, Bidens frondosa L., Conyza bonariensis (L.) Cronquist, C. canadensis (L.) Cronquist, C. sumatrensis E.Walker, Eclipta alba var. erecta L., Erechtites hieracifolia Raf., Erigeron annuus (L.) Pers., Hypochaeris radicata L., Senecio vulgaris L., Sonchus 16 asper (L.) Hill, S. oleraceus L., Taraxacum officinale Weber, Xanthium strumarium L. Gramineae Alopecurus japonicus Steud., A. pratensis L., Avena fatua L., Briza minor L., Bromus unioloides H.B.K., Catapodium rigidum (L.) C.E.Hubb., Dactylis glomerata L., Eragrostis curvula Nees, Festuca arundinacea Schreb., F. myuros L., Leptochloa fusca Kunth, Lolium multiflorum Lamarck, L. multiflorum var. ramosum Guss. ex Arcang., L. perenne L., Panicum dichotomiflorum Michx., P. miliaceum L., Parapholis incurva (L.) C.E.Hubb., Paspalum distichum L., P. distichum var. indutum Shinners, Phleum pratense L., Poa pratensis L., Sorghum halepense f. muticum Hubb. 22 Mokpo. As this species disturbs the natural ecosystems, the Ministry of Environment designated it as a ecosystem disturbance wild plant to monitor its spread in March, The number of naturalized plants seems to increase as artificial interference increases due to development and tours in islands. It requires further studies on what impacts some ecosystem disturbance species of naturalized plants have on native plants. In the present, considerable amounts of naturalized plants were introduced into islands. It is concerned that large amounts of naturalized plants spread in small areas of islands. Noteworthy plants 1) Juniperus chinensis var. procumbens (Sieb.) Endl. This belongs to the Cupressaceae family: it is a prostrate evergreen tree that inhabits in the seashore of the South of Korea: new shoots are red and the second year shoots are reddish brown. Shoots are upward and leaves have two shapes: needles and scales. According to documents, it inhabits in Daeheuksando in South Korea and the Sepo seashore in North Korea (Korea National Arboretum 2009). In this study, it was found that Cupressaceae inhabits with laying down in the forest of Jaewondo in Shinan. According to the Agronomic characteristics of Juniperus chinensis var. procumbens, it seems to inhabit between rocks on cutting areas in the edge of islands and it requires further studies. 2) Trachomitum lancifolium (Russanov) Pobed. This belongs to the Apocynaceae family: it blossoms in June and its distribution is limited to some regions of Gyeonggi and Gangwon (Korea National Arboretum 2009). Dozens of individuals were found in Aphaedo in this study, while few in habitats had been reported. As the number of individuals are not so much and they are likely to be damaged due to habits adjacent to roads and farms, it is urgent that preservation measures are prepared. 3) Centranthera cochinchinensis var. lutea (H.Hara) Haran This belongs to the Scrophulariaceae family: it blossoms in August. It is known to be distributed in Jindo, Jeollanamdo and Seongju, Gyeongsangbukdo (Korea National Arboretum 2009): it is generally distributed in marshy places. In this study, few individuals were found at marshy places in mountains of Aphaedo: it showed scattered distribution and mixed with Salomonia oblongifolia, Utricularia bifida, and Utricularia racemosa. Centranthera cochinchinensis var. lutea showed a limited distribution and it requires further information on its hibitats and management. 4) puntia humifusa (Raf.) Raf. This belongs to the Cactaceae family and its many species are distributed throughout the world (Med. Fl 1830). It originated from the North America and inhabits in the middle and west of the USA (Addison brown 2003). Shoots J. ASIA-PACIFIC BIDIVERSITY

8 288 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Table 9. Usage types of vascular plants in the Western Sea of Jeollanamdo E F M P R S T U Number of taxa Ratio (%) are flat and elliptical and have joints and many branches: its surface has thorns. It blossoms in May or June with yellow flowers and its fruits are berries (Fernald 1950). In this study, it was found in the seashore of Sangnagwoldo in Yeonggwang.. humifusa have been cultivated as local goods for sales: it is necessary to investigate in details the distribution of its habitats. puntia ficus-indica has been cultivated or is distributed as wild plants in Jejudo: it originated from Mexico and naturalized in the tropical and subtropical zones. This species inhabits at the elevation of 600~2,900 m; it has fruits and was introduced to China in 1645 (Wu 2007).The difference of these two species is that. humifusa grows with lying down on the ground while. ficus-indica with standing upright (Addison brown 2003, Wu 2007). Division by use After vascular plants in the survey regions were analyzed by their use based on data of Lee (1976), 615 taxa (77.6%) among 793 taxa were found to be available as resource plants except for 178 taxa (22.4%) whose uses could not be known. These vascular plants are classified by their use as followings: 232 taxa (29.3%) of edible plants (E), 7 taxa (0.9%) of fiber plants (F), 197 taxa (24.8%) of medicinal plants (M), 78 taxa (9.8%) of ornamental plants (), 273 taxa (34.4%) of pasture plants (P), 3 taxa (0.4%) of industrial plants (R), 15 taxa (1.9%)of dyeing plants (S), and 14 taxa (1.8%) of timber plants (T) (Table 9, Appendix). Conclusions We investigated the flora of islands in the west of Jeollanamdo including Nagwoldo, Songido, and Anmado in Yeonggwang, Dochodo, Maehwado, Bigeumdo, Anjwado, Amtaedo, Aphaedo, Imjado, Jaeundo, Jaewondo, Jeungdo, and Jido in Shinan, and Dallido in Mokpo. As results, a total of 793 taxa including 123 families, 421 genera, 695 species, 2 subspecies, 88 varieties, and 8 forms was found. Although some islands in the west of Jeollanamdo have been investigated targeting large islands or uninhabited islands, it was necessary to perform further studies on the distribution of vascular plants in islands of Jeollanamdo. In this study, therefore, endemic, rare, specific, and naturalized plants were investigated to preserve diversity in species and to suggest fundamental data for them, and their sample evidences with exact precision were presented. Acknowledgments This study was performed by support of Studies on the Distribution of Vascular Plants in the Korea Peninsula, the research project of Korea Forest Service in References Hon AB Illustrated Flora of the Northern United States and Canada. (2nd ed). New York: Dover publications, Inc. 572pp. Im HT, Hong HH Flora of the Surrounding of Imjado in Korea. Report of the 2nd. National Natural Environment Survey. Ministry of Environment (in Korean). Jeong JH, Jang CM, and Kim KH, h YJ, Paik WK Flora of Sinan-gun (Sinan, Jeollanam-do, Korea). Korean Journal of Conservation. 5(2): (in Korean). Kim CS The Flora of Huksan-do Archipelago (I). Bulletin of Institute of Littoral Biota. 1: (in Korean). Kim JH, Lee NS. 1994a. Allozyme variation in Hepatica asiatica and H. insularis. Koran. J. Pl. Taxon. 24(2): (in Korean). Kim JH, Lee NS. 1994b. Electrophoretic studies of Hepatica insularis and H. asiatca. The Korean Association of biological sciences. Announcement of academic. 85pp (in Korean). Korea Forest Service (accessed 4 Feb, 2013). Korean Plant Names Index (accessed 21 Mar, 2013). Korea National Arboretum Rare Plants Data Book in Korea. Gyeonggi: Korea National Arboretum (in Korean). Korea Biodiversity Information System go.kr:9001/index.do (accessed 21 Mar, 2013). Lee TB Vascular Plants and their uses in Korea. Bull. Seoul Natl. Univ. Arbor. 1: (in Korean). Lee TB Illustrated Flora of Korea. Seoul: Hyangmunsa (in Korean). Lee TB Coloured Flora of Korea (I, II). Seoul: Hyangmunsa (in Korean). Lee YM, Park SH, Jung SY, h SH, and Yang JC Study on the Current Status of Naturalized Plants in South Korea. Korean J. Pl. Taxon. 41(1): (in Korean). Lee WC 1996a. Lineamenta Florae Koreae. Seoul: Academy publishing Co. Ltd (in Korean). Lee WC. 1996b. Standard Illustrations of Korean Plants. Seoul: Academy publishing Co. Ltd (in Korean). Lee WC, Yim YJ Plant Geography. Chuncheon: Kangwon National University Press (in Korean). Fernald ML Gray s Manual of Botany. Eighth (centennial) edition-illustrated. New York: American book company. Ministry of Environment The 3rd National Natural Environment Research Guidelines. Ministry of Environment (in Korean). Mokpo Municipal office Yearbook. J. ASIA-PACIFIC BIDIVERSITY

9 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 289 Nakai T Japanese Hepatica. J. Jap. Bot. 13: , h BU, Jo DG, Kim KS, and Jang CG Endemic Vascular Plants in the Korean Peninsula. Gyeonggi: Korea National Arboretum (in Korean). h JG, Kim JS Studies on the Flora and Vegetation of Kohado Island. Bulletin of Institute of Littoral Environment. 12: (in Korean). Park SH Colored Illustrations of Naturalized Plants of Korea. Seoul:Ilchokak (in Korean). Park SH Colored Illustrations of Naturalized Plants of Korea (appendix). Seoul: Ilchokak (in Korean). Park SH New Illustrations and Photographs of Naturalized Plants of Korea. Seoul: Ilchokak (in Korean). Park YK Flora of Islands in West and South Regions of Korea. Unpublished master dissertation. The Honam University (in Korean). Rafinesque, Constantine Samuel Medical Flora. 2: 247 (in English). Shinan Country office Year book. Wu ZY, Raven PH, Hong DY Flora of China. Science Press, Beijing and Missouri Botanical Garden Press. 13: (in English). Yeonggwang Country office Year book. Yim DU Vascular Plants of Chilsan Islet.. Kor. J. Env. Eco. 15(3): (in Korean). Received: 16. Apr Revised: 20. May 2013 Accepted: 23. May 2013 J. ASIA-PACIFIC BIDIVERSITY

10 290 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Appendix 1. List of vascular plants of the Western Sea of Jeollanam-do Lycopodiaceae 석송과 Lycopodium clavatum L. 석송 , HHS100095; M Selaginellaceae 부처손과 Selaginella involvens (Sw.) Spring 바위손 HHS100362; U Equisetaceae 속새과 Equisetum ramosissimu Desf. 개속새 WR ; P smundaceae 고비과 smunda japonica Thunb. 고비 ParkSH70430, Y100131, Y102120; E, M Gleicheniaceae 풀고사리과 Dicranopteris pedata (Houtt.) Nakaike 발풀고사리 HHS100114, HHS100332, ParkSH70484, Y100119, YJ100037; U Schizaeaceae 실고사리과 Lygodium japonicum (Thunb.) Sw. 실고사리 ESJeon90612, Y101219, Y101310, Y101512, Y101651, Y102057; M Dennstaedtiaceae 잔고사리과 Pteridium aquilinum var.latiusculum (Desv.) Und.exHeller. 고사리 ParkSH81803, WR , Y101624, Y101976; E, M Lindsaeaceae 비고사리과 Sphenomeris chinensis (L.) Maxon 바위고사리 , ParkSH70482, WR , WR ; U Davalliaceae 넉줄고사리과 Davallia mariesii Moore ex Bak. 넉줄고사리 WR ; Parkeriaceae 공작고사리과 Coniogramme japonica (Thunb.) Diels 가지고비고사리 HHS100500; U Aspleniaceae 꼬리고사리과 Asplenium incisum Thunb. 꼬리고사리 HHS100112, HHS100512, WR , WR , Y100029, Y100285, Y100404, Y101487, Y101642; U Dryopteridaceae 면마과 Cyrtomium falcatum (L.f.) C. Presl 도깨비쇠고비 HHS100093, HHS100311, HHS100501, J100002, WR , Y100084; U Cyrtomium fortunei var. clivicola (Makino) Tagawa 산쇠고비 JKS2049 Dryopteris bissetiana (Bak.) C. Chr. 산족제비고사리 HHS100097, ParkSH70443, WR ; U Dryopteris chinensis (Bak.) Koidz. 가는잎족제비고사리 WR , WR , Y100117, Y100395; U Dryopteris erythrosora (D.C.Eaton) Kuntze 홍지네고사리 HHS100099, HHS100159, HHS100520; U Dryopteris hikonensis (H.Ito) Nakaike 큰족제비고사리 HHS100521, WR , WR , Y100128, Y100400; U Dryopteris lacera (Thunb.) Kuntze 비늘고사리 Y101554; U Dryopteris sacrosancta Koidz. 애기족제비고사리 WR ; U Polystichum ovatopaleaceum var. coraiense (Christ) Kurata 참나도히초미 HHS100158; U Thelypteridaceae 처녀고사리과 Thelypteris acuminata (Houtt.) Morton 별고사리 WR ; U Thelypteris decursive-pinnata (v.hall) Ching 설설고사리 WR , WR , WR , Y100030, Y101555; U Thelypteris glanduligera (Kunze) Ching 사다리고사리 ParkSH70427, WR , WR , WR , Y100126, Y101855; U Woodsiaceae 우드풀과 Athyrium niponicum (Mett.) Hance 개고사리 Y101899; E Deparia japonica (Thunb.) M.Kato 진고사리 Y100028, Y100138, Y100297, Y101940; U Polypodiaceae 고란초과 Lemmaphyllum microphyllum C.Presl 콩짜개덩굴 J100023, J100037; U Lepisorus uchiyamae (Makino) H.Itô 방망이일엽초 WR , WR Pinaceae 소나무과 Pinus densiflora Siebold & Zucc. 소나무 HHS100073; E, M,, T Pinus rigida Mill. 리기다소나무 HHS100089, ParkSH70429; T Pinus thunbergii Parl. 곰솔 HHS100090, HHS100515, ParkSH70476, Y100269, Y100604, Y101182, Y101902; T, M, E J. ASIA-PACIFIC BIDIVERSITY

11 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 291 Taxodiaceae 낙우송과 Cryptomeria japonica (L.f.) D.Don 삼나무 Y100163; T Sciadopitys verticillata (Thunb.) Siebold & Zucc. 금송 ESJeon90665; Cupressaceae 측백나무과 Chamaecyparis obtusa (Siebold & Zucc.) Endl. 편백 HHS100052; T, Juniperus chinensis var. procumbens (Siebold) Endl. 섬향나무 Y101300; Juniperus rigida Siebold & Zucc. 노간주나무 HHS100082, HHS100329, HHS100346, HHS100506, WR , WR , Y100259, Y100336, Y100616; M, S Thuja orientalis L. 측백나무 Y101724;, M Juglandaceae 가래나무과 Platycarya strobilacea Siebold & Zucc. 굴피나무 WR , Y100085, Y100249, Y100340, Y100462, Y101591, Y102039; S Salicaceae 버드나무과 Salix gracilistyla Miq. 갯버들 YJ100061; P Salix rorida Laksch. 분버들 J100027; S Salix subfragilis Andersson 선버들 YJ100030; S Betulaceae 자작나무과 Alnus firma Siebold & Zucc. 사방오리 ESJeon90617, HHS100156, HHS100310, HHS100535, J100007, ParkSH70440, WR , Y100150, YJ100018; S Alnus japonica (Thunb.) Steud. 오리나무 ParkSH94432; P Carpinus turczaninovii Hance 소사나무 WR , WR , WR , WR , Y100088, Y100410, Y100456, Y101638, Y101830; S Fagaceae 참나무과 Castanea crenata Siebold & Zucc. 밤나무 Y100429, Y101819; E, M, T, S Quercus acuta Thunb. 붉가시나무 HHS100517; T Quercus aliena Blume 갈참나무 WR , Y100351; E, T, P Quercus dentata Thunb. 떡갈나무 WR , Y101993; E, M, T, S Quercus serrata Thunb. 졸참나무 HHS100356, ParkSH81802, WR , WR , Y100083, Y100212, Y100348; E, T, P, M Quercus variabilis Blume 굴참나무 Y100392, Y100611; E, T, M Ulmaceae 느릅나무과 Celtis sinensis Pers. 팽나무 Y100080, Y100293, Y101486, Y101898, Y101924; E, M, P Moraceae 뽕나무과 Broussonetia kazinoki Siebold 닥나무 Y100201; E, F, M Broussonetia papyrifera (L.) L'H'er. ex Vent. 꾸지나무 Y100153, Y101608; F Cudrania tricuspidata (Carr.) Bureau ex Lavallée 꾸지뽕나무 WR , Y100184, Y100272, Y100486, Y100527, Y101665, Y102131; E, P Ficus oxyphylla Miq. ex Zoll. 모람 HHS100303, HHS100510, J100022, WR ; E Cannabaceae 삼과 Humulus japonicus Siebold & Zucc. 환삼덩굴 Y100576, Y100621, Y101230, Y101508, Y101692, Y102064; E, P, M Urticaceae 쐐기풀과 Boehmeria longispica Steud. 왜모시풀 Y101237, Y101516, Y101684; F Boehmeria nivea (L.)Gaudich. 모시풀 Y100627, Y101179; F, E, M Boehmeria nivea var. nipononivea (Koidz.) W.T.Wang 섬모시풀 Y101525, Y101672, Y102024; F Boehmeria pannosa Nakai & Satake 왕모시풀 Y102022; F Nanocnide japonica Blume 나도물통이 J100015; U Santalaceae 단향과 Thesium chinense Turcz. 제비꿀 ParkSH70480, WR , WR , WR , WR , WR , WR , Y100338, Y101988; M Polygonaceae 마디풀과 Fallopia dentatoalata (F.Schmidt) Holub 큰닭의덩굴 ; U Fallopia dumetorum (L.) Holub 닭의덩굴 Y101308, Y101511, Y101566, Y101846; U Persicaria conspicua (Nakai) Nakai ex Mori 꽃여뀌 WR , Y101323, Y101942; M Persicaria filiformis (Thunb.) Nakai ex Mori 이삭여뀌 Y101908; M Persicaria hydropiper (L.) Spach 여뀌 WR ; M, P Persicaria japonica (Meisn.) H.Gross ex Nakai 흰꽃여뀌 , WR , Y101403, Y101569, Y101726; U J. ASIA-PACIFIC BIDIVERSITY

12 292 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Persicaria lapathifolia (L.) Gray 흰여뀌 WR , WR , WR , WR , Y100235, Y100467, Y101455; U Persicaria longiseta (Bruijn) Kitag. 개여뀌 WR , WR , Y101133, Y101314, Y101434, Y101475, Y101756; M Persicaria nodosa piz 큰개여뀌 Y101483, Y101700, Y101736; P Persicaria perfoliata (L.) H.Gross 며느리배꼽 Y101404, Y101452; E Persicaria posumbu var. laxiflora (Meisn.) H.Hara 장대여뀌 Y101402; U Persicaria sagittata (L.) H.Gross ex Nakai 미꾸리낚시 WR , WR ; P Persicaria senticosa (Meisn.) H.Gross ex Nakai 며느리밑씻개 Y100575, Y100649, Y101177, Y101778, Y102084; E, P Persicaria thunbergii (Siebold & Zucc.) H.Gross ex Nakai 고마리 WR ; P Persicaria vulgaris Webb & Moq. 봄여뀌 Y101221; U Polygonum aviculare L. 마디풀 WR , Y100051, Y101561, Y102069; E, M Polygonum bellardii Alloni 큰옥매듭풀 WR ; U Rumex acetosa L. 수영 WR , Y100043, Y100116, Y100540, Y102113; M Rumex acetosella L. 애기수영 WR , WR , Y100337, Y100384; E Rumex crispus L. 소리쟁이 JKS2094, WR , Y100020, Y100271, Y100280, Y100440; E, M, P Rumex obtusifolius L. 돌소리쟁이 Y Phytolaccaceae 자리공과 Phytolacca americana L. 미국자리공 Y100111, Y100277, Y100463, Y100513, Y100597, Y100640, Y101470, Y101782; U Molluginaceae 석류풀과 Mollugo pentaphylla L. 석류풀 WR , Y101336, Y101366, Y101462, Y102081; U Aizoaceae 번행초과 Tetragonia tetragonoides (Pall.) Kuntze 번행초 WR , Y101798, Y102162; E, M Portulacaceae 쇠비름과 Portulaca oleracea L. 쇠비름 Y101276, Y101471, Y101792, Y102067; E, M, P Caryophyllaceae 석죽과 Arenaria serpyllifolia L. 벼룩이자리 WR ; E Cerastium glomeratum Thuill. 유럽점나도나물 HHS100103, HHS100371, HHS100523, Y102109, YJ Dianthus chinensis L. 패랭이꽃 Y101297; M Dianthus japonicus Thunb. 갯패랭이꽃 WR , WR ; Pseudostellaria heterophylla (Miq.) Pax ex Pax & Hoffm. 개별꽃 WR ; E, M Pseudostellaria palibiniana (Takeda) hwi 큰개별꽃 Y100053; E Sagina japonica (Sw.) hwi 개미자리 WR , Y100042, Y102128; M Silene aprica var. oldhamiana (Miq.) C.Y.Wu 갯장구채 JKS2048, WR , WR , WR , Y100048, Y101789; P Spergula arvensis L. 들개미자리 Y100382; U Spergularia marina (L.) Griseb. 갯개미자리 HHS100373, ParkSH70473, WR , Y100172, Y100315, Y100499; U Stellaria aquatica (L.) Scop. 쇠별꽃 WR , WR , Y100060; E, M Stellaria media (L.) Vill. 별꽃 HHS100107, HHS100306, HHS100343, HHS100370, WR , Y100112, YJ100001; E Chenopodiaceae 명아주과 Atriplex gmelinii C.A.Mey. 가는갯는쟁이 WR , Y101796, Y101844; P Chenopodium album L. 흰명아주 Y101362, Y101477, Y101734, Y101758; E, P Chenopodium album var. centrorubrum Makino 명아주 Y100653, Y101169, Y101215, Y101704; E, P Chenopodium ficifolium Smith 좀명아주 WR , Y100218, Y100512; E, P Chenopodium koraiense Nakai 참명아주 Y101143; E, P Salsola komarovii Iljin 수송나물 WR , Y101560; E Suaeda glauca (Bunge) Bunge 나문재 Y101406, Y101802; E Amaranthaceae 비름과 Achyranthes fauriei H.Lév. & Vaniot 털쇠무릎 Y101178, Y101877, Y Achyranthes japonica (Miq.) Nakai 쇠무릎 Y101273, Y101313, Y101663; E, M, P J. ASIA-PACIFIC BIDIVERSITY

13 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 293 Amaranthus lividus L. 개비름 Y101278; E, M, P Amaranthus patulus Bertol. 가는털비름 Y101467, Y101891, Y Amaranthus retroflexus L. 털비름 WR ; E, P Amaranthus viridis L. 청비름 Y101364; E Cactaceae 선인장과 puntia humifusa (Raf.) Raf. 선인장 J100045; Schisandraceae 오미자과 Kadsura japonica (L.) Dunal 남오미자 Y101479; P Lauraceae 녹나무과 Lindera erythrocarpa Makino 비목나무 Y100536; Lindera glauca (Siebold & Zucc.) Blume 감태나무 Y100322, Y100390, Y Lindera obtusiloba Blume 생강나무 HHS100068, HHS100511; E, M, Machilus thunbergii Siebold & Zucc. 후박나무 JKS2073, Y100067, Y100309, Y102127; M,, T Neolitsea sericea (Blume) Koidz. 참식나무 HHS100518; Ranunculaceae 미나리아재비과 Anemone raddeana Regel 꿩의바람꽃 HHS100453; Caltha palustris L. 동의나물 WR ; P Clematis apiifolia DC. 사위질빵 WR , WR , Y101168, Y101329, Y101674, Y102094; U Clematis terniflora DC. 참으아리 WR ; M Clematis terniflora var. mandshurica (Rupr.) hwi 으아리 WR , Y100114, Y101303, Y101497, Y101803, Y102040; M Hepatica asiatica Nakai 노루귀 HHS10032, Y100584; Hepatica insularis Nakai 새끼노루귀 HHS100055, HHS100166, J100003, WR , Y100019; Pulsatilla koreana (Yabe ex Nakai) Nakai ex Mori 할미꽃 HHS100094, HHS100365; M Ranunculus cantoniensis DC. 털개구리미나리 WR ; U Ranunculus chinensis Bunge 젓가락나물 Y100054; U Ranunculus sceleratus L. 개구리자리 ParkSH70477, Y100044, Y100312; U Ranunculus tachiroei Franch. & Sav. 개구리미나리 Y100049, Y100168, Y100234, Y100560; M Semiaquilegia adoxoides (DC.) Makino 개구리발톱 HHS100061, HHS100308, J100014, WR , YJ100023, YJ100040, YJ100066; U Thalictrum kemense var. hypoleucum (Siebold & Zucc.) Kitag. 좀꿩의다리 Y101460, Y101857; E Lardizabalaceae 으름덩굴과 Akebia quinata (Thunb.) Decne. 으름덩굴 Y101650; M, P, Stauntonia hexaphylla (Thunb.) Decne. 멀꿀 Y102056; E, Menispermaceae 새모래덩굴과 Cocculus trilobus (Thunb.) DC. 댕댕이덩굴 NAM , WR , WR , WR , WR , WR , Y100257, Y100331, Y100613, Y101458, Y101653, Y101739; E, M, P Sinomenium acutum (Thunb.) Rehder & E.H.Wilson 방기 Y100599, Y101987; M, S Saururaceae 삼백초과 Houttuynia cordata Thunb. 약모밀 ParkSH70456; M Chloranthaceae 홀아비꽃대과 Chloranthus fortunei (A.Gray) Solms 옥녀꽃대 ParkSH70428, WR , WR , WR , WR ; U Chloranthus japonicus Siebold 홀아비꽃대 Y100031, Y100399, Y100538; U Aristolochiaceae 쥐방울덩굴과 Asarum glabrata (C.S.Yook & J.G.Kim & J.Nam) B.U.h 각시족도리풀 HHS100060, HHS Actinidiaceae 다래나무과 Actinidia arguta (Siebold & Zucc. )Planch. ex Miq. 다래 Y100079; U Theaceae 차나무과 Camellia japonica L. 동백나무 ESJeon90666, HHS100301, J100020, Y100082;, M Eurya japonica Thunb. 사스레피나무 , ESJeon90662, HHS100069, HHS100085, HHS100316, HHS100345, HHS100509, J100006, WR , WR , Y100076, Y100343, Y101415; P J. ASIA-PACIFIC BIDIVERSITY

14 294 Hee-Suk Hwang, Jong-Cheol Yang, Seung-Hwan h, You-Mi Lee and Kae-Sun Chang Guttiferae 물레나물과 Hypericum ascyron L. 물레나물 Y101841; E, Hypericum erectum Thunb. 고추나물 ESJeon90962, WR , WR , WR , Y100652, Y101262, Y101357, Y101451, Y101962; M, P Hypericum japonicum Thunb. 애기고추나물 ESJeon90656, WR , WR , WR , Y101350; U Hypericum laxum (Blume) Koidz. 좀고추나물 WR , Y101925; U Droseraceae 끈끈이주걱과 Drosera peltata var. nipponica (Masam.) hwi 끈끈이귀개 WR ; U Fumariaceae 현호색과 Corydalis heterocarpa Siebold & Zucc. 염주괴불주머니 Y102147; U Corydalis incisa (Thunb.) Pers. 자주괴불주머니 HHS100312, HHS100394, HHS100504; M Corydalis remota Fisch. ex Maxim. 현호색 HHS100066, HHS100313, HHS100544, J100013, YJ100063; M Corydalis speciosa Maxim. 산괴불주머니 HHS100397, Y100015; U Cruciferae 십자화과 Arabis glabra Bernh. 장대나물 JKS2101, WR , Y100045, Y100288, Y100595; E Arabis hirsuta (L.) Scop. 털장대 Y100036; E Brassica juncea (L.) Czern. 갓 HHS100339, HHS100360, HHS100390, Y101531, YJ100004; E Capsella bursa-pastoris (L.) L.W.Medicus 냉이 HHS100053, HHS100108, HHS100320, HHS100340, HHS100386, HHS100529, Y100057, YJ100011, YJ100057; E, M Cardamine fallax L. 좁쌀냉이 HHS100080, HHS100335, HHS100358, HHS100524, J100011, YJ100022; E Cardamine flexuosa With. 황새냉이 HHS100106, HHS100337, HHS100398, Y100023, Y100215; E Cardamine impatiens L. 싸리냉이 HHS100157; E Coronopus didymus (L.) Smith 냄새냉이 ParkSH70465 Draba nemorosa L. 꽃다지 J100024; E, M Lepidium apetalum Willd. 다닥냉이 Y101863, Y101915, Y102108; E, M Lepidium virginicum L. 콩다닥냉이 WR , WR , WR , Y100143, Y100227, Y100362, Y100432, Y Rorippa indica (L.) Hiern 개갓냉이 WR , WR , Y101478; E Rorippa palustris (Leyss.) Besser 속속이풀 WR , Y100052, Y100313; E Thlaspi arvense L. 말냉이 JKS2070; E Crassulaceae 돌나물과 Sedum bulbiferum Makino 말똥비름 Y100007, Y100530; U Sedum kamtschaticum Fisch. & Mey. 기린초 WR ; U Sedum oryzifolium Makino 땅채송화 Y100402, Y101741, Y102148; U Saxifragaceae 범의귀과 Parnassia palustris L 물매화 , WR ; Ribes fasciculatum var. chinense Maxim. 까마귀밥나무 Y Pittosporaceae 돈나무과 Pittosporum tobira (Thunb.) W.T.Aiton 돈나무 HHS100115, JKS2072, WR , Y100009, Y100368; Rosaceae 장미과 Agrimonia coreana Nakai 산짚신나물 WR ; E, M Agrimonia pilosa Ledeb. 짚신나물 WR , Y101207, Y101337, Y101765, Y102047; E, M, P Agrimonia pilosa var. nipponica (Koidz.) Kitam. 좀짚신나물 WR Duchesnea indica (Andr.) Focke 뱀딸기 HHS100526, WR , WR , Y100142, Y100296, YJ100027; E, M, P Malus baccata Borkh. 야광나무 Y102055; E, M Malus sieboldii (Regel) Rehder 아그배나무 WR , Y100248, Y100471; E, Potentilla chinensis Ser. 딱지꽃 , WR , WR , Y101807; E, M, P Potentilla discolor Bunge 솜양지꽃 WR , Y100287; E, M Potentilla fragarioides var. major Maxim. 양지꽃 HHS100065, HHS100347, HHS100513, WR , WR , Y100018, YJ100012; E, M J. ASIA-PACIFIC BIDIVERSITY

15 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea 295 Potentilla freyniana Bornm. 세잎양지꽃 WR , WR ; E, P Pourthiaea villosa (Thunb.) Decne. 윤노리나무 JKS2102, ParkSH70425, WR , Y100195; U Prunus ishidoyana Nakai 산이스라지 JKS2097; E, M, P Prunus japonica var. nakaii (H.Lév.) Rehder 이스라지 WR , WR , WR , WR , Y100003; E, M, P Prunus persica (L.) Batsch 복사나무 Y100081, Y101669, Y102163; E, P Prunus serrulata var. pubescens (Makino) Nakai 잔털벚나무 Y100323, Y100482, Y100516;, E Prunus serrulata var. spontanea (Maxim.) E.H.Wilson 벚나무 JKS2046, ParkSH70442;, E Prunus verecunda (Koidz.) Koehne 개벚나무 HHS100355, WR ;, E Pyrus calleryana var. fauriei (C.K.Schneid.) Rehder 콩배나무 ESJeon90660, HHS100364, WR , WR ; E Pyrus pyrifolia (Burm.f.) Nakai 돌배나무 ParkSH70457; E Raphiolepis indica var. umbellata (Thunb.) hashi 다정큼나무 Y100066, Y101738; Raphiolepis indica var. integerrima (Hook. & Arn.) Rehder ex hwi 둥근잎다정큼 HHS100508; Rhodotypos scandens (Thunb.) Makino 병아리꽃나무 Y100074; Rosa maximowicziana Regel 용가시나무 Y101705; E, M Rosa multiflora Thunb. 찔레나무 JKS2054, WR , WR , WR , Y100206, Y100308, Y100502, Y Rosa rugosa Thunb. 해당화 WR , WR ; M Rosa wichuraiana Crép. ex Franch. & Sav. 돌가시나무 ParkSH70486, WR , WR , Y100010, Y100120, Y100205, Y100412, Y100474, Y100578, Y Rubus corchorifolius L.f. 수리딸기 HHS100071, HHS100084, HHS100163, Y100061, YJ100034; E Rubus crataegifolius Bunge 산딸기 JKS2045; E, M, P Rubus hirsutus Thunb. 장딸기 HHS100395, JKS2044, ParkSH70437, Y100069, Y102119; E Rubus parvifolius L. 멍석딸기 JKS2103, WR , WR , WR , WR , Y100062, Y100198, Y100208, Y100291, Y100403, Y100567, Y102111; E Sanguisorba officinalis L. 오이풀 WR , WR , WR , WR , Y101160, Y101426, Y101717; M, P Sorbus alnifolia (Siebold & Zucc.) K.Koch 팥배나무 Y100256, Y100408, Y100593, Y101909; E, P Spiraea chinensis Maxim. 당조팝나무 WR ; Spiraea pubescens Turcz. 아구장나무 WR ; Stephanandra incisa (Thunb.) Zabel 국수나무 WR , WR , WR , Y100132, Y100585; S Leguminosae 콩과 Aeschynomene indica L. 자귀풀 WR , WR , Y101571; U Albizia julibrissin Durazz. 자귀나무 WR , Y100441, Y100537, Y101163, Y101733, Y101772; M, P, Albizia kalkora (Roxb.) Prain 왕자귀나무 Y100344, Y100506, Y101345; M,, P Amorpha fruticosa L. 족제비싸리 WR ; P Amphicarpaea bracteata subsp. edgeworthii (Benth.) H.hashi 새콩 Y101862; E, P Caesalpinia decapetala (Roth) Alston 실거리나무 J100009, JKS2056, ParkSH70445, WR , WR , Y100014; S Chamaecrista nomame (Siebold) H.hashi 차풀 WR , WR , WR , Y100658, Y101203, Y101338, Y101510, Y101759, Y101922; E, M, P Crotalaria sessiliflora L. 활나물 WR , Y101341; U Desmodium podocarpum DC. 개도둑놈의갈고리 Y101661, Y101928; U Desmodium podocarpum var. oxyphyllum (DC.) H.hashi 도둑놈의갈고리 Y Dunbaria villosa (Thunb.) Makino 여우팥 , , ESJeon90618, WR , WR , WR , Y101417, Y101493, Y101875, Y Glycine soja Siebold & Zucc. 돌콩 WR , Y101883, Y101939; E, P Indigofera kirilowii Maxim. ex Palib. 땅비싸리 ParkSH70431, WR , WR , WR , Y100113, Y100457; J. ASIA-PACIFIC BIDIVERSITY

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

7(3)-03.fm

7(3)-03.fm w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure

More information

외떡잎식물 Monocotyledoneae

외떡잎식물 Monocotyledoneae 외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고

More information

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park 이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

차례

차례 차례 표차례 優占度階級 群度階級 그림차례 - 1 - - 2 - - 3 - 표 2. 優占度階級 (Braun-Blanquet, 1964) 5 : 표본구면적의 3/4이상을덮고, 개체수는임의 4 : 1/2-3/4을덮고, 3 : 1/4-1/2을덮고, 2 : 개체수는많으나被度가낮다혹은산재하나被度는높다 ( 단1/10이다 ). + : 被度는낮고散在 r : 고립하여출현하고被度는극히낮다.

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium

More information

05(김창석)p fm

05(김창석)p fm Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

01-Megascolex(dh)

01-Megascolex(dh) Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute

More information

BMYIHXZUOVDO.xls

BMYIHXZUOVDO.xls 1 좌사일대의식물 좌사일대의식물 - 154.5고지 - 도재화 국립환경과학원 김용현 경원대학교 요약 1 조사지역내에자생하는관속식물은 34목 63 과, 142 속, 139 종, 24 변종, 1 품종, 1잡 종의총 168 분류군으로나타났다. 2 식물구계학적특정식물종 IV등급종은비진도콩 1 분류군, III등급종까마귀쪽나무등 6 분류군, II등급종층꽃나무등 1 분류군,

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 목명과명출현종추자 (336021) 도엽특이사항영문한글영문한글학명국명 E1 E2 E5 E6 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella involvens 바위손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium virginianum 늦고사리삼 식물구계학적등급 (Ⅰ)

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

401.fm

401.fm Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

fm

fm Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)

More information

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo 이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp

[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information

fm

fm Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.

More information

조경식재학 - 식재재료(2) -

조경식재학 - 식재재료(2) - 조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora

More information

04(오영주)p fm

04(오영주)p fm Weed Turf. Sci. 3(4):276~283 http://dx.doi.org/10.5660/wts.2014.3.4.276 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

2011´ëÇпø2µµ 24p_0628

2011´ëÇпø2µµ 24p_0628 2011 Guide for U.S. Graduate School Admissions Table of Contents 02 03 04 05 06 08 09 10 11 13 15 21 LEADERS UHAK INTERNATIONAL STUDENTS SERVICE www.leadersuhak.com Leaders Uhak International Students

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

101.fm

101.fm Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest

More information

[00]_목차.hwp

[00]_목차.hwp Korean J. Plant Res. 27(5):518-533(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.518 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 장창석 1, 양선규 1, 장현도 1, 이로영 2, 박민수 3, 김기홍 1, 오병운

More information

03¹ü¼±±Ô

03¹ü¼±±Ô Relevancy between Aliases of Eight Provinces and Topographical Features during the Chosun Dynasty Seon-Gyu Beom* Abstract : In Korea, aside from their official administrative names, aliases of each province

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

<30322E20BABBB9AEC0FCC3BC2E687770>

<30322E20BABBB9AEC0FCC3BC2E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:

More information

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770> 수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National

More information

03 .이인용( ).fm

03 .이인용( ).fm Weed Turf. Sci. 5(3):126~135 http://dx.doi.org/10.5660/wts.2016.5.3.126 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both

More information

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바

도엽별출현종 _ 통계 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바 도엽별출현종 _ 통계 - 2013 년전국자연환경조사 - 식물 - 박재홍 - 남원 목명과명출현종남원 (357102) 도엽특이사항영문한글영문한글학명국명 E2 SELAGINELLALES 부처손목 SELAGINELLACEAE 부처손과 Selaginella involvens 바위손 식물구계학적등급 (Ⅲ) OPHIOGLOSSALES 고사리삼목 OPHIOGLOSSACEAE

More information

아니라 일본 지리지, 수로지 5, 지도 6 등을 함께 검토해야 하지만 여기서는 근대기 일본이 편찬한 조선 지리지와 부속지도만으로 연구대상을 한정하 기로 한다. Ⅱ. 1876~1905년 울릉도 독도 서술의 추이 1. 울릉도 독도 호칭의 혼란과 지도상의 불일치 일본이 조선

아니라 일본 지리지, 수로지 5, 지도 6 등을 함께 검토해야 하지만 여기서는 근대기 일본이 편찬한 조선 지리지와 부속지도만으로 연구대상을 한정하 기로 한다. Ⅱ. 1876~1905년 울릉도 독도 서술의 추이 1. 울릉도 독도 호칭의 혼란과 지도상의 불일치 일본이 조선 근대기 조선 지리지에 보이는 일본의 울릉도 독도 인식 호칭의 혼란을 중심으로 Ⅰ. 머리말 이 글은 근대기 일본인 편찬 조선 지리지에 나타난 울릉도 독도 관련 인식을 호칭의 변화에 초점을 맞춰 고찰한 것이다. 일본은 메이지유신 이후 부국강병을 기도하는 과정에서 수집된 정보에 의존하여 지리지를 펴냈고, 이를 제국주의 확장에 원용하였다. 특히 일본이 제국주의 확장을

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

서론

서론 - i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 김영동 - 태백 목명과명출현종태백 (378164) 도엽특이사항영문한글영문한글학명국명 E8 E9 Lycopodiales 석송문 Lycopodiaceae 석송과 Huperzia selago 좀다람쥐꼬리 식물구계학적등급 (Ⅳ) Lycopodiales 석송문 Lycopodiaceae 석송과 Lycopodium

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

02À±¼ø¿Á

02À±¼ø¿Á Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i

목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>

<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770> Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:

More information

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770> 사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to

Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum Programs The 201 EABCN symposium will be held on

More information

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽 울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를

More information

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )

. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( ) . 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

유기억.fm

유기억.fm 54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의 Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,

More information

완료_eri hwp

완료_eri hwp Ecology and Resilient Infrastructure (2015) 2(1): 080-092 http://dx.doi.org/10.17820/eri.2015.2.1.080 http://www.kseie.or.kr/ Online ISSN: 2288-8527 ORIGINAL ARTICLE 외래식물에의한대학교정생태계의교란 Disturbance of Campus

More information

02(이인용)p fm

02(이인용)p fm Weed Turf. Sci. 4(2):85~94 http://dx.doi.org/10.5660/wts.2015.4.2.85 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both

More information

2_11_24 김준수.hwp

2_11_24 김준수.hwp 농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

IKC43_06.hwp

IKC43_06.hwp 2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

02ÇãÀÎÇý ~26š

02ÇãÀÎÇý~26š The Spatial and temporal distributions of NET(Net Effective Temperature) with a Function of Temperature, Humidity and Wind Speed in Korea* Inhye Heo**, Youngeun Choi***, and Won-Tae Kwon**** Abstract :

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Korean J. Plant Res. 27(2):133-154(2014) http://dx.doi.org/10.7732/kjpr.2014.27.2.133 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 여서도의관속식물상 김선유 1, 윤종학 2, 김진석 1, 김중현 1 * 1 국립생물자원관식물자원과,

More information

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다

함동호외. 한반도난온대지역전남대학교내한약자원및상록활엽식물 최근우리나라는한약자원의해외의존도를줄이기위해대량증식을목적으로하는몇몇기초조사형태의연구가활발히진행중에있다 3). 또한전세계적으로각국가마다생물자원을환경생태보호의목적뿐만아니라산업적인목적으로적극적으로조사및관리하는추세에있다 한반도난온대지역전남대학교내한약자원및상록활엽식물 함동호 1, 김원호 1, 이지윤 1, 이준성 1, 한은경 2, 조원범 2, 이정현 2* 1. 전남대학교과학영재교육원 2. 전남대학교사범대학생물교육과 The medicinal and evergreen broad leaved plants in Chonnam national university on warm-temperate

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

<B3EDB9AEC1FD5F3235C1FD2E687770>

<B3EDB9AEC1FD5F3235C1FD2E687770> 오용록의 작품세계 윤 혜 진 1) * 이 논문은 생전( 生 前 )에 학자로 주로 활동하였던 오용록(1955~2012)이 작곡한 작품들을 살펴보고 그의 작품세계를 파악하고자 하는 것이다. 한국음악이론이 원 래 작곡과 이론을 포함하였던 초기 작곡이론전공의 형태를 염두에 둔다면 그의 연 구에서 기존연구의 방법론을 넘어서 창의적인 분석 개념과 체계를 적용하려는

More information

ePapyrus PDF Document

ePapyrus PDF Document 육아지원연구 2008. 제 3권 1 호, 147-170 어린이집에서의 낮잠에 대한 교사와 부모의 인식 및 실제 이 슬 기(동작구 보육정보센터)* 1) 요 약 본 연구의 목적은 어린이집에서의 일과 중 낮잠 시간에 대한 교사와 부모의 인식 및 실제를 알아봄 으로써, 교사와 부모의 협력을 통해 바람직한 낮잠 시간을 모색해 보는 데 있었다. 연구 대상은 서울, 경기지역

More information

304.fm

304.fm Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

<30302E20B8F1C2F72E666D>

<30302E20B8F1C2F72E666D> Korean J. Pl. Taxon. 44(3): 222-232 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.3.222 ISSN 1225-8318 Korean Journal of Plant Taxonomy Flora of Sumeunmulbaengdui wetland in Jeju-do, Korea Sung Chul Ko*,

More information

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit

84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit 농업생명과학연구 47(5) pp.83-94 Journal of Agriculture & Life Science 47(5) pp.83-94 울릉도섬현삼의새로운자생지보고및현지내 외보전전략 김수승 1 강기호 2 강신구 1 신현탁 3 조경호 2 김윤영 2 이명섭 2 양병훈 1* 1 산림청, 2 기청산식물원, 3 국립수목원 접수일 (2013 년 7 월 8 일 ), 수정일

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

44-3대지.08류주현c

44-3대지.08류주현c A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa

3(1): 21~33, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Pa 3(1): 21~33, 2017. 6. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Vascular Plants around Tongdosa(Temple) in Gajisan Provincial Park Oh, Hyun-Kyung* Choi, Yoon-Ho** You, Ju-Han*** ABSTRACT

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Study on the Pe

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI:   * A Study on the Pe Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.405-425 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.405 * A Study on the Perceptions and Factors of Immigrant Background Youth

More information